Mycobacterium marinum MMAR_0267-regulated copper utilization facilitates bacterial escape from phagolysosome

Mycobacterium marinum MMAR_0267-regulated copper utilization facilitates bacterial escape from phagolysosome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mycobacterium marinum MMAR_0267-regulated copper utilization facilitates bacterial escape from phagolysosome Junqi xu, Shaying Ma, Yu Huang, Qiao Zhang, lingxi huang, xianghong xu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4080994/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Sep, 2024 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Abstract The host limits Mycobacterium tuberculosis ( Mtb ) by restricting copper access. This research investigates how Mtb escapes copper stress. The membrane protein encoded by Mtb Rv0102 , when its homolog in M. smegmatis ( MSMEG_4702 ) was knocked out, resulted in a fourfold decrease in intracellular copper levels and enhanced tolerance to elevated extracellular copper concentrations. Similarly, knockout mutants of its homolog in M. marinum ( MMAR_0267 ) showed increased virulence in zebrafish and higher bacterial load within macrophages. In THP-1 cells infected with MMAR_0267 deletion mutants, the intracellular survival of the mutants increased, accompanied by reduced THP-1 apoptosis. Cu deficiency down-regulated the transcriptional level of the M. marinum virulence factor CFP-10, dampened macrophage STING cytosolic signaling, resulting in decreased IFN-β production and cell apoptosis. In conclusion, these findings highlight the significant impact of copper on the survival and reproduction of mycobacteria, underscoring the importance of studying mycobacterial adaptation mechanisms in copper-rich environments. Biological sciences/Microbiology/Pathogens Biological sciences/Chemical biology/Transporters Mycobacterium tuberculosis Rv0102 copper homeostasis apoptosis cuproptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction In the natural environment, trace metal elements such as manganese (Mn), copper (Cu), iron (Fe), zinc (Zn), and nickel (Ni) inhibit Mycobacterium tuberculosis ( Mtb ) growth by damaging cell membranes, disrupting metabolism, and inducing oxidative stress 1 . These metals play key roles in protein folding and enzyme activity, but their excess accumulation can be toxic 2 . The host employs mechanisms to sequester essential metals like Mn, Fe, and Zn within phagosomes to restrict intracellular pathogen growth. But the excess Cu is utilized by host cells to combat intracellular pathogens 3 . Therefore, maintaining metal, including Cu, homeostasis is critical for intracellular pathogen survival. Tuberculosis, caused by Mtb infection, remains a significant global public health issue 4 . Copper, among other metal elements, is essential for Mtb replication and enzyme activity 5 . Copper ions act as catalysts in single-electron transfer reactions within the cytochrome respiratory enzyme aa3-bc1 complex 6 . The redox potential of Cu(II)/Cu(I) exceeds that of Fe(III)/Fe(II) 7 , leading to the generation of ROS upon copper infiltration into bacterial cells like Mycobacterium avium , causing DNA damage and compromising integrity 8 . Cu toxicity arises from its competitive binding with metalloproteins, potentially inactivating critical enzymes and hindering Mtb growth 9 . To mitigate Cu excess toxicity, Mtb employs cytoplasmic proteins including metallothioneins, copper storage proteins 10 , and copper efflux proteins to chelate or buffer copper ions 11 . Mtb has a sophisticated copper ion uptake system to maintain intracellular copper homeostasis. Cross-membrane Cu transport relies on specific membrane proteins that facilitate copper ion transfer. In Mtb , one such protein is CopA, a member of the P1B-1 type ATPase subfamily. CopA is vital for transferring copper from ATPase to cytochrome oxidase, determining copper importation or expulsion from the cell 12 . In the presence of excess Cu, the CopZ/A operon induces a Cu efflux system. CopZ, acting as a Cu chaperone, transfers Cu to the CPX-type efflux ATPase CopA 13 . Additionally, the CtpA gene is induced during Mtb infection. Mtb CtpA, CtpB, and CtpV are transmembrane proteins involved in heavy metal cation transport, with CtpA potentially serving as a Cu transporter across the mycobacterial membrane 14 . CsoR, a copper-inducible transcriptional regulator, controls Cu efflux factors like CtpV in Mtb , regulating intracellular copper ion levels 15,16 . This Cu homeostasis system is conserved in various bacteria beyond Mtb , including Streptococcus , Salmonella , and Escherichia coli 17,18 . The mechanism of Cu(I) transport across bacterial membranes remains unclear 19 . Recent studies highlight the essential role of the p-type ATPase CtpB in copper acquisition and respiration, with its absence linked to increased virulence 6 . Nonetheless, a stable and regulated Cu uptake pathway is crucial for Mycobacteria to maintain copper ion homeostasis. This study shows that the ABC transporter Rv0102, located on the cell membrane, along with its homologous genes MMAR_0267 in M. marinum and MSMEG_4702 in M. smegmatis , play a crucial role in regulating intracellular copper levels and are integral components of the Cu homeostasis system in Mtb . When the homologous gene MSMEG_4702 in M. smegmatis is deleted, it results in a significant impairment of the bacterium's ability to effectively utilize copper ions. The deletion mutants exhibit increased tolerance to higher concentrations of Cu ions. Likewise, the elimination of the homologous gene MMAR_0267 in M. marinum also significantly affects the bacterium's capacity to utilize Cu. The underutilization of copper resources increases the survival and virulence of the deletion strain in zebrafish and decreases the THP-1 macrophages apoptosis, possibly due to macrophages failure to use Cu ions to kill the engulfed Mm . Our study presents the initial evidence indicating that Mtb Rv0102 is a membrane protein involved in the utilization of copper ions. Results Rv0102 is involved in copper ions transfer To generate an adequate number of single mutants, we created a mutant library of M. smegmatis mc 2 155 with 20,000 transposon insertions using the Tn7 transposon system. The library was screened on 7H10 medium with high copper ion concentration (20 µmol/L CuSO4), leading to the identification of a copper-tolerant mutant X674. This mutant had a Tn7 transposon insertion between the 375th and 376th positions of M. smegmatis MSMEG_4702 , confirmed by High-Tail RCR and BLAST. To validate the phenotype, we deleted the MSMEG_4702 gene in M. smegmatis mc 2 155 via homologous chromosome exchange (Fig. 1B) and complemented it with the Mtb homolog gene Rv0102 , which corresponds to MSMEG_4702 in Mtb (Supplementary Fig. 1). Multiple-sequence alignment analysis showed high conservation of the MSMEG_4702 amino acid sequence across various mycobacterial species (Fig. 1D). There is also significant homology between the DNA and amino acid sequences (Supplementary Fig. 2). The Rv0102 gene in Mtb is annotated as an integral membrane protein containing 661 amino acids (1986bp), while MSMEG_4702 in M. smegmatis is annotated as an ABC-type transporter, indicating that Rv0102 might function as a transporter in the cytoplasmic membrane. Protein immunoblotting brought about the localization of the Rv0102 protein, showing its exclusive presence in the cell wall/cell membrane (CW/CM) fraction while being absent in the cytoplasmic (CP) fraction (Fig. 1C), indicating that Rv0102 is a protein associated with the cell envelope. According to the analysis results of the PPM server 20 , Rv0102 has 16 transmembrane segments (TMS), with potential Cu-binding motifs in TMS14 to TMS15. InterProScan results suggested a conserved homeodomain in TMS3 to TMS6, akin to CopD, and cytochrome oxidase characteristics in TMS11 to TMS16 (Fig. 1E). CopD, a cytoplasmic copper transfer protein with no Mycobacterium homologs, hints at Mtb Rv0102 possibly having a copper uptake role like CopD. Protein structure predictions via I-TASSER and PyMOL indicated potential copper ion binding sites with features of divalent cation transport (Fig. 1F). The absence of MSMEG_4702 in M. smegmatis confers high copper tolerance, suggesting MSMEG_4702 's crucial involvement in facilitating divalent copper ion transport in Mtb . The deficiency of MSMEG_4702 confers copper tolerance to M. smegmatis Copper ions are essential for Mycobacterium virulence 21 . In contrast to the wild-type (WT) strain, the deletion mutant Δ MSMEG_4702 strain exhibited growth defects in Middlebrook 7H9 liquid medium supplemented with 0.05% Tween80 and 0.2% glycerol (Fig. 2A). The knockout MSMEG_4702 strain resulted in a delayed growth of the Δ MSMEG_4702 strain compared to the WT strain after 8 hours of culture. However, after an extended culture (64 hours), the bacterial densities of both the Δ MSMEG_4702 and WT strains tended to reach a similar level. To eliminate the potential effects of copper present in the commercial Middlebrook 7H9 medium, a copper-free 7H9 medium was prepared for a growth comparison. As anticipated, the growth defect of the Δ MSMEG_4702 strain became significantly more severe after 64 hours of cultivation in the copper-free 7H9 medium, exhibiting a much greater delay compared to the WT strain (Fig. 2B). The observed phenotype provides strong evidence for the involvement of MSMEG_4702 in copper ion utilization. Surprisingly, both the wild-type and complemented strains were capable of growth in copper-free Middlebrook 7H9 media, suggests that copper's fate within bacteria involves its binding to copper-storing proteins such as MymT. These proteins play a crucial role in mitigating copper toxicity under excessive copper conditions and can also serve as a source of copper nutrition during copper scarcity. Additionally, MSMEG_4702 is not the only protein involved in copper uptake, as CtpB also plays a significant role in the copper uptake pathway 6 . When copper ion is excessive, copper could be transferred into the cytoplasm through specific copper transport systems in the membrane, such as the major facilitator superfamily (MSF) transporters 22 . CuSO 4 of different concentrations (37.8 µΜ and 100 µΜ respectively) were added into the copper-free 7H9 medium and bacterial growth was evaluated again. Interestingly, the growth curves of WT and Δ MSMEG_4702 strains were essentially identical in the presence of 37.8 µmol/L CuSO 4 (Fig. 2C). However, when the concentration of CuSO 4 reached 100 µmol/L, both WT and complemented strains entered the decline phase, while the Δ MSMEG_4702 strain remained in the logarithmic phase (Fig. 2D). This indicates that M. smegmatis MSMEG_4702 is indeed involved in the utilization of copper ions, and the reduction in copper utilization resulting from the deletion of MSMEG_4702 enables the mutant strain to survive in high concentrations of exogenous copper. We investigated the impact of copper on bacterial growth on solid medium lacking copper ions and observed a significant growth rate impairment in the Δ MSMEG_4702 strain (Fig. 2E). CuSO 4 at concentrations of 6.3 µmol/L, 37.8 µmol/L, and 63 µmol/L were added to copper-free 7H9 solid medium, inoculated with 10 µl of diluted bacterial solution. Results showed that increasing CuSO 4 concentration notably inhibited WT strain growth. Conversely, Δ MSMEG_4702 growth was enhanced with rising CuSO 4 levels (Fig. 2E). At 37.8 µmol/L CuSO 4 , both WT and Δ MSMEG_4702 strains exhibited similar growth levels. Moreover, at 63 µmol/L CuSO 4 , Δ MSMEG_4702 strain displayed normal growth while WT could not survive. These findings suggest that the protein encoded by M. smegmatis MSMEG_4702 is crucial for copper ion utilization. MSMEG_4702 deficiency impairs the growth of M. smegmatis by reducing intracellular copper concentrations and inhibiting cell division Using the Cuprizone microplate method, we assessed the intracellular copper ion levels of both WT and Δ MSMEG_4702 strains. WT M. smegmatis maintained stable intracellular copper ion concentrations around 0.08 µmol/L, unaffected by external CuSO 4 concentration changes (Fig. 3A). However, at 37.8 µmol/L CuSO 4 , WT intracellular copper levels rose, suggesting M. smegmatis can regulate copper homeostasis to support growth. In cases of excessive extracellular copper reaching bactericidal levels, M. smegmatis may encounter homeostasis failure, leading to a sharp intracellular copper increase hindering bacterial growth. Notably, Δ MSMEG_4702 strain showed significantly lower intracellular copper content compared to WT, independent of external CuSO 4 levels (Fig. 3A). Conversely, very high CuSO 4 concentrations (63 µmol/L) resulted in six times higher intracellular copper levels in WT vs. Δ MSMEG_4702 . Rv0102 complementation successfully restored Δ MSMEG_4702 intracellular copper levels, emphasizing Rv0102's vital role in copper ion regulation. Zinc ion addition did not yield significant differences (Supplementary Fig. 3A). Overall, our data suggest Δ MSMEG_4702 markedly impairs copper ion utilization in M. smegmatis . Interestingly, despite the significant intracellular copper content difference, no distinct growth variation was observed between WT and Δ MSMEG_4702 strains on solid medium (Fig. 2E) or liquid medium (Fig. 2C) at 37.8 µM CuSO 4 concentration. WT intracellular copper ion concentration was four times higher than Δ MSMEG_4702 , restorable by Rv0102 complementation (Fig. 3A). Our data indicated a critical transition threshold of copper from growth promoter to inhibitor in M. smegmatis lying between 0.1 µmol/L and 0.2 µmol/L. At this pivotal copper concentration, Δ MSMEG_4702 growth was boosted while WT strain growth was notably hindered. Despite the growth behavior contrast, both strains ultimately reached similar growth levels. In summary, these findings highlight MSMEG_4702 's crucial role in mediating environmental copper ion utilization, maintaining copper homeostasis, and fostering M. smegmatis growth. To explore the mechanism behind copper's impact on bacterial proliferation and assess its influence on Δ MSMEG_4702 cell growth or division, we conducted experiments to examine the effects of varied copper concentrations on bacterial growth and colony morphology. At optimal CuSO 4 levels, wild-type M. smegmatis displayed distinctive colony morphology with large, rounded single colonies (Supplementary Fig. 3B). Supplementing copper-free 7H9 culture medium with different copper concentrations (0 µmol/L, 6.3 µmol/L, 37.8 µmol/L, and 126 µmol/L) revealed reduced growth rates and smaller colony sizes for Δ MSMEG_4702 at 0 µmol/L or 6.3 µmol/L CuSO 4 , while WT growth rate and colony size remained normal. Under 37.8 µmol/L CuSO 4 , both WT and Δ MSMEG_4702 exhibited comparable growth rates and colony sizes. Interestingly, exposure to 126 µmol/L CuSO 4 led to WT growth failure but allowed Δ MSMEG_4702 growth (Fig. 3B). Disparities in single colonies suggested individual bacteria underwent changes, indicating WT strain susceptibility to copper inhibition. Copper deficiency leads to the loss of function of several bacterial growth enzymes, likely due to the role of copper ions as cofactors for enzymes that are essential for bacterial growth 23 . When cultured with 6.3 µmol/L CuSO 4 , Δ MSMEG_4702 displayed slightly elongated and more dispersed morphology (Fig. 3C), whereas the wild-type strain exhibited uniform length. TUNEL assay results indicated that Δ MSMEG_4702 accumulated higher DNA damage than WT, implying inefficient copper ion utilization in Δ MSMEG_4702 might result in increased DNA damage and impede cellular division (Fig. 3D). Bathocuproine (BCS) is a bidentate copper chelator known to form a 1:2 tetrahedral complex with monovalent copper ions (CuI), effectively removing CuI from the medium. The supplementation of BCS restored the growth of WT M. smegmatis under high copper concentrations (Fig. 3E). When added to a copper-free medium, BCS reduced copper utilization by M. smegmatis , leading to decreased growth (Supplementary Fig. 4). These results suggest that Cu(I) ion plays a significant role in the growth disparity between WT and Δ MSMEG_4702 . MMAR_0267 deletion enables M. marinum to inhibit mycobacteria-induced macrophage apoptosis by interfering with phagolysosome acidification Transition metals such as copper, iron, zinc, and manganese are essential trace nutrients for Mtb and other pathogens during host infection 3 . However, it is generally observed that an elevation in copper concentration is employed to regulate the virulence of pathogens within phagosomes. Mtb in guinea pig macrophages can enhance virulence by accelerating copper efflux or upregulating copper-binding protein 24 . To investigate the impact of reduced copper utilization on Mycobacteria within macrophages, we disrupted MMAR_0267 , the equivalent of the Rv0102 gene in M. marinum . Subsequently, THP-1 macrophages were infected with both WT and Δ MMAR_0267 strains, and their intracellular survival was evaluated by measuring the colony-forming units (CFU) of viable bacteria. Upon infection of THP-1 macrophages, the Δ MMAR_0267 strain demonstrated a significantly higher intracellular survival rate compared to the WT strain at 2 and 3 days post-infection (Fig. 4A). Furthermore, the elimination of internalized Δ MMAR_0267 by THP-1 macrophages was notably delayed (Fig. 4B). These results suggest that the Δ MMAR_0267 mutant displays an enhanced survival rate within macrophages. In macrophages, pathogens often prevent host cell apoptosis to secure their differentiation, survival, and replication 25,26 . The increased intracellular viability of Δ MMAR_0267 may be due to abnormal programmed cell death. The CCK8 fluorescence assay indicated that, at 4 hours (Fig. 4C) and 24 hours (Fig. 4D) post-infection, the number of viable THP-1 cells was significantly higher in cells infected with Δ MMAR_0267 compared to those infected with the WT and complemented strains. These results suggest that Δ MMAR_0267 inhibits programmed cell death in infected cells. To verify if the Δ MMAR_0267 mutant modulates host cell apoptosis and enhances its survival within macrophages, Annexin V with PI co-staining, along with fluorescence microscopy and flow cytometry, were used to evaluate the effects of WT and Δ MMAR_0267 on host cell apoptosis. Δ MMAR_0267 demonstrated a notable reduction in THP-1 apoptosis compared to WT (Fig. 4E-fluorescence microscopy, Fig. 4F-flow cytometry). Interestingly, the levels of pro-inflammatory cytokines, including IL-1β, IL-10, and TNF-α, produced by THP-1 cells infected with Δ MMAR_0267 did not show significant changes (Supplementary Fig. 5). The expression of apoptosis-promoting proteins BAX, P53, and Cas9 was down-regulated by Δ MMAR_0267 , while the anti-apoptotic protein Bcl2 was up-regulated (Fig. 5A). These findings indicate that Δ MMAR_0267 can inhibit host cell apoptosis. Immunoblotting analysis also revealed no significant difference in the levels of IL-1, IL-6, and IL-12 among THP-1 cells infected with Δ MMAR_0267 , WT, and the complemented strain. However, the levels of P53 and Cas9 were decreased 24 hours post-infection (Fig. 5B). The results suggest that Δ MMAR_0267 enhances the intracellular survival of M. marinum by inhibiting macrophage programmed cell death, primarily by suppressing apoptosis rather than altering pro-inflammatory cytokine levels. Generally, apoptosis is induced by Mtb and is associated with better killing of mycobacterial cells and protection of the host 27 . The suppression of the apoptosis process by Δ MMAR_0267 suggests a potential increase in virulence, enabling evasion of the host's innate immune defenses. Mtb infection is known to cause membrane damage and induce necrosis, with the lysosome-mediated membrane repair pathway playing a crucial role in Mtb protection 28 . To investigate whether the Δ MMAR_0267 can hinder lysosomal acidification and LMP, THP-1 cells were infected with GFP-labeled WT, Δ MMAR_0267 , and complemented strains. LysoTracker-Blue was employed to visualize and track the acidic endosomes and lysosomes. Δ MMAR_0267 co-localization with lysosomes was significantly higher compared to the WT strain, while the complement strain showed a normal level of lysosomal co-localization (Fig. 5C and Fig. 5D). These findings suggest that infection with Δ MMAR_0267 enhances lysosome fusion but inhibits LMP. In summary, the Δ MMAR_0267 mutant can effectively inhibit macrophage apoptosis, thereby promoting macrophage survival, potentially through interference with normal phagolysosome acidification. MMAR_0267 deficiency increases zebrafish mortality upon M. marinum infection To examine how reduced copper utilization impacts the virulence of M. marinum in zebrafish, we intraperitoneally infected a total of thirty healthy adult wild-type zebrafish with 10 µl of 2*10 5 CFU/mL of either wild-type M. marinum , Δ MMAR_0267 , or MMAR_0267 complemented strains. The zebrafish infected with wild-type M. marinum succumbed on the seventh day following infection, whereas those infected with Δ MMAR_0267 died much earlier, on the third day after the infection. Notably, all zebrafish in the Δ MMAR_0267 infection group died 11 days earlier than those in the wild-type infection group (Fig. 6A). These results suggest that the deletion of MMAR_0267 can enhance the virulence of M. marinum . Based on the longtitudinal survival counts, we infected zebrafish with the three strains and dissected all infected fish on the third day. The data demonstrated that zebrafish infected with Δ MMAR_0267 exhibited significantly more severe symptoms of congestion, bleeding, and ulcers compared to those infected with the WT and complemented strains (Fig. 6B). The CFU analysis of zebrafish tissues on the third day post-infection revealed that the bacterial load of Δ MMAR_0267 was significantly higher in the liver and skin (Fig. 6C). Histopathological examination of the infected tissues demonstrated that compared to the WT or complemented strains, zebrafish infected with the Δ MMAR_0267 strain exhibited increased neutrophil infiltration and necrotic areas in the liver and skin (Fig. 6D). The results indicate that decreased copper utilization plays a role in facilitating M. marinum 's resistance to the host's innate immunity, thereby enhancing its intracellular growth and virulence during infection. MMAR_0267 deficiency enables M. marinum to escape host immunity by dampening the macrophage STING-TBK1-IRF3 signaling The MMAR_0267 deletion mutant revealed the capacity of M. marinum to inhibit zebrafish macrophages apoptosis for promoting survival. In order to delve deeper into the underlying mechanism behind the heightened virulence of Δ MMAR_0267 M. marinum towards zebrafish, we conducted a comprehensive analysis of the transcriptome and metabolome of infected zebrafish. GSEA (Gene Set Enrichment Analysis) analysis of the transcriptome revealed that the deletion of MMAR_0267 activated the zebrafish glycolysis / gluconeogenesis, RIG-I-like receptor signaling, mTOR signaling, and IgA immune signaling (Fig. 7A). Furthermore, transcriptome heat maps revealed varying degrees of differential gene expression associated with the mTOR signaling pathway (TBK1, IRF3, etc.) in zebrafish infected with Δ MMAR_0267 M. marinum to varying degrees. Metabolome analysis also identified increased levels of mTOR signaling pathway-related metabolites (L-Arginine, L-Leucine, etc.) in the Δ MMAR_0267 infection group (Fig. 7B). Metabolomic analysis simultaneously revealed that infection with Δ MMAR_0267 M. marinum resulted in an accumulation of alpha-ketoglutarate and a decrease in lactate levels in infected zebrafish, providing further evidence for the activation of the glycolysis and tricarboxylic acid (TCA) cycle (Supplementary Fig. 6). The results obtained from the omics analysis demonstrate the activation of mTOR signaling played a crucial role in this process, as ( 1 ) mTOR complex 1 (mTORC1) can enhance the mitochondrial energy metabolism of infected macrophages through glycolysis to protect them from mycobacteria-induced death 29,30 , ( 2 ) the mTOR signaling is regulated by early secreted antigenic target 6 (ESAT6) upon Bacillus Calmette-Guérin (BCG) vaccination 31 . Previous studies have demonstrated that the activation of TBK1 can inhibit the activity of mTORC1, leading to suppressed protein synthesis and enhanced autophagy 32 . The phosphorylation level of STING-TBK1-IRF3 has been shown to impact the activation of the mTOR signaling pathway. In line with this hypothesis, quantitative real-time PCR (qRT-PCR) analysis revealed a significant decrease in the mRNA levels of TBK1 and IRF3 in zebrafish infected with Δ MMAR_0267 M. marinum (Fig. 7C), suggesting that the inhibition of apoptosis is occurring, thereby potentially enhancing the survival of the bacteria within infected macrophages. We observed a noteworthy reduction in phosphorylated TBK1 in THP-1 cells during early infection with Δ MMAR_0267 M. marinum (Fig. 7D). This finding indicates that the STING-TBK1-IRF3 axis may directly modulate the mTOR signaling pathway. Activation of the STING-TBK1-IRF3 axis has been linked to the production of type I interferons (IFN-α/β) and promote cell apoptosis 33,34 . Our findings demonstrated a notable decrease in the levels of IFN-β in THP-1 cells infected with MMAR_0267 -deficient M. marinum , and this reduction was further inhibited by C176 (a potent and covalent STING inhibitor), while IFN-α showed no significant changes (Fig. 7E). This suggested that Δ MMAR_0267 M. marinum primarily enhances its virulence by suppressing the expression of host type I interferon IFN-β through inhibition of the STING-TBK1-IRF3 axis, possibly by modulating the phosphorylation of TBK1. Additionally, we have observed significant activation of the mTOR signaling pathway. Previous studies have shown that the secreted effectors of the Mtb ESAT-6 secretion system-1 (ESX-1) can regulate the mTOR signaling in infected cells. Hence, we aimed to elucidate which effector among the four secreted antigens (CFP-10, ESAT-6, MM1553, and Mh3881c) of Esx-1 substrates is involved in this process 35 . We observed a significant reduction in the expression of the CFP-10 antigen in MMAR_0267 -deficient M. marinum under normal copper conditions (6.3 µmol/L), while this expression was increased when copper levels were elevated (63 µmol/L) (Fig. 7F). Indicating that the Esx-1 secretion system may be involved in the inhibition of the STING-TBK1-IRF3 axis. To further investigate this, a double knockout strain of MSMEG_4702 and CFP-10 was constructed and employed it for infecting THP-1 macrophages. Following treatment with 63µmol/L CuSO 4 , only the Δ MSMEG_4702 M. marinum strain exhibited an increase in TBK1 phosphorylation, while the double knockout strain showed no effect on TBK1 phosphorylation (Supplementary Fig. 7). These findings imply that CFP-10 (Rv3874) may serve as the virulence factor responsible for activating the STING-TBK1-IRF3 axis. Discussion Copper is an essential trace metal in bacteria and serves as a cofactor for many enzymes, but it can be lethal at high concentrations. Multiple studies have shown that copper can rapidly and effectively kill various pathogenic bacteria, including Escherichia coli , Staphylococcus aureus , Clostridium difficile , Salmonella , Mycobacterium , Faecalis , and Enterococcus aureus 19 . In fact, high concentrations of copper were found in guinea pig granulomas during Mtb infection 36 . Subsequent investigations unveiled that mycobacterial phagosomes have the ability to accumulate high concentrations of copper during Mtb infection, which could serve as a potential defense mechanism against the pathogen 37 . In this study, we have identified a novel protein, MMAR_0267 (Homologous protein of Rv0102), that plays a crucial role in the utilization of copper ions in mycobacteria. While it has been previously discovered that the outer membrane pore protein family, Msp A, Msp B, and Msp C, are involved in copper uptake in M. smegmatis , the Msp family homologs are absent in Mtb 38 , and it remains unclear how copper enters Mtb cytoplasm. Secondary structure analysis has revealed the presence of two significant domains in Rv0102 (Fig. 1E). The first domain is the CopD domain, which is responsible for the uptake of copper from the periplasm to the cytoplasm 39 . Despite the absence of the Cop family in Mtb , the presence of the functional CopD domain in Rv0102 implies its potential involvement in a similar role within mycobacteria. This hypothesis is substantiated by the observation that the Δ MSMEG_4702 strain exhibited viability in culture medium containing 100 µmol/L CuSO 4 (Fig. 2D). Although the deletion of MSMEG_4702 did not entirely impede copper utilization by mycobacteria, the knockout strain displayed growth defects with the gradual increase in CuSO 4 concentration in the medium, presumably due to copper overload (Fig. 2). These results imply that the pathway for copper uptake in mycobacteria is not exclusive and that under conditions of abundant copper, non-specific uptake pathways may be activated. Additionally, a recent study has proposed the involvement of Mtb P-type ATPase CtpB in copper uptake 6 . The second domain in Rv0102 is the cytochrome Caa3 domain, which incorporates a Cu-binding center capable of binding CuA, CuI, and CuII in a mixed-valence state 40 . Bioinformatic analysis indicates that Rv0102 can both bind to copper and transport the bound copper to the cytoplasm. Moreover, the experimental data demonstrate a noticeable disparity in the intracellular copper ion content between WT and Δ MSMEG_4702 , even under identical growth conditions (Fig. 3A). This discrepancy can be attributed to the enhanced capability of the knockout strain to efficiently utilize copper at higher concentrations, thereby facilitating its growth. Conversely, the wild-type strain experienced growth inhibition due to heightened copper toxicity. These findings unveil a novel factor that governs the growth and development of M. smegmatis , particularly highlighting the role of copper. The tolerance of Δ MMAR_0267 to high concentrations of copper may contribute to its survival within the macrophages phagosomes. Our findings revealed that the infection of Δ MMAR_0267 inhibited the apoptosis of THP-1 cells and enhanced its intracellular survival. The regulatory mechanisms of cell death encompass apoptosis, ferroptosis, necrosis, and the newly discovered cuproptosis 41 . Immunoblotting of various death-critical molecules indicated a decrease in the levels of P53 and Cas9, which are known to promote apoptosis (Fig. 5B). Additionally, in the natural host of M. marinum , zebrafish, our observations revealed that zebrafish infected with the knockout strain exhibited a mortality rate four days earlier than those infected with the WT strain (Fig. 6A), and histological analysis of tissue sections exhibited more pronounced liver damage in the knockout group (Fig. 6D). CFP-10 associates with secreted proteins, including ESAT-6 and CAML (calcium-modulator and cyclophilin ligand), forming a complex on the host cell membrane, facilitating its entry of the bacterium into the host cell and triggers apoptosis and inflammatory responses, thereby exhibiting its virulence 42 . Our results indicate that copper ions may enhance the transcription of the CFP-10 virulence factor in M. marinum . However, it remains unclear whether copper directly regulates cell apoptosis. The findings suggest that the two factors function independently. Notably, we observed no significant changes in the transcription levels of MMAR_0267 and Ctp B, two genes involved in copper utilization, when the copper concentration in the medium was increased. In contrast, the transcription of Ctp V, which is involved in copper efflux, was upregulated (Supplementary Fig. 8). These findings suggest that M. marinum employs a strategy of increasing copper storage and efflux to counteract the toxicity of high copper levels within cells, rather than reducing copper uptake. It is worth noting that there exists a delicate balance between mycobacterial infection and the level of host cell apoptosis 43 . In the case of Δ MMAR_0267 infection, the phenomenon of bacterial inhibition of apoptosis may be further amplified due to its copper tolerance and enhanced survival. The discovery of MMAR_0267 as a copper transport protein provides valuable insights into the mechanisms underlying the acquisition and utilization of copper by Mtb . This finding, illustrated in Fig. 8, offers important information for enhancing our understanding of copper metabolism in Mtb . In conclusion, our findings indicate that the absence of MMAR_026 7 in M. marinum triggers the activation of host glycolysis, mTOR signaling, and the suppression of apoptosis, ultimately enhancing bacterial survival within infected macrophages and increasing virulence in zebrafish. This study highlights the significance of comprehending the molecular mechanisms involved in bacterial pathogenesis and host immune responses, which can contribute to the development of novel and effective treatments. Methods Bacterial strains and culture conditions M. smegmatis mc 2 155, X674 and complemented strains were grown in Middlebrooks 7H9 medium supplemented with 0.05% Tween 80 and 0.2% glycerin. Solid medium is 7H10-Dubos oleic acid complex-glycerol agar. Selected antibiotics were used at indicated concentrations: kanamycin, 50 µg/mL; ampicillin, 100 µg/mL for E. coli and 20 µg/mL for M. smegmatis mc 2 155; hygromycin, 100 µg/mL for E. coli and 50 µg/mL for M. smegmatis mc 2 155 at 37°C with shaking. M. marinum was cultured using the same antibiotic concentration but under constant temperature of 30°C. Construction and screening of M. smegmatis mc 2 155 Φ MycoMar insertion library The ΦMycoMarT7 transposon system was utilized to construct a transposon insertion mutant library of M. smegmatis mc 2 155 as previously described 44 . The ΦMycoMarT7 transposon system was used to create a transposon insertion mutant library of M. smegmatis mc 2 155. The donor strain was grown in Middlebrook7H9 broth with 10% OADC at 37°C until reaching an OD 600 of 0.6–0.8. The phage carrying the transposon sequence was then transferred to the recipient strain at a 1:1 ratio by electroporation. Transposed cells were plated on Middlebrook7H10 agar with 10% OADC and 50 µg/mL kanamycin, and colonies were allowed to form at 37°C for 2–3 days. For phage infection, M. smegmatis cells in late-log phase were washed and suspended in Mycobacteriophage buffer before adding phages at a 10:1 ratio and incubating at 37°C for 4 hours. The bacteria were then plated on Middlebrook7H10 agar with 20 µg/mL kanamycin and incubated for 3–4 days to obtain kanamycin-resistant colonies. These colonies were further plated on Middlebrook7H10 agar to create a library of 20,000 clones. Screening involved plating clones on Middlebrook7H10 agar with 20 µmol/L CuSO 4 to identify copper-tolerant strains. After screening, PCR sequencing and bioinformatics tools were used to analyze the identified genes. Defining the insertion-disrupted gene of Φ MycoMar. The mutation library was screened in 7H9 containing 20 µmol/L CuSO 4 . Mutation was defined by plasmid rescue method. Axygene bacterial genome small extraction Kit was used to extract the bacterial genomic DNA; The total DNA was treated with Sac II and then self-ligated using T4 DNA ligase. The resulting ligation products were transformed into E. coli DH5α λpir, and plasmid DNA was screened using kanamycin at a concentration of 50 µg/mL. Sequencing of the extracted plasmid was performed using the primer 5´-GCCTTCTTGACGAGTTCTTCTGAG-3´. The sequencing results were mapped to the M. smegmatis mc 2 155 genome in the NCBI database using BLAST. The transposon insertion site was confirmed by analyzing the sequences flanking the primers. Construction of the M. smegmatis deletion mutant in MSMEG_4702 The upstream and downstream homologous arm sequences of MSMEG_4702 gene were obtained by amplification of KOF1(5´- CCGATTGGGAGCAGCAGG − 3´), KOR1(5´- ATCACGCCGCTGACACCCCTACGCACGCACGTCAGAGGC − 3´), KOF2(5´- GCCTCTGACGTGCGTGCGTAGGGGTGTCAGCGGCGTGAT − 3´) and KOR2(5´- CGCGAAGACCATGCCGATC − 3´) primers from the genome of wild-type M. smegmatis , respectively. By overlapping PCR, they were merged into a single fragment and ligated to pDM19-T, which was named pDM19-T-MS. Using Bgl II enzymes to cut dif - hyg - dif box from the plasmid pAL75, ligated by the same enzyme used pDM19 - T - MS building to get the pDM19 - T - MS - hyg, Bam H I and Spe I enzymes were used, the recombinant fragments were amplified and transformed into the M. smegmatis competent cell with pJV53 plasmid by electrotransformation, then spread on the 7H10 plate with Kan and hyg to screen the deletion mutant, and then cultured in the absence of antibiotics 7H9 medium and transferred five generations to allow the loss of Hyg box and pJV53 plasmid. The MMAR_0267 gene of M. marinum was knocked out by using the same method, with the primer sequence as follows: KOF1(5´- GCCCAAGCTTACATGACCGCCCAAA − 3´), KOR1(5´- AGATCTCCCTCGAGCTTACGACTGGATGTCG − 3´), KOF2(5´- CCAGTCGTAAGCTCGAGGGAGATCTAGGCGGGGACGGATCGCTAGCCGAC − 3´) and KOR2(5´- TGGACGGTGAGGTCTTTGACGCTGT − 3´). Complementation with Mtb Rv0102 gene and Western blot Mtb Rv0102 gene was amplified by PCR from Mtb H37Rv genome using the forward primer 5´- CGGGATCCATGGGGACGCACGG − 3´and reverse primer 5´- CCATCGATTCAGCGCCGCATTCGCG − 3´, digested using Nde I and Cla I restriction enzymes and ligated with pALACE plasmid (A Mycobacterium expression test plasmid as a gift from Professor Yossef Av-Gay, University of British Columbia, hygromycin resistance). Desired E. coli clones were screened on solid LB medium containing hygromycin. The recombinant plasmid was then transformed into mycobacterial cells by electroporation, empty pALACE plasmid subjected to the same procedure was used as a negative control. All transformants were selected by hygromycin (50 µg/mL) on Middlebrook 7H10 agar. Supplemented M. smegmatis strains were cultured in 50 mL Middlebrook 7H9 liquid medium to an OD 600 of 0.8-1.0 in the presence of 50 µg /mL hygromycin. Bacteria were washed (three times) with ice-cold 1×PBS, and then suspended in the same buffer. Sonication was used to lyse cells.100 µL total cell lysates were resolved on 12% SDS-PAGE, followed by Western blot analysis. Specific anti-Myc monoclonal antibody (TIANGEN, China) was detected with IgG-HRP, an anti-mouse IgG monoclonal antibody labeled with horseradish peroxidase (TIANGEN, China). Growth curves Growth curves for wild type and mutant M. smegmatis strains were assessed by spectrophotometry (UV-VIS spectrophotometer, Varian Cary 50). Briefly, overnight-cultured bacteria were diluted with liquid 7H9 to an optical density of 0.8. 1% inoculum was then transferred into a fresh liquid 7H9 without or with CuSO 4 of different concentrations. Samples were incubated at 37°C at110 rpm/min. Optical density was determined every 4 hours for consecutive 60 hours. Determination of copper accumulation The Cuprizone microplate method is used to quantify the copper content in M. smegmatis . Cuprizone, a copper chelating agent, forms a blue copper ketone complex with Cu ions. Its unique structure gives it high affinity and selectivity with Cu ions, showing specificity in its reaction. Pre-cultured strains of WT, Δ MSMEG_4702 , and Δ MSMEG_4702::Rv0102 were inoculated into 7H9 medium with varying Cu ion concentrations (0, 6.3, 25.2, 37.8, and 63 µmol/L) by adding CuSO 4 . Each strain was incubated in triplicate in shaking flasks at 37°C for 3 days. After centrifugation at 12,000×g, 4°C for 10 minutes, pellets were washed with metal-ion-free PBS. OD at 600 nm was adjusted to 1.0 using ddH 2 O. Samples underwent sonication, lysis buffer addition, and centrifugation at 4°C, 12,000×g for 10 minutes. The supernatant was used for copper content determination with the Cell Copper (Cu) Colorimetric Assay Kit. Refer to the instructions provided for specific procedure steps. For the heat-killed control group, pre-cultured strains were washed with metal-ion-free PBS and suspended in sterile deionized water. Bacterial suspension was heat treated at 100°C for 20 minutes. After treatment, CuSO 4 solution was added to achieve copper ion concentrations of 0, 6.3, 25.2, 37.8, and 63 µmol/L. The mixture was incubated at 37°C for 1 hour and then washed with metal-ion-free PBS. OD 600 was adjusted to 1.0, followed by sonication and copper ion quantification using the Cell Copper (Cu) Colorimetric Assay Kit. Accumulated copper was determined by subtracting copper ions adsorbed in the heat-killed group from the total copper ions in the culture. The detection method for zinc ions is similar to that of copper ions, but it employs the 5-Br-PADAP microplate method for determining zinc ion concentration. In this method, zinc ions in the sample form a colored complex with the 5-Br-PADAP reagent, and the intensity of the color is proportional to the concentration of zinc ions. All M. smegmatis strains were cultured using the same previously described method, but with different final concentrations of zinc ions (adding ZnSO 4 ): 0, 5, 10, 20, and 40 µmol/L. After incubating the bacteria, both the cultures and heat-killed cells were collected and subjected to ultrasonic treatment for cell lysis. The zinc content in the bacteria was then determined using the Zinc (Zn) Colorimetric Assay Kit. Antibiotic susceptibility assays For antibiotic susceptibility assays, M. smegmatis wild-type and mutant strains were grown to an OD 600 = 0.8. The susceptibility to antibiotics was determined by spotting a 10-fold serially diluted samples on Middlebrook 7H10 (Difco) plates containing 0.05µg/mL moxifloxacin. All experiments were repeated at least three times. RNA isolation and real-time quantitative TaqMan PCR assay A 50 mL bacterial culture with OD 600 = 0.3 was diluted (1:100) into 7H9 media. The strains were cultured until OD 600 = 0.8, then split into untreated (control) and treated groups. Cells in the treated group were exposed to 0.05µg/mL moxifloxacin for 30 minutes, followed by centrifugation at 12,000 x g. Bacterial pellets were suspended in TRIzol (Invitrogen, USA) for RNA extraction and purification per the manufacturer's instructions. cDNA was synthesized using the Superscript III First-Strand Synthesis System kit (Invitrogen, USA). Quantitative real-time reverse transcription-PCR was conducted with cDNA from 50 ng RNA using an SYBR Green Supermix kit (Applied Biosystems) to assess gene expression. Expression levels were normalized to sigA as the control, and the relative expression means were averaged over three replicates. Localization of the Rv0102 protein M. smegmatis recombinant strains harboring the Rv0102 - pALACE-myc and pALACE-myc empty vector were grown as previously described. The cells were lysed by sonication. Cell debris and intact cells were removed by centrifugation (3000× g ) for 5 min, and the supernatant was centrifuged (27,000× g ) for 30 min at 4°C. The pellet contained cell wall, whereas the supernatant represented the cell membrane and cytosol fractions. The pellet and supernatant were used to detect the recombinant protein and GroEL2 (cytoplasmic protein control) by Western blotting with anti-Myc antibody and anti-His antibody. In vitro infection with recombinant M. marinum THP-1 cells were cultured in RPMI 1640 medium (Invitrogen) supplemented with 10% (v/v) heat-inactivated FBS, 2 mM L-glutamine, 100 µg/mL streptomycin, and 100 U/mL penicillin (Invitrogen) at 37°C with 5% CO 2 . Cells were seeded at 2 × 10 6 cells/well in 6-well plates and differentiated with 100 ng/mL PMA. After differentiation, cells were infected with WT, Δ MMAR_0267 and Δ MMAR_0267 :: MMAR_0267 M. marinum at an MOI of 10. Four hours post-infection, cells were washed with PBS, and gentamicin (100 µg/mL) was used to eliminate extracellular bacteria. For LDH activity assay, culture supernatants were collected at 6, 24, 48, and 72 h post-infection and analyzed using a commercially available LDH cytotoxicity kit (Takara Bio). For intracellular bacterial survival, THP-1 cells were infected with the aforementioned strains for 6, 24, 48, and 72 h at 37°C. Infected cells were washed three times with PBS, lysed in 1 mL of 0.025% SDS, diluted, and plated on 7H10 agar plates with 10% glycerol. After 3 days of incubation, colony-forming units were counted to calculate the survival rate compared to the control. Zebrafish infection with M. marinum WT, Δ MMAR_0267 and Δ MMAR_0267 :: MMAR_0267 M. marinum were grown on 7H10 plates, a single colony was picked for culture in liquid medium at 30°C until the OD 600 = 0.5. Healthy adult zebrafish was selected from a population and acclimated them in fresh water for 24 hours before grouping. The M. marinum culture was centrifuged to remove the supernatant, the bacteria were washed with PBS three times, and diluted the bacterial suspension to 10^8 CFU/mL. The zebrafish was placed into a new dish, 10µL bacterial suspension was injected into the zebrafish abdomen. After infection, the zebrafish was placed to the acclimation water. At different time points after infection, the fish was recorded for signs of illness and death. Simultaneously, the bacteria were isolated from dead fish to determine the species and count the bacterial load. Transcriptome and metabolome of zebrafish On the third day of infection, the zebrafish were euthanized and liver tissues were extracted and immediately frozen in liquid nitrogen. These frozen samples were then sent to APTBIO, a company in Shanghai, China for transcriptome and metabolome analysis. Flow cytometry analysis of M. smegmatis induced macrophage apoptosis 2 × 10 6 THP-1 cells were infected with WT_ Ms , Δ MSMEG_4702 and Δ MSMEG_4702 :: Rv0102 for 6 h and 48 h. The infected cells were washed with ice-cold PBS and the apoptotic cells were determined by Annexin V-FITC and propidium iodide (PI) according to the manufacturer’s instructions (Beibo, Shanghai, China). This product detects the externalization of phosphatidylserine in apoptotic cells using recombinant annexin V conjugated to green-fluorescent FITC dye and dead cells using propidium iodide (PI). The cells were subjected to fluorescence microscopy analysis and flow cytometry. Untreated cells were taken as negative control. RT-PCR and Assay for cytokines PMA-differentiated THP-1 cells were infected with WT_ Ms , Δ MSMEG_4702 and Δ MSMEG_4702 :: Rv0102 at an MOI of 10. After 6, 24 and 48 h infection, total cellular RNA was extracted from cells was extracted from the infected cells using RNA extraction kit (TIANGEN) according to the manufacturer’s recommendations. cDNA synthesis was performed using the PrimeScript RT reagent kit (Takara, Shiga, Japan). Quantitative real-time RT-PCR reactions were performed using a CFX96 RT-PCR Detection System (Bio-Rad) using SYBR Green Master Mix. Relative mRNA levels were calculated after normalizing to β-actin. Culture supernatants were collected from the infected macrophages, the cytokines production was detected with commercialy available ELISA kits for TNF-α, IL-10, IL-1β, IL-12, IL-6 and IL-8 (eBioscience). Statistical analysis Data were expressed as the mean ± SEM of at least three independent experiments. Statistical analysis was performed using GraphPad Prism 8.0. The results from RT-PCR, and CFU assays were analyzed by Student’s t test. Differences were considered statistically significant with * P < 0.05, ** P < 0.01, and *** P < 0.001. Data accessibility The data supporting the results of this study are publicly available. Transcriptomic data of zebrafish have been deposited in the GEO database under the accession number GSE235754. Interested researchers can access and download the data from the GEO database. Additionally, the metabolomics dataset has been assigned the accession number MTBLS8036 and can be accessed and downloaded from the respective repository. Abbreviations Mtb Mycobacterium tuberculosis ROS reactive oxygen species NADH Nicotinamide adenine dinucleotide NCBI national center for biotechnology information PBS phosphate buffer saline LDH lactate dehydrogenase THP-1 human myeloid leukemia mononuclear cells TSB Tryptic soy broth PMA Phorbol-12-myristate-13-acetate MOI multiplicity of infection SDS Sodium dodecyl sulfate LPS Lipopolysaccharide PAGE polyacrylamide gelelectrophoresis FBS fetal bovine serum CFU Colony-Forming Units LMP lysosomal membrane permeability References Mehdiratta, K., et al.: Kupyaphores are zinc homeostatic metallophores required for colonization of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U S A. 119 (2022). 10.1073/pnas.2110293119 Kunkle, D.E., Skaar, E.P.: Moving metals: How microbes deliver metal cofactors to metalloproteins. Mol. Microbiol. 120 , 547–554 (2023). 10.1111/mmi.15117 Samanovic, M.I., Ding, C., Thiele, D.J., Darwin, K.H.: Copper in microbial pathogenesis: meddling with the metal. Cell. Host Microbe. 11 , 106–115 (2012). 10.1016/j.chom.2012.01.009 Bagcchi, S., WHO's Global Tuberculosis Report: Lancet Microbe 4, e20, (2022). 10.1016/S2666-5247(22)00359-7 (2023) Serafini, A.: Interplay between central carbon metabolism and metal homeostasis in mycobacteria and other human pathogens. Microbiol. (Reading). 167 (2021). 10.1099/mic.0.001060 Shey-Njila, O., et al.: CtpB Facilitates Mycobacterium tuberculosis Growth in Copper-Limited Niches. Int. J. Mol. Sci. 23 (2022). 10.3390/ijms23105713 Oikawa, S., Kawanishi, S.: Site-specific DNA damage induced by NADH in the presence of copper(II): role of active oxygen species. Biochemistry. 35 , 4584–4590 (1996). 10.1021/bi9527000 Tejeda, C., et al.: Experimental evidence of the anti-bacterial activity pathway of copper ion treatment on Mycobacterium avium subsp. paratuberculosis. Braz J. Microbiol. 54 , 407–413 (2023). 10.1007/s42770-022-00897-w Doku, R.T., Park, G., Wheeler, K.E., Splan, K.E.: Spectroscopic characterization of copper(I) binding to apo and metal-reconstituted zinc finger peptides. J. Biol. Inorg. Chem. 18 , 669–678 (2013). 10.1007/s00775-013-1012-6 Giachino, A., Waldron, K.J.: Copper tolerance in bacteria requires the activation of multiple accessory pathways. Mol. Microbiol. 114 , 377–390 (2020). 10.1111/mmi.14522 Neyrolles, O., Wolschendorf, F., Mitra, A., Niederweis, M.: Mycobacteria, metals, and the macrophage. Immunol. Rev. 264 , 249–263 (2015). 10.1111/imr.12265 Ekici, S., et al.: Intracytoplasmic copper homeostasis controls cytochrome c oxidase production. mBio 5, e01055-01013, (2014). 10.1128/mBio.01055-13 Navarro, C.A., von Bernath, D., Martinez-Bussenius, C., Castillo, R.A., Jerez, C.A.: Cytoplasmic CopZ-Like Protein and Periplasmic Rusticyanin and AcoP Proteins as Possible Copper Resistance Determinants in Acidithiobacillus ferrooxidans ATCC 23270. Appl. Environ. Microb. 82 , 1015–1022 (2016). 10.1128/Aem.02810-15 Leon-Torres, A., Novoa-Aponte, L., Soto, C.Y.: CtpA, a putative Mycobacterium tuberculosis P-type ATPase, is stimulated by copper (I) in the mycobacterial plasma membrane. Biometals. 28 , 713–724 (2015). 10.1007/s10534-015-9860-x Marcus, S.A., Sidiropoulos, S.W., Steinberg, H., Talaat, A.M.: CsoR Is Essential for Maintaining Copper Homeostasis in Mycobacterium tuberculosis. PLoS One. 11 , e0151816 (2016). 10.1371/journal.pone.0151816 Igbaria-Jaber, Y., Hofmann, L., Gevorkyan-Airapetov, L., Shenberger, Y., Ruthstein, S.: Revealing the DNA Binding Modes of CsoR by EPR Spectroscopy. ACS Omega. 8 , 39886–39895 (2023). 10.1021/acsomega.3c06336 Turner, A.G., Ong, C.Y., Walker, M.J., Djoko, K.Y., McEwan, A.G.: Transition Metal Homeostasis in Streptococcus pyogenes and Streptococcus pneumoniae. Adv. Microb. Physiol. 70 , 123–191 (2017). 10.1016/bs.ampbs.2017.01.002 Giachino, A., Waldron, K.J.: Copper tolerance in bacteria requires the activation of multiple accessory pathways. Mol. Microbiol. 114 , 377–390 (2020). 10.1111/mmi.14522 Fu, Y., Chang, F.M.J., Giedroc, D.P.: Copper Transport and Trafficking at the Host Bacterial Pathogen Interface. Acc. Chem. Res. 47 , 3605–3613 (2014). 10.1021/ar500300n Lomize, M.A., Pogozheva, I.D., Joo, H., Mosberg, H.I., Lomize, A.L.: OPM database and PPM web server: resources for positioning of proteins in membranes. Nucleic Acids Res. 40 , D370–376 (2012). 10.1093/nar/gkr703 Nandi, S.K., et al.: Evidences for zinc (II) and copper (II) ion interactions with Mycobacterium leprae HSP18: Effect on its structure and chaperone function. J. Inorg. Biochem. 188 , 62–75 (2018). 10.1016/j.jinorgbio.2018.08.010 Quistgaard, E.M., Low, C., Guettou, F., Nordlund, P.: Understanding transport by the major facilitator superfamily (MFS): structures pave the way. Nat. Rev. Mol. Cell. Bio. 17 , 123–132 (2016). 10.1038/nrm.2015.25 Khalfaoui-Hassani, B., et al.: Widespread Distribution and Functional Specificity of the Copper Importer CcoA: Distinct Cu Uptake Routes for Bacterial Cytochrome c Oxidases. mBio 9, (2018). 10.1128/mBio.00065-18 Wolschendorf, F., et al.: Copper resistance is essential for virulence of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U S A. 108 , 1621–1626 (2011). 10.1073/pnas.1009261108 Galle, J.N., Fechtner, T., Eierhoff, T., Romer, W., Hegemann, J.H.: A Chlamydia pneumoniae adhesin induces phosphatidylserine exposure on host cells. Nat. Commun. 10 , 4644 (2019). 10.1038/s41467-019-12419-8 Chow, S.H., Deo, P., Naderer, T.: Macrophage cell death in microbial infections. Cell. Microbiol. 18 , 466–474 (2016). 10.1111/cmi.12573 Pan, H., et al.: gene mediates innate immunity to tuberculosis. Nature. 434 , 767–772 (2005). 10.1038/nature03419 Divangahi, M., et al.: evades macrophage defenses by inhibiting plasma membrane repair. Nat. Immunol. 10 , 899–U123 (2009). 10.1038/ni.1758 Pagan, A.J., et al.: mTOR-regulated mitochondrial metabolism limits mycobacterium-induced cytotoxicity. Cell 185, 3720–3738 e3713, (2022). 10.1016/j.cell.2022.08.018 Collins, S.L., et al.: mTORC1 Signaling Regulates Proinflammatory Macrophage Function and Metabolism. J. Immunol. 207 , 913–922 (2021). 10.4049/jimmunol.2100230 Dong, H., et al.: ESAT6 inhibits autophagy flux and promotes BCG proliferation through MTOR. Biochem. Biophys. Res. Commun. 477 , 195–201 (2016). 10.1016/j.bbrc.2016.06.042 Hasan, M., et al.: Chronic innate immune activation of TBK1 suppresses mTORC1 activity and dysregulates cellular metabolism. Proc. Natl. Acad. Sci. U S A. 114 , 746–751 (2017). 10.1073/pnas.1611113114 Parker, D., et al.: Streptococcus pneumoniae DNA initiates type I interferon signaling in the respiratory tract. mBio 2, e00016-00011, (2011). 10.1128/mBio.00016-11 Sekheri, M., Rizo-Tellez, S.A., Othman, A., El Kebir, D., Filep, J.G.: Interferon-beta regulates proresolving lipids to promote the resolution of acute airway inflammation. Proc. Natl. Acad. Sci. U S A. 119 , e2201146119 (2022). 10.1073/pnas.2201146119 Xu, J., et al.: A unique Mycobacterium ESX-1 protein co-secretes with CFP-10/ESAT-6 and is necessary for inhibiting phagosome maturation. Mol. Microbiol. 66 , 787–800 (2007). 10.1111/j.1365-2958.2007.05959.x Wolschendorf, F., et al.: Copper resistance is essential for virulence of Mycobacterium tuberculosis. P Natl. Acad. Sci. USA. 108 , 1621–1626 (2011). 10.1073/pnas.1009261108 Wagner, D., et al.: Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell's endosomal system. J. Immunol. 174 , 1491–1500 (2005). 10.4049/jimmunol.174.3.1491 Speer, A., Rowland, J.L., Haeili, M., Niederweis, M., Wolschendorf, F.: Porins Increase Copper Susceptibility of Mycobacterium tuberculosis. J. Bacteriol. 195 , 5133–5140 (2013). 10.1128/Jb.00763-13 Lawton, T.J., Kenney, G.E., Hurley, J.D., Rosenzweig, A.C.: The CopC Family: Structural and Bioinformatic Insights into a Diverse Group of Periplasmic Copper Binding Proteins. Biochemistry. 55 , 2278–2290 (2016). 10.1021/acs.biochem.6b00175 Gupta, D.D., et al.: Identification of a copper ion recognition peptide sequence in the subunit II of cytochrome c oxidase: a combined theoretical and experimental study. J. Biol. Inorg. Chem. 26 , 411–425 (2021). 10.1007/s00775-021-01867-7 Tsvetkov, P., et al.: Copper induces cell death by targeting lipoylated TCA cycle proteins. Science. 375 , 1254–1261 (2022). 10.1126/science.abf0529 Rojas-Espinosa, O., et al.: A neutrophil-based test as an auxiliary tool for substantiating the diagnosis of bovine tuberculosis. Int. J. Mycobacteriol. 11 , 190–198 (2022). 10.4103/ijmy.ijmy_71_22 Dubey, R.K.: Assuming the role of mitochondria in mycobacterial infection. Int. J. Mycobacteriol. 5 , 379–383 (2016). 10.1016/j.ijmyco.2016.06.001 Murry, J.P., Sassetti, C.M., Lane, J.M., Xie, Z., Rubin, E.J.: Transposon site hybridization in Mycobacterium tuberculosis. Methods Mol. Biol. 416 , 45–59 (2008). 10.1007/978-1-59745-321-9_4 Additional Declarations There is NO Competing Interest. Supplementary Files Supplementalfigures.docx Cite Share Download PDF Status: Published Journal Publication published 19 Sep, 2024 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4080994","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":281274795,"identity":"ae821a57-3c2b-4a45-b60f-d5805aeafaa8","order_by":0,"name":"Junqi xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYBACNvb+hw8+VNjIsbE3EKmFj+cMs+GMM2nGfDwHiNQiJ5HDJs3ZdjhRTiKBWIfxnD0gzdjGnMAm+XjjDYYam2jCWtj7EowLzrHlsUmnFVswHEvLbSBsywGD5BllPMVs0jlmEowNh4nQIpFgcJiHTSKxTfIM0VpyDJt52gwS2yR4iNXCcyyZccaZBGM2HqBfEojxi3x78/EfHyr+y8m3H95440ONDWEtyMCA6KhB0kKqjlEwCkbBKBgZAACTRjw4aJNEiQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0009-3162-6843","institution":"southwest university","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Junqi","middleName":"","lastName":"xu","suffix":""},{"id":281274796,"identity":"607ef63b-69dd-498b-9855-230851d0843e","order_by":1,"name":"Shaying Ma","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shaying","middleName":"","lastName":"Ma","suffix":""},{"id":281274797,"identity":"c5877121-ea1f-41a0-b92e-6e4ab0b306e1","order_by":2,"name":"Yu Huang","email":"","orcid":"https://orcid.org/0000-0003-4053-3648","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Huang","suffix":""},{"id":281274798,"identity":"af6f9427-425c-487d-a58b-54f8f2d4def9","order_by":3,"name":"Qiao Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiao","middleName":"","lastName":"Zhang","suffix":""},{"id":281274799,"identity":"8af38344-7918-4a0e-ae0b-dacf5f2fa4ef","order_by":4,"name":"lingxi huang","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"lingxi","middleName":"","lastName":"huang","suffix":""},{"id":281274800,"identity":"3b6b7c64-f60e-4491-be10-993af33ea8b8","order_by":5,"name":"xianghong xu","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"xianghong","middleName":"","lastName":"xu","suffix":""},{"id":281274801,"identity":"49f31443-d7cb-4b58-b83c-0bcf252392ab","order_by":6,"name":"Ismail Suleiman","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ismail","middleName":"","lastName":"Suleiman","suffix":""},{"id":281274802,"identity":"8d20d271-a2bc-453a-8499-3aeaf3bda9af","order_by":7,"name":"peibo li","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"peibo","middleName":"","lastName":"li","suffix":""},{"id":281274803,"identity":"f76f2cf6-d961-44bd-835c-1662e9cce821","order_by":8,"name":"ZhiJian Wang","email":"","orcid":"","institution":"Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Science, Southwest University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"ZhiJian","middleName":"","lastName":"Wang","suffix":""},{"id":281274804,"identity":"6ba03eba-4a24-4bd9-b9af-48878a8b56ec","order_by":9,"name":"Jianping Xie","email":"","orcid":"","institution":"Southwest University, Beibei, Chongqing","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jianping","middleName":"","lastName":"Xie","suffix":""}],"badges":[],"createdAt":"2024-03-12 07:41:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4080994/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4080994/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s42003-024-06860-9","type":"published","date":"2024-09-19T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":53148190,"identity":"39b0cd66-37de-4c8e-af64-b742080082e8","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":816452,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends1.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/24e6317927b6cda0de71d527.png"},{"id":53148193,"identity":"8028ea97-928c-4c91-89bf-e578104be38c","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":680688,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends2.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/2e17d37df9da42e344798c3c.png"},{"id":53148191,"identity":"96a7952e-5b4a-477d-816f-d3e79c8d788b","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":764076,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends3.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/290f82e7d775d15dd90329dc.png"},{"id":53148198,"identity":"578047e2-9ffa-4567-b042-575d08c9e695","added_by":"auto","created_at":"2024-03-21 07:53:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":526533,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends4.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/301b95c183ffb9637dd90011.png"},{"id":53148199,"identity":"fdd62fc8-0578-4f3d-b7d4-d7cb9e6f3b34","added_by":"auto","created_at":"2024-03-21 07:53:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":611823,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends5.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/90eda561062d3f4729f2946d.png"},{"id":53148196,"identity":"6b3496f1-9729-4b87-85ef-b32163e515b0","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2348829,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends6.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/0c28a2967540e62b7f61fb23.png"},{"id":53148195,"identity":"3f155ac7-fa2a-497a-a087-ef584437453e","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":412701,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends7.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/154f33c1ea9e6e72e2717bce.png"},{"id":53148192,"identity":"d3a60e41-d0d6-4304-adab-5054e1896fbe","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1031239,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"FiguresandLegends8.png","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/ca06be2a33fa98fc385ce1d5.png"},{"id":64896111,"identity":"0808baf3-2bd1-4d58-9837-033db07dfaec","added_by":"auto","created_at":"2024-09-20 07:06:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8911965,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/e10e0818-0a00-41a9-b880-e0320e7aa1b8.pdf"},{"id":53148194,"identity":"3ad57837-d423-4f04-a0ad-0300d5128c2a","added_by":"auto","created_at":"2024-03-21 07:53:16","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2287757,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementalfigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-4080994/v1/02b9aa9d992b98e7c2a5d499.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Mycobacterium marinum MMAR_0267-regulated copper utilization facilitates bacterial escape from phagolysosome","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn the natural environment, trace metal elements such as manganese (Mn), copper (Cu), iron (Fe), zinc (Zn), and nickel (Ni) inhibit \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMtb\u003c/em\u003e) growth by damaging cell membranes, disrupting metabolism, and inducing oxidative stress \u003csup\u003e1\u003c/sup\u003e. These metals play key roles in protein folding and enzyme activity, but their excess accumulation can be toxic \u003csup\u003e2\u003c/sup\u003e. The host employs mechanisms to sequester essential metals like Mn, Fe, and Zn within phagosomes to restrict intracellular pathogen growth. But the excess Cu is utilized by host cells to combat intracellular pathogens \u003csup\u003e3\u003c/sup\u003e. Therefore, maintaining metal, including Cu, homeostasis is critical for intracellular pathogen survival.\u003c/p\u003e \u003cp\u003eTuberculosis, caused by \u003cem\u003eMtb\u003c/em\u003e infection, remains a significant global public health issue \u003csup\u003e4\u003c/sup\u003e. Copper, among other metal elements, is essential for \u003cem\u003eMtb\u003c/em\u003e replication and enzyme activity \u003csup\u003e5\u003c/sup\u003e. Copper ions act as catalysts in single-electron transfer reactions within the cytochrome respiratory enzyme aa3-bc1 complex \u003csup\u003e6\u003c/sup\u003e. The redox potential of Cu(II)/Cu(I) exceeds that of Fe(III)/Fe(II) \u003csup\u003e7\u003c/sup\u003e, leading to the generation of ROS upon copper infiltration into bacterial cells like \u003cem\u003eMycobacterium avium\u003c/em\u003e, causing DNA damage and compromising integrity \u003csup\u003e8\u003c/sup\u003e. Cu toxicity arises from its competitive binding with metalloproteins, potentially inactivating critical enzymes and hindering \u003cem\u003eMtb\u003c/em\u003e growth \u003csup\u003e9\u003c/sup\u003e. To mitigate Cu excess toxicity, \u003cem\u003eMtb\u003c/em\u003e employs cytoplasmic proteins including metallothioneins, copper storage proteins \u003csup\u003e10\u003c/sup\u003e, and copper efflux proteins to chelate or buffer copper ions \u003csup\u003e11\u003c/sup\u003e. \u003cem\u003eMtb\u003c/em\u003e has a sophisticated copper ion uptake system to maintain intracellular copper homeostasis.\u003c/p\u003e \u003cp\u003eCross-membrane Cu transport relies on specific membrane proteins that facilitate copper ion transfer. In \u003cem\u003eMtb\u003c/em\u003e, one such protein is CopA, a member of the P1B-1 type ATPase subfamily. CopA is vital for transferring copper from ATPase to cytochrome oxidase, determining copper importation or expulsion from the cell \u003csup\u003e12\u003c/sup\u003e. In the presence of excess Cu, the CopZ/A operon induces a Cu efflux system. CopZ, acting as a Cu chaperone, transfers Cu to the CPX-type efflux ATPase CopA \u003csup\u003e13\u003c/sup\u003e. Additionally, the CtpA gene is induced during \u003cem\u003eMtb\u003c/em\u003e infection. \u003cem\u003eMtb\u003c/em\u003e CtpA, CtpB, and CtpV are transmembrane proteins involved in heavy metal cation transport, with CtpA potentially serving as a Cu transporter across the mycobacterial membrane \u003csup\u003e14\u003c/sup\u003e. CsoR, a copper-inducible transcriptional regulator, controls Cu efflux factors like CtpV in \u003cem\u003eMtb\u003c/em\u003e, regulating intracellular copper ion levels \u003csup\u003e15,16\u003c/sup\u003e. This Cu homeostasis system is conserved in various bacteria beyond \u003cem\u003eMtb\u003c/em\u003e, including \u003cem\u003eStreptococcus\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e, and \u003cem\u003eEscherichia coli\u003c/em\u003e \u003csup\u003e17,18\u003c/sup\u003e. The mechanism of Cu(I) transport across bacterial membranes remains unclear \u003csup\u003e19\u003c/sup\u003e. Recent studies highlight the essential role of the p-type ATPase CtpB in copper acquisition and respiration, with its absence linked to increased virulence \u003csup\u003e6\u003c/sup\u003e. Nonetheless, a stable and regulated Cu uptake pathway is crucial for Mycobacteria to maintain copper ion homeostasis.\u003c/p\u003e \u003cp\u003eThis study shows that the ABC transporter Rv0102, located on the cell membrane, along with its homologous genes \u003cem\u003eMMAR_0267\u003c/em\u003e in \u003cem\u003eM. marinum\u003c/em\u003e and \u003cem\u003eMSMEG_4702\u003c/em\u003e in \u003cem\u003eM. smegmatis\u003c/em\u003e, play a crucial role in regulating intracellular copper levels and are integral components of the Cu homeostasis system in \u003cem\u003eMtb\u003c/em\u003e. When the homologous gene \u003cem\u003eMSMEG_4702\u003c/em\u003e in \u003cem\u003eM. smegmatis\u003c/em\u003e is deleted, it results in a significant impairment of the bacterium's ability to effectively utilize copper ions. The deletion mutants exhibit increased tolerance to higher concentrations of Cu ions. Likewise, the elimination of the homologous gene \u003cem\u003eMMAR_0267\u003c/em\u003e in \u003cem\u003eM. marinum\u003c/em\u003e also significantly affects the bacterium's capacity to utilize Cu. The underutilization of copper resources increases the survival and virulence of the deletion strain in zebrafish and decreases the THP-1 macrophages apoptosis, possibly due to macrophages failure to use Cu ions to kill the engulfed \u003cem\u003eMm\u003c/em\u003e. Our study presents the initial evidence indicating that \u003cem\u003eMtb\u003c/em\u003e Rv0102 is a membrane protein involved in the utilization of copper ions.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eRv0102 is involved in copper ions transfer\u003c/h2\u003e \u003cp\u003eTo generate an adequate number of single mutants, we created a mutant library of \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155 with 20,000 transposon insertions using the Tn7 transposon system. The library was screened on 7H10 medium with high copper ion concentration (20 \u0026micro;mol/L CuSO4), leading to the identification of a copper-tolerant mutant X674. This mutant had a Tn7 transposon insertion between the 375th and 376th positions of \u003cem\u003eM. smegmatis MSMEG_4702\u003c/em\u003e, confirmed by High-Tail RCR and BLAST. To validate the phenotype, we deleted the \u003cem\u003eMSMEG_4702\u003c/em\u003e gene in \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155 via homologous chromosome exchange (Fig.\u0026nbsp;1B) and complemented it with the \u003cem\u003eMtb\u003c/em\u003e homolog gene \u003cem\u003eRv0102\u003c/em\u003e, which corresponds to \u003cem\u003eMSMEG_4702\u003c/em\u003e in \u003cem\u003eMtb\u003c/em\u003e (Supplementary Fig.\u0026nbsp;1). Multiple-sequence alignment analysis showed high conservation of the \u003cem\u003eMSMEG_4702\u003c/em\u003e amino acid sequence across various mycobacterial species (Fig.\u0026nbsp;1D). There is also significant homology between the DNA and amino acid sequences (Supplementary Fig.\u0026nbsp;2).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eRv0102\u003c/em\u003e gene in \u003cem\u003eMtb\u003c/em\u003e is annotated as an integral membrane protein containing 661 amino acids (1986bp), while \u003cem\u003eMSMEG_4702\u003c/em\u003e in \u003cem\u003eM. smegmatis\u003c/em\u003e is annotated as an ABC-type transporter, indicating that Rv0102 might function as a transporter in the cytoplasmic membrane. Protein immunoblotting brought about the localization of the Rv0102 protein, showing its exclusive presence in the cell wall/cell membrane (CW/CM) fraction while being absent in the cytoplasmic (CP) fraction (Fig.\u0026nbsp;1C), indicating that Rv0102 is a protein associated with the cell envelope. According to the analysis results of the PPM server \u003csup\u003e20\u003c/sup\u003e, Rv0102 has 16 transmembrane segments (TMS), with potential Cu-binding motifs in TMS14 to TMS15. InterProScan results suggested a conserved homeodomain in TMS3 to TMS6, akin to CopD, and cytochrome oxidase characteristics in TMS11 to TMS16 (Fig.\u0026nbsp;1E). CopD, a cytoplasmic copper transfer protein with no Mycobacterium homologs, hints at \u003cem\u003eMtb\u003c/em\u003e Rv0102 possibly having a copper uptake role like CopD. Protein structure predictions via I-TASSER and PyMOL indicated potential copper ion binding sites with features of divalent cation transport (Fig.\u0026nbsp;1F). The absence of \u003cem\u003eMSMEG_4702\u003c/em\u003e in \u003cem\u003eM. smegmatis\u003c/em\u003e confers high copper tolerance, suggesting \u003cem\u003eMSMEG_4702\u003c/em\u003e's crucial involvement in facilitating divalent copper ion transport in \u003cem\u003eMtb\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe deficiency of MSMEG_4702 confers copper tolerance to\u003c/b\u003e \u003cb\u003eM. smegmatis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCopper ions are essential for \u003cem\u003eMycobacterium\u003c/em\u003e virulence \u003csup\u003e21\u003c/sup\u003e. In contrast to the wild-type (WT) strain, the deletion mutant Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain exhibited growth defects in Middlebrook 7H9 liquid medium supplemented with 0.05% Tween80 and 0.2% glycerol (Fig.\u0026nbsp;2A). The knockout \u003cem\u003eMSMEG_4702\u003c/em\u003e strain resulted in a delayed growth of the Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain compared to the WT strain after 8 hours of culture. However, after an extended culture (64 hours), the bacterial densities of both the Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e and WT strains tended to reach a similar level. To eliminate the potential effects of copper present in the commercial Middlebrook 7H9 medium, a copper-free 7H9 medium was prepared for a growth comparison. As anticipated, the growth defect of the Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain became significantly more severe after 64 hours of cultivation in the copper-free 7H9 medium, exhibiting a much greater delay compared to the WT strain (Fig.\u0026nbsp;2B). The observed phenotype provides strong evidence for the involvement of \u003cem\u003eMSMEG_4702\u003c/em\u003e in copper ion utilization. Surprisingly, both the wild-type and complemented strains were capable of growth in copper-free Middlebrook 7H9 media, suggests that copper's fate within bacteria involves its binding to copper-storing proteins such as MymT. These proteins play a crucial role in mitigating copper toxicity under excessive copper conditions and can also serve as a source of copper nutrition during copper scarcity. Additionally, \u003cem\u003eMSMEG_4702\u003c/em\u003e is not the only protein involved in copper uptake, as CtpB also plays a significant role in the copper uptake pathway \u003csup\u003e6\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWhen copper ion is excessive, copper could be transferred into the cytoplasm through specific copper transport systems in the membrane, such as the major facilitator superfamily (MSF) transporters \u003csup\u003e22\u003c/sup\u003e. CuSO\u003csub\u003e4\u003c/sub\u003e of different concentrations (37.8 \u0026micro;Μ and 100 \u0026micro;Μ respectively) were added into the copper-free 7H9 medium and bacterial growth was evaluated again. Interestingly, the growth curves of WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strains were essentially identical in the presence of 37.8 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e (Fig.\u0026nbsp;2C). However, when the concentration of CuSO\u003csub\u003e4\u003c/sub\u003e reached 100 \u0026micro;mol/L, both WT and complemented strains entered the decline phase, while the Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain remained in the logarithmic phase (Fig.\u0026nbsp;2D). This indicates that \u003cem\u003eM. smegmatis\u003c/em\u003e MSMEG_4702 is indeed involved in the utilization of copper ions, and the reduction in copper utilization resulting from the deletion of \u003cem\u003eMSMEG_4702\u003c/em\u003e enables the mutant strain to survive in high concentrations of exogenous copper.\u003c/p\u003e \u003cp\u003eWe investigated the impact of copper on bacterial growth on solid medium lacking copper ions and observed a significant growth rate impairment in the Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain (Fig.\u0026nbsp;2E). CuSO\u003csub\u003e4\u003c/sub\u003e at concentrations of 6.3 \u0026micro;mol/L, 37.8 \u0026micro;mol/L, and 63 \u0026micro;mol/L were added to copper-free 7H9 solid medium, inoculated with 10 \u0026micro;l of diluted bacterial solution. Results showed that increasing CuSO\u003csub\u003e4\u003c/sub\u003e concentration notably inhibited WT strain growth. Conversely, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e growth was enhanced with rising CuSO\u003csub\u003e4\u003c/sub\u003e levels (Fig.\u0026nbsp;2E). At 37.8 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, both WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strains exhibited similar growth levels. Moreover, at 63 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain displayed normal growth while WT could not survive. These findings suggest that the protein encoded by \u003cem\u003eM. smegmatis MSMEG_4702\u003c/em\u003e is crucial for copper ion utilization.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMSMEG_4702 deficiency impairs the growth of\u003c/b\u003e \u003cb\u003eM. smegmatis\u003c/b\u003e \u003cb\u003eby reducing intracellular copper concentrations and inhibiting cell division\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUsing the Cuprizone microplate method, we assessed the intracellular copper ion levels of both WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strains. WT \u003cem\u003eM. smegmatis\u003c/em\u003e maintained stable intracellular copper ion concentrations around 0.08 \u0026micro;mol/L, unaffected by external CuSO\u003csub\u003e4\u003c/sub\u003e concentration changes (Fig.\u0026nbsp;3A). However, at 37.8 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, WT intracellular copper levels rose, suggesting \u003cem\u003eM. smegmatis\u003c/em\u003e can regulate copper homeostasis to support growth. In cases of excessive extracellular copper reaching bactericidal levels, \u003cem\u003eM. smegmatis\u003c/em\u003e may encounter homeostasis failure, leading to a sharp intracellular copper increase hindering bacterial growth. Notably, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain showed significantly lower intracellular copper content compared to WT, independent of external CuSO\u003csub\u003e4\u003c/sub\u003e levels (Fig.\u0026nbsp;3A). Conversely, very high CuSO\u003csub\u003e4\u003c/sub\u003e concentrations (63 \u0026micro;mol/L) resulted in six times higher intracellular copper levels in WT vs. Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e. Rv0102 complementation successfully restored Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e intracellular copper levels, emphasizing Rv0102's vital role in copper ion regulation. Zinc ion addition did not yield significant differences (Supplementary Fig.\u0026nbsp;3A). Overall, our data suggest Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e markedly impairs copper ion utilization in \u003cem\u003eM. smegmatis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eInterestingly, despite the significant intracellular copper content difference, no distinct growth variation was observed between WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strains on solid medium (Fig.\u0026nbsp;2E) or liquid medium (Fig.\u0026nbsp;2C) at 37.8 \u0026micro;M CuSO\u003csub\u003e4\u003c/sub\u003e concentration. WT intracellular copper ion concentration was four times higher than Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e, restorable by \u003cem\u003eRv0102\u003c/em\u003e complementation (Fig.\u0026nbsp;3A). Our data indicated a critical transition threshold of copper from growth promoter to inhibitor in \u003cem\u003eM. smegmatis\u003c/em\u003e lying between 0.1 \u0026micro;mol/L and 0.2 \u0026micro;mol/L. At this pivotal copper concentration, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e growth was boosted while WT strain growth was notably hindered. Despite the growth behavior contrast, both strains ultimately reached similar growth levels. In summary, these findings highlight \u003cem\u003eMSMEG_4702\u003c/em\u003e's crucial role in mediating environmental copper ion utilization, maintaining copper homeostasis, and fostering \u003cem\u003eM. smegmatis\u003c/em\u003e growth.\u003c/p\u003e \u003cp\u003eTo explore the mechanism behind copper's impact on bacterial proliferation and assess its influence on Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e cell growth or division, we conducted experiments to examine the effects of varied copper concentrations on bacterial growth and colony morphology. At optimal CuSO\u003csub\u003e4\u003c/sub\u003e levels, wild-type \u003cem\u003eM. smegmatis\u003c/em\u003e displayed distinctive colony morphology with large, rounded single colonies (Supplementary Fig.\u0026nbsp;3B). Supplementing copper-free 7H9 culture medium with different copper concentrations (0 \u0026micro;mol/L, 6.3 \u0026micro;mol/L, 37.8 \u0026micro;mol/L, and 126 \u0026micro;mol/L) revealed reduced growth rates and smaller colony sizes for Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e at 0 \u0026micro;mol/L or 6.3 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, while WT growth rate and colony size remained normal. Under 37.8 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, both WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e exhibited comparable growth rates and colony sizes. Interestingly, exposure to 126 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e led to WT growth failure but allowed Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e growth (Fig.\u0026nbsp;3B). Disparities in single colonies suggested individual bacteria underwent changes, indicating WT strain susceptibility to copper inhibition.\u003c/p\u003e \u003cp\u003eCopper deficiency leads to the loss of function of several bacterial growth enzymes, likely due to the role of copper ions as cofactors for enzymes that are essential for bacterial growth \u003csup\u003e23\u003c/sup\u003e. When cultured with 6.3 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e displayed slightly elongated and more dispersed morphology (Fig.\u0026nbsp;3C), whereas the wild-type strain exhibited uniform length. TUNEL assay results indicated that Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e accumulated higher DNA damage than WT, implying inefficient copper ion utilization in Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e might result in increased DNA damage and impede cellular division (Fig.\u0026nbsp;3D).\u003c/p\u003e \u003cp\u003eBathocuproine (BCS) is a bidentate copper chelator known to form a 1:2 tetrahedral complex with monovalent copper ions (CuI), effectively removing CuI from the medium. The supplementation of BCS restored the growth of WT \u003cem\u003eM. smegmatis\u003c/em\u003e under high copper concentrations (Fig.\u0026nbsp;3E). When added to a copper-free medium, BCS reduced copper utilization by \u003cem\u003eM. smegmatis\u003c/em\u003e, leading to decreased growth (Supplementary Fig.\u0026nbsp;4). These results suggest that Cu(I) ion plays a significant role in the growth disparity between WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMMAR_0267\u003c/b\u003e \u003cb\u003edeletion enables\u003c/b\u003e \u003cb\u003eM. marinum\u003c/b\u003e \u003cb\u003eto inhibit mycobacteria-induced macrophage apoptosis by interfering with phagolysosome acidification\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTransition metals such as copper, iron, zinc, and manganese are essential trace nutrients for \u003cem\u003eMtb\u003c/em\u003e and other pathogens during host infection \u003csup\u003e3\u003c/sup\u003e. However, it is generally observed that an elevation in copper concentration is employed to regulate the virulence of pathogens within phagosomes. \u003cem\u003eMtb\u003c/em\u003e in guinea pig macrophages can enhance virulence by accelerating copper efflux or upregulating copper-binding protein \u003csup\u003e24\u003c/sup\u003e. To investigate the impact of reduced copper utilization on Mycobacteria within macrophages, we disrupted \u003cem\u003eMMAR_0267\u003c/em\u003e, the equivalent of the Rv0102 gene in \u003cem\u003eM. marinum\u003c/em\u003e. Subsequently, THP-1 macrophages were infected with both WT and Δ\u003cem\u003eMMAR_0267\u003c/em\u003e strains, and their intracellular survival was evaluated by measuring the colony-forming units (CFU) of viable bacteria. Upon infection of THP-1 macrophages, the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e strain demonstrated a significantly higher intracellular survival rate compared to the WT strain at 2 and 3 days post-infection (Fig.\u0026nbsp;4A). Furthermore, the elimination of internalized Δ\u003cem\u003eMMAR_0267\u003c/em\u003e by THP-1 macrophages was notably delayed (Fig.\u0026nbsp;4B). These results suggest that the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e mutant displays an enhanced survival rate within macrophages.\u003c/p\u003e \u003cp\u003eIn macrophages, pathogens often prevent host cell apoptosis to secure their differentiation, survival, and replication \u003csup\u003e25,26\u003c/sup\u003e. The increased intracellular viability of Δ\u003cem\u003eMMAR_0267\u003c/em\u003e may be due to abnormal programmed cell death. The CCK8 fluorescence assay indicated that, at 4 hours (Fig.\u0026nbsp;4C) and 24 hours (Fig.\u0026nbsp;4D) post-infection, the number of viable THP-1 cells was significantly higher in cells infected with Δ\u003cem\u003eMMAR_0267\u003c/em\u003e compared to those infected with the WT and complemented strains. These results suggest that Δ\u003cem\u003eMMAR_0267\u003c/em\u003e inhibits programmed cell death in infected cells. To verify if the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e mutant modulates host cell apoptosis and enhances its survival within macrophages, Annexin V with PI co-staining, along with fluorescence microscopy and flow cytometry, were used to evaluate the effects of WT and Δ\u003cem\u003eMMAR_0267\u003c/em\u003e on host cell apoptosis. Δ\u003cem\u003eMMAR_0267\u003c/em\u003e demonstrated a notable reduction in THP-1 apoptosis compared to WT (Fig.\u0026nbsp;4E-fluorescence microscopy, Fig.\u0026nbsp;4F-flow cytometry). Interestingly, the levels of pro-inflammatory cytokines, including IL-1β, IL-10, and TNF-α, produced by THP-1 cells infected with Δ\u003cem\u003eMMAR_0267\u003c/em\u003e did not show significant changes (Supplementary Fig.\u0026nbsp;5). The expression of apoptosis-promoting proteins BAX, P53, and Cas9 was down-regulated by Δ\u003cem\u003eMMAR_0267\u003c/em\u003e, while the anti-apoptotic protein Bcl2 was up-regulated (Fig.\u0026nbsp;5A). These findings indicate that Δ\u003cem\u003eMMAR_0267\u003c/em\u003e can inhibit host cell apoptosis. Immunoblotting analysis also revealed no significant difference in the levels of IL-1, IL-6, and IL-12 among THP-1 cells infected with Δ\u003cem\u003eMMAR_0267\u003c/em\u003e, WT, and the complemented strain. However, the levels of P53 and Cas9 were decreased 24 hours post-infection (Fig.\u0026nbsp;5B). The results suggest that Δ\u003cem\u003eMMAR_0267\u003c/em\u003e enhances the intracellular survival of \u003cem\u003eM. marinum\u003c/em\u003e by inhibiting macrophage programmed cell death, primarily by suppressing apoptosis rather than altering pro-inflammatory cytokine levels.\u003c/p\u003e \u003cp\u003eGenerally, apoptosis is induced by \u003cem\u003eMtb\u003c/em\u003e and is associated with better killing of mycobacterial cells and protection of the host \u003csup\u003e27\u003c/sup\u003e. The suppression of the apoptosis process by Δ\u003cem\u003eMMAR_0267\u003c/em\u003e suggests a potential increase in virulence, enabling evasion of the host's innate immune defenses. \u003cem\u003eMtb\u003c/em\u003e infection is known to cause membrane damage and induce necrosis, with the lysosome-mediated membrane repair pathway playing a crucial role in \u003cem\u003eMtb\u003c/em\u003e protection \u003csup\u003e28\u003c/sup\u003e. To investigate whether the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e can hinder lysosomal acidification and LMP, THP-1 cells were infected with GFP-labeled WT, Δ\u003cem\u003eMMAR_0267\u003c/em\u003e, and complemented strains. LysoTracker-Blue was employed to visualize and track the acidic endosomes and lysosomes. Δ\u003cem\u003eMMAR_0267\u003c/em\u003e co-localization with lysosomes was significantly higher compared to the WT strain, while the complement strain showed a normal level of lysosomal co-localization (Fig.\u0026nbsp;5C and Fig.\u0026nbsp;5D). These findings suggest that infection with Δ\u003cem\u003eMMAR_0267\u003c/em\u003e enhances lysosome fusion but inhibits LMP. In summary, the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e mutant can effectively inhibit macrophage apoptosis, thereby promoting macrophage survival, potentially through interference with normal phagolysosome acidification.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMMAR_0267\u003c/b\u003e \u003cb\u003edeficiency increases zebrafish mortality upon\u003c/b\u003e \u003cb\u003eM. marinum\u003c/b\u003e \u003cb\u003einfection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo examine how reduced copper utilization impacts the virulence of \u003cem\u003eM. marinum\u003c/em\u003e in zebrafish, we intraperitoneally infected a total of thirty healthy adult wild-type zebrafish with 10 \u0026micro;l of 2*10\u003csup\u003e5\u003c/sup\u003e CFU/mL of either wild-type \u003cem\u003eM. marinum\u003c/em\u003e, Δ\u003cem\u003eMMAR_0267\u003c/em\u003e, or \u003cem\u003eMMAR_0267\u003c/em\u003e complemented strains. The zebrafish infected with wild-type \u003cem\u003eM. marinum\u003c/em\u003e succumbed on the seventh day following infection, whereas those infected with Δ\u003cem\u003eMMAR_0267\u003c/em\u003e died much earlier, on the third day after the infection. Notably, all zebrafish in the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e infection group died 11 days earlier than those in the wild-type infection group (Fig.\u0026nbsp;6A). These results suggest that the deletion of \u003cem\u003eMMAR_0267\u003c/em\u003e can enhance the virulence of \u003cem\u003eM. marinum\u003c/em\u003e. Based on the longtitudinal survival counts, we infected zebrafish with the three strains and dissected all infected fish on the third day. The data demonstrated that zebrafish infected with Δ\u003cem\u003eMMAR_0267\u003c/em\u003e exhibited significantly more severe symptoms of congestion, bleeding, and ulcers compared to those infected with the WT and complemented strains (Fig.\u0026nbsp;6B). The CFU analysis of zebrafish tissues on the third day post-infection revealed that the bacterial load of Δ\u003cem\u003eMMAR_0267\u003c/em\u003e was significantly higher in the liver and skin (Fig.\u0026nbsp;6C). Histopathological examination of the infected tissues demonstrated that compared to the WT or complemented strains, zebrafish infected with the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e strain exhibited increased neutrophil infiltration and necrotic areas in the liver and skin (Fig.\u0026nbsp;6D). The results indicate that decreased copper utilization plays a role in facilitating \u003cem\u003eM. marinum\u003c/em\u003e's resistance to the host's innate immunity, thereby enhancing its intracellular growth and virulence during infection.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMMAR_0267\u003c/b\u003e \u003cb\u003edeficiency enables\u003c/b\u003e \u003cb\u003eM. marinum\u003c/b\u003e \u003cb\u003eto escape host immunity by dampening the macrophage STING-TBK1-IRF3 signaling\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eMMAR_0267\u003c/em\u003e deletion mutant revealed the capacity of \u003cem\u003eM. marinum\u003c/em\u003e to inhibit zebrafish macrophages apoptosis for promoting survival. In order to delve deeper into the underlying mechanism behind the heightened virulence of Δ\u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e towards zebrafish, we conducted a comprehensive analysis of the transcriptome and metabolome of infected zebrafish. GSEA (Gene Set Enrichment Analysis) analysis of the transcriptome revealed that the deletion of \u003cem\u003eMMAR_0267\u003c/em\u003e activated the zebrafish glycolysis / gluconeogenesis, RIG-I-like receptor signaling, mTOR signaling, and IgA immune signaling (Fig.\u0026nbsp;7A). Furthermore, transcriptome heat maps revealed varying degrees of differential gene expression associated with the mTOR signaling pathway (TBK1, IRF3, etc.) in zebrafish infected with Δ\u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e to varying degrees. Metabolome analysis also identified increased levels of mTOR signaling pathway-related metabolites (L-Arginine, L-Leucine, etc.) in the Δ\u003cem\u003eMMAR_0267\u003c/em\u003e infection group (Fig.\u0026nbsp;7B). Metabolomic analysis simultaneously revealed that infection with Δ\u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e resulted in an accumulation of alpha-ketoglutarate and a decrease in lactate levels in infected zebrafish, providing further evidence for the activation of the glycolysis and tricarboxylic acid (TCA) cycle (Supplementary Fig.\u0026nbsp;6). The results obtained from the omics analysis demonstrate the activation of mTOR signaling played a crucial role in this process, as (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) mTOR complex 1 (mTORC1) can enhance the mitochondrial energy metabolism of infected macrophages through glycolysis to protect them from mycobacteria-induced death \u003csup\u003e29,30\u003c/sup\u003e, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) the mTOR signaling is regulated by early secreted antigenic target 6 (ESAT6) upon Bacillus Calmette-Gu\u0026eacute;rin (BCG) vaccination \u003csup\u003e31\u003c/sup\u003e. Previous studies have demonstrated that the activation of TBK1 can inhibit the activity of mTORC1, leading to suppressed protein synthesis and enhanced autophagy \u003csup\u003e32\u003c/sup\u003e. The phosphorylation level of STING-TBK1-IRF3 has been shown to impact the activation of the mTOR signaling pathway. In line with this hypothesis, quantitative real-time PCR (qRT-PCR) analysis revealed a significant decrease in the mRNA levels of TBK1 and IRF3 in zebrafish infected with Δ\u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e (Fig.\u0026nbsp;7C), suggesting that the inhibition of apoptosis is occurring, thereby potentially enhancing the survival of the bacteria within infected macrophages. We observed a noteworthy reduction in phosphorylated TBK1 in THP-1 cells during early infection with Δ\u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e (Fig.\u0026nbsp;7D). This finding indicates that the STING-TBK1-IRF3 axis may directly modulate the mTOR signaling pathway. Activation of the STING-TBK1-IRF3 axis has been linked to the production of type I interferons (IFN-α/β) and promote cell apoptosis \u003csup\u003e33,34\u003c/sup\u003e. Our findings demonstrated a notable decrease in the levels of IFN-β in THP-1 cells infected with \u003cem\u003eMMAR_0267\u003c/em\u003e-deficient \u003cem\u003eM. marinum\u003c/em\u003e, and this reduction was further inhibited by C176 (a potent and covalent STING inhibitor), while IFN-α showed no significant changes (Fig.\u0026nbsp;7E). This suggested that Δ\u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e primarily enhances its virulence by suppressing the expression of host type I interferon IFN-β through inhibition of the STING-TBK1-IRF3 axis, possibly by modulating the phosphorylation of TBK1. Additionally, we have observed significant activation of the mTOR signaling pathway. Previous studies have shown that the secreted effectors of the \u003cem\u003eMtb\u003c/em\u003e ESAT-6 secretion system-1 (ESX-1) can regulate the mTOR signaling in infected cells. Hence, we aimed to elucidate which effector among the four secreted antigens (CFP-10, ESAT-6, MM1553, and Mh3881c) of Esx-1 substrates is involved in this process \u003csup\u003e35\u003c/sup\u003e. We observed a significant reduction in the expression of the CFP-10 antigen in \u003cem\u003eMMAR_0267\u003c/em\u003e-deficient \u003cem\u003eM. marinum\u003c/em\u003e under normal copper conditions (6.3 \u0026micro;mol/L), while this expression was increased when copper levels were elevated (63 \u0026micro;mol/L) (Fig.\u0026nbsp;7F). Indicating that the Esx-1 secretion system may be involved in the inhibition of the STING-TBK1-IRF3 axis. To further investigate this, a double knockout strain of \u003cem\u003eMSMEG_4702\u003c/em\u003e and CFP-10 was constructed and employed it for infecting THP-1 macrophages. Following treatment with 63\u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e, only the Δ\u003cem\u003eMSMEG_4702 M. marinum\u003c/em\u003e strain exhibited an increase in TBK1 phosphorylation, while the double knockout strain showed no effect on TBK1 phosphorylation (Supplementary Fig.\u0026nbsp;7). These findings imply that CFP-10 (Rv3874) may serve as the virulence factor responsible for activating the STING-TBK1-IRF3 axis.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eCopper is an essential trace metal in bacteria and serves as a cofactor for many enzymes, but it can be lethal at high concentrations. Multiple studies have shown that copper can rapidly and effectively kill various pathogenic bacteria, including \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, \u003cem\u003eClostridium difficile\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003eMycobacterium\u003c/em\u003e, \u003cem\u003eFaecalis\u003c/em\u003e, and \u003cem\u003eEnterococcus aureus\u003c/em\u003e \u003csup\u003e19\u003c/sup\u003e. In fact, high concentrations of copper were found in guinea pig granulomas during \u003cem\u003eMtb\u003c/em\u003e infection \u003csup\u003e36\u003c/sup\u003e. Subsequent investigations unveiled that mycobacterial phagosomes have the ability to accumulate high concentrations of copper during Mtb infection, which could serve as a potential defense mechanism against the pathogen \u003csup\u003e37\u003c/sup\u003e. In this study, we have identified a novel protein, MMAR_0267 (Homologous protein of Rv0102), that plays a crucial role in the utilization of copper ions in mycobacteria. While it has been previously discovered that the outer membrane pore protein family, \u003cem\u003eMsp\u003c/em\u003eA, \u003cem\u003eMsp\u003c/em\u003eB, and \u003cem\u003eMsp\u003c/em\u003eC, are involved in copper uptake in \u003cem\u003eM. smegmatis\u003c/em\u003e, the Msp family homologs are absent in \u003cem\u003eMtb\u003c/em\u003e \u003csup\u003e38\u003c/sup\u003e, and it remains unclear how copper enters \u003cem\u003eMtb\u003c/em\u003e cytoplasm.\u003c/p\u003e \u003cp\u003eSecondary structure analysis has revealed the presence of two significant domains in Rv0102 (Fig.\u0026nbsp;1E). The first domain is the CopD domain, which is responsible for the uptake of copper from the periplasm to the cytoplasm \u003csup\u003e39\u003c/sup\u003e. Despite the absence of the Cop family in \u003cem\u003eMtb\u003c/em\u003e, the presence of the functional CopD domain in Rv0102 implies its potential involvement in a similar role within mycobacteria. This hypothesis is substantiated by the observation that the Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e strain exhibited viability in culture medium containing 100 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e (Fig.\u0026nbsp;2D). Although the deletion of \u003cem\u003eMSMEG_4702\u003c/em\u003e did not entirely impede copper utilization by mycobacteria, the knockout strain displayed growth defects with the gradual increase in CuSO\u003csub\u003e4\u003c/sub\u003e concentration in the medium, presumably due to copper overload (Fig.\u0026nbsp;2). These results imply that the pathway for copper uptake in mycobacteria is not exclusive and that under conditions of abundant copper, non-specific uptake pathways may be activated. Additionally, a recent study has proposed the involvement of \u003cem\u003eMtb\u003c/em\u003e P-type ATPase CtpB in copper uptake \u003csup\u003e6\u003c/sup\u003e. The second domain in Rv0102 is the cytochrome Caa3 domain, which incorporates a Cu-binding center capable of binding CuA, CuI, and CuII in a mixed-valence state \u003csup\u003e40\u003c/sup\u003e. Bioinformatic analysis indicates that Rv0102 can both bind to copper and transport the bound copper to the cytoplasm. Moreover, the experimental data demonstrate a noticeable disparity in the intracellular copper ion content between WT and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e, even under identical growth conditions (Fig.\u0026nbsp;3A). This discrepancy can be attributed to the enhanced capability of the knockout strain to efficiently utilize copper at higher concentrations, thereby facilitating its growth. Conversely, the wild-type strain experienced growth inhibition due to heightened copper toxicity. These findings unveil a novel factor that governs the growth and development of \u003cem\u003eM. smegmatis\u003c/em\u003e, particularly highlighting the role of copper.\u003c/p\u003e \u003cp\u003eThe tolerance of Δ\u003cem\u003eMMAR_0267\u003c/em\u003e to high concentrations of copper may contribute to its survival within the macrophages phagosomes. Our findings revealed that the infection of Δ\u003cem\u003eMMAR_0267\u003c/em\u003e inhibited the apoptosis of THP-1 cells and enhanced its intracellular survival. The regulatory mechanisms of cell death encompass apoptosis, ferroptosis, necrosis, and the newly discovered cuproptosis \u003csup\u003e41\u003c/sup\u003e. Immunoblotting of various death-critical molecules indicated a decrease in the levels of P53 and Cas9, which are known to promote apoptosis (Fig.\u0026nbsp;5B). Additionally, in the natural host of \u003cem\u003eM. marinum\u003c/em\u003e, zebrafish, our observations revealed that zebrafish infected with the knockout strain exhibited a mortality rate four days earlier than those infected with the WT strain (Fig.\u0026nbsp;6A), and histological analysis of tissue sections exhibited more pronounced liver damage in the knockout group (Fig.\u0026nbsp;6D). CFP-10 associates with secreted proteins, including ESAT-6 and CAML (calcium-modulator and cyclophilin ligand), forming a complex on the host cell membrane, facilitating its entry of the bacterium into the host cell and triggers apoptosis and inflammatory responses, thereby exhibiting its virulence \u003csup\u003e42\u003c/sup\u003e. Our results indicate that copper ions may enhance the transcription of the CFP-10 virulence factor in \u003cem\u003eM. marinum\u003c/em\u003e. However, it remains unclear whether copper directly regulates cell apoptosis. The findings suggest that the two factors function independently. Notably, we observed no significant changes in the transcription levels of \u003cem\u003eMMAR_0267\u003c/em\u003e and \u003cem\u003eCtp\u003c/em\u003eB, two genes involved in copper utilization, when the copper concentration in the medium was increased. In contrast, the transcription of \u003cem\u003eCtp\u003c/em\u003eV, which is involved in copper efflux, was upregulated (Supplementary Fig.\u0026nbsp;8). These findings suggest that \u003cem\u003eM. marinum\u003c/em\u003e employs a strategy of increasing copper storage and efflux to counteract the toxicity of high copper levels within cells, rather than reducing copper uptake. It is worth noting that there exists a delicate balance between mycobacterial infection and the level of host cell apoptosis \u003csup\u003e43\u003c/sup\u003e. In the case of Δ\u003cem\u003eMMAR_0267\u003c/em\u003e infection, the phenomenon of bacterial inhibition of apoptosis may be further amplified due to its copper tolerance and enhanced survival.\u003c/p\u003e \u003cp\u003eThe discovery of MMAR_0267 as a copper transport protein provides valuable insights into the mechanisms underlying the acquisition and utilization of copper by \u003cem\u003eMtb\u003c/em\u003e. This finding, illustrated in Fig.\u0026nbsp;8, offers important information for enhancing our understanding of copper metabolism in \u003cem\u003eMtb\u003c/em\u003e. In conclusion, our findings indicate that the absence of \u003cem\u003eMMAR_026\u003c/em\u003e7 in \u003cem\u003eM. marinum\u003c/em\u003e triggers the activation of host glycolysis, mTOR signaling, and the suppression of apoptosis, ultimately enhancing bacterial survival within infected macrophages and increasing virulence in zebrafish. This study highlights the significance of comprehending the molecular mechanisms involved in bacterial pathogenesis and host immune responses, which can contribute to the development of novel and effective treatments.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eBacterial strains and culture conditions\u003c/h2\u003e \u003cp\u003e \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155, X674 and complemented strains were grown in Middlebrooks 7H9 medium supplemented with 0.05% Tween 80 and 0.2% glycerin. Solid medium is 7H10-Dubos oleic acid complex-glycerol agar. Selected antibiotics were used at indicated concentrations: kanamycin, 50 \u0026micro;g/mL; ampicillin, 100 \u0026micro;g/mL for \u003cem\u003eE. coli\u003c/em\u003e and 20 \u0026micro;g/mL for \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155; hygromycin, 100 \u0026micro;g/mL for \u003cem\u003eE. coli\u003c/em\u003e and 50 \u0026micro;g/mL for \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155 at 37\u0026deg;C with shaking. \u003cem\u003eM. marinum\u003c/em\u003e was cultured using the same antibiotic concentration but under constant temperature of 30\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConstruction and screening of\u003c/b\u003e \u003cb\u003eM. smegmatis\u003c/b\u003e \u003cb\u003emc\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e \u003cb\u003e155 Φ MycoMar insertion library\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe ΦMycoMarT7 transposon system was utilized to construct a transposon insertion mutant library of \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155 as previously described \u003csup\u003e44\u003c/sup\u003e. The ΦMycoMarT7 transposon system was used to create a transposon insertion mutant library of \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155. The donor strain was grown in Middlebrook7H9 broth with 10% OADC at 37\u0026deg;C until reaching an OD\u003csub\u003e600\u003c/sub\u003e of 0.6\u0026ndash;0.8. The phage carrying the transposon sequence was then transferred to the recipient strain at a 1:1 ratio by electroporation. Transposed cells were plated on Middlebrook7H10 agar with 10% OADC and 50 \u0026micro;g/mL kanamycin, and colonies were allowed to form at 37\u0026deg;C for 2\u0026ndash;3 days. For phage infection, \u003cem\u003eM. smegmatis\u003c/em\u003e cells in late-log phase were washed and suspended in Mycobacteriophage buffer before adding phages at a 10:1 ratio and incubating at 37\u0026deg;C for 4 hours. The bacteria were then plated on Middlebrook7H10 agar with 20 \u0026micro;g/mL kanamycin and incubated for 3\u0026ndash;4 days to obtain kanamycin-resistant colonies. These colonies were further plated on Middlebrook7H10 agar to create a library of 20,000 clones. Screening involved plating clones on Middlebrook7H10 agar with 20 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e to identify copper-tolerant strains. After screening, PCR sequencing and bioinformatics tools were used to analyze the identified genes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDefining the insertion-disrupted gene of Φ MycoMar.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe mutation library was screened in 7H9 containing 20 \u0026micro;mol/L CuSO\u003csub\u003e4\u003c/sub\u003e. Mutation was defined by plasmid rescue method. Axygene bacterial genome small extraction Kit was used to extract the bacterial genomic DNA; The total DNA was treated with \u003cem\u003eSac\u003c/em\u003eII and then self-ligated using T4 DNA ligase. The resulting ligation products were transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α λpir, and plasmid DNA was screened using kanamycin at a concentration of 50 \u0026micro;g/mL. Sequencing of the extracted plasmid was performed using the primer 5\u0026acute;-GCCTTCTTGACGAGTTCTTCTGAG-3\u0026acute;. The sequencing results were mapped to the \u003cem\u003eM. smegmatis\u003c/em\u003e mc\u003csup\u003e2\u003c/sup\u003e 155 genome in the NCBI database using BLAST. The transposon insertion site was confirmed by analyzing the sequences flanking the primers.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConstruction of the\u003c/b\u003e \u003cb\u003eM. smegmatis\u003c/b\u003e \u003cb\u003edeletion mutant in\u003c/b\u003e \u003cb\u003eMSMEG_4702\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe upstream and downstream homologous arm sequences of \u003cem\u003eMSMEG_4702\u003c/em\u003e gene were obtained by amplification of KOF1(5\u0026acute;- CCGATTGGGAGCAGCAGG \u0026minus;\u0026thinsp;3\u0026acute;), KOR1(5\u0026acute;- ATCACGCCGCTGACACCCCTACGCACGCACGTCAGAGGC \u0026minus;\u0026thinsp;3\u0026acute;), KOF2(5\u0026acute;- GCCTCTGACGTGCGTGCGTAGGGGTGTCAGCGGCGTGAT \u0026minus;\u0026thinsp;3\u0026acute;) and KOR2(5\u0026acute;- CGCGAAGACCATGCCGATC \u0026minus;\u0026thinsp;3\u0026acute;) primers from the genome of wild-type \u003cem\u003eM. smegmatis\u003c/em\u003e, respectively. By overlapping PCR, they were merged into a single fragment and ligated to pDM19-T, which was named pDM19-T-MS. Using \u003cem\u003eBgl\u003c/em\u003e II enzymes to cut dif - hyg - dif box from the plasmid pAL75, ligated by the same enzyme used pDM19 - T - MS building to get the pDM19 - T - MS - hyg, \u003cem\u003eBam\u003c/em\u003eH I and \u003cem\u003eSpe\u003c/em\u003e I enzymes were used, the recombinant fragments were amplified and transformed into the \u003cem\u003eM. smegmatis\u003c/em\u003e competent cell with pJV53 plasmid by electrotransformation, then spread on the 7H10 plate with Kan and hyg to screen the deletion mutant, and then cultured in the absence of antibiotics 7H9 medium and transferred five generations to allow the loss of Hyg box and pJV53 plasmid. The \u003cem\u003eMMAR_0267\u003c/em\u003e gene of \u003cem\u003eM. marinum\u003c/em\u003e was knocked out by using the same method, with the primer sequence as follows: KOF1(5\u0026acute;- GCCCAAGCTTACATGACCGCCCAAA \u0026minus;\u0026thinsp;3\u0026acute;), KOR1(5\u0026acute;- AGATCTCCCTCGAGCTTACGACTGGATGTCG \u0026minus;\u0026thinsp;3\u0026acute;), KOF2(5\u0026acute;- CCAGTCGTAAGCTCGAGGGAGATCTAGGCGGGGACGGATCGCTAGCCGAC \u0026minus;\u0026thinsp;3\u0026acute;) and KOR2(5\u0026acute;- TGGACGGTGAGGTCTTTGACGCTGT \u0026minus;\u0026thinsp;3\u0026acute;).\u003c/p\u003e \u003cp\u003e \u003cb\u003eComplementation with\u003c/b\u003e \u003cb\u003eMtb Rv0102\u003c/b\u003e \u003cb\u003egene and Western blot\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eMtb Rv0102\u003c/em\u003e gene was amplified by PCR from \u003cem\u003eMtb\u003c/em\u003e H37Rv genome using the forward primer 5\u0026acute;- CGGGATCCATGGGGACGCACGG \u0026minus;\u0026thinsp;3\u0026acute;and reverse primer 5\u0026acute;- CCATCGATTCAGCGCCGCATTCGCG \u0026minus;\u0026thinsp;3\u0026acute;, digested using \u003cem\u003eNde\u003c/em\u003eI and \u003cem\u003eCla\u003c/em\u003eI restriction enzymes and ligated with pALACE plasmid (A \u003cem\u003eMycobacterium\u003c/em\u003e expression test plasmid as a gift from Professor Yossef Av-Gay, University of British Columbia, hygromycin resistance). Desired \u003cem\u003eE. coli\u003c/em\u003e clones were screened on solid LB medium containing hygromycin. The recombinant plasmid was then transformed into mycobacterial cells by electroporation, empty pALACE plasmid subjected to the same procedure was used as a negative control. All transformants were selected by hygromycin (50 \u0026micro;g/mL) on Middlebrook 7H10 agar. Supplemented \u003cem\u003eM. smegmatis\u003c/em\u003e strains were cultured in 50 mL Middlebrook 7H9 liquid medium to an OD\u003csub\u003e600\u003c/sub\u003e of 0.8-1.0 in the presence of 50 \u0026micro;g /mL hygromycin. Bacteria were washed (three times) with ice-cold 1\u0026times;PBS, and then suspended in the same buffer. Sonication was used to lyse cells.100 \u0026micro;L total cell lysates were resolved on 12% SDS-PAGE, followed by Western blot analysis. Specific anti-Myc monoclonal antibody (TIANGEN, China) was detected with IgG-HRP, an anti-mouse IgG monoclonal antibody labeled with horseradish peroxidase (TIANGEN, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGrowth curves\u003c/h2\u003e \u003cp\u003eGrowth curves for wild type and mutant \u003cem\u003eM. smegmatis\u003c/em\u003e strains were assessed by spectrophotometry (UV-VIS spectrophotometer, Varian Cary 50). Briefly, overnight-cultured bacteria were diluted with liquid 7H9 to an optical density of 0.8. 1% inoculum was then transferred into a fresh liquid 7H9 without or with CuSO\u003csub\u003e4\u003c/sub\u003e of different concentrations. Samples were incubated at 37\u0026deg;C at110 rpm/min. Optical density was determined every 4 hours for consecutive 60 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of copper accumulation\u003c/h2\u003e \u003cp\u003eThe Cuprizone microplate method is used to quantify the copper content in \u003cem\u003eM. smegmatis\u003c/em\u003e. Cuprizone, a copper chelating agent, forms a blue copper ketone complex with Cu ions. Its unique structure gives it high affinity and selectivity with Cu ions, showing specificity in its reaction. Pre-cultured strains of WT, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e, and Δ\u003cem\u003eMSMEG_4702::Rv0102\u003c/em\u003e were inoculated into 7H9 medium with varying Cu ion concentrations (0, 6.3, 25.2, 37.8, and 63 \u0026micro;mol/L) by adding CuSO\u003csub\u003e4\u003c/sub\u003e. Each strain was incubated in triplicate in shaking flasks at 37\u0026deg;C for 3 days. After centrifugation at 12,000\u0026times;g, 4\u0026deg;C for 10 minutes, pellets were washed with metal-ion-free PBS. OD at 600 nm was adjusted to 1.0 using ddH\u003csub\u003e2\u003c/sub\u003eO. Samples underwent sonication, lysis buffer addition, and centrifugation at 4\u0026deg;C, 12,000\u0026times;g for 10 minutes. The supernatant was used for copper content determination with the Cell Copper (Cu) Colorimetric Assay Kit. Refer to the instructions provided for specific procedure steps.\u003c/p\u003e \u003cp\u003eFor the heat-killed control group, pre-cultured strains were washed with metal-ion-free PBS and suspended in sterile deionized water. Bacterial suspension was heat treated at 100\u0026deg;C for 20 minutes. After treatment, CuSO\u003csub\u003e4\u003c/sub\u003e solution was added to achieve copper ion concentrations of 0, 6.3, 25.2, 37.8, and 63 \u0026micro;mol/L. The mixture was incubated at 37\u0026deg;C for 1 hour and then washed with metal-ion-free PBS. OD\u003csub\u003e600\u003c/sub\u003e was adjusted to 1.0, followed by sonication and copper ion quantification using the Cell Copper (Cu) Colorimetric Assay Kit. Accumulated copper was determined by subtracting copper ions adsorbed in the heat-killed group from the total copper ions in the culture.\u003c/p\u003e \u003cp\u003eThe detection method for zinc ions is similar to that of copper ions, but it employs the 5-Br-PADAP microplate method for determining zinc ion concentration. In this method, zinc ions in the sample form a colored complex with the 5-Br-PADAP reagent, and the intensity of the color is proportional to the concentration of zinc ions. All \u003cem\u003eM. smegmatis\u003c/em\u003e strains were cultured using the same previously described method, but with different final concentrations of zinc ions (adding ZnSO\u003csub\u003e4\u003c/sub\u003e): 0, 5, 10, 20, and 40 \u0026micro;mol/L. After incubating the bacteria, both the cultures and heat-killed cells were collected and subjected to ultrasonic treatment for cell lysis. The zinc content in the bacteria was then determined using the Zinc (Zn) Colorimetric Assay Kit.\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eAntibiotic susceptibility assays\u003c/h2\u003e \u003cp\u003eFor antibiotic susceptibility assays, \u003cem\u003eM. smegmatis\u003c/em\u003e wild-type and mutant strains were grown to an OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.8. The susceptibility to antibiotics was determined by spotting a 10-fold serially diluted samples on Middlebrook 7H10 (Difco) plates containing 0.05\u0026micro;g/mL moxifloxacin. All experiments were repeated at least three times.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and real-time quantitative TaqMan PCR assay\u003c/h2\u003e \u003cp\u003eA 50 mL bacterial culture with OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.3 was diluted (1:100) into 7H9 media. The strains were cultured until OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.8, then split into untreated (control) and treated groups. Cells in the treated group were exposed to 0.05\u0026micro;g/mL moxifloxacin for 30 minutes, followed by centrifugation at 12,000 x g. Bacterial pellets were suspended in TRIzol (Invitrogen, USA) for RNA extraction and purification per the manufacturer's instructions. cDNA was synthesized using the Superscript III First-Strand Synthesis System kit (Invitrogen, USA). Quantitative real-time reverse transcription-PCR was conducted with cDNA from 50 ng RNA using an SYBR Green Supermix kit (Applied Biosystems) to assess gene expression. Expression levels were normalized to sigA as the control, and the relative expression means were averaged over three replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eLocalization of the Rv0102 protein\u003c/h2\u003e \u003cp\u003e \u003cem\u003eM. smegmatis\u003c/em\u003e recombinant strains harboring the \u003cem\u003eRv0102\u003c/em\u003e- pALACE-myc and pALACE-myc empty vector were grown as previously described. The cells were lysed by sonication. Cell debris and intact cells were removed by centrifugation (3000\u0026times;\u003cem\u003eg\u003c/em\u003e) for 5 min, and the supernatant was centrifuged (27,000\u0026times;\u003cem\u003eg\u003c/em\u003e) for 30 min at 4\u0026deg;C. The pellet contained cell wall, whereas the supernatant represented the cell membrane and cytosol fractions. The pellet and supernatant were used to detect the recombinant protein and GroEL2 (cytoplasmic protein control) by Western blotting with anti-Myc antibody and anti-His antibody.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro infection with recombinant\u003c/b\u003e \u003cb\u003eM. marinum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTHP-1 cells were cultured in RPMI 1640 medium (Invitrogen) supplemented with 10% (v/v) heat-inactivated FBS, 2 mM L-glutamine, 100 \u0026micro;g/mL streptomycin, and 100 U/mL penicillin (Invitrogen) at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were seeded at 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well in 6-well plates and differentiated with 100 ng/mL PMA. After differentiation, cells were infected with WT, Δ\u003cem\u003eMMAR_0267\u003c/em\u003e and Δ\u003cem\u003eMMAR_0267\u003c/em\u003e:: \u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e at an MOI of 10. Four hours post-infection, cells were washed with PBS, and gentamicin (100 \u0026micro;g/mL) was used to eliminate extracellular bacteria. For LDH activity assay, culture supernatants were collected at 6, 24, 48, and 72 h post-infection and analyzed using a commercially available LDH cytotoxicity kit (Takara Bio). For intracellular bacterial survival, THP-1 cells were infected with the aforementioned strains for 6, 24, 48, and 72 h at 37\u0026deg;C. Infected cells were washed three times with PBS, lysed in 1 mL of 0.025% SDS, diluted, and plated on 7H10 agar plates with 10% glycerol. After 3 days of incubation, colony-forming units were counted to calculate the survival rate compared to the control.\u003c/p\u003e \u003cp\u003e \u003cb\u003eZebrafish infection with\u003c/b\u003e \u003cb\u003eM. marinum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWT, Δ\u003cem\u003eMMAR_0267\u003c/em\u003e and Δ\u003cem\u003eMMAR_0267\u003c/em\u003e:: \u003cem\u003eMMAR_0267 M. marinum\u003c/em\u003e were grown on 7H10 plates, a single colony was picked for culture in liquid medium at 30\u0026deg;C until the OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.5. Healthy adult zebrafish was selected from a population and acclimated them in fresh water for 24 hours before grouping. The \u003cem\u003eM. marinum\u003c/em\u003e culture was centrifuged to remove the supernatant, the bacteria were washed with PBS three times, and diluted the bacterial suspension to 10^8 CFU/mL. The zebrafish was placed into a new dish, 10\u0026micro;L bacterial suspension was injected into the zebrafish abdomen. After infection, the zebrafish was placed to the acclimation water. At different time points after infection, the fish was recorded for signs of illness and death. Simultaneously, the bacteria were isolated from dead fish to determine the species and count the bacterial load.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome and metabolome of zebrafish\u003c/h2\u003e \u003cp\u003eOn the third day of infection, the zebrafish were euthanized and liver tissues were extracted and immediately frozen in liquid nitrogen. These frozen samples were then sent to APTBIO, a company in Shanghai, China for transcriptome and metabolome analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFlow cytometry analysis of\u003c/b\u003e \u003cb\u003eM. smegmatis\u003c/b\u003e \u003cb\u003einduced macrophage apoptosis\u003c/b\u003e\u003c/p\u003e \u003cp\u003e2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e THP-1 cells were infected with WT_\u003cem\u003eMs\u003c/em\u003e, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e::\u003cem\u003eRv0102\u003c/em\u003e for 6 h and 48 h. The infected cells were washed with ice-cold PBS and the apoptotic cells were determined by Annexin V-FITC and propidium iodide (PI) according to the manufacturer\u0026rsquo;s instructions (Beibo, Shanghai, China). This product detects the externalization of phosphatidylserine in apoptotic cells using recombinant annexin V conjugated to green-fluorescent FITC dye and dead cells using propidium iodide (PI). The cells were subjected to fluorescence microscopy analysis and flow cytometry. Untreated cells were taken as negative control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRT-PCR and Assay for cytokines\u003c/h2\u003e \u003cp\u003ePMA-differentiated THP-1 cells were infected with WT_\u003cem\u003eMs\u003c/em\u003e, Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e and Δ\u003cem\u003eMSMEG_4702\u003c/em\u003e::\u003cem\u003eRv0102\u003c/em\u003e at an MOI of 10. After 6, 24 and 48 h infection, total cellular RNA was extracted from cells was extracted from the infected cells using RNA extraction kit (TIANGEN) according to the manufacturer\u0026rsquo;s recommendations. cDNA synthesis was performed using the PrimeScript RT reagent kit (Takara, Shiga, Japan). Quantitative real-time RT-PCR reactions were performed using a CFX96 RT-PCR Detection System (Bio-Rad) using SYBR Green Master Mix. Relative mRNA levels were calculated after normalizing to β-actin. Culture supernatants were collected from the infected macrophages, the cytokines production was detected with commercialy available ELISA kits for TNF-α, IL-10, IL-1β, IL-12, IL-6 and IL-8 (eBioscience).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData were expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM of at least three independent experiments. Statistical analysis was performed using GraphPad Prism 8.0. The results from RT-PCR, and CFU assays were analyzed by Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test. Differences were considered statistically significant with *\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eData accessibility\u003c/h2\u003e \u003cp\u003eThe data supporting the results of this study are publicly available. Transcriptomic data of zebrafish have been deposited in the GEO database under the accession number GSE235754. Interested researchers can access and download the data from the GEO database. Additionally, the metabolomics dataset has been assigned the accession number MTBLS8036 and can be accessed and downloaded from the respective repository.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNADH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNicotinamide adenine dinucleotide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNCBI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enational center for biotechnology information\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ephosphate buffer saline\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLDH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elactate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTHP-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehuman myeloid leukemia mononuclear cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTSB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTryptic soy broth\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePMA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhorbol-12-myristate-13-acetate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMOI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emultiplicity of infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSodium dodecyl sulfate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLPS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLipopolysaccharide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePAGE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epolyacrylamide gelelectrophoresis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCFU\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eColony-Forming Units\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLMP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elysosomal membrane permeability\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMehdiratta, K., et al.: Kupyaphores are zinc homeostatic metallophores required for colonization of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U S A. \u003cb\u003e119\u003c/b\u003e (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.2110293119\u003c/span\u003e\u003cspan address=\"10.1073/pnas.2110293119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKunkle, D.E., Skaar, E.P.: Moving metals: How microbes deliver metal cofactors to metalloproteins. Mol. Microbiol. \u003cb\u003e120\u003c/b\u003e, 547\u0026ndash;554 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/mmi.15117\u003c/span\u003e\u003cspan address=\"10.1111/mmi.15117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamanovic, M.I., Ding, C., Thiele, D.J., Darwin, K.H.: Copper in microbial pathogenesis: meddling with the metal. Cell. Host Microbe. \u003cb\u003e11\u003c/b\u003e, 106\u0026ndash;115 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chom.2012.01.009\u003c/span\u003e\u003cspan address=\"10.1016/j.chom.2012.01.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBagcchi, S., WHO's Global Tuberculosis Report: \u003cem\u003eLancet Microbe\u003c/em\u003e 4, e20, (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S2666-5247(22)00359-7\u003c/span\u003e\u003cspan address=\"10.1016/S2666-5247(22)00359-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSerafini, A.: Interplay between central carbon metabolism and metal homeostasis in mycobacteria and other human pathogens. Microbiol. (Reading). 167 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/mic.0.001060\u003c/span\u003e\u003cspan address=\"10.1099/mic.0.001060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShey-Njila, O., et al.: CtpB Facilitates Mycobacterium tuberculosis Growth in Copper-Limited Niches. Int. J. Mol. Sci. \u003cb\u003e23\u003c/b\u003e (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23105713\u003c/span\u003e\u003cspan address=\"10.3390/ijms23105713\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOikawa, S., Kawanishi, S.: Site-specific DNA damage induced by NADH in the presence of copper(II): role of active oxygen species. Biochemistry. \u003cb\u003e35\u003c/b\u003e, 4584\u0026ndash;4590 (1996). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/bi9527000\u003c/span\u003e\u003cspan address=\"10.1021/bi9527000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTejeda, C., et al.: Experimental evidence of the anti-bacterial activity pathway of copper ion treatment on Mycobacterium avium subsp. paratuberculosis. Braz J. Microbiol. \u003cb\u003e54\u003c/b\u003e, 407\u0026ndash;413 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s42770-022-00897-w\u003c/span\u003e\u003cspan address=\"10.1007/s42770-022-00897-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoku, R.T., Park, G., Wheeler, K.E., Splan, K.E.: Spectroscopic characterization of copper(I) binding to apo and metal-reconstituted zinc finger peptides. J. Biol. Inorg. Chem. \u003cb\u003e18\u003c/b\u003e, 669\u0026ndash;678 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00775-013-1012-6\u003c/span\u003e\u003cspan address=\"10.1007/s00775-013-1012-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiachino, A., Waldron, K.J.: Copper tolerance in bacteria requires the activation of multiple accessory pathways. Mol. Microbiol. \u003cb\u003e114\u003c/b\u003e, 377\u0026ndash;390 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/mmi.14522\u003c/span\u003e\u003cspan address=\"10.1111/mmi.14522\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeyrolles, O., Wolschendorf, F., Mitra, A., Niederweis, M.: Mycobacteria, metals, and the macrophage. Immunol. Rev. \u003cb\u003e264\u003c/b\u003e, 249\u0026ndash;263 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/imr.12265\u003c/span\u003e\u003cspan address=\"10.1111/imr.12265\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEkici, S., et al.: Intracytoplasmic copper homeostasis controls cytochrome c oxidase production. \u003cem\u003emBio\u003c/em\u003e 5, e01055-01013, (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mBio.01055-13\u003c/span\u003e\u003cspan address=\"10.1128/mBio.01055-13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro, C.A., von Bernath, D., Martinez-Bussenius, C., Castillo, R.A., Jerez, C.A.: Cytoplasmic CopZ-Like Protein and Periplasmic Rusticyanin and AcoP Proteins as Possible Copper Resistance Determinants in Acidithiobacillus ferrooxidans ATCC 23270. Appl. Environ. Microb. \u003cb\u003e82\u003c/b\u003e, 1015\u0026ndash;1022 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/Aem.02810-15\u003c/span\u003e\u003cspan address=\"10.1128/Aem.02810-15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeon-Torres, A., Novoa-Aponte, L., Soto, C.Y.: CtpA, a putative Mycobacterium tuberculosis P-type ATPase, is stimulated by copper (I) in the mycobacterial plasma membrane. Biometals. \u003cb\u003e28\u003c/b\u003e, 713\u0026ndash;724 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10534-015-9860-x\u003c/span\u003e\u003cspan address=\"10.1007/s10534-015-9860-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarcus, S.A., Sidiropoulos, S.W., Steinberg, H., Talaat, A.M.: CsoR Is Essential for Maintaining Copper Homeostasis in Mycobacterium tuberculosis. PLoS One. \u003cb\u003e11\u003c/b\u003e, e0151816 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0151816\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0151816\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIgbaria-Jaber, Y., Hofmann, L., Gevorkyan-Airapetov, L., Shenberger, Y., Ruthstein, S.: Revealing the DNA Binding Modes of CsoR by EPR Spectroscopy. ACS Omega. \u003cb\u003e8\u003c/b\u003e, 39886\u0026ndash;39895 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsomega.3c06336\u003c/span\u003e\u003cspan address=\"10.1021/acsomega.3c06336\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurner, A.G., Ong, C.Y., Walker, M.J., Djoko, K.Y., McEwan, A.G.: Transition Metal Homeostasis in Streptococcus pyogenes and Streptococcus pneumoniae. Adv. Microb. Physiol. \u003cb\u003e70\u003c/b\u003e, 123\u0026ndash;191 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/bs.ampbs.2017.01.002\u003c/span\u003e\u003cspan address=\"10.1016/bs.ampbs.2017.01.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiachino, A., Waldron, K.J.: Copper tolerance in bacteria requires the activation of multiple accessory pathways. Mol. Microbiol. \u003cb\u003e114\u003c/b\u003e, 377\u0026ndash;390 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/mmi.14522\u003c/span\u003e\u003cspan address=\"10.1111/mmi.14522\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu, Y., Chang, F.M.J., Giedroc, D.P.: Copper Transport and Trafficking at the Host Bacterial Pathogen Interface. Acc. Chem. Res. \u003cb\u003e47\u003c/b\u003e, 3605\u0026ndash;3613 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/ar500300n\u003c/span\u003e\u003cspan address=\"10.1021/ar500300n\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLomize, M.A., Pogozheva, I.D., Joo, H., Mosberg, H.I., Lomize, A.L.: OPM database and PPM web server: resources for positioning of proteins in membranes. Nucleic Acids Res. \u003cb\u003e40\u003c/b\u003e, D370\u0026ndash;376 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkr703\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkr703\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNandi, S.K., et al.: Evidences for zinc (II) and copper (II) ion interactions with Mycobacterium leprae HSP18: Effect on its structure and chaperone function. J. Inorg. Biochem. \u003cb\u003e188\u003c/b\u003e, 62\u0026ndash;75 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jinorgbio.2018.08.010\u003c/span\u003e\u003cspan address=\"10.1016/j.jinorgbio.2018.08.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuistgaard, E.M., Low, C., Guettou, F., Nordlund, P.: Understanding transport by the major facilitator superfamily (MFS): structures pave the way. Nat. Rev. Mol. Cell. Bio. \u003cb\u003e17\u003c/b\u003e, 123\u0026ndash;132 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrm.2015.25\u003c/span\u003e\u003cspan address=\"10.1038/nrm.2015.25\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhalfaoui-Hassani, B., et al.: Widespread Distribution and Functional Specificity of the Copper Importer CcoA: Distinct Cu Uptake Routes for Bacterial Cytochrome c Oxidases. \u003cem\u003emBio\u003c/em\u003e 9, (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mBio.00065-18\u003c/span\u003e\u003cspan address=\"10.1128/mBio.00065-18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolschendorf, F., et al.: Copper resistance is essential for virulence of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U S A. \u003cb\u003e108\u003c/b\u003e, 1621\u0026ndash;1626 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1009261108\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1009261108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalle, J.N., Fechtner, T., Eierhoff, T., Romer, W., Hegemann, J.H.: A Chlamydia pneumoniae adhesin induces phosphatidylserine exposure on host cells. Nat. Commun. \u003cb\u003e10\u003c/b\u003e, 4644 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-019-12419-8\u003c/span\u003e\u003cspan address=\"10.1038/s41467-019-12419-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChow, S.H., Deo, P., Naderer, T.: Macrophage cell death in microbial infections. Cell. Microbiol. \u003cb\u003e18\u003c/b\u003e, 466\u0026ndash;474 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cmi.12573\u003c/span\u003e\u003cspan address=\"10.1111/cmi.12573\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan, H., et al.: gene mediates innate immunity to tuberculosis. Nature. \u003cb\u003e434\u003c/b\u003e, 767\u0026ndash;772 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature03419\u003c/span\u003e\u003cspan address=\"10.1038/nature03419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDivangahi, M., et al.: evades macrophage defenses by inhibiting plasma membrane repair. Nat. Immunol. \u003cb\u003e10\u003c/b\u003e, 899\u0026ndash;U123 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ni.1758\u003c/span\u003e\u003cspan address=\"10.1038/ni.1758\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagan, A.J., et al.: mTOR-regulated mitochondrial metabolism limits mycobacterium-induced cytotoxicity. \u003cem\u003eCell\u003c/em\u003e 185, 3720\u0026ndash;3738 e3713, (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2022.08.018\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2022.08.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollins, S.L., et al.: mTORC1 Signaling Regulates Proinflammatory Macrophage Function and Metabolism. J. Immunol. \u003cb\u003e207\u003c/b\u003e, 913\u0026ndash;922 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.2100230\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.2100230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, H., et al.: ESAT6 inhibits autophagy flux and promotes BCG proliferation through MTOR. Biochem. Biophys. Res. Commun. \u003cb\u003e477\u003c/b\u003e, 195\u0026ndash;201 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2016.06.042\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2016.06.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasan, M., et al.: Chronic innate immune activation of TBK1 suppresses mTORC1 activity and dysregulates cellular metabolism. Proc. Natl. Acad. Sci. U S A. \u003cb\u003e114\u003c/b\u003e, 746\u0026ndash;751 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1611113114\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1611113114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParker, D., et al.: Streptococcus pneumoniae DNA initiates type I interferon signaling in the respiratory tract. \u003cem\u003emBio\u003c/em\u003e 2, e00016-00011, (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mBio.00016-11\u003c/span\u003e\u003cspan address=\"10.1128/mBio.00016-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSekheri, M., Rizo-Tellez, S.A., Othman, A., El Kebir, D., Filep, J.G.: Interferon-beta regulates proresolving lipids to promote the resolution of acute airway inflammation. Proc. Natl. Acad. Sci. U S A. \u003cb\u003e119\u003c/b\u003e, e2201146119 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.2201146119\u003c/span\u003e\u003cspan address=\"10.1073/pnas.2201146119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, J., et al.: A unique Mycobacterium ESX-1 protein co-secretes with CFP-10/ESAT-6 and is necessary for inhibiting phagosome maturation. Mol. Microbiol. \u003cb\u003e66\u003c/b\u003e, 787\u0026ndash;800 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-2958.2007.05959.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2958.2007.05959.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolschendorf, F., et al.: Copper resistance is essential for virulence of Mycobacterium tuberculosis. P Natl. Acad. Sci. USA. \u003cb\u003e108\u003c/b\u003e, 1621\u0026ndash;1626 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1009261108\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1009261108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWagner, D., et al.: Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell's endosomal system. J. Immunol. \u003cb\u003e174\u003c/b\u003e, 1491\u0026ndash;1500 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.174.3.1491\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.174.3.1491\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpeer, A., Rowland, J.L., Haeili, M., Niederweis, M., Wolschendorf, F.: Porins Increase Copper Susceptibility of Mycobacterium tuberculosis. J. Bacteriol. \u003cb\u003e195\u003c/b\u003e, 5133\u0026ndash;5140 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/Jb.00763-13\u003c/span\u003e\u003cspan address=\"10.1128/Jb.00763-13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLawton, T.J., Kenney, G.E., Hurley, J.D., Rosenzweig, A.C.: The CopC Family: Structural and Bioinformatic Insights into a Diverse Group of Periplasmic Copper Binding Proteins. Biochemistry. \u003cb\u003e55\u003c/b\u003e, 2278\u0026ndash;2290 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.biochem.6b00175\u003c/span\u003e\u003cspan address=\"10.1021/acs.biochem.6b00175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta, D.D., et al.: Identification of a copper ion recognition peptide sequence in the subunit II of cytochrome c oxidase: a combined theoretical and experimental study. J. Biol. Inorg. Chem. \u003cb\u003e26\u003c/b\u003e, 411\u0026ndash;425 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00775-021-01867-7\u003c/span\u003e\u003cspan address=\"10.1007/s00775-021-01867-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsvetkov, P., et al.: Copper induces cell death by targeting lipoylated TCA cycle proteins. Science. \u003cb\u003e375\u003c/b\u003e, 1254\u0026ndash;1261 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.abf0529\u003c/span\u003e\u003cspan address=\"10.1126/science.abf0529\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRojas-Espinosa, O., et al.: A neutrophil-based test as an auxiliary tool for substantiating the diagnosis of bovine tuberculosis. Int. J. Mycobacteriol. \u003cb\u003e11\u003c/b\u003e, 190\u0026ndash;198 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/ijmy.ijmy_71_22\u003c/span\u003e\u003cspan address=\"10.4103/ijmy.ijmy_71_22\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDubey, R.K.: Assuming the role of mitochondria in mycobacterial infection. Int. J. Mycobacteriol. \u003cb\u003e5\u003c/b\u003e, 379\u0026ndash;383 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijmyco.2016.06.001\u003c/span\u003e\u003cspan address=\"10.1016/j.ijmyco.2016.06.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurry, J.P., Sassetti, C.M., Lane, J.M., Xie, Z., Rubin, E.J.: Transposon site hybridization in Mycobacterium tuberculosis. Methods Mol. Biol. \u003cb\u003e416\u003c/b\u003e, 45\u0026ndash;59 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-1-59745-321-9_4\u003c/span\u003e\u003cspan address=\"10.1007/978-1-59745-321-9_4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Mycobacterium tuberculosis, Rv0102, copper homeostasis, apoptosis, cuproptosis ","lastPublishedDoi":"10.21203/rs.3.rs-4080994/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4080994/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe host limits \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMtb\u003c/em\u003e) by restricting copper access. This research investigates how \u003cem\u003eMtb\u003c/em\u003e escapes copper stress. The membrane protein encoded by \u003cem\u003eMtb Rv0102\u003c/em\u003e, when its homolog in \u003cem\u003eM. smegmatis\u003c/em\u003e (\u003cem\u003eMSMEG_4702\u003c/em\u003e) was knocked out, resulted in a fourfold decrease in intracellular copper levels and enhanced tolerance to elevated extracellular copper concentrations. Similarly, knockout mutants of its homolog in \u003cem\u003eM. marinum\u003c/em\u003e (\u003cem\u003eMMAR_0267\u003c/em\u003e) showed increased virulence in zebrafish and higher bacterial load within macrophages. In THP-1 cells infected with \u003cem\u003eMMAR_0267\u003c/em\u003e deletion mutants, the intracellular survival of the mutants increased, accompanied by reduced THP-1 apoptosis. Cu deficiency down-regulated the transcriptional level of the \u003cem\u003eM. marinum\u003c/em\u003e virulence factor CFP-10, dampened macrophage STING cytosolic signaling, resulting in decreased IFN-β production and cell apoptosis. In conclusion, these findings highlight the significant impact of copper on the survival and reproduction of mycobacteria, underscoring the importance of studying mycobacterial adaptation mechanisms in copper-rich environments.\u003c/p\u003e","manuscriptTitle":"Mycobacterium marinum MMAR_0267-regulated copper utilization facilitates bacterial escape from phagolysosome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-21 07:53:11","doi":"10.21203/rs.3.rs-4080994/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"communications-biology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"commsbio","sideBox":"Learn more about [Communications Biology](http://www.nature.com/commsbio/)","snPcode":"","submissionUrl":"","title":"Communications Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Communications Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9ee4e50a-403c-4d6a-8dfe-f83c953cf830","owner":[],"postedDate":"March 21st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":29616691,"name":"Biological sciences/Microbiology/Pathogens"},{"id":29616692,"name":"Biological sciences/Chemical biology/Transporters"}],"tags":[],"updatedAt":"2024-09-20T07:06:36+00:00","versionOfRecord":{"articleIdentity":"rs-4080994","link":"https://doi.org/10.1038/s42003-024-06860-9","journal":{"identity":"communications-biology","isVorOnly":false,"title":"Communications Biology"},"publishedOn":"2024-09-19 04:00:00","publishedOnDateReadable":"September 19th, 2024"},"versionCreatedAt":"2024-03-21 07:53:11","video":"","vorDoi":"10.1038/s42003-024-06860-9","vorDoiUrl":"https://doi.org/10.1038/s42003-024-06860-9","workflowStages":[]},"version":"v1","identity":"rs-4080994","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4080994","identity":"rs-4080994","version":["v1"]},"buildId":"pf3fE39SIOqb-0xH_OWvX","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}