SENP3 promotes renal tubular epithelial cell apoptosis after ischemia-reperfusion injury via ASS1 deSUMOylation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article SENP3 promotes renal tubular epithelial cell apoptosis after ischemia-reperfusion injury via ASS1 deSUMOylation Yi Yang, Wang Hongju, Gao Cui, Lini Jin, Longlong Wu, Qian Zhang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6609361/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Dec, 2025 Read the published version in Cell Death & Disease → Version 1 posted You are reading this latest preprint version Abstract The balance between SUMOylation and deSUMOylation critically regulate cellular apoptosis, with SUMO-modified proteins implicated in ischemia/hypoxia injury. However, the specific contributions of SUMO-conjugated proteins in renal ischemia-reperfusion injury (IRI) remain poorly defined. SUMOylation in IRI was investigated Using proximal tubular-specific Senp3 conditional knockout (CKO) mice. While SENP3-deficiency did not induce tubular injury under basal conditions, its significantly attenuated renal damage following IRI. SUMOylation conferred protection against apoptosis in renal tubular epithelia cells during ischemia/hypoxia. Mass spectrometry revealed arginosuccinate synthase 1 (ASS1) as a key SUMO2/3 target (modified at K239 and K310) in IRI progression. Mechanistically, SENP3-mediated deSUMOylation promoted ASS1 nuclear accumulation in post-IRI tubular epithelial cells, subsequently activating the intrinsic apoptosis pathway via p53-dependent transcriptional upregulation. These findings nominate the SENP3-ASS1-p53 axis as a potential therapeutic target for renal IRI. Health sciences/Diseases/Kidney diseases Biological sciences/Molecular biology SUMOylation ischemia-reperfusion injury ASS1 apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction SUMOylation, a reversible post-translation modification, entails the covalent conjugation of small ubiquitin-like modifier (SUMO) proteins to lysine residues on target proteins. This process is dynamically regulated by SUMO-specific proteases (SENPs) [ 1 ] . Among SENPs, SENP3 localizes predominantly to the nuclear and selectively regulates both SUMO2/3 maturation and deconjugation. Notably, SENP3 exhibits redox-sensitive, oxidative stress triggers its redistribution from nucleoli to the nucleoplasm by inhibiting degradation [ 2 – 4 ] . SUMOylation primarily modulates nuclear process, including gene expression, genome stability, RNA processing, nucleocytoplasmic transport and cell cycle progression [ 5 ] . The equilibrium between SUMOylation and deSUMOylation critically influences cell fate, with outcomes contingent on disease context, SUMO isoforms specificity, substrate identity, and cell type. Apoptosis, among other cell death modalities, has been extensively linked to SUMOylation [ 6 , 7 ] . As evolutionarily conserved regulators essential for eukaryotic cell viability, SUMO family members are frequently dysregulated in human diseases. SUMOylation can alter target protein activity, stability or subcellular localization, often by modifying interactions with macromolecules (e.g., proteins, DNA, or RNA) [ 8 – 10 ] . For instance, SUMOylation of Sirt1 and Eef2 in cardiomyocytes [ 11 ] , Drp1 in hepatocytes [ 12 ] , and Nrf2 in neuronal [ 13 ] mitigates apoptosis induced by ischemia-reperfusion injury (IRI). In kidney diseases, SUMOylation participates in acute kidney injury (AKI), diabetic nephropathy, fibrosis and renal cell carcinoma, though mechanistic details remain debated [ 14 ] . IRI-associated AKI features proximal tubular epithelial cell detachment, dysfunction and apoptosis, a major driver of renal functional decline [ 15 , 16 ] . Prior studies suggested that SUMOylation may exert cytoprotective effects in renal tubular cells [ 17 – 19 ] ; however, the precise mechanisms underlying SUMOylation in renal IRI remains unclear. Moreover, the repertoire of SUMOylated proteins that promote tubular epithelial cell injury has yet to be comprehensively defined. Identifying these substrates is critical for elucidating IRI pathogenesis and developing targeted therapies. Here, we demonstrate that SENP3-mediated SUMO2/3 homeostasis is a pivotal regulatory of apoptosis in renal IRI. We identify argininosuccinate synthase (ASS1) as a key SUMO2/3-modified protein in IRI-induced apoptosis. SENP3-driven deconjugation of ASS1 promotes its nuclear accumulation, activating pro-apoptotic Trp53 gene expression and culminating in intrinsic pathway-mediated apoptosis. Results SENP3 Promotes Apoptosis in Renal Ischemia-Reperfusion Injury (IRI) We initially investigated the role of SUMOylation and deSUMOylation in kidney ischemia-reperfusion injury (IRI). SENP3 knockdown effectively inhibited the deSUMOylation process. In IRI-induced acute kidney injury (IRI-AKI) mice, SENP3 expression increased progressively with reperfusion time following ( Fig. 1 a, b ) . Immunofluorescence staining confirmed elevated SENP3 expression in proximal tubular epithelia cells (PTECs) after IRI ( Fig. 1 c ) . To examine SENP3’s role in PTECs, we generated proximal tubule-specific Senp3 knockout mice ( Senp3 flox/flox - Ggt1 Cre , CKO) and control littermates ( Senp3 flox/flox mice, WT). Genotyping by PCR (Figure S1 a) , Western blot analysis (Figure S1 b, c) , and immunofluorescence (Figure S1 d) confirmed successful SNEP3 deletion in PTECs of CKO mice. While sham-operated CKO and WT mice showed comparable renal injury, CKO mice exhibited significantly attenuated renal damage after IRI. It has been demonstrated by lower serum creatinine levels ( Fig. 2 a ) , reduced expression of neutrophil gelatinase-associated lipocalin (NGAL) and kidney injury molecule (KIM)-1 ( Fig. 2 b, c ) , diminished tubular damage on pathological examination and KIM-1 staining ( Fig. 2 d-f ) , and fewer TUNEL-positive apoptotic cells ( Fig. 2 d, g ) . SENP3-Mediated DeSUMOylation activates the Intrinsic Apoptosis Pathway in renal IRI To elucidate the molecular mechanism underlying SENP3-dependeny apoptosis, we analyzed key components of apoptotic signaling pathways. In renal tissues following IRI, SENP3 deficiency significantly attenuated the activation of truncated BID (tBID), cleaved CASPASE-9, cleaved CASPASE-3 and Cleaved PARP1, except cleaved-CASPASE 8 ( Fig. 2 h-l, Figure S2a, b) . We further validated these findings in vitro using a hypoxia/reoxygenation (H/R) model in TCMK1 cells. After 3 h of hypoxia, the level of SENP3 decreased slightly but subsequently progressive increase during reoxygenation ( Fig. 3 a-c ) . We then transfected TCMK1 cells with SENP3 siRNA (Figure S3) . Consistent with the in vivo data, SENP3 knockdown conferred significant cyto-protection against apoptosis ( Fig. 3 d, e ) . Similarly, SNEP3 knockdown suppressed activation of apoptotic executors except cleaved CASPASE8 ( Fig. 3 f-j; Figure S2c, d) . To establish the requirement for SENP3’s deSUMOylation activity, we generated wild-type SENP3 (SENP3-WT-HIS) and catalytically inactive mutant- SENP3 (SENP3-C526S-HIS, cysteine to serine mutation at residue 526) (Figure S4, 5) [ 21 ] . SENP3-WT overexpression, but not C526S, exacerbated H/R-induced apoptosis ( Fig. 4 a, b ) , and enhanced tBID generation, cleaved CASPASE 3/9 activation and PARP1 cleavage. These results demonstrate that SENP3 promotes renal tubular apoptosis through its deSUMOylate activity, primarily via activation of the intrinsic apoptosis pathway ( Fig. 4 c-g ) . Identification of SUMO2/3-Modified ASS1 as a Key SENP3 Substrate in Renal IRI Building on our findings that SENP3-mediated deSUMOylation promotes apoptosis, we sought to identify critical SUMO2/3-conjugated protein substrates involved in IRI pathogenesis using a comprehensive proteomic approach. We first screened SUMO23 substrate via performed IP from kidney lysates of IRI-AKI mice with/without SENP3 deficiency, and identified 16 potential SUMO2/3 targets by quantitative mass spectrometry ( Figure S6 ). We compared the biological functions of these proteins and their distribution characteristics in kidney tissues (Table S1 ) , the associated studies of these proteins with pathogenic mechanism, and then comprehensively evaluated all the information. Arginosuccinate synthase 1 (ASS1) is a rate-limiting enzyme responsible for arginine biosynthesis in the urea cycle, and highly expressed in the kidney, especially in the proximal tubule cells. It has been reported that ASS1 expression inhibited fibroblast cell proliferation [ 22 ] . Loss of ASS1 and arginine auxotrophy were found in several types of tumors and ASS1 overexpression effectively inhibited tumor cell growth with an increase in apoptosis [ 23 ] . Thus, we finally selected ASS1 for further study (Figure S7) . Then we confirmed that ASS-SUMO2/3 conjugation in WT kidneys decreased post-IRI (Fig. 5 a). We further recapitulated this finding in TCMK1 cells (Fig. 5 b). In the same way, the ASS1 interacted with SENP3 and this connection was enhanced during H/R ( Fig. 5 c, d ) . To identify potential SUMOylation sites of ASS1 (NP_031520.1, P16460), we employed three prediction algorithms: SUMOplot Analysis Program, JASSA and GPS-SUMO ( Figure S8 ). Previous studies have reported 19 SUMOylation sites in human ASS1 [ 24 ] . Given the high sequence homology between human ASS1 and mouse Ass1 , we cross-referenced these reported SUMOylation sites with our prediction results after performing a BLAST alignment of their amino acid sequences. Based on this integrated analysis, we selected five candidate lysine residues− K215, K228, K239, K310, and K348−for experimental validation. Each site was individually mutated to arginine (R) to assess its role in SUMOylation. The interaction between exogenous ASS1, SUMO2/3 and SENP3 was confirmed firstly in HEK-293T cells (Figure S9) . Our findings suggest that K239 and K310 are likely the primary modification sites, as the K239R and K310R mutations significantly reduced ASS1 SUMO2/3 modification levels, whereas mutations at K215, K228 and K348 had minimal impact ( Fig. 5 e ) . To further confirm these results, we generated a FLAG-tagged ASS1 double mutant (K239R/K310R, designated 2KR) and co-transfected it into HEK-293T cells with HA-tagged UBC9, His-tagged SENP3 or MYC-tagged SUMO2/3. Consistent with our earlier observations, the 2KR mutation markedly diminished SUMO2/3 modification of ASS1 (Fig. 5 f). Moreover, the 2KR mutation disrupted the interaction between ASS1 and SENP3 ( Fig. 5 g ) . In summary, our data demonstrate that ASS1 undergoes SUMO2/3 modification primarily at K239 and K310, and this modification is reversed by SENP3-mediated deSUMOylation. SENP3-Dependent DeSUMOylation is Required for ASS1 Nuclear accumulation Under basal conditions, ASS1 localizes to both the cytosol and nucleus, whereas SENP3 and SUMO2/3 are predominantly nuclear. Following H/R treatment, we observed increased nuclear accumulation of ASS1 accompanied by a concomitant decrease in its cytosolic levels ( Fig. 6 a; Figure S10a, b) . Notably, nuclear ASS1 was primarily in a deSUMOylated state ( Fig. 6 b ) . To investigate the role of SENP3-mediated deSUMOylated in ASS1 nuclear translocation, we performed subcellular fraction assays. siRNA mediated knockdown of SENP3 in TCMK1 cells reduced nuclear ASS1 level and partially suppressed H/R-induced ASS1 nuclear accumulation ( Fig. 6 c-e, FigureS10c, d) . Conversely, SENP3 overexpression further enhanced nuclear ASS1 accumulation. However, transfection of a catalytically inactive mutant (SENP3-C526S) failed to promote ASS1 nuclear translocation, with effects comparable to baseline SENP3 levels ( Fig. 6 f-h, Figure S10e, f) . Consistent with these findings, ASS1 nuclear accumulation also observed in renal PETCs following IRI (Figure S11) . Collectively, these data demonstrate that H/R-induced nuclear accumulation of ASS1 in TCMK1 cells is dependent on SENP3-mediated deSUMOylation. ASS1 DeSUMOylation Induced Apoptosis by Enhancing p53 Transcriptional Activity Based on our findings, ASS1 accumulates in the nucleus following IRI or H/R in a SENP3-dependent deSUMOylation manner. Notably, pharmacological inhibition of ASS1 using MDLA, even in the absence of SENP3 deficiency, significantly attenuated H/R-induced apoptosis ( Fig. 7 a; Figure S12) . To further validate these observations, we performed ASS1 knockdown in TCMK1 cells using siRNA. As expected, ASS1 silencing remarkably alleviated H/R-induced cellular apoptosis ( Fig. 7 b, c ). Similarly, ASS1-deficiency TCMK1 cells exhibited decreased expression of pro-apoptotic proteins (Figure S13; Fig. 7 d-g ) . While these results establish a clear association between nuclear deSUMOylated ASS1 and apoptosis, the underling molecular mechanism required further investigation. Previous studies have demonstrated that severe hypoxia triggers p53 accumulation, which regulates downstream targets to promote mitochondria-dependent apoptosis, and the expression of BID is regulated by p53 [ 25 ] . We therefore hypothesized that nuclear deSUMOylated ASS1 enhanced apoptosis by promoting Trp53 transactivation. H/R treatment increased the co-localization of p53 and ASS1 ( Fig. 7 h ) , and enhanced Trp53 transcriptional activity. However, these effects were attenuated by either SENP3 or ASS1 knockdown ( Fig. 7 i-j ) . In vivo studies confirmed that SENP3 deficiency reduced p53 expression in renal tissue following IRI ( Fig. 7 k, Figure S14) . Conversely, SENP3 overexpression of further amplified Trp53 transcription after H/R treat, while catalytically inactive SENP3-C526S mutant showed effects comparable to SENP3-WT ( Fig. 7 l ) . Complementary mRNA sequencing analysis of H/R-treated TCMK1 cells revealed significant upregulation of Trp53 and its downstream target Bid (Figure S15) . These findings were further validated by RT-qPCR analysis demonstrating SENP3 deSUMOylation-dependent regulation of Bid expression that paralleled Trp53 transcriptional activation (Figure S16) . In summary, our data demonstrate that SENP3-mediated deSUMOylation of ASS1 promotes its nuclear accumulation, which in turn enhanced Trp53 transcriptional activity and ultimately induces apoptosis following IRI. Discussion Protein SUMOylation plays critical roles in pathophysiology of various diseases, and represents a promising therapeutic target. In this study, we identified ASS1 as a novel SUMO-modified protein involved in IRI. Our findings demonstrate that SENP3-mediated deSUMOylation of SUMO2/3-conjugated ASS1 promotes apoptosis in PTECs following ischemic/hypoxic stress. The functional consequences of SUMOylation in AKI appear to be context-dependent, varying by etiology, specific SUMO isoforms, regulatory SENP proteases, and substrate proteins. Previous studies have shown dynamic changes in protein SUMOylation during ischemic AKI, with SUMO1- and SUMO2/3-modified proteins increasing modestly after 30 minutes of ischemia but dramatically after 8 hours of reperfusion, before disappearing during the 24-48-hour perfusion period [ 17 ] . In folic acid- and IRI induced-AKI models, increased SUMO1 conjugation to Sirt3 was observed, and SENP1-mediated deSUMOylation of Sirt3 ameliorate kidney injury [ 18 ] . Interesting, while global SUMOylation inhibition sensitized renal cells to apoptosis in cisplatin-induced nephrotoxic [ 17 ] , and SENP1 deficiency exacerbated cisplatin-induced renal damage [ 26 ] . In contrast, our study reveals a cytoprotective role for SUMO2/3-modified ASS1 in SENP3-deficient IRI-AKI model, highlighting the complex, substrate-specific nature of SUMOylation in renal pathophysiology. Emerging evidence implicates SUMOylation, particular SUMO2/3 conjugation, in cellular responses to ischemic and hypoxic stress [ 27 , 28 ] . Although SUMO2 and SUMO3 share near-identical sequence (referred to as SUMO2/3), SUMO2 is a more abundant isoform than SUMO3 in mammals, and can compensate for most SUMO1 function [ 29 ] . These observations underscore the importance of identifying specific SUMO2/3 target proteins in renal IRI, with our findings suggesting that enhancing ASS1 SUMOylation may represent a novel therapeutic strategy for IRI-induced AKI. Under basal conditions, most SUMO targets exhibit low modification levels but undergo rapid SUMOylation cycle, where even minimal modifications can exert significant effects. Nuclear SUMOylation typically suppresses transcription through modification of transcription factors and cofactors [ 30 ] . However, exceptions exist- oxidative stress-induces SUMOylation of TP53INP1 is required for activation of p53 activation and subsequently apoptosis [ 31 ] . In cerebral IRI, blocking ANXA1 deSUMOylation reduces apoptosis by inhibiting the transcription activity of p53 [ 32 , 33 ] . Our study adds to this complexity by demonstrating that nuclear accumulation of deSUMOylated ASS1 following H/R enhances p53 transcriptional activity. Several limitations warrant consideration. First, while we identified 16 potential SUMO2/3-modified proteins in IRI-induced apoptosis, we focus exclusively on ASS1 based on bioinformatic analysis. Other candidates may also play also contribute to this process. Second, although we established SENP3-dependent nuclear accumulation of deSUMOylated ASS1 post-H/R, the precise molecular mechanisms require further investigation. In conclusion, our study highlights the critical importance of SUMOylation homeostasis in renal protection and identifies SUMO2/3-modified ASS1 as a key regulator in IRI-induced AKI. We propose a novel apoptotic pathway in PTECs wherein ischemia/reperfusion triggers SENP3-mediated ASS1 deSUMOylation, leading to nuclear accumulation and enhanced p53 transcriptional activation (Fig. 8 ). These findings provide new insights into the molecular mechanisms of renal IRI and suggest potential therapeutic targets for AKI intervention. Methods Animal Experiments Senp3 flox/flox mice (provided by Prof. Jing Yi and Prof. Jie Yang, Shanghai Jiao Tong University School of Medicine, China) were crossed with Ggt1 Cre mice (provided by Prof. Huijuan Wu, School of Basic Medical Sciences, Fudan University, China) to generate proximal tubule-specific Senp3 knockout mice ( Senp3 flox/flox -Ggt1 Cre , CKO) and littermate controls ( Senp3 flox/flox , WT). Mice were housed under specific-pathogen-free conditions (20–24℃, 50%-60% humidity, 12-h light/dark cycle). For IRI-AKI modeling, 8-10-week-old male mice underwent right nephrectomy followed by left renal pedicle clamping (30min) or sham surgery. Reperfusion was confirmed by kidney color recovery [ 20 ] . Mice were euthanized 24 h post-reperfusion, serum and kidneys were collected. All procedures were approved by the Committees for Animal Experiments of Zhejiang University. Cell Culture and Interventions Cell Culture and Interventions HEK293T (RRID: CVCL_0063) and TCMK1 (RRID: CVCL_2772) cells were provided by Servicebio Technology Co., Ltd. (STCC10301G, STCC20015G), and were identified by short tandem repeat (STR) profiling. All the cells used have undergone quality testing, and there were no detections of bacteria, fungi or mycoplasma. TCMK1 cells were cultured in RPMI 1640 and HEK-293T in DMEM (10% FBS, 1% penicillin/streptomycin) at 37 ℃ (21% O 2 , 5% CO 2 ). Hypoxia/reoxygenation (H/R) was induced in TCMK1 cells by serum starvation (overnight), hypoxia (0.1% O 2 , 3 h), and reoxygenation (21% O 2 , 24h). For functional studies: Lentiviral transduction: SENP3-WT-HIS, SENP3-C526S-HIS (catalytically inactive mutant), or empty vector (72h; Vigen). siRNA knockdown: SENP3 (GenePharma Technology Co., Ltd., S: ACAGCUUCUUCUAUGAUAATT, AS: UUAUCAUAGAAGAAGCUGUUG) or ASS1 (Sangon Biotech Co., Ltd., S: CUGAUGGAGUAUGCAAAGCAA, AS: UUGCUUUGCAUACUCCAUCAG) siRNA (24h). Pharmacological inhibition: ASS1 inhibitor α-Methyl-DL-aspartic acid (MDLA, 20 mM, 24h; MCE, HY-W142119) Renal Function and Histopathology Serum creatinine and BUN were measured (FUJIDRI-CHEM 7000i). Kidney sections (4 µm) were stain with Hematoxylin and Eosin (H&E) and Periodic Acid-Schiff (PAS). Tubular damage was scored (0–4) based on brush border loss, dilatation and disruption, epithelial flattened and cell sloughing. Immunofluorescence and TUNEL assay PFA-fixed samples were permeabilized (0.5% Triton X-100), blocked (5% BSA), and incubated with primary antibodies (SENP3, #5591, CST; ASS1, 16210-1-AP, Proteintech; LTL, L32480, Invitrogen; P53, 60283-2-Ig, Proteintech) followed by DAPI. TUNEL staining (APO001 kit, Multi Sciences) dected apoptotic cells. Images were acquired via confocal microscope (Nikon A1 Ti/Zeiss LSM 900) and analyzed with ImageJ. Western Blot and Immunoprecipitation (IP) Western Blot and Immunoprecipitation (IP) Proteins were extracted using RIPA lysis buffer (with 1 mM PMSF), Pierce™ IP lysis buffer (Thermos scientific, 87787), or nuclear/cytoplasmic freaction kits (Beyotime, P0027). Protein samples were separated by SDS-PAGE, and were subsequently transferred onto PVDF membranes. Blots were incubated with 5% fat-free milk in TBS containing 1% Tween for 1 h, and incubated with primary antibodies at 4 ℃ overnight. Then the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies. For IP, lysates were incubated with the indicated primary antibodies or IgG in combination with protein A/G beads (Beyotime, P2108) overnight (4 ℃), washed and eluted for immunoblotting. The SUMO2/3-conjugated proteins identification was performed by LC-MS using a Thermo Fusion Lumos, and analyzed by Proteome Discoverer software 2.1. Primary antibodies: SENP3(#5591, CST), SUMO2/3 (ab81371, Abcam), ASS1 (16210-1-AP, Proteintech), GAPDH (60004-1-Ig, Proteintech), HA (AE105, ABclonal), MYC (19C2, ABmart), FLAG (20543-1-AP, Proteintech), HIS (66005-1-IG, Proteintech), BID/tBID (10988-1-AP, Proteintech; A0210, ABclonal), Cleaved CASPASE-3 (19677-1-AP, Proteintech, A19654, ABclonal), Cleaved CASPASE-9 (10380-1-AP, Proteintech), Cleaved CASPASE-8 (66093-1-Ig, Proteintech) and cleaved PARP1 (13371-1-AP, Proteintech; A22535, ABclonal), P53 (60283-2-Ig, Proteintech). qRT-PCR Total RNA was extracted (Accurate Biology, AG21023), reverse-transcribed to cDNA with gDNA clean for qPCR (Evo M-MLV RT Mix kit, Accurate Biology, AG11728), and amplified (SYBR Green Premix PCR Master Mix, Accurate Biology, AG11701) on a CFX96 instrument (Bio-Rad). Primers: Senp3 , 5’-CCTGCTGTCGTTTTGACTCC-3’ (forward) and 5’-GTCCACCTTAGTCCATCTTCCT-3’ (reverse); Ngal , 5’-TGGCCCTGAGTGTCATGTG-3’ (forward) and 5’-CTCTTGTAGCTCATAGATGGTGC-3’ (reverse); Kim-1 , 5’-CCTTGTGAGCACCGTGGCTA-3’ (forward) and 5’-TGTTGTCTTCAGCTCGGGAATG-3’ (reverse); Bid , 5’-GCCTGTCGGAGGAAGACAAA-3’ (forward) and 5’-GTGGAAGACATCACGGAGCA-3’ (reverse), and β-Actin , 5’-GTGACGTTGACATCCGTAAAGA-3’ (forward) and 5’-GCCGGACTCATCGTACTCC-3’ (reverse). Flow cytometry assay 10^5 cells were collected and centrifuged at 300 g for 5 min and the supernatant was discarded. And the pellet was resuspended in 500 µL 1×binding buffer, and later incubated with 5 µL FITC-conjugated Annexin V and 10 µL propidium iodide (PI) for 5 min at 37 ℃ in the dark. The sample were analyzed by a flow cytometer (BD Bioscience). Luciferase reporter assay TCMK1 cells were co-transfected with pGL3-Luc (with p53 binding cis-element) plasmid and Prl-tk Renilla luciferase plasmid before establishing hypoxia/re-oxygenation (H/R) model. The cells were collected for luciferase assay (Dual Luciferase Reporter Assay Kit, Vazyme, DL101) and normalized to the Renilla. Statistical analysis All experiments were repeated at least 3 times. Data are mean ± SEM (n ≥ 3) and analyzed using GraphPad Prism 9.3. T-test was used to compare the difference in two groups. One-way ANOVA test or Two-way ANOVA test was used to compare between multiple groups. P < 0.05 was statistically significant. Declarations Acknowledgments We appreciate the gift of the Senp3 flox/flox mice from Prof. Jing Yi and Prof. Jie Yang, Shanghai Jiao Tong University School of Medicine, China. Conflict of Interest Statement The authors declare no conflict of interests. Author Contribution Statement Yi Yang and Weiqiang Lin conceived and designed the experiments. Hongju Wang, Cui Gao, Lini Jin, Longlong Wu, Qian Zhang, Jingjuan Yang and Hong Pan performed experiments. Hongju Wang, Cui Gao, Yi Yang, Weiqiang Lin and Huijuan Wu analyzed results and interpretation. Cui Gao wrote the manuscript. Yi Yang, Weiqiang Lin, Huijuan Wu, and Pattarin Tangtanatakul supervised the study and revised the manuscript. All authors approved the final version of the manuscript. Ethics Statement All procedures on mice were approved by the Committees for Animal Experiments of Zhejiang University. Funding Statement This work was supported by grants from the National Nature Science Foundation (82170681 and 82270704), Zhejiang Provincial Nature Science Foundation of China (No. LZ24H050001 and No. LZ22H050001), and Zhejiang provincial program for the Cultivation of High-level Innovative Health talents. Data Availability Statement The mass spectrometry data and RNA sequence date are in progress for inclusion in the Proteomics identification database (PRIDE) and National Center for Biotechnology Information (NCBI), the project accession numbers will be made available before manuscript acceptance. References Chang HM, Yeh ETH. SUMO: FROM BENCH TO BEDSIDE. PHYSIOLOGICAL REVIEWS 2020; 100(4): 1599 – 619.DOI.10.1152/physrev.00025.2019. Huang C, Han Y, Wang Y, et al. SENP3 is responsible for HIF-1 transactivation under mild oxidative stress via p300 de-SUMOylation. EMBO JOURNAL 2009; 28(18): 2748-62.DOI.10.1038/emboj.2009.210. Cai Z, Wang Z, Yuan R, et al. Redox-sensitive enzyme SENP3 mediates vascular remodeling via de-SUMOylation of β-catenin and regulation of its stability. EBIOMEDICINE 2021; 67.DOI.10.1016/j.ebiom.2021.103386. Chen X, Wang J, Yang P, et al. SENP3 sensitizes macrophages to ferroptosis via de-SUMOylation of FSP1. REDOX BIOLOGY 2024; 75.DOI.10.1016/j.redox.2024.103267. Vertegaal ACO. Signalling mechanisms and cellular functions of SUMO. NATURE REVIEWS MOLECULAR CELL BIOLOGY 2022; 23(11): 715 – 31.DOI.10.1038/s41580-022-00500-y. Han Z-J, Feng Y-H, Gu B-H, Li Y-M, Chen H. The post-translational modification, SUMOylation, and cancer (Review). INTERNATIONAL JOURNAL OF ONCOLOGY 2018; 52(4): 1081-94.DOI.10.3892/ijo.2018.4280. Sheng Z, Zhu J, Deng Y-n, Gao S, Liang S. SUMOylation modification-mediated cell death. OPEN BIOLOGY 2021; 11(7).DOI.10.1098/rsob.210050. Flotho A, Melchior F. Sumoylation: A Regulatory Protein Modification in Health and Disease. In: Kornberg RD, ed. ANNUAL REVIEW OF BIOCHEMISTRY, VOL 82; 2013: 357–85. Yang Y, He Y, Wang X, et al. Protein SUMOylation modification and its associations with disease. OPEN BIOLOGY 2017; 7(10).DOI.10.1098/rsob.170167. Huang CH, Yang TT, Lin K. Mechanisms and functions of SUMOylation in health and disease: a review focusing on immune cells. JOURNAL OF BIOMEDICAL SCIENCE 2024; 31(1).DOI.10.1186/s12929-024-01003-y. Chen J, Luo Y, Wang S, Zhu H, Li D. Roles and mechanisms of SUMOylation on key proteins in myocardial ischemia/reperfusion injury. JOURNAL OF MOLECULAR AND CELLULAR CARDIOLOGY 2019; 134: 154 – 64.DOI.10.1016/j.yjmcc.2019.07.009. Huang J, Xie P, Dong Y, An W. Inhibition of Drp1 SUMOylation by ALR protects the liver from ischemia-reperfusion injury. CELL DEATH AND DIFFERENTIATION 2021; 28(4): 1174-92.DOI.10.1038/s41418-020-00641-7. Xia Q, Que MX, Zhan GF, et al. SENP6-Mediated deSUMOylation of Nrf2 Exacerbates Neuronal Oxidative Stress Following Cerebral Ischemia and Reperfusion Injury. ADVANCED SCIENCE 2025; 12(7).DOI.10.1002/advs.202410410. Li O, Ma Q, Li F, Cai G-Y, Chen X-M, Hong Q. Progress of small ubiquitin-related modifiers in kidney diseases. Chinese Medical Journal 2019; 132(4): Havasi A, Borkan SC. Apoptosis and acute kidney injury. KIDNEY INTERNATIONAL 2011; 80(1): 29–40.DOI.10.1038/ki.2011.120. Priante G, Gianesello L, Ceol M, Del Prete D, Anglani F. Cell Death in the Kidney. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES 2019; 20(14).DOI.10.3390/ijms20143598. Guo C, Wei Q, Su Y, Dong Z. SUMOylation occurs in acute kidney injury and plays a cytoprotective role. BIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE 2015; 1852(3): 482-9.DOI.10.1016/j.bbadis.2014.12.013. Zhu M, He J, Xu Y, et al. AMPK activation coupling SENP1-Sirt3 axis protects against acute kidney injury. MOLECULAR THERAPY 2023; 31(10): 3052-66.DOI.10.1016/j.ymthe.2023.08.014. Chen SQ, Li JM, Liang Y, et al. β-catenin-inhibited Sumoylation modification of LKB1 and fatty acid metabolism is critical in renal fibrosis. CELL DEATH & DISEASE 2024; 15(10).DOI.10.1038/s41419-024-07154-y. Miao J, Zhu HH, Wang JN, Chen JH, Han F, Lin WQ. Experimental models for preclinical research in kidney disease. ZOOLOGICAL RESEARCH 2024; 45(5): 1161-74.DOI.10.24272/j.issn.2095-8137.2024.072. Tong Y, Zhang Z, Cheng Y, et al. Hypoxia-induced NFATc3 deSUMOylation enhances pancreatic carcinoma progression. Cell Death & Disease 2022; 13(4): 413.DOI.10.1038/s41419-022-04779-9. Li JM, Yang DC, Oldham J, et al. Therapeutic targeting of argininosuccinate synthase 1 (ASS1)-deficient pulmonary fibrosis. Mol Ther 2021; 29(4): 1487 – 500.DOI.10.1016/j.ymthe.2021.01.028. Kim S, Lee M, Song Y, et al. Argininosuccinate synthase 1 suppresses tumor progression through activation of PERK/eIF2α/ATF4/CHOP axis in hepatocellular carcinoma. Journal of Experimental & Clinical Cancer Research 2021; 40(1): 127.DOI.10.1186/s13046-021-01912-y. Hendriks IA, Lyon D, Young C, Jensen LJ, Vertegaal ACO, Nielsen ML. Site-specific mapping of the human SUMO proteome reveals co-modification with phosphorylation. Nature Structural & Molecular Biology 2017; 24(3): 325 – 36.DOI.10.1038/nsmb.3366. Sax JK, Fei P, Murphy ME, Bernhard E, Korsmeyer SJ, El-Deiry WS. BID regulation by p53 contributes to chemosensitivity. Nature Cell Biology 2002; 4(11): 842-9.DOI.10.1038/ncb866. Wang L, Gao X, Tang X, et al. SENP1 protects cisplatin-induced AKI by attenuating apoptosis through regulation of HIF-1α. Experimental Cell Research 2022; 419(1): 113281. DOI.https://doi.org/10.1016/j.yexcr.2022.113281 . Peters M, Wielsch B, Boltze J. The role of SUMOylation in cerebral hypoxia and ischemia. Neurochem Int 2017; 107: 66–77.DOI.10.1016/j.neuint.2017.03.011. Filippopoulou C, Simos G, Chachami G. The Role of Sumoylation in the Response to Hypoxia: An Overview. Cells 2020; 9(11).DOI.10.3390/cells9112359. Wang L, Wansleeben C, Zhao S, Miao P, Paschen W, Yang W. SUMO2 is essential while SUMO3 is dispensable for mouse embryonic development. EMBO reports 2014; 15(8): 878- 85-85.DOI.https://doi.org/10.15252/embr.201438534 . Nhat-Tu L, Martin JF, Fujiwara K, Abe J-i. Sub-cellular localization specific SUMOylation in the heart. BIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE 2017; 1863(8): 2041-55.DOI.10.1016/j.bbadis.2017.01.018. Peuget S, Bonacci T, Soubeyran P, Iovanna J, Dusetti NJ. Oxidative stress-induced p53 activity is enhanced by a redox-sensitive TP53INP1 SUMOylation. Cell Death Differ 2014; 21(7): 1107-18.DOI.10.1038/cdd.2014.28. Li X, Zhao Y, Xia Q, et al. Nuclear translocation of annexin 1 following oxygen-glucose deprivation-reperfusion induces apoptosis by regulating Bid expression via p53 binding. Cell Death Dis 2016; 7(9): e2356.DOI.10.1038/cddis.2016.259. Xia Q, Mao M, Zeng Z, et al. Inhibition of SENP6 restrains cerebral ischemia-reperfusion injury by regulating Annexin-A1 nuclear translocation-associated neuronal apoptosis. Theranostics 2021; 11(15): 7450-70.DOI.10.7150/thno.60277. Additional Declarations There is no duality of interest Supplementary Files supplfig202505.pdf Supplemental Material 1 supptable.tif Supplemental Material 2 orginwbfig202505.pdf Supplemental Material 3 Cite Share Download PDF Status: Published Journal Publication published 05 Dec, 2025 Read the published version in Cell Death & Disease → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6609361","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":455197953,"identity":"671e161e-0ecb-473b-b9e5-d892c7da04e2","order_by":0,"name":"Yi Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIie3RsQrCMBCA4StCuwRdoyD6CCeBILQP0yLEpYijg0NAcO0L+DCRgi4pXbsLLnbQzUHE2AeIdRPMv9wN95EhAC7Xz4aAPYDYbJ0vSF9+RwxC1cwWBI9FfiHLnLFSnSmswkQGhbITvRAhQcG5UoKCnieSLGI7USlnBKOI76Wg3jZPJCVoJ2X9JjRiGzDk2YZUKTuZVzj6byJbkH5Vc2+HglENs2l8mLMtSe2kW6bsWj/ySZbppLquw2EWaDsZK/AHpFlJ3Hymb703jSR0bvdmDdSnY5fL5frTXg3OQ1tvzGjVAAAAAElFTkSuQmCC","orcid":"","institution":"Zhejiang University","correspondingAuthor":true,"prefix":"","firstName":"Yi","middleName":"","lastName":"Yang","suffix":""},{"id":455197954,"identity":"2842aea8-eba9-41fa-b45f-f77bb944a950","order_by":1,"name":"Wang Hongju","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Wang","middleName":"","lastName":"Hongju","suffix":""},{"id":455197955,"identity":"354d8459-ea2d-4fd7-b305-763b8bfbef74","order_by":2,"name":"Gao Cui","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Gao","middleName":"","lastName":"Cui","suffix":""},{"id":455197956,"identity":"e1eb47b7-250d-48d4-92d8-1da9e808a67a","order_by":3,"name":"Lini Jin","email":"","orcid":"","institution":"the First Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lini","middleName":"","lastName":"Jin","suffix":""},{"id":455197957,"identity":"febdcd5e-2ad0-4457-b4b3-14db2885d95a","order_by":4,"name":"Longlong Wu","email":"","orcid":"","institution":"Zhejiang University School of medicine","correspondingAuthor":false,"prefix":"","firstName":"Longlong","middleName":"","lastName":"Wu","suffix":""},{"id":455197958,"identity":"536d877b-def8-4d7b-8784-e843149e7e2c","order_by":5,"name":"Qian Zhang","email":"","orcid":"","institution":"The Fourth Affiliated Hospital Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Zhang","suffix":""},{"id":455197959,"identity":"8e0050d1-fe14-4175-9879-5bca1361e2f9","order_by":6,"name":"Yang Jingjuan","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Jingjuan","suffix":""},{"id":455197960,"identity":"aac469ae-f027-4365-91ca-add6991e1fa5","order_by":7,"name":"Hong Pan","email":"","orcid":"","institution":"Zhejiang University School of medicine","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Pan","suffix":""},{"id":455197961,"identity":"ea3d060c-e988-46f7-b8d1-295077047613","order_by":8,"name":"Huijuan Wu","email":"","orcid":"https://orcid.org/0000-0003-4681-4440","institution":"School of Basic Medical Sciences, Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Huijuan","middleName":"","lastName":"Wu","suffix":""},{"id":455197962,"identity":"123292b7-9435-4e05-a4d9-ab0298d59e23","order_by":9,"name":"Tangtanatakul Pattarin","email":"","orcid":"","institution":"Chulalongkorn University","correspondingAuthor":false,"prefix":"","firstName":"Tangtanatakul","middleName":"","lastName":"Pattarin","suffix":""},{"id":455197963,"identity":"bb93d530-85b2-4fd0-b601-646ab3d0ea23","order_by":10,"name":"Weiqiang Lin","email":"","orcid":"https://orcid.org/0000-0002-2171-8009","institution":"The 4th Affiliated Hospital of Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Weiqiang","middleName":"","lastName":"Lin","suffix":""}],"badges":[],"createdAt":"2025-05-07 07:50:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6609361/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6609361/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-025-08308-2","type":"published","date":"2025-12-05T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":85401986,"identity":"7b20c685-d72d-4315-8508-0b0aaae8f428","added_by":"auto","created_at":"2025-06-25 12:12:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":438919,"visible":true,"origin":"","legend":"\u003cp\u003eSENP3 expression is upregulated in PTECs following IRI.\u003c/p\u003e\n\u003cp\u003e(a-b) WT mice underwent unilateral nephrectomy followed by 30 min of left renal pedicle clamping and reperfusion for 6, 12, or 24 h. SENP3 expression increased progressively with reperfusion duration in IRI-AKI. (c) Immunofluorescence staining confirmed SENP3(red) localization in PTECs (marked by Lotus tetragonolobus lectin, LTL, green) at 24 h post-reperfusion. \u0026nbsp;Scale bar, 10 mm. \u0026nbsp;Data: mean ±SEM (\u003cem\u003en\u003c/em\u003e=3). ns, not significance. ****p \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Fig01.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/048183fda135a71d7fca77b1.png"},{"id":85402302,"identity":"f3681759-461d-4092-a34e-b735ca9382e5","added_by":"auto","created_at":"2025-06-25 12:20:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":888428,"visible":true,"origin":"","legend":"\u003cp\u003eSENP3 deficiency attenuates renal injury after ischemia-reperfusion.\u003c/p\u003e\n\u003cp\u003e(a) Serum creatinine levels were reduced in\u003cem\u003e Senp3\u003c/em\u003eCKO mice compared to WT following 30 min ischemia and 24 h reperfusion. \u0026nbsp;(b-c) RT-qPCR revealed decreased expression of injury markers \u003cem\u003eNgal\u003c/em\u003e and\u003cem\u003e Kim-1\u003c/em\u003e in CKO kidney post-IRI. (d) Representative histology (H\u0026amp;E, PAS) and immunofluorescence staining for KIM-1 and TUNEL (apoptosis) in sham and IRI groups. CKO mice exhibited milder tubular injury. Scale bar, 50mm. (e-g) Quantification of tubular injury scores, KIM-1 fluorescence intensity, and TUNEL+ cells confirmed reduced injury and apoptosis in CKO mice. (h-m) Western blot and quantification of pro-apoptosis proteins (tBID, cleaved-CASPASE9/3, cleaved-PARP1) in kidney lysates. Data: mean ±SEM (\u003cem\u003en\u003c/em\u003e=6). ns, not significance. *p \u0026lt;0.05, **p \u0026lt;0.01, ***p \u0026lt;0.001, ****p \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Fig02.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/98770a4839cab3a84a8d979f.png"},{"id":85401988,"identity":"7bc82f3b-ce3f-496d-a48f-fae633968a36","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":426045,"visible":true,"origin":"","legend":"\u003cp\u003eSENP3 knockdown suppressed H/R-induced apoptosis in PTECs.\u003c/p\u003e\n\u003cp\u003e(a-b) TCMK1 cells subjected to 3 h hypoxia followed by reoxygenation (0-24 h) showed dynamic SENP3 expression (peak at 24 h). (c-d) Flow cytometry (Annexin V-FITC/PI) induced apoptosis in SENP3-silenced (si-SENP3) vs. \u0026nbsp;control (si-NC) cells post-H/R. (e-i) Western blot analysis of pro-apoptotic markers (tBID, cleaved-CASPASE9/3, cleaved-PARP1) in H/R-treated TCMK1 cells with or without SENP3 knockdown. Data: mean ±SEM (\u003cem\u003en\u003c/em\u003e=3). ns, not significance. **p \u0026lt;0.01, ***p \u0026lt;0.001, ****p \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Fig03.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/858811936bb325c18a14e4dd.png"},{"id":85401995,"identity":"a37f2c2a-ceb8-4bf5-a546-c685c99f6ac8","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":338948,"visible":true,"origin":"","legend":"\u003cp\u003eSENP3 deSUMOylase activity promotes H/R-induced apoptosis.\u003c/p\u003e\n\u003cp\u003e(a-b) Overexpression of wild-type SENP3 (SENP3-WT), but not the catalytically inactive mutant (SENP-C526S), exacerbated apoptosis (Annexin V-FITC/PI). (c-g) Apoptosis protein levels (tBID, cleaved-CASPASE9/3, cleaved-PARP1) were elevated in SENP3-WT-transfected cels, an effect abolished by C526S mutation. Data: mean ±SEM \u003cem\u003e(n=3).\u003c/em\u003e ns, not significance. **p \u0026lt;0.01, ***p \u0026lt;0.001, ****p \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Fig04.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/9175552b464c9cc4075e04ac.png"},{"id":85401990,"identity":"dda45935-c808-4d29-b04c-fc19bb3c56fa","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":690302,"visible":true,"origin":"","legend":"\u003cp\u003eSENP3 mediated ASS1 deSUMOylation at K239/310 during H/R.\u003c/p\u003e\n\u003cp\u003e(a-b) SUMO2/3-ASS1 interaction was reduced in IRI kidney and H/R-treated TCMK1 cells. (c-d) Endogenous SENP3-ASS1 binding increased post-H/R. (e-f) SUMO2/3 preferentially conjugated to ASS1 at K239/K310 (2KR mutation abrogated binding). UBC9, an essential E2-conjugating enzyme in the SUMOylation process. (g) 2KR mutation impaired SENP3-ASS1 interaction. \u0026nbsp;All experiments: ³ 3 biological replicates.\u003c/p\u003e","description":"","filename":"Fig05.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/0039ab980022c24d6ecb8235.png"},{"id":85401994,"identity":"bac01846-7811-4442-b83c-8b0600e7b685","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":548693,"visible":true,"origin":"","legend":"\u003cp\u003eNuclear accumulation of deSUMOylated ASS1 depends on SENP3.\u003c/p\u003e\n\u003cp\u003e(a-b) H/R induced nuclear ASS1 enrichment, predominantly in a deSUMOylation form (co-IP of nuclear fractions). (c-e) Western blot and Immunofluorescence confirmed SENP3-dependent nuclear translocation of ASS1 post- H/R. (f-h) SENP3-C526S fail to promote ASS1 nuclear accumulation. Scale bar, 20mm. Data: mean ±SEM \u003cem\u003e(n=3).\u003c/em\u003e ns, not significance. **p \u0026lt;0.01, ***p \u0026lt;0.001, ****p \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Fig06.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/d7ced019e3cc0ae92752f8bf.png"},{"id":85401993,"identity":"5aaf77df-7deb-47a6-bc24-c55046975f6c","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":548868,"visible":true,"origin":"","legend":"\u003cp\u003eASS1 inhibition mitigates H/R-induced apoptosis.\u003c/p\u003e\n\u003cp\u003e(a) ASS1 Inhibitor MDLA reduced tBID, cleaved CASPASE-9/3 in H/R-treated TCMK1 cells. (b-g) ASS1 knockdown reduced cellular apoptosis (Annexin-V-FITC/PI), tBID and cleavage CASPASE-9/3 in H/R-treated TCMK1 cells. (h) ASS1-p53 cp-localization increased post-H/R. (i) SENP3 knockdown attenuated \u003cem\u003eTrp53\u003c/em\u003e transcriptional activation in TCMK1 cells. \u0026nbsp;(j) ASS1 knockdown attenuated H/R-induced \u003cem\u003eTrp53\u003c/em\u003etranscriptional activation. \u0026nbsp;(k) SENP3 deficiency reduces renal p53 expression following IRI. (l) The catalytically inactive SENP3 mutant (C526S) failed to enhance transcriptional activity following H/R. Data: mean ±SEM \u003cem\u003e(n=3).\u003c/em\u003e ns, not significance. *p \u0026lt;0.05, **p \u0026lt;0.01, ***p \u0026lt;0.001, ****p \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Fig07.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/027a06d1bb05ce1185807b30.png"},{"id":85401997,"identity":"187b2533-0d54-451a-9019-783d2e8a66ea","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":139671,"visible":true,"origin":"","legend":"\u003cp\u003eModel for the Role of ASS1 in IRI.\u003c/p\u003e\n\u003cp\u003eIschemia/reperfusion triggers SENP3-mediated ASS1 deSUMOylation, leading to nuclear accumulation, enhanced p53 transcriptional activation, then increased the tBID and cleaved CASPASE-9/3.\u003c/p\u003e","description":"","filename":"Fig08.png","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/3f67a1a0d83d04889f82b201.png"},{"id":100959616,"identity":"bbd9473c-c185-440d-9d2b-9802de8249fc","added_by":"auto","created_at":"2026-01-23 08:15:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4705554,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/14f377ee-dabf-4d19-b554-b851585ba00e.pdf"},{"id":85402303,"identity":"471f1718-ddaf-4a59-9dc9-00233f518357","added_by":"auto","created_at":"2025-06-25 12:20:38","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2720215,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental Material 1\u003c/p\u003e","description":"","filename":"supplfig202505.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/ba9dff4eb2fc9dc9e3471669.pdf"},{"id":85401992,"identity":"af7e60b7-85db-4a98-aa52-21afdcecde2d","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":562990,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental Material 2\u003c/p\u003e","description":"","filename":"supptable.tif","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/cb3b3af0ce71ffb127b641af.tif"},{"id":85401999,"identity":"3730c006-ce42-41ce-85ec-30cc736f1332","added_by":"auto","created_at":"2025-06-25 12:12:38","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":4729824,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental Material 3\u003c/p\u003e","description":"","filename":"orginwbfig202505.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6609361/v1/61c70c5f80fc9593a0a3bce7.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"SENP3 promotes renal tubular epithelial cell apoptosis after ischemia-reperfusion injury via ASS1 deSUMOylation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSUMOylation, a reversible post-translation modification, entails the covalent conjugation of small ubiquitin-like modifier (SUMO) proteins to lysine residues on target proteins. This process is dynamically regulated by SUMO-specific proteases (SENPs)\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Among SENPs, SENP3 localizes predominantly to the nuclear and selectively regulates both SUMO2/3 maturation and deconjugation. Notably, SENP3 exhibits redox-sensitive, oxidative stress triggers its redistribution from nucleoli to the nucleoplasm by inhibiting degradation\u003csup\u003e[\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. SUMOylation primarily modulates nuclear process, including gene expression, genome stability, RNA processing, nucleocytoplasmic transport and cell cycle progression\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. The equilibrium between SUMOylation and deSUMOylation critically influences cell fate, with outcomes contingent on disease context, SUMO isoforms specificity, substrate identity, and cell type. Apoptosis, among other cell death modalities, has been extensively linked to SUMOylation\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAs evolutionarily conserved regulators essential for eukaryotic cell viability, SUMO family members are frequently dysregulated in human diseases. SUMOylation can alter target protein activity, stability or subcellular localization, often by modifying interactions with macromolecules (e.g., proteins, DNA, or RNA)\u003csup\u003e[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. For instance, SUMOylation of Sirt1 and Eef2 in cardiomyocytes\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e, Drp1 in hepatocytes\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, and Nrf2 in neuronal\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e mitigates apoptosis induced by ischemia-reperfusion injury (IRI).\u003c/p\u003e \u003cp\u003eIn kidney diseases, SUMOylation participates in acute kidney injury (AKI), diabetic nephropathy, fibrosis and renal cell carcinoma, though mechanistic details remain debated\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. IRI-associated AKI features proximal tubular epithelial cell detachment, dysfunction and apoptosis, a major driver of renal functional decline\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Prior studies suggested that SUMOylation may exert cytoprotective effects in renal tubular cells\u003csup\u003e[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e; however, the precise mechanisms underlying SUMOylation in renal IRI remains unclear. Moreover, the repertoire of SUMOylated proteins that promote tubular epithelial cell injury has yet to be comprehensively defined. Identifying these substrates is critical for elucidating IRI pathogenesis and developing targeted therapies.\u003c/p\u003e \u003cp\u003eHere, we demonstrate that SENP3-mediated SUMO2/3 homeostasis is a pivotal regulatory of apoptosis in renal IRI. We identify argininosuccinate synthase (ASS1) as a key SUMO2/3-modified protein in IRI-induced apoptosis. SENP3-driven deconjugation of ASS1 promotes its nuclear accumulation, activating pro-apoptotic \u003cem\u003eTrp53\u003c/em\u003e gene expression and culminating in intrinsic pathway-mediated apoptosis.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSENP3 Promotes Apoptosis in Renal Ischemia-Reperfusion Injury (IRI)\u003c/h2\u003e \u003cp\u003eWe initially investigated the role of SUMOylation and deSUMOylation in kidney ischemia-reperfusion injury (IRI). SENP3 knockdown effectively inhibited the deSUMOylation process. In IRI-induced acute kidney injury (IRI-AKI) mice, SENP3 expression increased progressively with reperfusion time following \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e. Immunofluorescence staining confirmed elevated SENP3 expression in proximal tubular epithelia cells (PTECs) after IRI \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo examine SENP3\u0026rsquo;s role in PTECs, we generated proximal tubule-specific \u003cem\u003eSenp3\u003c/em\u003e knockout mice (\u003cem\u003eSenp3\u003c/em\u003e\u003csup\u003e\u003cem\u003eflox/flox\u003c/em\u003e\u003c/sup\u003e-\u003cem\u003eGgt1\u003c/em\u003e\u003csup\u003e\u003cem\u003eCre\u003c/em\u003e\u003c/sup\u003e, CKO) and control littermates (\u003cem\u003eSenp3\u003c/em\u003e\u003csup\u003e\u003cem\u003eflox/flox\u003c/em\u003e\u003c/sup\u003e mice, WT). Genotyping by PCR \u003cb\u003e(Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea)\u003c/b\u003e, Western blot analysis \u003cb\u003e(Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eb, c)\u003c/b\u003e, and immunofluorescence \u003cb\u003e(Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ed)\u003c/b\u003e confirmed successful SNEP3 deletion in PTECs of CKO mice. While sham-operated CKO and WT mice showed comparable renal injury, CKO mice exhibited significantly attenuated renal damage after IRI. It has been demonstrated by lower serum creatinine levels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e, reduced expression of neutrophil gelatinase-associated lipocalin (NGAL) and kidney injury molecule (KIM)-1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, c\u003cb\u003e)\u003c/b\u003e, diminished tubular damage on pathological examination and KIM-1 staining \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-f\u003cb\u003e)\u003c/b\u003e, and fewer TUNEL-positive apoptotic cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, g\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSENP3-Mediated DeSUMOylation activates the Intrinsic Apoptosis Pathway in renal IRI\u003c/h2\u003e \u003cp\u003eTo elucidate the molecular mechanism underlying SENP3-dependeny apoptosis, we analyzed key components of apoptotic signaling pathways. In renal tissues following IRI, SENP3 deficiency significantly attenuated the activation of truncated BID (tBID), cleaved CASPASE-9, cleaved CASPASE-3 and Cleaved PARP1, except cleaved-CASPASE 8 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh-l, \u003cb\u003eFigure S2a, b)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eWe further validated these findings \u003cem\u003ein vitro\u003c/em\u003e using a hypoxia/reoxygenation (H/R) model in TCMK1 cells. After 3 h of hypoxia, the level of SENP3 decreased slightly but subsequently progressive increase during reoxygenation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-c\u003cb\u003e)\u003c/b\u003e. We then transfected TCMK1 cells with SENP3 siRNA \u003cb\u003e(Figure S3)\u003c/b\u003e. Consistent with the \u003cem\u003ein vivo\u003c/em\u003e data, SENP3 knockdown conferred significant cyto-protection against apoptosis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, e\u003cb\u003e)\u003c/b\u003e. Similarly, SNEP3 knockdown suppressed activation of apoptotic executors except cleaved CASPASE8 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef-j; \u003cb\u003eFigure S2c, d)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo establish the requirement for SENP3\u0026rsquo;s deSUMOylation activity, we generated wild-type SENP3 (SENP3-WT-HIS) and catalytically inactive mutant- SENP3 (SENP3-C526S-HIS, cysteine to serine mutation at residue 526) \u003cb\u003e(Figure S4, 5)\u003c/b\u003e\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. SENP3-WT overexpression, but not C526S, exacerbated H/R-induced apoptosis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e, and enhanced tBID generation, cleaved CASPASE 3/9 activation and PARP1 cleavage. These results demonstrate that SENP3 promotes renal tubular apoptosis through its deSUMOylate activity, primarily via activation of the intrinsic apoptosis pathway \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec-g\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of SUMO2/3-Modified ASS1 as a Key SENP3 Substrate in Renal IRI\u003c/h2\u003e \u003cp\u003eBuilding on our findings that SENP3-mediated deSUMOylation promotes apoptosis, we sought to identify critical SUMO2/3-conjugated protein substrates involved in IRI pathogenesis using a comprehensive proteomic approach. We first screened SUMO23 substrate via performed IP from kidney lysates of IRI-AKI mice with/without SENP3 deficiency, and identified 16 potential SUMO2/3 targets by quantitative mass spectrometry (\u003cb\u003eFigure S6\u003c/b\u003e). We compared the biological functions of these proteins and their distribution characteristics in kidney tissues \u003cb\u003e(Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e)\u003c/b\u003e, the associated studies of these proteins with pathogenic mechanism, and then comprehensively evaluated all the information. Arginosuccinate synthase 1 (ASS1) is a rate-limiting enzyme responsible for arginine biosynthesis in the urea cycle, and highly expressed in the kidney, especially in the proximal tubule cells. It has been reported that ASS1 expression inhibited fibroblast cell proliferation\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Loss of ASS1 and arginine auxotrophy were found in several types of tumors and ASS1 overexpression effectively inhibited tumor cell growth with an increase in apoptosis\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Thus, we finally selected ASS1 for further study \u003cb\u003e(Figure S7)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eThen we confirmed that ASS-SUMO2/3 conjugation in WT kidneys decreased post-IRI (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). We further recapitulated this finding in TCMK1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). In the same way, the ASS1 interacted with SENP3 and this connection was enhanced during H/R \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, d\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eTo identify potential SUMOylation sites of ASS1 (NP_031520.1, P16460), we employed three prediction algorithms: SUMOplot Analysis Program, JASSA and GPS-SUMO (\u003cb\u003eFigure S8\u003c/b\u003e). Previous studies have reported 19 SUMOylation sites in human \u003cem\u003eASS1\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Given the high sequence homology between human \u003cem\u003eASS1\u003c/em\u003e and mouse \u003cem\u003eAss1\u003c/em\u003e, we cross-referenced these reported SUMOylation sites with our prediction results after performing a BLAST alignment of their amino acid sequences. Based on this integrated analysis, we selected five candidate lysine residues\u0026minus; K215, K228, K239, K310, and K348\u0026minus;for experimental validation. Each site was individually mutated to arginine (R) to assess its role in SUMOylation. The interaction between exogenous ASS1, SUMO2/3 and SENP3 was confirmed firstly in HEK-293T cells \u003cb\u003e(Figure S9)\u003c/b\u003e. Our findings suggest that K239 and K310 are likely the primary modification sites, as the K239R and K310R mutations significantly reduced ASS1 SUMO2/3 modification levels, whereas mutations at K215, K228 and K348 had minimal impact \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee\u003cb\u003e)\u003c/b\u003e. To further confirm these results, we generated a FLAG-tagged ASS1 double mutant (K239R/K310R, designated 2KR) and co-transfected it into HEK-293T cells with HA-tagged UBC9, His-tagged SENP3 or MYC-tagged SUMO2/3. Consistent with our earlier observations, the 2KR mutation markedly diminished SUMO2/3 modification of ASS1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). Moreover, the 2KR mutation disrupted the interaction between ASS1 and SENP3 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg\u003cb\u003e)\u003c/b\u003e. In summary, our data demonstrate that ASS1 undergoes SUMO2/3 modification primarily at K239 and K310, and this modification is reversed by SENP3-mediated deSUMOylation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSENP3-Dependent DeSUMOylation is Required for ASS1 Nuclear accumulation\u003c/h2\u003e \u003cp\u003eUnder basal conditions, ASS1 localizes to both the cytosol and nucleus, whereas SENP3 and SUMO2/3 are predominantly nuclear. Following H/R treatment, we observed increased nuclear accumulation of ASS1 accompanied by a concomitant decrease in its cytosolic levels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea; \u003cb\u003eFigure S10a, b)\u003c/b\u003e. Notably, nuclear ASS1 was primarily in a deSUMOylated state \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. To investigate the role of SENP3-mediated deSUMOylated in ASS1 nuclear translocation, we performed subcellular fraction assays. siRNA mediated knockdown of SENP3 in TCMK1 cells reduced nuclear ASS1 level and partially suppressed H/R-induced ASS1 nuclear accumulation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec-e, \u003cb\u003eFigureS10c, d)\u003c/b\u003e. Conversely, SENP3 overexpression further enhanced nuclear ASS1 accumulation. However, transfection of a catalytically inactive mutant (SENP3-C526S) failed to promote ASS1 nuclear translocation, with effects comparable to baseline SENP3 levels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef-h, \u003cb\u003eFigure S10e, f)\u003c/b\u003e. Consistent with these findings, ASS1 nuclear accumulation also observed in renal PETCs following IRI \u003cb\u003e(Figure S11)\u003c/b\u003e. Collectively, these data demonstrate that H/R-induced nuclear accumulation of ASS1 in TCMK1 cells is dependent on SENP3-mediated deSUMOylation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eASS1 DeSUMOylation Induced Apoptosis by Enhancing p53 Transcriptional Activity\u003c/h2\u003e \u003cp\u003eBased on our findings, ASS1 accumulates in the nucleus following IRI or H/R in a SENP3-dependent deSUMOylation manner. Notably, pharmacological inhibition of ASS1 using MDLA, even in the absence of SENP3 deficiency, significantly attenuated H/R-induced apoptosis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea; \u003cb\u003eFigure S12)\u003c/b\u003e. To further validate these observations, we performed ASS1 knockdown in TCMK1 cells using siRNA. As expected, ASS1 silencing remarkably alleviated H/R-induced cellular apoptosis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb, c\u003cb\u003e).\u003c/b\u003e Similarly, ASS1-deficiency TCMK1 cells exhibited decreased expression of pro-apoptotic proteins \u003cb\u003e(Figure S13;\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed-g\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWhile these results establish a clear association between nuclear deSUMOylated ASS1 and apoptosis, the underling molecular mechanism required further investigation. Previous studies have demonstrated that severe hypoxia triggers p53 accumulation, which regulates downstream targets to promote mitochondria-dependent apoptosis, and the expression of BID is regulated by p53\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. We therefore hypothesized that nuclear deSUMOylated ASS1 enhanced apoptosis by promoting \u003cem\u003eTrp53\u003c/em\u003e transactivation. H/R treatment increased the co-localization of p53 and ASS1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eh\u003cb\u003e)\u003c/b\u003e, and enhanced \u003cem\u003eTrp53\u003c/em\u003e transcriptional activity. However, these effects were attenuated by either SENP3 or ASS1 knockdown \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ei-j\u003cb\u003e)\u003c/b\u003e. In vivo studies confirmed that SENP3 deficiency reduced p53 expression in renal tissue following IRI \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ek, \u003cb\u003eFigure S14)\u003c/b\u003e. Conversely, SENP3 overexpression of further amplified \u003cem\u003eTrp53\u003c/em\u003e transcription after H/R treat, while catalytically inactive SENP3-C526S mutant showed effects comparable to SENP3-WT \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003el\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eComplementary mRNA sequencing analysis of H/R-treated TCMK1 cells revealed significant upregulation of \u003cem\u003eTrp53\u003c/em\u003e and its downstream target \u003cem\u003eBid\u003c/em\u003e \u003cb\u003e(Figure S15)\u003c/b\u003e. These findings were further validated by RT-qPCR analysis demonstrating SENP3 deSUMOylation-dependent regulation of Bid expression that paralleled Trp53 transcriptional activation \u003cb\u003e(Figure S16)\u003c/b\u003e. In summary, our data demonstrate that SENP3-mediated deSUMOylation of ASS1 promotes its nuclear accumulation, which in turn enhanced \u003cem\u003eTrp53\u003c/em\u003e transcriptional activity and ultimately induces apoptosis following IRI.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eProtein SUMOylation plays critical roles in pathophysiology of various diseases, and represents a promising therapeutic target. In this study, we identified ASS1 as a novel SUMO-modified protein involved in IRI. Our findings demonstrate that SENP3-mediated deSUMOylation of SUMO2/3-conjugated ASS1 promotes apoptosis in PTECs following ischemic/hypoxic stress.\u003c/p\u003e \u003cp\u003eThe functional consequences of SUMOylation in AKI appear to be context-dependent, varying by etiology, specific SUMO isoforms, regulatory SENP proteases, and substrate proteins. Previous studies have shown dynamic changes in protein SUMOylation during ischemic AKI, with SUMO1- and SUMO2/3-modified proteins increasing modestly after 30 minutes of ischemia but dramatically after 8 hours of reperfusion, before disappearing during the 24-48-hour perfusion period\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. In folic acid- and IRI induced-AKI models, increased SUMO1 conjugation to Sirt3 was observed, and SENP1-mediated deSUMOylation of Sirt3 ameliorate kidney injury\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Interesting, while global SUMOylation inhibition sensitized renal cells to apoptosis in cisplatin-induced nephrotoxic\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, and SENP1 deficiency exacerbated cisplatin-induced renal damage \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. In contrast, our study reveals a cytoprotective role for SUMO2/3-modified ASS1 in SENP3-deficient IRI-AKI model, highlighting the complex, substrate-specific nature of SUMOylation in renal pathophysiology.\u003c/p\u003e \u003cp\u003eEmerging evidence implicates SUMOylation, particular SUMO2/3 conjugation, in cellular responses to ischemic and hypoxic stress \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Although SUMO2 and SUMO3 share near-identical sequence (referred to as SUMO2/3), SUMO2 is a more abundant isoform than SUMO3 in mammals, and can compensate for most SUMO1 function \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. These observations underscore the importance of identifying specific SUMO2/3 target proteins in renal IRI, with our findings suggesting that enhancing ASS1 SUMOylation may represent a novel therapeutic strategy for IRI-induced AKI.\u003c/p\u003e \u003cp\u003eUnder basal conditions, most SUMO targets exhibit low modification levels but undergo rapid SUMOylation cycle, where even minimal modifications can exert significant effects. Nuclear SUMOylation typically suppresses transcription through modification of transcription factors and cofactors\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. However, exceptions exist- oxidative stress-induces SUMOylation of TP53INP1 is required for activation of p53 activation and subsequently apoptosis\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. In cerebral IRI, blocking ANXA1 deSUMOylation reduces apoptosis by inhibiting the transcription activity of p53\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Our study adds to this complexity by demonstrating that nuclear accumulation of deSUMOylated ASS1 following H/R enhances p53 transcriptional activity.\u003c/p\u003e \u003cp\u003eSeveral limitations warrant consideration. First, while we identified 16 potential SUMO2/3-modified proteins in IRI-induced apoptosis, we focus exclusively on ASS1 based on bioinformatic analysis. Other candidates may also play also contribute to this process. Second, although we established SENP3-dependent nuclear accumulation of deSUMOylated ASS1 post-H/R, the precise molecular mechanisms require further investigation.\u003c/p\u003e \u003cp\u003eIn conclusion, our study highlights the critical importance of SUMOylation homeostasis in renal protection and identifies SUMO2/3-modified ASS1 as a key regulator in IRI-induced AKI. We propose a novel apoptotic pathway in PTECs wherein ischemia/reperfusion triggers SENP3-mediated ASS1 deSUMOylation, leading to nuclear accumulation and enhanced p53 transcriptional activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). These findings provide new insights into the molecular mechanisms of renal IRI and suggest potential therapeutic targets for AKI intervention.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal Experiments\u003c/h2\u003e \u003cp\u003e\u003cem\u003eSenp3\u003c/em\u003e\u003csup\u003e\u003cem\u003eflox/flox\u003c/em\u003e\u003c/sup\u003e mice (provided by Prof. Jing Yi and Prof. Jie Yang, Shanghai Jiao Tong University School of Medicine, China) were crossed with \u003cem\u003eGgt1\u003c/em\u003e\u003csup\u003e\u003cem\u003eCre\u003c/em\u003e\u003c/sup\u003e mice (provided by Prof. Huijuan Wu, School of Basic Medical Sciences, Fudan University, China) to generate proximal tubule-specific \u003cem\u003eSenp3\u003c/em\u003e knockout mice (\u003cem\u003eSenp3\u003c/em\u003e\u003csup\u003e\u003cem\u003eflox/flox\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e-Ggt1\u003c/em\u003e\u003csup\u003e\u003cem\u003eCre\u003c/em\u003e\u003c/sup\u003e, CKO) and littermate controls (\u003cem\u003eSenp3\u003c/em\u003e\u003csup\u003e\u003cem\u003eflox/flox\u003c/em\u003e\u003c/sup\u003e, WT). Mice were housed under specific-pathogen-free conditions (20\u0026ndash;24℃, 50%-60% humidity, 12-h light/dark cycle). For IRI-AKI modeling, 8-10-week-old male mice underwent right nephrectomy followed by left renal pedicle clamping (30min) or sham surgery. Reperfusion was confirmed by kidney color recovery\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Mice were euthanized 24 h post-reperfusion, serum and kidneys were collected. All procedures were approved by the Committees for Animal Experiments of Zhejiang University.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell Culture and Interventions\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eCell Culture and Interventions\u003c/div\u003e \u003cp\u003eHEK293T (RRID: CVCL_0063) and TCMK1 (RRID: CVCL_2772) cells were provided by Servicebio Technology Co., Ltd. (STCC10301G, STCC20015G), and were identified by short tandem repeat (STR) profiling. All the cells used have undergone quality testing, and there were no detections of bacteria, fungi or mycoplasma. TCMK1 cells were cultured in RPMI 1640 and HEK-293T in DMEM (10% FBS, 1% penicillin/streptomycin) at 37 ℃ (21% O\u003csub\u003e2\u003c/sub\u003e, 5% CO\u003csub\u003e2\u003c/sub\u003e). Hypoxia/reoxygenation (H/R) was induced in TCMK1 cells by serum starvation (overnight), hypoxia (0.1% O\u003csub\u003e2\u003c/sub\u003e, 3 h), and reoxygenation (21% O\u003csub\u003e2\u003c/sub\u003e, 24h).\u003c/p\u003e \u003cp\u003eFor functional studies: Lentiviral transduction: SENP3-WT-HIS, SENP3-C526S-HIS (catalytically inactive mutant), or empty vector (72h; Vigen). siRNA knockdown: SENP3 (GenePharma Technology Co., Ltd., S: ACAGCUUCUUCUAUGAUAATT, AS: UUAUCAUAGAAGAAGCUGUUG) or ASS1 (Sangon Biotech Co., Ltd., S: CUGAUGGAGUAUGCAAAGCAA, AS: UUGCUUUGCAUACUCCAUCAG) siRNA (24h). Pharmacological inhibition: ASS1 inhibitor α-Methyl-DL-aspartic acid (MDLA, 20 mM, 24h; MCE, HY-W142119)\u003c/p\u003e\n\u003ch3\u003eRenal Function and Histopathology\u003c/h3\u003e\n\u003cp\u003eSerum creatinine and BUN were measured (FUJIDRI-CHEM 7000i). Kidney sections (4 \u0026micro;m) were stain with Hematoxylin and Eosin (H\u0026amp;E) and Periodic Acid-Schiff (PAS). Tubular damage was scored (0\u0026ndash;4) based on brush border loss, dilatation and disruption, epithelial flattened and cell sloughing.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence and TUNEL assay\u003c/h3\u003e\n\u003cp\u003ePFA-fixed samples were permeabilized (0.5% Triton X-100), blocked (5% BSA), and incubated with primary antibodies (SENP3, #5591, CST; ASS1, 16210-1-AP, Proteintech; LTL, L32480, Invitrogen; P53, 60283-2-Ig, Proteintech) followed by DAPI. TUNEL staining (APO001 kit, Multi Sciences) dected apoptotic cells. Images were acquired via confocal microscope (Nikon A1 Ti/Zeiss LSM 900) and analyzed with ImageJ.\u003c/p\u003e\n\u003ch3\u003eWestern Blot and Immunoprecipitation (IP)\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern Blot and Immunoprecipitation (IP)\u003c/div\u003e \u003cp\u003eProteins were extracted using RIPA lysis buffer (with 1 mM PMSF), Pierce\u0026trade; IP lysis buffer (Thermos scientific, 87787), or nuclear/cytoplasmic freaction kits (Beyotime, P0027). Protein samples were separated by SDS-PAGE, and were subsequently transferred onto PVDF membranes. Blots were incubated with 5% fat-free milk in TBS containing 1% Tween for 1 h, and incubated with primary antibodies at 4 ℃ overnight. Then the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies.\u003c/p\u003e \u003cp\u003eFor IP, lysates were incubated with the indicated primary antibodies or IgG in combination with protein A/G beads (Beyotime, P2108) overnight (4 ℃), washed and eluted for immunoblotting. The SUMO2/3-conjugated proteins identification was performed by LC-MS using a Thermo Fusion Lumos, and analyzed by Proteome Discoverer software 2.1.\u003c/p\u003e \u003cp\u003ePrimary antibodies: SENP3(#5591, CST), SUMO2/3 (ab81371, Abcam), ASS1 (16210-1-AP, Proteintech), GAPDH (60004-1-Ig, Proteintech), HA (AE105, ABclonal), MYC (19C2, ABmart), FLAG (20543-1-AP, Proteintech), HIS (66005-1-IG, Proteintech), BID/tBID (10988-1-AP, Proteintech; A0210, ABclonal), Cleaved CASPASE-3 (19677-1-AP, Proteintech, A19654, ABclonal), Cleaved CASPASE-9 (10380-1-AP, Proteintech), Cleaved CASPASE-8 (66093-1-Ig, Proteintech) and cleaved PARP1 (13371-1-AP, Proteintech; A22535, ABclonal), P53 (60283-2-Ig, Proteintech).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eqRT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted (Accurate Biology, AG21023), reverse-transcribed to cDNA with gDNA clean for qPCR (Evo M-MLV RT Mix kit, Accurate Biology, AG11728), and amplified (SYBR Green Premix PCR Master Mix, Accurate Biology, AG11701) on a CFX96 instrument (Bio-Rad).\u003c/p\u003e \u003cp\u003ePrimers: \u003cem\u003eSenp3\u003c/em\u003e, 5\u0026rsquo;-CCTGCTGTCGTTTTGACTCC-3\u0026rsquo; (forward) and 5\u0026rsquo;-GTCCACCTTAGTCCATCTTCCT-3\u0026rsquo; (reverse); \u003cem\u003eNgal\u003c/em\u003e, 5\u0026rsquo;-TGGCCCTGAGTGTCATGTG-3\u0026rsquo; (forward) and 5\u0026rsquo;-CTCTTGTAGCTCATAGATGGTGC-3\u0026rsquo; (reverse); \u003cem\u003eKim-1\u003c/em\u003e, 5\u0026rsquo;-CCTTGTGAGCACCGTGGCTA-3\u0026rsquo; (forward) and 5\u0026rsquo;-TGTTGTCTTCAGCTCGGGAATG-3\u0026rsquo; (reverse); \u003cem\u003eBid\u003c/em\u003e, 5\u0026rsquo;-GCCTGTCGGAGGAAGACAAA-3\u0026rsquo; (forward) and 5\u0026rsquo;-GTGGAAGACATCACGGAGCA-3\u0026rsquo; (reverse), and\u003cem\u003eβ-Actin\u003c/em\u003e, 5\u0026rsquo;-GTGACGTTGACATCCGTAAAGA-3\u0026rsquo; (forward) and 5\u0026rsquo;-GCCGGACTCATCGTACTCC-3\u0026rsquo; (reverse).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFlow cytometry assay\u003c/h3\u003e\n\u003cp\u003e10^5 cells were collected and centrifuged at 300 g for 5 min and the supernatant was discarded. And the pellet was resuspended in 500 \u0026micro;L 1\u0026times;binding buffer, and later incubated with 5 \u0026micro;L FITC-conjugated Annexin V and 10 \u0026micro;L propidium iodide (PI) for 5 min at 37 ℃ in the dark. The sample were analyzed by a flow cytometer (BD Bioscience).\u003c/p\u003e\n\u003ch3\u003eLuciferase reporter assay\u003c/h3\u003e\n\u003cp\u003eTCMK1 cells were co-transfected with pGL3-Luc (with p53 binding cis-element) plasmid and Prl-tk Renilla luciferase plasmid before establishing hypoxia/re-oxygenation (H/R) model. The cells were collected for luciferase assay (Dual Luciferase Reporter Assay Kit, Vazyme, DL101) and normalized to the Renilla.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll experiments were repeated at least 3 times. Data are mean \u0026plusmn; SEM (n\u0026thinsp;\u0026ge;\u0026thinsp;3) and analyzed using GraphPad Prism 9.3. T-test was used to compare the difference in two groups. One-way ANOVA test or Two-way ANOVA test was used to compare between multiple groups. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgments\u003c/h2\u003e\n\u003cp\u003eWe appreciate the gift of the \u003cem\u003eSenp3\u003c/em\u003e\u003csup\u003eflox/flox\u003c/sup\u003e mice from Prof. Jing Yi and Prof. Jie Yang, Shanghai Jiao Tong University School of Medicine, China.\u003c/p\u003e\n\u003ch2\u003eConflict of Interest Statement\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflict of interests.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution Statement\u003c/h2\u003e\n\u003cp\u003eYi Yang and Weiqiang Lin conceived and designed the experiments. Hongju Wang, Cui Gao, Lini Jin, Longlong Wu, Qian Zhang, Jingjuan Yang and Hong Pan performed experiments. Hongju Wang, Cui Gao, Yi Yang, Weiqiang Lin and Huijuan Wu analyzed results and interpretation. Cui Gao wrote the manuscript. \u0026nbsp;Yi Yang, Weiqiang Lin, Huijuan Wu, and Pattarin Tangtanatakul supervised the study and revised the manuscript. All authors approved the final version of the manuscript.\u003c/p\u003e\n\u003ch2\u003eEthics Statement\u003c/h2\u003e\n\u003cp\u003eAll procedures on mice were approved by the Committees for Animal Experiments of Zhejiang University.\u003c/p\u003e\n\u003ch2\u003eFunding Statement\u003c/h2\u003e\n\u003cp\u003eThis work was supported by grants from the National Nature Science Foundation (82170681 and 82270704), Zhejiang Provincial Nature Science Foundation of China (No. LZ24H050001 and No. LZ22H050001), and Zhejiang provincial program for the Cultivation of High-level Innovative Health talents.\u003c/p\u003e\n\u003ch2\u003eData Availability Statement\u003c/h2\u003e\n\u003cp\u003eThe mass spectrometry data and RNA sequence date are in progress for inclusion in the Proteomics identification database (PRIDE) and National Center for Biotechnology Information (NCBI), the project accession numbers will be made available before manuscript acceptance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChang HM, Yeh ETH. SUMO: FROM BENCH TO BEDSIDE. PHYSIOLOGICAL REVIEWS 2020; 100(4): 1599\u0026thinsp;\u0026ndash;\u0026thinsp;619.DOI.10.1152/physrev.00025.2019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang C, Han Y, Wang Y, et al. SENP3 is responsible for HIF-1 transactivation under mild oxidative stress via p300 de-SUMOylation. EMBO JOURNAL 2009; 28(18): 2748-62.DOI.10.1038/emboj.2009.210.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai Z, Wang Z, Yuan R, et al. Redox-sensitive enzyme SENP3 mediates vascular remodeling via de-SUMOylation of β-catenin and regulation of its stability. EBIOMEDICINE 2021; 67.DOI.10.1016/j.ebiom.2021.103386.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Wang J, Yang P, et al. SENP3 sensitizes macrophages to ferroptosis via de-SUMOylation of FSP1. REDOX BIOLOGY 2024; 75.DOI.10.1016/j.redox.2024.103267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVertegaal ACO. Signalling mechanisms and cellular functions of SUMO. NATURE REVIEWS MOLECULAR CELL BIOLOGY 2022; 23(11): 715\u0026thinsp;\u0026ndash;\u0026thinsp;31.DOI.10.1038/s41580-022-00500-y.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Z-J, Feng Y-H, Gu B-H, Li Y-M, Chen H. The post-translational modification, SUMOylation, and cancer (Review). INTERNATIONAL JOURNAL OF ONCOLOGY 2018; 52(4): 1081-94.DOI.10.3892/ijo.2018.4280.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheng Z, Zhu J, Deng Y-n, Gao S, Liang S. SUMOylation modification-mediated cell death. OPEN BIOLOGY 2021; 11(7).DOI.10.1098/rsob.210050.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlotho A, Melchior F. Sumoylation: A Regulatory Protein Modification in Health and Disease. In: Kornberg RD, ed. ANNUAL REVIEW OF BIOCHEMISTRY, VOL 82; 2013: 357\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, He Y, Wang X, et al. Protein SUMOylation modification and its associations with disease. OPEN BIOLOGY 2017; 7(10).DOI.10.1098/rsob.170167.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang CH, Yang TT, Lin K. Mechanisms and functions of SUMOylation in health and disease: a review focusing on immune cells. JOURNAL OF BIOMEDICAL SCIENCE 2024; 31(1).DOI.10.1186/s12929-024-01003-y.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Luo Y, Wang S, Zhu H, Li D. Roles and mechanisms of SUMOylation on key proteins in myocardial ischemia/reperfusion injury. JOURNAL OF MOLECULAR AND CELLULAR CARDIOLOGY 2019; 134: 154\u0026thinsp;\u0026ndash;\u0026thinsp;64.DOI.10.1016/j.yjmcc.2019.07.009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Xie P, Dong Y, An W. Inhibition of Drp1 SUMOylation by ALR protects the liver from ischemia-reperfusion injury. CELL DEATH AND DIFFERENTIATION 2021; 28(4): 1174-92.DOI.10.1038/s41418-020-00641-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Q, Que MX, Zhan GF, et al. SENP6-Mediated deSUMOylation of Nrf2 Exacerbates Neuronal Oxidative Stress Following Cerebral Ischemia and Reperfusion Injury. ADVANCED SCIENCE 2025; 12(7).DOI.10.1002/advs.202410410.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi O, Ma Q, Li F, Cai G-Y, Chen X-M, Hong Q. Progress of small ubiquitin-related modifiers in kidney diseases. Chinese Medical Journal 2019; 132(4):\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHavasi A, Borkan SC. Apoptosis and acute kidney injury. KIDNEY INTERNATIONAL 2011; 80(1): 29\u0026ndash;40.DOI.10.1038/ki.2011.120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePriante G, Gianesello L, Ceol M, Del Prete D, Anglani F. Cell Death in the Kidney. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES 2019; 20(14).DOI.10.3390/ijms20143598.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo C, Wei Q, Su Y, Dong Z. SUMOylation occurs in acute kidney injury and plays a cytoprotective role. BIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE 2015; 1852(3): 482-9.DOI.10.1016/j.bbadis.2014.12.013.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu M, He J, Xu Y, et al. AMPK activation coupling SENP1-Sirt3 axis protects against acute kidney injury. MOLECULAR THERAPY 2023; 31(10): 3052-66.DOI.10.1016/j.ymthe.2023.08.014.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen SQ, Li JM, Liang Y, et al. β-catenin-inhibited Sumoylation modification of LKB1 and fatty acid metabolism is critical in renal fibrosis. CELL DEATH \u0026amp; DISEASE 2024; 15(10).DOI.10.1038/s41419-024-07154-y.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiao J, Zhu HH, Wang JN, Chen JH, Han F, Lin WQ. Experimental models for preclinical research in kidney disease. ZOOLOGICAL RESEARCH 2024; 45(5): 1161-74.DOI.10.24272/j.issn.2095-8137.2024.072.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong Y, Zhang Z, Cheng Y, et al. Hypoxia-induced NFATc3 deSUMOylation enhances pancreatic carcinoma progression. Cell Death \u0026amp; Disease 2022; 13(4): 413.DOI.10.1038/s41419-022-04779-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi JM, Yang DC, Oldham J, et al. Therapeutic targeting of argininosuccinate synthase 1 (ASS1)-deficient pulmonary fibrosis. Mol Ther 2021; 29(4): 1487\u0026thinsp;\u0026ndash;\u0026thinsp;500.DOI.10.1016/j.ymthe.2021.01.028.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim S, Lee M, Song Y, et al. Argininosuccinate synthase 1 suppresses tumor progression through activation of PERK/eIF2α/ATF4/CHOP axis in hepatocellular carcinoma. Journal of Experimental \u0026amp; Clinical Cancer Research 2021; 40(1): 127.DOI.10.1186/s13046-021-01912-y.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHendriks IA, Lyon D, Young C, Jensen LJ, Vertegaal ACO, Nielsen ML. Site-specific mapping of the human SUMO proteome reveals co-modification with phosphorylation. Nature Structural \u0026amp; Molecular Biology 2017; 24(3): 325\u0026thinsp;\u0026ndash;\u0026thinsp;36.DOI.10.1038/nsmb.3366.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSax JK, Fei P, Murphy ME, Bernhard E, Korsmeyer SJ, El-Deiry WS. BID regulation by p53 contributes to chemosensitivity. Nature Cell Biology 2002; 4(11): 842-9.DOI.10.1038/ncb866.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Gao X, Tang X, et al. SENP1 protects cisplatin-induced AKI by attenuating apoptosis through regulation of HIF-1α. Experimental Cell Research 2022; 419(1): 113281.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eDOI.https://doi.org/10.1016/j.yexcr.2022.113281\u003c/span\u003e\u003cspan address=\"DOI.10.1016/j.yexcr.2022.113281\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeters M, Wielsch B, Boltze J. The role of SUMOylation in cerebral hypoxia and ischemia. Neurochem Int 2017; 107: 66\u0026ndash;77.DOI.10.1016/j.neuint.2017.03.011.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFilippopoulou C, Simos G, Chachami G. The Role of Sumoylation in the Response to Hypoxia: An Overview. Cells 2020; 9(11).DOI.10.3390/cells9112359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Wansleeben C, Zhao S, Miao P, Paschen W, Yang W. SUMO2 is essential while SUMO3 is dispensable for mouse embryonic development. EMBO reports 2014; 15(8): 878-\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e85-85.DOI.https://doi.org/10.15252/embr.201438534\u003c/span\u003e\u003cspan address=\"85-85.DOI.10.15252/embr.201438534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNhat-Tu L, Martin JF, Fujiwara K, Abe J-i. Sub-cellular localization specific SUMOylation in the heart. BIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE 2017; 1863(8): 2041-55.DOI.10.1016/j.bbadis.2017.01.018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeuget S, Bonacci T, Soubeyran P, Iovanna J, Dusetti NJ. Oxidative stress-induced p53 activity is enhanced by a redox-sensitive TP53INP1 SUMOylation. Cell Death Differ 2014; 21(7): 1107-18.DOI.10.1038/cdd.2014.28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Zhao Y, Xia Q, et al. Nuclear translocation of annexin 1 following oxygen-glucose deprivation-reperfusion induces apoptosis by regulating Bid expression via p53 binding. Cell Death Dis 2016; 7(9): e2356.DOI.10.1038/cddis.2016.259.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Q, Mao M, Zeng Z, et al. Inhibition of SENP6 restrains cerebral ischemia-reperfusion injury by regulating Annexin-A1 nuclear translocation-associated neuronal apoptosis. Theranostics 2021; 11(15): 7450-70.DOI.10.7150/thno.60277.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"SUMOylation, ischemia-reperfusion injury, ASS1, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-6609361/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6609361/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe balance between SUMOylation and deSUMOylation critically regulate cellular apoptosis, with SUMO-modified proteins implicated in ischemia/hypoxia injury. However, the specific contributions of SUMO-conjugated proteins in renal ischemia-reperfusion injury (IRI) remain poorly defined. SUMOylation in IRI was investigated Using proximal tubular-specific \u003cem\u003eSenp3\u003c/em\u003e conditional knockout (CKO) mice. While SENP3-deficiency did not induce tubular injury under basal conditions, its significantly attenuated renal damage following IRI. SUMOylation conferred protection against apoptosis in renal tubular epithelia cells during ischemia/hypoxia. Mass spectrometry revealed arginosuccinate synthase 1 (ASS1) as a key SUMO2/3 target (modified at K239 and K310) in IRI progression. Mechanistically, SENP3-mediated deSUMOylation promoted ASS1 nuclear accumulation in post-IRI tubular epithelial cells, subsequently activating the intrinsic apoptosis pathway via p53-dependent transcriptional upregulation. These findings nominate the SENP3-ASS1-p53 axis as a potential therapeutic target for renal IRI.\u003c/p\u003e","manuscriptTitle":"SENP3 promotes renal tubular epithelial cell apoptosis after ischemia-reperfusion injury via ASS1 deSUMOylation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-25 12:12:33","doi":"10.21203/rs.3.rs-6609361/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c233b2e6-973e-41f0-95be-fdc4f4fdd5bc","owner":[],"postedDate":"June 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":48385645,"name":"Health sciences/Diseases/Kidney diseases"},{"id":48385646,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-01-23T08:15:29+00:00","versionOfRecord":{"articleIdentity":"rs-6609361","link":"https://doi.org/10.1038/s41419-025-08308-2","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2025-12-05 05:00:00","publishedOnDateReadable":"December 5th, 2025"},"versionCreatedAt":"2025-06-25 12:12:33","video":"","vorDoi":"10.1038/s41419-025-08308-2","vorDoiUrl":"https://doi.org/10.1038/s41419-025-08308-2","workflowStages":[]},"version":"v1","identity":"rs-6609361","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6609361","identity":"rs-6609361","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.