Meloidogyne vitis, a new infecting nematode species on mulberry in Yunnan, China

Meloidogyne vitis, a new infecting nematode species on mulberry in Yunnan, China | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Meloidogyne vitis, a new infecting nematode species on mulberry in Yunnan, China Yanmei Yang, Xinghua Yu, Dehong Tang, Wendong Xu, Zhengyu Zhang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8170667/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 14 You are reading this latest preprint version Abstract Background Mulberry is an economically important sericulture crop, however, root-knot nematodes (RKNs) infection pose a serious threat to the production of mulberry. We found a high density RKNs parasitizing mulberry in Yunnan, China. In order to clarify the pathogenic species, the morphometric traits and measurements, rDNA/mtDNA-based phylogenetic relationships of this nematode and SCAR-PCR analysis were used to identify RKNs, and the mulberry healthy seedlings were inoculated artificially with second-stage juveniles to research pathogenicity. Results The perineal pattern of females is round to ovoid with a moderately high dorsal arch and two large and prominent phasmids, similar to Meloidogyne vitis . The morphological characteristics and morphometric values of females, second-stage juveniles and males were similar to M. vitis . The nucleotide sequence of rDNA ITS1-5.8S-ITS2, mtDNA coxI and coxII of this nematode were highly similar to M. vitis , with a similarity of more than 99%, and all were clustered within the same clade with those of M. vitis with a high support rate of 100%. Moreover, species identity was further confirmed using M. vitis -specific primers Mv-F/R, a single specific fragment of 174 bp was obtained. Artificial inoculation showed that the RKN isolated and purified from mulberry could complete its life history in the roots of healthy seedlings of mulberry, and produced typical root-knot and egg masses. Conclusions The RKN parasitizing in mulberry was confirmed as M. vitis based on the morphological features and molecular results. This is the first report of M. vitis attacking mulberry. M. vitis could infect and damage mulberry and may constitute a potential threat to mulberry production. The results of this study providing a theoretical basis for accurately identifying and implementing future effective and integrated nematodes management strategy to safeguard mulberry cultivation. Meloidogyne vitis Mulberry (Morus spp.) New host plant Phylogenetic relationship Pathogenicity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background Mulberry ( Morus spp.) is the Moracea family of the genus Morusis, an economically important sericulture crop and has primer importance in the sericulture industry as it is the only food to feed silkworm [ 1 , 2 ]. The Chinese Ministry of Health classifies it as one of the “food and medicine” agricultural products [ 3 ]. Mulberry leaf and mulberry fruit also have numerous biological function as a potential source of medicinally active chemicals, such as regulating sugar and lipid metabolism, reducing blood glucose, anti-inflammatory, anti-cancer and anti-hyperlipidemia [ 4 , 5 ]. Mulberry is widely grown in Asia, North America, Africa and Europe, including India, Japan, China, Korea and other countries [ 6 ], and the cultivation area of Mulberry in China spans over 100000 hectares [ 7 ]. Yunnan is one of the major provinces for the mulberry cultivation in China, mulberry industry plays an important role in the agricultural. However, various pathogens, including root-knot nematodes (RKNs), pose a serious threat to the production of mulberry worldwide. At present, mulberry RKN disease has been discovered in mulberry planting areas at home and abroad. In China, Tian reported that six RKNs species ( M. incognita , M. arenaria , M. javanica , M. hapla , M. mali , M. thamesi ) were found to damage mulberry [ 8 ]. Among them, the RKNs were found in Shandong province, Shanxi province, Zhejiang province and Yunnan provinces, mainly were M. incognita and M. arenaria [ 9 – 12 ]. Luo et al . reported that the mulberry in the Huanan zone of Guangzhou City were infected by M. enterolobii [ 13 ]. Liu et al . reported that the pathogen of mulberry RKNs collected from mulberry orchard in Guangdong, Guangxi, Hainan and Yunnan Province were M. enterolobii [ 14 ]. In other countries, the mulberry RKNs disease were found in Japan [ 15 , 16 ], India [ 17 ], Spain [ 18 ], Brazil [ 19 ], Saudi Arabia [ 20 ] and other countries, the pathogenic RKNs species include M. suginamiensis , M. incognita , M. arenaria , M. hapla , M. mali , M. enterolobii and Meloidodera sp. Plant-parasitic nematodes can diminish global food production by approximately 12.3%, leading to annual economic losses of nearly $ 173 billion [ 21 ]. RKNs rank first among the top ten plant-parasitic nematodes [ 22 ] and are one of the greatest threats to agriculture production [ 23 ], the mulberry destroyed by RKNs presented stunted growth, yellowing leaves, severe root gall, which directly affects the absorption of water and nutrients and leading to a great reductions in mulberry productivity. Lei et al . reported that RKNs disease could reduce the yield of mulberry by approximately 20%-30%, the protein content in mulberry leaves also decreased, and the leaf quality was affected [ 24 ]. In addition to the direct harm caused by nematodes, it also induces and promotes fungal diseases, bacterial diseases, viral diseases and other diseases. Kumari et al . reported that root knot disease caused by Meloidogyne incognita is a serious one and causes 10%-12% leaf yield loss [ 25 ]. Given that mulberry are seriously damaged by RKNs, thus, accurate identification of Meloidogyne species populations and their pathogenic race characterization are critical for designing effective control measures in the context of sustainability and integrated pest management [ 26 , 27 ]. In Yunnan, we found a serious mulberry RKNs disease, root samples was collected for Meloidogyne species identification, morphological methods (morphological observation and morphometric measurement of females, males, second-stage juveniles and perineal pattern) and molecular biological methods (rDNA-ITS PCR, mtDNA-coxI PCR, mtDNA-coxII PCR, BLAST alignment and phylogenetic tree construction) were used to identify this RKNs species. Furthermore, the pathogenicity of this nematode was further determined by artificial inoculation. The results of this research will provide a theoretical guidance basis for the prevention and control of mulberry RKNs disease. Results Disease symptoms induced by root-knot nematodes The aboveground part of the nematode-infected mulberry showed poor plant growth and leaf yellowing and shedding (Fig. 1A-C), while the underground part showed obvious symptoms, with severe swollen root knots and the roots were atrophied and distorted, including axial roots and branch roots; The root knots were uneven in size and long were beaded; The surface of the root knots presented milky white or yellowish-brown egg mass, the seriously nematode-infected roots were rotten and had become necrotic (Fig. 1D-F). Figure 1 Symptoms induced by root-knot nematodes in Mulberry. (A-C) The aboveground symptoms of leaf yellowing and wilting in diseased mulberry. (D-F) The root symptom of diseased mulberry, the arrow of fig showing eggs. Nematodes morphological characters Morphological characters of male: The body is linear, the head cap is obvious and slightly separated from the body, and the anterior end of the body tapers off (Fig. 2-A); the stylet was robust, the boundary between the stylet cone and the stylet shaft is clear, the stylet knot is oblate-spheroidal; the dorsal esophageal gland orifice opening is hook-like; the metacorpus and the valve is clear (Fig. 2-B). The tail present a humped end, the spicules is strong, arch-shaped (Fig. 2-C, D). Female: The body is enlarged, pear-shaped, milky white, with a prominent neck and slightly prominent lip area, the posterior part of the body is round, and the anal region has no protuberances. The stylet is developed, the boundary between the cone and shaft is clear, the stylet knobs is obvious and spheroidicity. The metacorpus is round or oval, the opening of the dorsal esophageal gland orifice is hook-like (Fig. 2-E, F). The perineal pattern is approximately round or oval and with a continuous, dense and relatively smooth striae, the dorsal arch is medium high. Two phasmids are large and obvious, the distance between them was longer than the length of the vulva fissure. There are no lateral lines in the lateral region, and there was no obvious line in the vulva and anus region (Fig. 2-H, I). J2s: Vermicular-shaped, tapered at both ends, pointed at the tail end than the head end, lip region without obvious constriction. Stylet is straight and slender, the stylet knob is oblate spherical. Metacorpus is obvious and oval shape (Fig. 2-J, K). Tail is conical and constricted, tapered at the end, hyaline tail is obvious and short (Fig. 2-L, M). The morphometric measurements of males (n = 15), females (n = 25), J2s(n = 26) are shown in Table 1 , the morphological characteristics and measurements are consistent with the original description of the species M. vitis [ 28 ] (Yang et al ., 2021). Table 1 Morphometrics of root knot nematodes from mulberry. All measurements are in µm and shown in the form: mean ± s.d. (range) Character Females Females of M.vitis [ 28 ] Males Males of M.vitis [ 28 ] J2s J2s of M.vitis [ 28 ] n 25 25 15 10 26 26 Body length 1170.07 ± 107.50 (984.72-1322.10) 958.99 ± 132.32 (822.99-1245.16) 1532.3 ± 112.43 (1262.12-1713.87) 1330.42 ± 179.15 (1032.23-1593.38) 394.27 ± 40.64 (320.49-468.15) 396.85 ± 18.34 (353.36-425.76) Body width 730.06 ± 71.16 (598.95-830.09) 609.00 ± 43.63 (531.80-688.11) 32.01 ± 2.28 (28.58–35.53) 36.75 ± 6.15 (25.69–43.94) 17.00 ± 2.12 (13.31–20.44) 16.19 ± 1.93 (12.81–22.43) Stylet length 17.25 ± 5.44 (11.09–29.22) 15.73 ± 3.68 (8.11–26.58) 18.82 ± 1.65 (16.67–20.97) 19.31 ± 1.71 (17.02–21.39) 13.22 ± 0.7 (12.20-14.85) 13.33 ± 0.32 (12.74–14.11) Stylet knobs width 4.71 ± 1.03 (2.78–7.72) 4.44 ± 0.96 (2.74–5.95) 3.62 ± 0.58 (2.71–4.08) 3.50 ± 0.62 (2.65–4.67) 1.86 ± 0.55 (1.04–2.97) 1.56 ± 0.31 (1.21–2.22) Stylet knobs height 2.51 ± 1.31 (1.20–5.78) 2.08 ± 0.48 (1.32–3.32) 2.47 ± 0.54 (2.06–3.06) 2.54 ± 0.29 (2.23–3.19) 1.80 ± 0.69 (1.19–2.35) 1.24 ± 0.18 (0.98–1.69) DGO 4.32 ± 0.95 (2.65–5.80) 4.13 ± 0.84 (2.59–5.32) 2.68 ± 0.35 (2.27–3.28) 3.30 ± 0.52 (2.35–3.91) 1.66 ± 0.54 (1.01–2.94) 1.35 ± 0.31 (1.02–2.01) Metacorpus length 44.90 ± 3.15 (40.25–50.32) 42.72 ± 7.05 (23.01–51.53) 16.91 ± 1.15 (15.71–18.99) 17.95 ± 1.63 (15.61–20.43) 9.78 ± 2.71 (8.32–12.57) 10.37 ± 1.21 (8.14–12.18) Metacorpus width 35.68 ± 4.91 (22.44–40.56) 37.03 ± 5.81 (21.11–42.86) 10.73 ± 1.34 (9.23–12.50) 9.23 ± 0.73 (7.92–10.38) 6.64 ± 1.52 (4.29–8.52) 6.94 ± 0.64 (5.67–8.15) Head region height / / 3.08 ± 0.35 (2.17–4.31) 5.20 ± 0.39 (4.70–5.76) / / Head region width / / 7.81 ± 0.89 (5.43–8.25) 10.41 ± 1.27 (8.33–12.32) / / Distance from anterior end to center of metacarpus 75.99 ± 10.71 (56.88–97.71) 72.75 ± 12.70 (44.17–86.28) 91.16 ± 12.11 (81.20-119.17) 99.31 ± 5.88 (90.96-108.73) 63.07 ± 1.81 (61.65–65.55) 54.89 ± 1.99 (50.8-58.62) Hyaline tail length / / / / 13.55 ± 2.35 (10.31–17.45) 12.16 ± 1.74 (9.72–15.73) Spicules length / / 27.37 ± 1.28 (26.07–29.93) 30.88 ± 2.59 (27.86–35.75) / / Gubermaculum length / / 15.36 ± 2.54 (10.60-19.91) 10.23 ± 1.86 (8.15–14.88) / / a (Body length/ Body width) 1.49 ± 0.27 (1.08–2.03) 1.58 ± 0.2 (1.30–1.95) 48.14 ± 5.08 (36.13–55.87) 36.79 ± 5.96 (30.67–50.15) 22.23 ± 3.91 (16.35–25.17) 24.76 ± 2.51 (18.98–28.44) Figure 2 Morphological characteristics of root knot nematodes from Mulberry. Male (A-D) A. Entire body of male. B. Anterior region of male. C, D. Tail region of male. Female (E-F) E. Entire body of female. F. Anterior region of female. G. Eggs of female. H, I. Perineal pattern of female. Second-stage juveniles (J-M) J. Entire body of second-stage juveniles. K. Anterior region of second-stage juveniles. L, M. Tail region of second-stage juveniles. (Scale bars: A, E = 200 µm; B-D, F-I, K-M = 20 µm; J = 50 µm) Table 1 Morphometrics of root knot nematodes from mulberry. All measurements are in µm and shown in the form: mean ± s.d. (range) PCR product electrophoresis PCR product electrophoresis Amplification and sequencing of the rDNA-ITS1-5.8S-ITS2 region, mtDNA coxI region and coxII region of the females isolated from six mulberry samples revealed that the sequence sizes were 877 bp (Fig. 3-A), 413 bp (Fig. 3-B), and 545 bp (Fig. 3-C), respectively. Figure 3 PCR electropherogram of rDNA ITS1-5.8S-ITS2 (A), mtDNA cox I (B) and mtDNA coxII (C) sequences from root-knot nematodes on six mulberry samples . M. 2000 DNA marker. CK. The negative control consisting of water. Lanes 1–6, 7–12 and 13–18 were amplified fragment of rDNA-ITS1-5.8S-ITS2 region, mtDNA-coxⅠ and mtDNA-cox II region of root-knot nematodes from six mulberry samples respectively. PCR product sequencing and phylogenetic tree construction The sequences of rDNA-ITS1-5.8S-ITS2 of the females isolated from mulberry samples was upload to the NCBI database and obtain the GenBank accession numbers are PQ452305 and PQ452306, the sequences was BLAST search and revealed that the most similar sequence was that of M. vitis (GenBank accession numbers MN816222.1, MN816223.1), with an identity of 100%. Phylogenetic trees (47 sequences in total; Rotylenchus buxophilus , GenBank accession number JX015432.1, was used as the out-group taxon) showed that the highest match was M. vitis (MN816222.1, MN816223.1) and M. suginamiensis (MN101822.1, MN101826.1, MN101823.1) and formed one group with high bootstrap support (100%) and was clearly separated from other species (Fig. 4). Figure 4 Phylogenetic relationships of root knot nematodes isolated from mulberry with other root-knot nematodes based on rDNA ITS1-5.8S-ITS2 sequences. Numbers to the left of the branches are bootstrap values for 1000 replications The sequences of mtDNA-coxI was upload to the NCBI database and obtain the GenBank accession numbers are PQ451474 and PQ451475, a BLAST search revealed that the most similar sequence was that of M. vitis (GenBank accession numbers MN814829.1, MN814830.1), with an identity more than 99%. Phylogenetic trees (40 sequences in total; Romanomermis wuchangensis , GenBank accession number EF617356.1, was used as the out-group taxon) showed that the highest match was M. vitis (MN814829.1, MN814830.1) and formed one group with high bootstrap support (100%) and was clearly separated from other species (Fig. 5). Figure 5 Phylogenetic relationships of of root knot nematodes isolated from mulberry with other root-knot nematodes based on mtDNA coxI genes sequences. Numbers to the left of the branches are bootstrap values for 1000 replications The sequences of mtDNA-coxII was upload to the NCBI database and obtain the GenBank accession numbers are PQ639275 and PQ639276, a BLAST search revealed that the most similar sequence was that of M. vitis (GenBank accession numbers MT012386.1, MT012387.1), with an identity more than 99%. Phylogenetic trees (43 sequences in total; Radopholus similis , GenBank accession number FN313571.1, was used as the out-group taxon) showed that the highest match was M. vitis (MT012386.1, MT012387.1) and M. suginamiensis (MN115432.1) and formed one group with high bootstrap support (100%) and was clearly separated from other species (Fig. 6). Figure 6 Phylogenetic relationships of root knot nematodes isolated from mulberry with other root-knot nematodes based on coxII-16S rRNA genes sequences. Numbers to the left of the branches are bootstrap values for 1000 replications SCAR-PCR analysis According to the results of morphological identification and phylogenetic tree construction, the RKN isolated from mulberry was initially identified as M. vitis . Therefore, species identity was further confirmed using M. vitis -specific primers Mv-F/R, a single specific fragment of 174 bp was obtained, which was consistent with the reported of PCR amplification band size from M. vitis . (Fig. 7). Figure 7 PCR amplification results of root-knot nematodes from mulberry samples using primers Mv-F/Mv-R. M. 2000 DNA marker. CK. Negative control. Lanes 1–6 were PCR amplification results of root-knot nematodes from six mulberry samples using primers Mv-F/Mv-R. Pathogenicity detection After 90 days of inoculation with M. vitis , mulberry were seriously damaged, the aboveground parts of mulberry showed yellowing leaves, and the roots were covered with root knots, both the axial roots and branch roots were infected, and the surface of the infected roots presented numerous milky white or yellowish-brown eggs (Fig. 8A-C). The reproductive factor (RF = final population/initial population) was 5.7 to 12.3. After acidic fuchsin-staining, nematodes of all ages, including second stage juveniles, third stage juveniles, fourth stage juveniles, females and eggs, were found in the roots (Fig. 8D-H). The root tissue at the root knot was dissected, and milky white plump females were found (Fig. 8I). Observation by paraffin section showed that the cells in the root of the infected mulberry were loosely arranged, with obvious signs of destruction, and giant cells of unequal size were found. Some of the giant cells are hollowed out, causing cell lysis to fall away from the root tissue (Fig. 8J, K). The control mulberry had better growth and no nematodes in the roots, and close arrangement of root cell. Figure 8 Symptoms and histopathlology of mulberry inoculated with M. vitis for 90 days. A-C. Aboveground and root symptoms of mulberry inoculated with M. vitis for 90 days (Arrows show eggs mass). D-H. Different stages of M. vitis in Mulberry after inoculating for 90 days. I. Symptoms of the root phloem after M. vitis infection for 90 days, and the arrow indicated female. J-K. Transverse section of root infected with M. vitis for 90 days (gc = giant cells; n = nematodes). (Scale bars: D, F = 100 µm; E, H = 200 µm; G = 2000 µm; I = 1000 µm) Discussion Mulberry is an important economic forest in China, known as the “Oriental divine wood”. With the implementation of the national strategy of “moving mulberry from east to west”, the planting area of the mulberry in Yunnan Province has gradually increased, and it has become one of the important provinces for the development of sericulture in western China [ 24 ]. Luliang County is the largest mulberry planting area in Yunnan Province and the occurrence of mulberry RKN disease in this county is more harmful, which restricts the development of mulberry silkworm industry. At present, seven RKNs species ( M. incognita , M. arenaria , M. javanica , M. hapla , M. enterolobii , M. mali , M. thamesi ) have been reported to harm mulberry. In this study, a high density RKNs was found to infect mulberry in Luliang County, Yunnan Province and the pathogen nematode was identified as M. vitis by systematic identification, which was the first report that M. vitis parasitizing mulberry. M. vitis is a new species of RKN parasitic on grapes discovered by our research group in 2021 [ 28 ]. Since the discovery of M. vitis , no reports of new hosts for this nematode have been seen yet. In this study, we found that the morphological characteristics (females, perineal pattern, J2s, males) of RKNs parasitizing mulberry were basically consistent with the original reported M. vitis populations, except for the morphological measurements of the males were slightly different. Its longer gubermaculum length (10.60-19.91 vs. 8.15–14.88 µm), smaller head region height (2.17–4.31 vs. 4.70–5.76 µm) and head region width (5.43–8.25 vs. 8.33–12.32 µm). Ghaderi et al reported that there exist considerable variations in measurements of adult RKNs between different populations because of their great body size [ 29 ]. Morphology and morphometric of M. javanica from different countries are also exist variations [ 30 ]. The differences between the male gubermaculum length and head region height/width identified in this study and the original description of M. vitis may be caused by differences among individuals and errors in measurement data. In particular, the phylogenetic trees in this research based on rDNA-ITS1-5.8S-ITS2 and mtDNA-coxII sequences showed that the pathogenic RKNs isolated from mulberry and M. vitis and M. suginamiensis (the sequences are from the report by Gu et al. [ 31 ]) formed one group with high bootstrap support (100%), this indicates that M. vitis have a closer genetic relationship with M. suginamiensis . Therefore, M. vitis was compared with the original description (only contains morphological descriptions and lacks molecular information) of M. suginamiensis [ 15 ], the result shows that M. vitis are different from M. Suginamiensis in that the body of the female is pear-shaped and milky white (pearly white, sometimes yellow brown in M. suginamiensis ), the excretory pore of the female is located on the ventral region between 23rd and 25th annule behind lips (being on 22-28th annule from anterior end in M. suginamiensis ), no obvious lateral lips of the female (lateral lips fused to the upper surface of head in M. suginamiensis ), the perineal pattern of the female is round to ovoid, with smooth and fine striae (slightly squarish outline, wavy striae in M. suginamiensis ), the distance between two phasmids of the perineal pattern is wider than or equal to the length of the vulval slit and in very few specimens, this value is slightly smaller (slightly wider than the length of vulval slit in M. suginamiensis ), the head region of the male lacks annulus (one or two annules in M. suginamiensis ), the body of the male slightly bends towards the ventral side after being heated and killed (body almost straight and twist in posterior portion in M. suginamiensis ), the labial disc of the male is horizontally ovoid-squared, no obvious lateral lips and a prominent slit-like opening between the labial disc and medial lips (labial disc large, lozenge­shaped and lateral lips clear in M. suginamiensis ), the lateral field of the male having four incisures forming 3 lateral bands, which are full of reticular striae (four incisures forming 3 lateral bands, the outermost two side bands have reticular patterns, while the middle side band has discontinuous striae in M. suginamiensis ), the tail of male is mostly straight and short with a humped tip (tail shorter and with rounded broad tip in M. suginamiensis ), the tip end of the spicules of the male resemble slightly curves to form a hook-like shape (not described in M. suginamiensis ), the lateral field of the second stage juveniles having four incisures forming 3 lateral bands, which are full of reticular striae (four incisures, of which outer two slightly crenated, and not areolated in M. suginamiensis ), the tail of the second stage juveniles is conical and constricted of tail tip (tail conoid, short, deeply constricting, with rounded, blunt tip in M. suginamiensis ), the hyaline tail of the second stage juveniles is longer (9.72–15.73 um vs 3–5 um). Furthermore, the hosts are different, peppers are the host of M. suginamiensis but not of M. vitis [ 32 ]. RKNs are a global menace to agricultural crop production [ 33 ], and identifying their species is complex and crucial to understand the host-parasite relationships and to implement appropriate management strategies [ 34 , 35 ], reliable detection and identification technology is necessary for the protection of agricultural production systems and formulating effective prevention and control measures [ 36 ]. At the moment, more than 100 genus Meloidogyne have been described [ 37 – 39 ], however, some nematodes have similar morphology and is difficult to distinguish due to interspecies similarity [ 40 – 42 ]. PCR analysis is a more practical method for routine and rapid diagnosis of RKN species and having increasingly become the preferred approach for unidentified samples [ 43 , 44 ]. The DNA-based methods, sequences of ribosomal (rDNA-ITS, 28S rDNA-D2/D3) and mitochondrial DNA (mtDNA-coxI, mtDNA-coxII) and sequence characterized amplified regions (SCAR) markers are considered to be more effective molecular markers for RKNs identification [ 45 – 47 ]. However, some studies have suggested that the sequences of rDNA-ITS, 28S rDNA-D2/D3, rDNA-18S of some RKNs are extremely conserved and remains difficult to distinguish [ 48 – 51 ]. This study also found that the M. vitis has a relatively close genetic relationship with the M. suginamiensis , but there are significant differences in morphology. Therefore, to accurately identify the RKNs species, it is necessary to combine morphological characteristics with molecular biological identification [ 52 – 54 ]. In this research, the field symptom observation and morphological identification, molecular biology techniques of polygene tandem (rDNA-ITS-PCR, mtDNA-CoxI PCR, mtDNA-CoxII PCR, SCAR-PCR), phylogenetic tree construction analysis and pathogenicity determination were combined to identify the species of the RKNs parasitizing mulberry, the pathogen was confirmed to be M. vitis , the identification results are accurate and reliable. New hosts of this nematode have been identified again, which is of great significance. M. vitis was previously found parasitizing grape in 2021 and caused serious damage to grape [ 28 ], to our knowledge, this is the first report of M. vitis attacking mulberry, this findings are important information for mulberry disease diagnosis and control. M. vitis may spread rapidly in a certain region of the world, further investigations are essential to monitoring its new potential hosts, distribution and spread and to implementing future effective and integrated nematodes management strategy to safeguard plant cultivation. Conclusion Root-knot nematodes (RKNs) attack a wide array of plant species and cause significant damage, resulting in economic losses. In this study, we found a high density RKNs parasitizing Mulberry in Yunnan, China. To accomplish this, we assayed the morphometric traits and measurements, rDNA/mtDNA-based phylogenetic relationships of this nematode and SCAR-PCR analysis to identify RKNs, the pathogen nematodes were identified as M. vitis . This is the first report of M. vitis attacking mulberry. The pathogenicity of M. vitis to mulberry was detected and with the result of inducing typical root-knot symptoms and egg mass formation. Since the discovery of M. vitis , new hosts of this nematode have been identified again. Valuably, the results of this study have significantly expanded our understanding of the new hosts of M. vitis , providing a basis for assessing the distribution range of M. vitis , providing a theoretical basis for accurately identifying and implementing future effective and integrated nematodes management strategy to safeguard mulberry cultivation. Methods Experimental Material The mulberry RKNs disease samples: Collected from the planting field of mulberry (nü sang) in Xiaojie Street, Zhongshu Subdistrict, Luliang County, Yunnan Province (24˚96’ N, 103˚66’ E), a total of 6 samples were collected, named SS-1, SS-2, SS-3, SS-4, SS-5, SS-6. Mulberry seedlings (nü sang): cutting seedling, the branches of nü sang used for cutting propagation were collected from the fields where the mulberry RKNs disease was discovered, brought back to the laboratory for cutting and wait for rooting and then used for nematode inoculation to test their pathogenicity. Observation the disease symptom The symptoms of the aboveground and underground parts of the infected mulberry were carefully observed and photographed when the samples were collected in the field. After the collected samples were cleaned and dried, they were observed and photographed under the stereomicroscope (Discovery.V12, Carl Zeiss, Germany). Nematode population isolation and morphological identification Female and eggs samples were extracted from the root tissues of mulberry, parts of the females were stored in a refrigerator at -80℃ for DNA extraction. Others were photographed under an inverted microscope (Axio Vert. A1, Carl Zeiss, Germany), and the morphologic index were measured following the method described by Yang et al [ 28 ]. Part of single egg mass was directly extracted and inoculated on the root of cucumber (Jinyan No. 4) for purification and propagation, others were cultured in a constant temperature incubator at 28℃ to collect the second stage juveniles (J2s), at the same time, the males attached to the eggs mass were free in water and collect them. J2s and males were heat-killed and fixed using 4% formaldehyde solution for morphological observation and measurement. Perineal patterns of female adults were made following the method of Zhang et al [ 55 ]. The perineal pattern was cleaned with a 45% lactic acid solution, placed on a glass slide and covered with coverslip, using pure glycerine as a floating carrier. The finished perineal pattern was placed under a microscope for observation and photographing. DNA extraction, PCR amplification and sequencing DNA extraction, DNA was extracted from a single female adult following the method described by Yang et al. [ 56 ]. Worm lysis buffer (WLB, 100 µL) was prepared: 10×PCR Buffer (Mg 2+ , free) 20 µL, MgCL 2 16 µL, protease K 1 µL, ddH 2 O 63 µL. The females were pierced with sterilized skewer, added with 5 µL WLB, frozen in liquid nitrogen for 20 min, added with 10 µL paraffin oil, and kept at 56℃ for 80 min and 95℃ for 15 min in a PCR apparatus. PCR amplification, rDNA ITS1-5.8S-ITS2 fragments and two mtDNA fragments (partial coxI and 16S rRNA coxII) were amplified using the primer pairs 18S/26S [ 57 ], cox1F/cox1R [ 58 ] and C2F3/1108 [ 59 ], respectively. SCAR-PCR was amplified using the primer pairs Mv-F/Mv-R [ 56 ]. The primer sequences are listed in Table 2 . All of the polymerase chain reactions (PCRs) were performed in 25.00 µL mixed solution containing 10× PCR buffer (Mg 2་ , plus) 2.50 µL, dNTPs 2.00 µL, forward and reverse primers (10 µmol/L) 1.00 µL, template DNA 2.50 µL, Taq DNA polymerase (5 U/µL) 0.25 µL, and ddH 2 O 15.75 µL. The PCR amplification procedure is showed in Table 3 . PCR products were electrophoresed. Table 2 The primers used Primers code Primer sequence (5′-3′) References 18S TTGATTACGTCCCTGCCCTTT Vrain et al. [ 57 ] 26S TCCTCCGCTAAATGATATG cox1F TGGTCATCCTGAAGTTTATG Trinh et al. [ 58 ] cox1R CTACA ACATAATAAGTATCATG C2F3 GGTCAATGTTCAGAAATTTGTGG Powers et al. [ 59 ] 1108 TACCTTTGACCAATCACGCT Mv-F CTGGTTCAGGGTCATTTATAAAC Yang et al . [ 56 ] Mv-R TATACGCTTGTGTGGATGAC Table 3 The PCR amplification procedure of primers Primers code Pre degeneration Response parameter (35 cycle) Final extension Degeneration Annealing Extension 18S/26S 94 ℃ 4 min 94 ℃ 30 s 55 ℃ 45 s 72 ℃ 1 min 72 ℃ 10 min cox1F/cox1R 94 ℃ 4 min 94 ℃ 30 s 54 ℃ 30 s 72 ℃ 1 min 72 ℃ 10 min C2F3/1108 94 ℃ 4 min 94 ℃ 30 s 51 ℃ 30 s 72 ℃ 1 min 72 ℃ 10 min Mv-F/Mv-R 94°C 4 min 94°C 30 s 53°C 30 s 72°C 1 min 72°C 10 min Sequencing, PCR products were purified using the EasyPure Quick Gel Extraction Kit (TransGen Biotech). The recovered product was ligated with pmD18 cloning vector and transformed into DH5α competent cells. The positive clones were selected and sequenced. Table 2 The primers used Table 3 The PCR amplification procedure of primers Phylogenetic analyses PCR products were cloned, and the positive clones were selected and sequenced, the obtained sequences were compared with those from other nematodes available in the GenBank database using the BLAST homology search program. The sequence of rDNA ITS1-5.8S-ITS, and mtDNA coxI and coxII from Meloidogyne spp. were selected for phylogenetic reconstruction. A phylogenetic tree was constructed based on the neighbor-joining (NJ) method in MEGA 5.1 to analyze the phylogenetic relationships among nematodes. Pathogenicity detection The mulberry materials tested were cutting seedling, and the cutting were planted in plastic flower pots (18 cm diamete×15 cm high) containing a sterilized mixed soil (humus soil/laterite soil/perlite = 3:1:1). After 6 months, M. vitis was artificially inoculated into mulberry root following the method of Velloso et al . [ 60 ], 10 mulberry seeding were inoculated, each plant was inoculated with 2500 J2s, three noninoculated mulberry were used as the negative control. All plants were cultured in greenhouse at approximately 14 ℃ to 26 ℃. After 90 days, all plants were observed. The morphology of nematodes at different growth stages in the roots of mulberry were observed using the acid fusion staining method followed by Tian et al . [ 61 ]. Galled roots of mulberry were collected for histopathological studies using the paraffin section staining method followed by Arun et al . [ 62 ]. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Funding This work was supported by grants from the National Natural Science Foundation of China (32560631) and the National Key Research and Development Program of China (2023YFD1400400). Author Contribution Y. Y. performed all experiments and was a major contributor in writing the manuscript. X. Y. collected samples, analyzed data and assisted with writing. D. T. investigation and collected samples. W. X. and Z. Z. collected samples and data curation. P.W. and S. Y. analysed the data, Wrote-reviewd & edited the main draft of the manuscript and prepared the figures. All authors read and approved the final manuscript. Data Availability All sequences are available from the GenBank database (accession number: PQ452305, PQ452306, PQ451475, PQ451474, PQ639275, PQ639276). Other relevant data are within the paper. References Arunakumar GS, Gnanesh BN, Manojkumar HB, Doss G, Mogili T, Sivaprasad V, et al. Genetic diversity, identification, and utilization of novel genetic resources for resistance to Meloidogyne incognita in Mulberry (Morus spp). Plant Dis. 2021;105(10):2919–28. Ma B, Wang HH, Liu JC, Chen L, Xia XY, Wei WQ, et al. The gap-free genome of mulberry elucidates the architecture and evolution of polycentric chromosomes. Hortic Res. 2023;10(7):1–12. Hao JY, Gao YF, Xue JB, Yang YY, Yin JJ, Wu T, et al. Phytochemicals, pharmacological effects and molecular mechanisms of mulberry. Foods. 2022;11(8):1–19. Cui WY, Luo KY, Xiao Q, Sun ZY, Wang YF, Cui CF, et al. Effect of mulberry leaf or mulberry leaf extract on glycemic traits: a systematic review and meta-analysis. Food Funct. 2023;14(3):1277–89. Li RL, Wang J, Liu JY, Li MY, Lu JY, Zhou JN, et al. Mulberry leaf and its effects against obesity: a systematic review of phytochemistry, molecular mechanisms and applications. Phytomedicine. 2024;128:155528. Maqsood M, Saeed RA, Sahar A, Khan MI. Mulberry plant as a source of functional food with therapeutic and nutritional applications: A review. J Food Biochem. 2022;46(11):1–37. Xia ZQ, Fan W, Liu DY, Chen YN, Lv J, Xu MX, Zhang MR. Haplotype-resolved chromosomal-level genome assembly reveals regulatory variations in mulberry fruit anthocyanin content. Hortic Res. 2024;11(6):1–18. Tian ZD. A Summary of the harm and control of mulberry root- knot nematodiasis. GuangXi Seric. 2000;37(4):17–21. Sun TG, Fang DW, Sun Y, Li YJ. Preliminary report of selecting effective agents for controlling mulberry root nematodiasis. Cany Kexue. 2004;30(4):421–3. Wang RX, Chen ZA. The identification of root-knot nematodes on mulberr. Acta Agriculturae Boreali-Occidentalis Sinica. 1989;17(2):1115–116. Chen LJ, Jiang YP. Inhibition effect of clayey soil on nematodes of mulberry. Jiangsu Seric, 1993;(4):46–7. Tang JY, Shi SQ, Hu XQ, Zhang Z. Preliminary study on mulberry root-knot nematode disease in luliang county Yunnan Province. J Yunnan Agricultural Univ. 2002;17(3):294–6. Luo LH, Huang YX, Meng F, Yuan T, Zhang XN, Wang YQ, et al. Morphological and molecular identification of root-knot nematode from mulberry field of Guangzho. Sci Seric. 2021;47(2):147–55. Liu JP. The New progress in identification and molecular detection of Meloidogyne enterolobii . Newsl Sericultural Sci. 2021;41(3):58. Toida Y, Yaegashi T. Description of Meloidogyne suginamiensis n. sp. (Nematoda: Meloidogynidae) from mulberry in Japan. Japanese J Nematology. 1984;14:49–57. Tong TXF, Gao ZX. Growth and development of nematodes and mulberr. Jiangsu Sericul Ture. 1985;(02):58–61. Naik VN, Sharma DD, Govindaiah G. Incidence and intensity of root disease complex due to nematode and soilborne fungal pathogens in mulberry (Morus alba L). Int J Industrial Entomol. 2008;16(2):49–56. Castillo P, Di Vito M, Vovlas N, Jiménez-Díaz RM. Host-parasite relationships in root-knot disease of white mulberry. Plant Dis. 2001;85(3):277–81. Soares MRC, Lopes APM, Dias-Arieira CR, Souto ER, Manenti ER, Mattei DC. First report on Meloidogyne enterolobii in Morus celtidifolia in Paraná State, Brazil. Plant Dis. 2018;102(8):1671. Lafi HA, AI-Yahya FA, AI-Hazmi AS. First report of Meloidogyne incognita on mulberry in Saudi Arabia. Plant Dis. 2021;105(12):4171. Cong Z, Huang G, Huo S, Liao X, Gao S, Zheng J, et al. The nuclear hormone receptor family transcription factor Dd-NHR-1 is required for embryonic development in Ditylenchus destructor. New Plant Prot. 2025;2:e70009. Jones JT, Haegeman A, Danchin EGJ, Gaur H, Helder J, Jones MGK, et al. Top 10 plant-parasitic nematodes in molecular plant pathology. Mol Plant Pathol. 2013;14(9):946–61. Chen YP, Liu Q, Sun XQ, Liu L, Zhao JL, Yang SS, et al. Meloidogyne enterolobii MeMSP1 effector targets the glutathione-S-transferase phi GSTF family in arabidopsis to manipulate host metabolism and promote nematode parasitism. New Phytol. 2023;240(6):2468–83. Lei SM, Li G, Yang L, Li JJ, Yang JF. Occurrence, harm and control of mulberry root knot nematode disease in Yunnan Province. Guangxi Seric. 2012;49(1):13–5. Kumari NV, Sujathamma P. Integrated management of root knot nematode Meloidogyne incognita chitwood in mulberry (Morus spp). IOSR J Pharm Biol Sci. 2014;9(1):30–3. Rashidifard M, Fourie H, Daneel MS, Marais M. Morphological and morphometrical identification of Meloidogyne populations from various crop production areas in south africa with emphasis on M. enterolobii . Zootaxa. 2019;4658(2):251–74. Sebastian K, E, F. J., and, Andrea B-K. Development and validation of LNA-Based quantitative real-time PCR assays for detection and identification of the root-knot nematode Meloidogyne enterolobii in complex DNA backgrounds. Phytopathology. 2015;105(9):1245–9. Yang YM, Hu XQ, Liu P, Chen L, Peng H, Wang QM, et al. A new root-knot nematode, Meloidogyne vitis sp. nov. (Nematoda: Meloidogynidae), parasitizing grape in Yunnan. PLoS ONE. 2021;16(2):1–25. Ghaderi R, Dehghan AA, Hesa AM, Karega A. Genetic intraspecific diversity of Meloidogyne javanica parasitizing vegetables in southern Iran. J nematol. 2020;52:1–13. Phan KL, Le TML, Nguyen HT, Nguyen TD, Trinh QP. First report and new molecular and morphological characterizations of root-knot nematode, Meloidogyne javanica , infecting ginger and long coriander in Vietnam. J nematol. 2021;53:1–8. Gu JF, Fang YW, Liu LL. First Report of the Suginami Root-knot nematode, Meloidogyne suginamiensis , infecting maple trees, acer palmatum, from Japan. Plant Dis. 2019;104(1):1. Yang YM. Studies on the identification, biological characteristics and candidate pathogenic genes of Meloidogyne vitis sp. nov. Thesis, Yunnan Agricultural University. 2021. La SK, Li JF, Ma S, Liu XQ, Gao LH, Tian YQ. Protective role of native root-associated bacterial consortium against root-knot nematode infection in susceptible plants. Nat Commun. 2024;15(1):1–18. Rusinque L, Maleita C, Abrantes I, Palomares-Rius JE, Inácio ML. Meloidogyne graminicola -A threat to rice production review update on distribution, biology, identification, and management. Biology. 2021;10(1163):1–19. Rusinque L, Camacho MJ, Serra C, No´brega F, Ina´cio ML. Root-knot nematode assessment: species identification, distribution, and new host records in Portugal. Front plant sci. 2023;14:1–11. Kiewnick S, Frey JE, Braun-Kiewnick A. Development and validation of LNA-based quantitative real time PCR assays for detection and identification of the root-knot nematode Meloidogyne enterolobii in complex DNA backgrounds. Phytopathology. 2015;105(9):1245–9. Maleita C, Cardoso JMS, Rusinque L, Esteves I, Abrantes I. Species-specific molecular detection of the root knot Nematode Meloidogyne luci . Biology. 2021;10(775):1–10. Tao Y, Xu CL, Yuan CF, Wang HH, Borong Lin BR, Zhuo K, Liao JL. Meloidogyne aberrans sp. nov. (Nematoda: Meloidogynidae), a new root-knot nematode parasitizing kiwifruit in China. PLoS ONE. 2017;12(8):1–22. Rusinque L, Nóbrega F, Serra C, Inácio ML. The northern root-knot nematode Meloidogyne hapla : new host records in Portugal. Biology. 2022;11(11):1567. Riva G, Brito JA, Oliveira CD, Marin M, Gu M, Bui HX, et al. Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii . J nematol. 2024;56(1):1–20. Sun BX, Gao B, Wang RY, Chen SL, Li XH, Dong YH, et al. Development of enzyme-mediated duplex exponential amplification assay for detection and identification of Meloidogyne enterolobii in Field. Microorganisms. 2025;13(6):1–13. Oliveira SA, Oliveira CMG, Maleita CMN, Silva MFA, Abrantes IMO. Wilcken S R S. First report of Meloidogyne graminis on golf courses turfgrass in Brazil. PLoS ONE. 2018;13(2):1–14. Marquez J, Hajihassani A. Identification and Virulence of Five Isolates of root-knot nematode Meloidogyne floridensis on vegetables. Plant Dis. 2023;107(5):1522–8. Bacic J, Lalicevic I, Sirca S, Theuerschuh M, Susic N, Stare BG. Occurrence and distribution of root-knot nematodes Meloidogyne spp. Serbia Agron. 2025;15(2):1–17. Skantar AM, Handoo ZA, Kantor MR, Hult MN. First report of barley root-knot nematode, Meloidogyne naasi from turfgrass in Idaho, with multigene molecular characterization. J nematol. 2023;55(1):1–17. Anderson SD, Gleason CA. A molecular beacon real-time polymerase chain reaction assay for the identification of M. chitwoodi , M. fallax , and M. minor . Front Plant Sci. 2023;14:1–13. Wendimu GY. Biology, taxonomy, and management of the root-knot nematode ( Meloidogyne incognita ) in Sweet Potato. Adv Agric. 2021;1–13. Powers TO, Todd TC, Burnell AM, Murray PCB, Fleming CC, Szalanski AL, et al. The rDNA internal transcribed spacer region as a taxonomic marker for nematodes. J nematol. 1997;29(4):441–50. Landa BB, Rius JEP, Vovlas N, Carneiro RM, D G, Maleita CMN, Abrantes IM, O, et al. Molecular characterization of Meloidogyne hispanica (Nematoda, Meloidogynidae) by phylogenetic analysis of genes within the rDNA in Meloidogyne spp. Plant Dis. 2008;92(7):1104–10. Pan S, Wei PY, Li Y, Chen ZJ, Peng DL, Wang L, et al. Identification of Meloidogyne Species on traditional chinese medicine plants in the qinling mountain area of china and their aggressiveness to different medicinal herbs. Plant Dis. 2024;108(5):1202–10. Habteweld A, Davidson W, Desaeger J, Crow WT. First Report of Meloidogyne incognita Infecting Mitragyna speciosa in the United States. J nematol. 2022;54(1):1–4. Suwanngam A, Schiffer PH, Sasnarukkit A, Siripattanapipong S, Jindapunnapat K, Chinnasri B, et al. Development of colorimetric and fluorescent closed tube LAMP assay using simplified extraction for diagnosis of Meloidogyne enterolobii in root tissues. Sci Rep. 2025;15(1):1–12. Trinh QP, Le TML, Nguyen TD, Nguyen HT, Morphologic. Morphometric, and Characterization of Vietnamese Populations of Meloidogyne incognita . Plant Dis. 2023;107(12):3693–700. Maleita C, Cardoso JMS, Rusinque L, Esteves I, Abrantes I. Species-Specific Molecular Detection of the root knot nematode Meloidogyne luci . Biology. 2021;10(8):1–10. Zhang XX, Zhao W, Lin YM, Shan B, Yang SS. Identification of Meloidogyne panyuensis (Nematoda: Meloidogynidae) infecting Orah (Citrus reticulata Blanco) and its impact on rhizosphere microbial dynamics: Guangxi, China. Peer J. 2024;12:1–23. Yang YM, Liu P, Li HM, Peng H, Du X, Dong Y, et al. Study on PCR rapid molecular detection technique of Meloidogyne vitis . J Integr Agr. 2022;21(11):3408–16. Vrain TC, Wakarchuk DA, Laplantelevesque AC, Hamilton RI. Intraspecific rDNA restrietion fragment length polymorphisrms in the Xiphinema americanum group. Fundamental Appl nematology. 1992;15(6):563–73. Trinh QP, Le TML, Nguyen TD, Nguyen HT, Liebanas G, Nguyen TAD. Meloidogyne daklakensis n. sp. (Nematoda: Meloidogynidae), a new root-knot nematode associated with Robusta coffee (Coffea canephora Pierre ex A. Froehner) in the Western Highlands. Vietnam J helminthol. 2019;93(2):242–54. Powers TO, Harris TS. A polymerase chain reaction method for identification of five major Meloidogyne species. J nematol. 1993;25(1):1–6. Velloso JA, Maquilan MAD, Campos VP, Brito JA, Dickson DW. Temperature Effects on Development of Meloidogyne enterolobii and M. floridensis . J nematol. 2022;54(1):1–11. Tiian ZL, Shi HL, Maria M, Zheng JW. Pectate lyase is a factor in the adaptability for Heterodera glycines infecting tobacco. J Integr Agr. 2019;18(3):618–26. Arun A, Shanthi A, Raveendran M, Pushpam R, Shandeep G. An insight into occurrence, biology, and pathogenesis of rice root-knot nematode Meloidogyne graminicola . Biology. 2023;12(7):1–18. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 23 Dec, 2025 Reviews received at journal 22 Dec, 2025 Reviews received at journal 21 Dec, 2025 Reviewers agreed at journal 11 Dec, 2025 Reviewers agreed at journal 08 Dec, 2025 Reviewers agreed at journal 07 Dec, 2025 Reviews received at journal 05 Dec, 2025 Reviews received at journal 05 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers invited by journal 03 Dec, 2025 Editor assigned by journal 03 Dec, 2025 Editor invited by journal 03 Dec, 2025 Submission checks completed at journal 02 Dec, 2025 First submitted to journal 02 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8170667","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":554591281,"identity":"ea7661e9-78d3-4764-8c1f-3c433159d5aa","order_by":0,"name":"Yanmei Yang","email":"","orcid":"","institution":"Yunnan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yanmei","middleName":"","lastName":"Yang","suffix":""},{"id":554591282,"identity":"bc20bc35-5df2-41d8-80e8-583dcf8d1984","order_by":1,"name":"Xinghua Yu","email":"","orcid":"","institution":"Yunnan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xinghua","middleName":"","lastName":"Yu","suffix":""},{"id":554591283,"identity":"6ee07522-35d9-4943-9c62-93609272d9e0","order_by":2,"name":"Dehong Tang","email":"","orcid":"","institution":"Yunnan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dehong","middleName":"","lastName":"Tang","suffix":""},{"id":554591284,"identity":"94d91ede-dbe2-4673-a88a-ebe2a3bdb66d","order_by":3,"name":"Wendong Xu","email":"","orcid":"","institution":"Luliang County Plant Protection and Quarantine Station","correspondingAuthor":false,"prefix":"","firstName":"Wendong","middleName":"","lastName":"Xu","suffix":""},{"id":554591285,"identity":"8431917b-54c9-450a-b037-8c8ea0a4082b","order_by":4,"name":"Zhengyu Zhang","email":"","orcid":"","institution":"Agricultural Technology Extension Center of Xuanwei","correspondingAuthor":false,"prefix":"","firstName":"Zhengyu","middleName":"","lastName":"Zhang","suffix":""},{"id":554591286,"identity":"cf1b7ddd-deee-4184-a1ff-3892bcfe3a81","order_by":5,"name":"Pengjun Wang","email":"","orcid":"","institution":"Agricultural Technology Extension Center of Xuanwei","correspondingAuthor":false,"prefix":"","firstName":"Pengjun","middleName":"","lastName":"Wang","suffix":""},{"id":554591287,"identity":"1c11fb7b-85dc-477e-b38f-f5ccfc931d93","order_by":6,"name":"Shaojie Yuan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYHCCxAcf//yTY2NvPkC0lmTDmQ0HjPl4jiUQrYVNmrfhQOI8iRwF4tQbnD/w2Jh3x530NoYcBoYfFduI0HIjIfHh3DPPctsYzh5g7DlzmxgtDMkGb9iYc9sY+xKYGduI0XL+QJoEDxtzOhszjwGRWg4kpEnyth1OYGMjVovkjYRkwxln0gzbeNgSDhLlF77zZxIffKiwkZef//jggx8VRGhROMCTAOccIKweCOQb2IlTOApGwSgYBSMYAAA+3kMSGjVFdQAAAABJRU5ErkJggg==","orcid":"","institution":"Yunnan Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Shaojie","middleName":"","lastName":"Yuan","suffix":""}],"badges":[],"createdAt":"2025-11-21 07:23:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8170667/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8170667/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97896329,"identity":"78216617-5889-4541-93c6-58ec0b14c196","added_by":"auto","created_at":"2025-12-10 15:36:22","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3766004,"visible":true,"origin":"","legend":"","description":"","filename":"fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/3d2057b94b05df79013b0516.tif"},{"id":97895972,"identity":"15c6c983-ba71-4c6b-a243-6ae1fb3d6bd4","added_by":"auto","created_at":"2025-12-10 15:35:28","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":84072,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript2025.12.3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/682c5e34b954730070be1b9c.docx"},{"id":97895586,"identity":"901fcd91-38d5-4142-88c4-ef33b200859d","added_by":"auto","created_at":"2025-12-10 15:34:30","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2135970,"visible":true,"origin":"","legend":"","description":"","filename":"fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/cec342b9b2dee551a4c4dece.tif"},{"id":97896987,"identity":"1df82d09-1249-4a70-995d-b8aca0f8ab6f","added_by":"auto","created_at":"2025-12-10 15:37:18","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49345,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/4c942b84989a68ec29c3a3ba.docx"},{"id":97735651,"identity":"f54874b3-bf59-4d28-9156-9c92eb31a6e4","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":249240,"visible":true,"origin":"","legend":"","description":"","filename":"fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/8243bebaeac3c6f70df7a05a.tif"},{"id":97896827,"identity":"103b009a-d890-4ae5-b630-3410f775a969","added_by":"auto","created_at":"2025-12-10 15:37:06","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1647134,"visible":true,"origin":"","legend":"","description":"","filename":"fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/b827ec39a31d63b7cefefb70.tif"},{"id":97895013,"identity":"b5189b88-91be-470e-b7a5-4664e0ee3111","added_by":"auto","created_at":"2025-12-10 15:33:23","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42316,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/c329645d1d0a012b84b1d32d.docx"},{"id":97735662,"identity":"1562a270-7bbf-4adc-ab34-442f4b648041","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":699212,"visible":true,"origin":"","legend":"","description":"","filename":"fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/f9e98324959eef60bcbb95e6.tif"},{"id":97735655,"identity":"85fcda47-dc27-4084-9934-d50e20a48f8c","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42375,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/4663bd754f4ae8238a4b220d.docx"},{"id":97896072,"identity":"e733cf82-d6d3-4834-bb33-317aeca499ee","added_by":"auto","created_at":"2025-12-10 15:35:49","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":650136,"visible":true,"origin":"","legend":"","description":"","filename":"fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/ed988b348067268656df0e25.tif"},{"id":97895914,"identity":"3f4fb817-5e05-4f12-8051-23354a83d683","added_by":"auto","created_at":"2025-12-10 15:35:23","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56242,"visible":true,"origin":"","legend":"","description":"","filename":"fig7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/9ab266b2b6a7059ec5ff9d91.tif"},{"id":97735671,"identity":"9e616763-8858-448b-beca-b581c3d0bdfa","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6133678,"visible":true,"origin":"","legend":"","description":"","filename":"fig8.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/9bdc5a06611bfbe1d4d013c7.tif"},{"id":97735666,"identity":"f44e3212-4f56-4c85-a8ea-6a32e2abfe93","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"json","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8627,"visible":true,"origin":"","legend":"","description":"","filename":"49b5e1a309e541f49c40c90992bc001f.json","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/09a0d13e1755be429ebf8904.json"},{"id":97735667,"identity":"96cd1b36-3f65-4bb0-b67a-e482b539b6de","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"zip","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3234291,"visible":true,"origin":"","legend":"","description":"","filename":"file.zip","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/452df0d23f8fb570ff847ce0.zip"},{"id":97894255,"identity":"a9b81471-8829-415d-a55f-cada45b65238","added_by":"auto","created_at":"2025-12-10 15:32:08","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157989,"visible":true,"origin":"","legend":"","description":"","filename":"49b5e1a309e541f49c40c90992bc001f1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/8f886f605e80d1a05224536e.xml"},{"id":97895790,"identity":"f4905e31-ba8e-49d4-9979-2ea3bb9f3752","added_by":"auto","created_at":"2025-12-10 15:34:56","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3766004,"visible":true,"origin":"","legend":"","description":"","filename":"fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/118172c3ce82600bbd291592.tif"},{"id":97735661,"identity":"26ca7b05-3b5f-4eb9-abbb-7f018d0bd0a8","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2135970,"visible":true,"origin":"","legend":"","description":"","filename":"fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/8e580bf31cca931e51794236.tif"},{"id":97895742,"identity":"9368e495-15a1-48ce-8475-2badb2449718","added_by":"auto","created_at":"2025-12-10 15:34:50","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":249240,"visible":true,"origin":"","legend":"","description":"","filename":"fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/a8f237d1f7bf3708b66f3910.tif"},{"id":97735682,"identity":"6b305a11-b9a9-4d9a-a035-375a73478269","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1647134,"visible":true,"origin":"","legend":"","description":"","filename":"fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/2f3811aae9e54f71a9098d48.tif"},{"id":97894381,"identity":"c328b981-36a9-477f-a445-1af0d8164b4f","added_by":"auto","created_at":"2025-12-10 15:32:25","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":699212,"visible":true,"origin":"","legend":"","description":"","filename":"fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/33812e4cc4cef02bc61cade9.tif"},{"id":97895505,"identity":"3db89e48-6c52-4853-8379-0775f56877e7","added_by":"auto","created_at":"2025-12-10 15:34:22","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":650136,"visible":true,"origin":"","legend":"","description":"","filename":"fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/73b52d80be352f200a767bf6.tif"},{"id":97895765,"identity":"52a869c6-0730-4f0c-9258-d42b130fe51d","added_by":"auto","created_at":"2025-12-10 15:34:53","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56242,"visible":true,"origin":"","legend":"","description":"","filename":"fig7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/96c65192aa1ec8a800f721d4.tif"},{"id":97735679,"identity":"446bb318-2e02-446f-8599-d5de46d0615a","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"tif","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6133678,"visible":true,"origin":"","legend":"","description":"","filename":"fig8.tif","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/6a70bc34081ef650809695ea.tif"},{"id":97735676,"identity":"f5e8bb4b-492d-4370-a649-a3ac5d276451","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":631173,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig1.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/006e51049ab4fedd45255280.png"},{"id":97894386,"identity":"b0dbfe73-1a98-4f77-8814-0d51c8030b6f","added_by":"auto","created_at":"2025-12-10 15:32:25","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":268024,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig2.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/cd3edbb5d3f5b0879d8f355a.png"},{"id":97896033,"identity":"dd19fd36-5e96-405b-92e4-8e566845792d","added_by":"auto","created_at":"2025-12-10 15:35:42","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":298715,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig3.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/004ed1374f506c0d76c7f0d9.png"},{"id":97894332,"identity":"752e3c6a-b63f-4963-8862-d8f3cfa298e3","added_by":"auto","created_at":"2025-12-10 15:32:21","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":445867,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig4.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/97369017ee5959f4433b4bf7.png"},{"id":97735680,"identity":"189d7200-71c7-4cfb-af0d-b11e659f9a2e","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150984,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig5.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/c24e2b9de5067e322fe3b0aa.png"},{"id":97735678,"identity":"8e1fc4b2-45fb-48ab-ba4a-2cb11ab1b01b","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122393,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig6.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/c413f349c3f3e3c86e799a04.png"},{"id":97735683,"identity":"5831359e-f446-4941-b076-572290c898b7","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42068,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig7.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/9e0bee116579efede0c5afd6.png"},{"id":97735674,"identity":"2b00686f-c9bd-405b-8e6b-1a40725bb612","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":679227,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig8.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/731bf2fe81481cfca681ab4c.png"},{"id":97735685,"identity":"dca58611-d523-40ba-b42e-b5f3c2f370e3","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"xml","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155563,"visible":true,"origin":"","legend":"","description":"","filename":"49b5e1a309e541f49c40c90992bc001f1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/ba27834eba931448ea4d166c.xml"},{"id":97896691,"identity":"85d2fe11-ac36-4385-9384-bb122b53aa3a","added_by":"auto","created_at":"2025-12-10 15:36:53","extension":"html","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":170615,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/4df941b70ba9a6b409d18756.html"},{"id":97735658,"identity":"de4d13ed-dd93-4fb4-8f52-87f7cbdcd027","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":20565402,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSymptoms induced by root-knot nematodes in Mulberry.\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e(A-C) The aboveground symptoms of leaf yellowing and wilting in diseased mulberry. (D-F) The root symptom of diseased mulberry, the arrow of fig showing eggs.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/56a1042ffa1c68c0c68751c6.png"},{"id":97896977,"identity":"5cf27d3b-dd0a-49bb-aa31-cd0a7bd13628","added_by":"auto","created_at":"2025-12-10 15:37:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":6638688,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphological characteristics of root knot nematodes from Mulberry.\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eMale (A-D) A. Entire body of male. B. Anterior region of male. C, D. Tail region of male. Female (E-F) E. Entire body of female. F. Anterior region of female. G. Eggs of female. H, I. Perineal pattern of female. Second-stage juveniles (J-M) J. Entire body of second-stage juveniles. K. Anterior region of second-stage juveniles. L, M. Tail region of second-stage juveniles. (Scale bars: A, E=200 μm; B-D, F-I, K-M=20 μm; J=50 μm)\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/b4c49cf63fea4e37c91b2f90.png"},{"id":97735642,"identity":"db75e659-2b2c-4e89-8374-14e68cfb42b3","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":956433,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR electropherogram\u003c/strong\u003e \u003cstrong\u003eof rDNA ITS1-5.8S-ITS2 (A), mtDNA cox I (B) and mtDNA coxII (C) sequences from root-knot nematodes on six mulberry samples\u003c/strong\u003e. M. 2000 DNA marker. CK. The negative control consisting of water. Lanes 1-6, 7-12 and 13-18 were amplified fragment of rDNA-ITS1-5.8S-ITS2 region, mtDNA-coxⅠ and mtDNA-cox II region of root-knot nematodes from six mulberry samples respectively.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/033a6dadecbabf24459cd99f.png"},{"id":97735645,"identity":"b20551f0-ab62-4095-bb44-0a2ea37ab8a9","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1915617,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic relationships of root knot nematodes isolated from mulberry\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ewith other root-knot nematodes based on rDNA ITS1-5.8S-ITS2 sequences. \u003c/strong\u003eNumbers to the left of the branches are bootstrap values for 1000 replications\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/eaf9ec79eff735e74776d64b.png"},{"id":97735648,"identity":"f0097234-f4f8-4d74-b0e6-36aff89b6c4e","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":978395,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic relationships of of root knot nematodes isolated from mulberry with other root-knot nematodes based on mtDNA coxI genes sequences.\u003c/strong\u003e Numbers to the left of the branches are bootstrap values for 1000 replications\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/11995f31827e10bb37e1adb8.png"},{"id":97735649,"identity":"42589438-4f3d-4ea6-ae11-8e3a1d6d284e","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1544570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic relationships of root knot nematodes isolated from mulberry with other root-knot nematodes based on coxII-16S rRNA genes sequences. \u003c/strong\u003eNumbers to the left of the branches are bootstrap values for 1000 replications\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/84793dcc9c83deac6b06d6f3.png"},{"id":97894552,"identity":"0c1f992b-dff9-4879-927d-43a5c02f25c8","added_by":"auto","created_at":"2025-12-10 15:32:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":571912,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification results of root-knot nematodes from mulberry samples using primers Mv-F/Mv-R.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM. 2000 DNA marker. CK. Negative control. Lanes 1-6 were PCR amplification results of root-knot nematodes from six mulberry samples using primers Mv-F/Mv-R.\u003c/p\u003e","description":"","filename":"fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/502919e37bc2aaec37a68d7e.png"},{"id":97735681,"identity":"78136283-9a17-44a4-b129-a10d49474d8e","added_by":"auto","created_at":"2025-12-08 19:35:17","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":32688285,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSymptoms and histopathlology of mulberry inoculated with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eM. vitis \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efor 90 days. \u003c/strong\u003eA-C. Aboveground and root symptoms of mulberry inoculated with \u003cem\u003eM. vitis \u003c/em\u003efor 90 days (Arrows show eggs mass). D-H. Different stages of \u003cem\u003eM. vitis\u003c/em\u003ein Mulberry after inoculating for 90 days. I. Symptoms of the root phloem after \u003cem\u003eM. vitis\u003c/em\u003e infection for 90 days, and the arrow indicated female. J-K. Transverse section of root infected with \u003cem\u003eM. vitis \u003c/em\u003efor 90 days (gc=giant cells; n=nematodes). (Scale bars: D, F=100 μm; E, H=200 μm; G=2000 μm; I=1000 μm)\u003c/p\u003e","description":"","filename":"fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/c88e1948640baaf26fd8e49d.png"},{"id":98622707,"identity":"6a9e0509-c99c-4fef-980a-ad2b212eb87a","added_by":"auto","created_at":"2025-12-19 17:01:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":66955678,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8170667/v1/989e6126-b64e-4f5a-bb21-fd3fc3dde6c5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Meloidogyne vitis, a new infecting nematode species on mulberry in Yunnan, China","fulltext":[{"header":"Background","content":"\u003cp\u003eMulberry (\u003cem\u003eMorus\u003c/em\u003e spp.) is the Moracea family of the genus Morusis, an economically important sericulture crop and has primer importance in the sericulture industry as it is the only food to feed silkworm [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The Chinese Ministry of Health classifies it as one of the \u0026ldquo;food and medicine\u0026rdquo; agricultural products [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Mulberry leaf and mulberry fruit also have numerous biological function as a potential source of medicinally active chemicals, such as regulating sugar and lipid metabolism, reducing blood glucose, anti-inflammatory, anti-cancer and anti-hyperlipidemia [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Mulberry is widely grown in Asia, North America, Africa and Europe, including India, Japan, China, Korea and other countries [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and the cultivation area of Mulberry in China spans over 100000 hectares [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Yunnan is one of the major provinces for the mulberry cultivation in China, mulberry industry plays an important role in the agricultural. However, various pathogens, including root-knot nematodes (RKNs), pose a serious threat to the production of mulberry worldwide.\u003c/p\u003e\u003cp\u003eAt present, mulberry RKN disease has been discovered in mulberry planting areas at home and abroad. In China, Tian reported that six RKNs species (\u003cem\u003eM. incognita\u003c/em\u003e, \u003cem\u003eM. arenaria\u003c/em\u003e, \u003cem\u003eM. javanica\u003c/em\u003e, \u003cem\u003eM. hapla\u003c/em\u003e, \u003cem\u003eM. mali\u003c/em\u003e, \u003cem\u003eM. thamesi\u003c/em\u003e) were found to damage mulberry [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among them, the RKNs were found in Shandong province, Shanxi province, Zhejiang province and Yunnan provinces, mainly were \u003cem\u003eM. incognita\u003c/em\u003e and \u003cem\u003eM. arenaria\u003c/em\u003e [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Luo \u003cem\u003eet al\u003c/em\u003e. reported that the mulberry in the Huanan zone of Guangzhou City were infected by \u003cem\u003eM. enterolobii\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Liu \u003cem\u003eet al\u003c/em\u003e. reported that the pathogen of mulberry RKNs collected from mulberry orchard in Guangdong, Guangxi, Hainan and Yunnan Province were \u003cem\u003eM. enterolobii\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In other countries, the mulberry RKNs disease were found in Japan [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], India [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], Spain [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], Brazil [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], Saudi Arabia [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and other countries, the pathogenic RKNs species include \u003cem\u003eM. suginamiensis\u003c/em\u003e, \u003cem\u003eM. incognita\u003c/em\u003e, \u003cem\u003eM. arenaria\u003c/em\u003e, \u003cem\u003eM. hapla\u003c/em\u003e, \u003cem\u003eM. mali\u003c/em\u003e, \u003cem\u003eM. enterolobii\u003c/em\u003e and \u003cem\u003eMeloidodera\u003c/em\u003e sp. Plant-parasitic nematodes can diminish global food production by approximately 12.3%, leading to annual economic losses of nearly \u003cspan\u003e$\u003c/span\u003e173\u0026nbsp;billion [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. RKNs rank first among the top ten plant-parasitic nematodes [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and are one of the greatest threats to agriculture production [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], the mulberry destroyed by RKNs presented stunted growth, yellowing leaves, severe root gall, which directly affects the absorption of water and nutrients and leading to a great reductions in mulberry productivity. Lei \u003cem\u003eet al\u003c/em\u003e. reported that RKNs disease could reduce the yield of mulberry by approximately 20%-30%, the protein content in mulberry leaves also decreased, and the leaf quality was affected [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In addition to the direct harm caused by nematodes, it also induces and promotes fungal diseases, bacterial diseases, viral diseases and other diseases. Kumari \u003cem\u003eet al\u003c/em\u003e. reported that root knot disease caused by \u003cem\u003eMeloidogyne incognita\u003c/em\u003e is a serious one and causes 10%-12% leaf yield loss [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGiven that mulberry are seriously damaged by RKNs, thus, accurate identification of \u003cem\u003eMeloidogyne\u003c/em\u003e species populations and their pathogenic race characterization are critical for designing effective control measures in the context of sustainability and integrated pest management [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In Yunnan, we found a serious mulberry RKNs disease, root samples was collected for \u003cem\u003eMeloidogyne\u003c/em\u003e species identification, morphological methods (morphological observation and morphometric measurement of females, males, second-stage juveniles and perineal pattern) and molecular biological methods (rDNA-ITS PCR, mtDNA-coxI PCR, mtDNA-coxII PCR, BLAST alignment and phylogenetic tree construction) were used to identify this RKNs species. Furthermore, the pathogenicity of this nematode was further determined by artificial inoculation. The results of this research will provide a theoretical guidance basis for the prevention and control of mulberry RKNs disease.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eDisease symptoms induced by root-knot nematodes\u003c/h2\u003e\u003cp\u003eThe aboveground part of the nematode-infected mulberry showed poor plant growth and leaf yellowing and shedding (Fig.\u0026nbsp;1A-C), while the underground part showed obvious symptoms, with severe swollen root knots and the roots were atrophied and distorted, including axial roots and branch roots; The root knots were uneven in size and long were beaded; The surface of the root knots presented milky white or yellowish-brown egg mass, the seriously nematode-infected roots were rotten and had become necrotic (Fig.\u0026nbsp;1D-F).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;1 Symptoms induced by root-knot nematodes in Mulberry.\u003c/b\u003e (A-C) The aboveground symptoms of leaf yellowing and wilting in diseased mulberry. (D-F) The root symptom of diseased mulberry, the arrow of fig showing eggs.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eNematodes morphological characters\u003c/h3\u003e\n\u003cp\u003eMorphological characters of male: The body is linear, the head cap is obvious and slightly separated from the body, and the anterior end of the body tapers off (Fig.\u0026nbsp;2-A); the stylet was robust, the boundary between the stylet cone and the stylet shaft is clear, the stylet knot is oblate-spheroidal; the dorsal esophageal gland orifice opening is hook-like; the metacorpus and the valve is clear (Fig.\u0026nbsp;2-B). The tail present a humped end, the spicules is strong, arch-shaped (Fig.\u0026nbsp;2-C, D).\u003c/p\u003e\u003cp\u003eFemale: The body is enlarged, pear-shaped, milky white, with a prominent neck and slightly prominent lip area, the posterior part of the body is round, and the anal region has no protuberances. The stylet is developed, the boundary between the cone and shaft is clear, the stylet knobs is obvious and spheroidicity. The metacorpus is round or oval, the opening of the dorsal esophageal gland orifice is hook-like (Fig.\u0026nbsp;2-E, F). The perineal pattern is approximately round or oval and with a continuous, dense and relatively smooth striae, the dorsal arch is medium high. Two phasmids are large and obvious, the distance between them was longer than the length of the vulva fissure. There are no lateral lines in the lateral region, and there was no obvious line in the vulva and anus region (Fig.\u0026nbsp;2-H, I).\u003c/p\u003e\u003cp\u003eJ2s: Vermicular-shaped, tapered at both ends, pointed at the tail end than the head end, lip region without obvious constriction. Stylet is straight and slender, the stylet knob is oblate spherical. Metacorpus is obvious and oval shape (Fig.\u0026nbsp;2-J, K). Tail is conical and constricted, tapered at the end, hyaline tail is obvious and short (Fig.\u0026nbsp;2-L, M).\u003c/p\u003e\u003cp\u003eThe morphometric measurements of males (n\u0026thinsp;=\u0026thinsp;15), females (n\u0026thinsp;=\u0026thinsp;25), J2s(n\u0026thinsp;=\u0026thinsp;26) are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the morphological characteristics and measurements are consistent with the original description of the species \u003cem\u003eM. vitis\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] (Yang \u003cem\u003eet al\u003c/em\u003e., 2021).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eMorphometrics of root knot nematodes from mulberry.\u003c/b\u003e All measurements are in \u0026micro;m and shown in the form: mean\u0026thinsp;\u0026plusmn;\u0026thinsp;s.d. (range)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCharacter\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemales\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFemales of \u003cem\u003eM.vitis\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMales\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMales of \u003cem\u003eM.vitis\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eJ2s\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eJ2s of \u003cem\u003eM.vitis\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBody length\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1170.07\u0026thinsp;\u0026plusmn;\u0026thinsp;107.50\u003c/p\u003e\u003cp\u003e(984.72-1322.10)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e958.99\u0026thinsp;\u0026plusmn;\u0026thinsp;132.32 (822.99-1245.16)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1532.3\u0026thinsp;\u0026plusmn;\u0026thinsp;112.43\u003c/p\u003e\u003cp\u003e(1262.12-1713.87)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1330.42\u0026thinsp;\u0026plusmn;\u0026thinsp;179.15\u003c/p\u003e\u003cp\u003e(1032.23-1593.38)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e394.27\u0026thinsp;\u0026plusmn;\u0026thinsp;40.64 (320.49-468.15)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e396.85\u0026thinsp;\u0026plusmn;\u0026thinsp;18.34 (353.36-425.76)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBody width\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e730.06\u0026thinsp;\u0026plusmn;\u0026thinsp;71.16 (598.95-830.09)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e609.00\u0026thinsp;\u0026plusmn;\u0026thinsp;43.63 (531.80-688.11)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e32.01\u0026thinsp;\u0026plusmn;\u0026thinsp;2.28\u003c/p\u003e\u003cp\u003e(28.58\u0026ndash;35.53)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e36.75\u0026thinsp;\u0026plusmn;\u0026thinsp;6.15\u003c/p\u003e\u003cp\u003e(25.69\u0026ndash;43.94)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e17.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.12 (13.31\u0026ndash;20.44)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e16.19\u0026thinsp;\u0026plusmn;\u0026thinsp;1.93 (12.81\u0026ndash;22.43)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStylet length\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e17.25\u0026thinsp;\u0026plusmn;\u0026thinsp;5.44 (11.09\u0026ndash;29.22)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15.73\u0026thinsp;\u0026plusmn;\u0026thinsp;3.68 (8.11\u0026ndash;26.58)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e18.82\u0026thinsp;\u0026plusmn;\u0026thinsp;1.65\u003c/p\u003e\u003cp\u003e(16.67\u0026ndash;20.97)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e19.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71 (17.02\u0026ndash;21.39)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e13.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7 (12.20-14.85)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e13.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32 (12.74\u0026ndash;14.11)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStylet knobs width\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e4.71\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03 (2.78\u0026ndash;7.72)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.96 (2.74\u0026ndash;5.95)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e\u003cp\u003e(2.71\u0026ndash;4.08)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62 (2.65\u0026ndash;4.67)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55 (1.04\u0026ndash;2.97)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31 (1.21\u0026ndash;2.22)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStylet knobs height\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2.51\u0026thinsp;\u0026plusmn;\u0026thinsp;1.31 (1.20\u0026ndash;5.78)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48 (1.32\u0026ndash;3.32)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54\u003c/p\u003e\u003cp\u003e(2.06\u0026ndash;3.06)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29 (2.23\u0026ndash;3.19)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69 (1.19\u0026ndash;2.35)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18 (0.98\u0026ndash;1.69)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDGO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e4.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.95 (2.65\u0026ndash;5.80)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84 (2.59\u0026ndash;5.32)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e\u003cp\u003e(2.27\u0026ndash;3.28)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52 (2.35\u0026ndash;3.91)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54 (1.01\u0026ndash;2.94)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e\u003cp\u003e(1.02\u0026ndash;2.01)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMetacorpus length\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e44.90\u0026thinsp;\u0026plusmn;\u0026thinsp;3.15 (40.25\u0026ndash;50.32)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e42.72\u0026thinsp;\u0026plusmn;\u0026thinsp;7.05 (23.01\u0026ndash;51.53)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16.91\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003c/p\u003e\u003cp\u003e(15.71\u0026ndash;18.99)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e17.95\u0026thinsp;\u0026plusmn;\u0026thinsp;1.63 (15.61\u0026ndash;20.43)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e9.78\u0026thinsp;\u0026plusmn;\u0026thinsp;2.71 (8.32\u0026ndash;12.57)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e10.37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.21 (8.14\u0026ndash;12.18)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMetacorpus width\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e35.68\u0026thinsp;\u0026plusmn;\u0026thinsp;4.91 (22.44\u0026ndash;40.56)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e37.03\u0026thinsp;\u0026plusmn;\u0026thinsp;5.81 (21.11\u0026ndash;42.86)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10.73\u0026thinsp;\u0026plusmn;\u0026thinsp;1.34\u003c/p\u003e\u003cp\u003e(9.23\u0026ndash;12.50)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e9.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.73 (7.92\u0026ndash;10.38)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e6.64\u0026thinsp;\u0026plusmn;\u0026thinsp;1.52 (4.29\u0026ndash;8.52)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e6.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64 (5.67\u0026ndash;8.15)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHead region height\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e\u003cp\u003e(2.17\u0026ndash;4.31)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.39\u003c/p\u003e\u003cp\u003e(4.70\u0026ndash;5.76)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHead region width\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e7.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89\u003c/p\u003e\u003cp\u003e(5.43\u0026ndash;8.25)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e10.41\u0026thinsp;\u0026plusmn;\u0026thinsp;1.27\u003c/p\u003e\u003cp\u003e(8.33\u0026ndash;12.32)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDistance from anterior end to center of metacarpus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e75.99\u0026thinsp;\u0026plusmn;\u0026thinsp;10.71 (56.88\u0026ndash;97.71)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e72.75\u0026thinsp;\u0026plusmn;\u0026thinsp;12.70 (44.17\u0026ndash;86.28)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e91.16\u0026thinsp;\u0026plusmn;\u0026thinsp;12.11\u003c/p\u003e\u003cp\u003e(81.20-119.17)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e99.31\u0026thinsp;\u0026plusmn;\u0026thinsp;5.88\u003c/p\u003e\u003cp\u003e(90.96-108.73)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e63.07\u0026thinsp;\u0026plusmn;\u0026thinsp;1.81 (61.65\u0026ndash;65.55)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e54.89\u0026thinsp;\u0026plusmn;\u0026thinsp;1.99\u003c/p\u003e\u003cp\u003e(50.8-58.62)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHyaline tail length\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e13.55\u0026thinsp;\u0026plusmn;\u0026thinsp;2.35 (10.31\u0026ndash;17.45)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e12.16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.74 (9.72\u0026ndash;15.73)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSpicules length\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e27.37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.28\u003c/p\u003e\u003cp\u003e(26.07\u0026ndash;29.93)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e30.88\u0026thinsp;\u0026plusmn;\u0026thinsp;2.59\u003c/p\u003e\u003cp\u003e(27.86\u0026ndash;35.75)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGubermaculum length\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15.36\u0026thinsp;\u0026plusmn;\u0026thinsp;2.54\u003c/p\u003e\u003cp\u003e(10.60-19.91)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e10.23\u0026thinsp;\u0026plusmn;\u0026thinsp;1.86\u003c/p\u003e\u003cp\u003e(8.15\u0026ndash;14.88)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ea (Body length/ Body width)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27 (1.08\u0026ndash;2.03)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"1\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\u003cp\u003e(1.30\u0026ndash;1.95)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e48.14\u0026thinsp;\u0026plusmn;\u0026thinsp;5.08\u003c/p\u003e\u003cp\u003e(36.13\u0026ndash;55.87)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e36.79\u0026thinsp;\u0026plusmn;\u0026thinsp;5.96\u003c/p\u003e\u003cp\u003e(30.67\u0026ndash;50.15)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e22.23\u0026thinsp;\u0026plusmn;\u0026thinsp;3.91\u003c/p\u003e\u003cp\u003e(16.35\u0026ndash;25.17)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e24.76\u0026thinsp;\u0026plusmn;\u0026thinsp;2.51\u003c/p\u003e\u003cp\u003e(18.98\u0026ndash;28.44)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;2 Morphological characteristics of root knot nematodes from Mulberry.\u003c/b\u003e Male (A-D) A. Entire body of male. B. Anterior region of male. C, D. Tail region of male. Female (E-F) E. Entire body of female. F. Anterior region of female. G. Eggs of female. H, I. Perineal pattern of female. Second-stage juveniles (J-M) J. Entire body of second-stage juveniles. K. Anterior region of second-stage juveniles. L, M. Tail region of second-stage juveniles. (Scale bars: A, E\u0026thinsp;=\u0026thinsp;200 \u0026micro;m; B-D, F-I, K-M\u0026thinsp;=\u0026thinsp;20 \u0026micro;m; J\u0026thinsp;=\u0026thinsp;50 \u0026micro;m)\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u003cb\u003eMorphometrics of root knot nematodes from mulberry.\u003c/b\u003e All measurements are in \u0026micro;m and shown in the form: mean\u0026thinsp;\u0026plusmn;\u0026thinsp;s.d. (range)\u003c/p\u003e\n\u003ch3\u003ePCR product electrophoresis\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003ePCR product electrophoresis\u003c/div\u003e\u003cp\u003eAmplification and sequencing of the rDNA-ITS1-5.8S-ITS2 region, mtDNA coxI region and coxII region of the females isolated from six mulberry samples revealed that the sequence sizes were 877 bp (Fig.\u0026nbsp;3-A), 413 bp (Fig.\u0026nbsp;3-B), and 545 bp (Fig.\u0026nbsp;3-C), respectively.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;3 PCR electropherogram of rDNA ITS1-5.8S-ITS2 (A), mtDNA cox I (B) and mtDNA coxII (C) sequences from root-knot nematodes on six mulberry samples\u003c/b\u003e. M. 2000 DNA marker. CK. The negative control consisting of water. Lanes 1\u0026ndash;6, 7\u0026ndash;12 and 13\u0026ndash;18 were amplified fragment of rDNA-ITS1-5.8S-ITS2 region, mtDNA-coxⅠ and mtDNA-cox II region of root-knot nematodes from six mulberry samples respectively.\u003c/p\u003e\n\u003ch3\u003ePCR product sequencing and phylogenetic tree construction\u003c/h3\u003e\n\u003cp\u003eThe sequences of rDNA-ITS1-5.8S-ITS2 of the females isolated from mulberry samples was upload to the NCBI database and obtain the GenBank accession numbers are PQ452305 and PQ452306, the sequences was BLAST search and revealed that the most similar sequence was that of \u003cem\u003eM. vitis\u003c/em\u003e (GenBank accession numbers MN816222.1, MN816223.1), with an identity of 100%. Phylogenetic trees (47 sequences in total; \u003cem\u003eRotylenchus buxophilus\u003c/em\u003e, GenBank accession number JX015432.1, was used as the out-group taxon) showed that the highest match was \u003cem\u003eM. vitis\u003c/em\u003e (MN816222.1, MN816223.1) and \u003cem\u003eM. suginamiensis\u003c/em\u003e (MN101822.1, MN101826.1, MN101823.1) and formed one group with high bootstrap support (100%) and was clearly separated from other species (Fig.\u0026nbsp;4).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;4 Phylogenetic relationships of root knot nematodes isolated from mulberry with other root-knot nematodes based on rDNA ITS1-5.8S-ITS2 sequences.\u003c/b\u003e Numbers to the left of the branches are bootstrap values for 1000 replications\u003c/p\u003e\u003cp\u003eThe sequences of mtDNA-coxI was upload to the NCBI database and obtain the GenBank accession numbers are PQ451474 and PQ451475, a BLAST search revealed that the most similar sequence was that of \u003cem\u003eM. vitis\u003c/em\u003e (GenBank accession numbers MN814829.1, MN814830.1), with an identity more than 99%. Phylogenetic trees (40 sequences in total; \u003cem\u003eRomanomermis wuchangensis\u003c/em\u003e, GenBank accession number EF617356.1, was used as the out-group taxon) showed that the highest match was \u003cem\u003eM. vitis\u003c/em\u003e (MN814829.1, MN814830.1) and formed one group with high bootstrap support (100%) and was clearly separated from other species (Fig.\u0026nbsp;5).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;5 Phylogenetic relationships of of root knot nematodes isolated from mulberry with other root-knot nematodes based on mtDNA coxI genes sequences.\u003c/b\u003e Numbers to the left of the branches are bootstrap values for 1000 replications\u003c/p\u003e\u003cp\u003eThe sequences of mtDNA-coxII was upload to the NCBI database and obtain the GenBank accession numbers are PQ639275 and PQ639276, a BLAST search revealed that the most similar sequence was that of \u003cem\u003eM. vitis\u003c/em\u003e (GenBank accession numbers MT012386.1, MT012387.1), with an identity more than 99%. Phylogenetic trees (43 sequences in total; \u003cem\u003eRadopholus similis\u003c/em\u003e, GenBank accession number FN313571.1, was used as the out-group taxon) showed that the highest match was \u003cem\u003eM. vitis\u003c/em\u003e (MT012386.1, MT012387.1) and \u003cem\u003eM. suginamiensis\u003c/em\u003e (MN115432.1) and formed one group with high bootstrap support (100%) and was clearly separated from other species (Fig.\u0026nbsp;6).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;6 Phylogenetic relationships of root knot nematodes isolated from mulberry with other root-knot nematodes based on coxII-16S rRNA genes sequences.\u003c/b\u003e Numbers to the left of the branches are bootstrap values for 1000 replications\u003c/p\u003e\n\u003ch3\u003eSCAR-PCR analysis\u003c/h3\u003e\n\u003cp\u003eAccording to the results of morphological identification and phylogenetic tree construction, the RKN isolated from mulberry was initially identified as \u003cem\u003eM. vitis\u003c/em\u003e. Therefore, species identity was further confirmed using \u003cem\u003eM. vitis\u003c/em\u003e-specific primers Mv-F/R, a single specific fragment of 174 bp was obtained, which was consistent with the reported of PCR amplification band size from \u003cem\u003eM. vitis\u003c/em\u003e. (Fig.\u0026nbsp;7).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;7 PCR amplification results of root-knot nematodes from mulberry samples using primers Mv-F/Mv-R.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eM. 2000 DNA marker. CK. Negative control. Lanes 1\u0026ndash;6 were PCR amplification results of root-knot nematodes from six mulberry samples using primers Mv-F/Mv-R.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003ePathogenicity detection\u003c/h2\u003e\u003cp\u003eAfter 90 days of inoculation with \u003cem\u003eM. vitis\u003c/em\u003e, mulberry were seriously damaged, the aboveground parts of mulberry showed yellowing leaves, and the roots were covered with root knots, both the axial roots and branch roots were infected, and the surface of the infected roots presented numerous milky white or yellowish-brown eggs (Fig.\u0026nbsp;8A-C). The reproductive factor (RF\u0026thinsp;=\u0026thinsp;final population/initial population) was 5.7 to 12.3. After acidic fuchsin-staining, nematodes of all ages, including second stage juveniles, third stage juveniles, fourth stage juveniles, females and eggs, were found in the roots (Fig.\u0026nbsp;8D-H). The root tissue at the root knot was dissected, and milky white plump females were found (Fig.\u0026nbsp;8I). Observation by paraffin section showed that the cells in the root of the infected mulberry were loosely arranged, with obvious signs of destruction, and giant cells of unequal size were found. Some of the giant cells are hollowed out, causing cell lysis to fall away from the root tissue (Fig.\u0026nbsp;8J, K). The control mulberry had better growth and no nematodes in the roots, and close arrangement of root cell.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure\u0026nbsp;8 Symptoms and histopathlology of mulberry inoculated with\u003c/b\u003e \u003cb\u003eM. vitis\u003c/b\u003e \u003cb\u003efor 90 days.\u003c/b\u003e A-C. Aboveground and root symptoms of mulberry inoculated with \u003cem\u003eM. vitis\u003c/em\u003e for 90 days (Arrows show eggs mass). D-H. Different stages of \u003cem\u003eM. vitis\u003c/em\u003e in Mulberry after inoculating for 90 days. I. Symptoms of the root phloem after \u003cem\u003eM. vitis\u003c/em\u003e infection for 90 days, and the arrow indicated female. J-K. Transverse section of root infected with \u003cem\u003eM. vitis\u003c/em\u003e for 90 days (gc\u0026thinsp;=\u0026thinsp;giant cells; n\u0026thinsp;=\u0026thinsp;nematodes). (Scale bars: D, F\u0026thinsp;=\u0026thinsp;100 \u0026micro;m; E, H\u0026thinsp;=\u0026thinsp;200 \u0026micro;m; G\u0026thinsp;=\u0026thinsp;2000 \u0026micro;m; I\u0026thinsp;=\u0026thinsp;1000 \u0026micro;m)\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMulberry is an important economic forest in China, known as the \u0026ldquo;Oriental divine wood\u0026rdquo;. With the implementation of the national strategy of \u0026ldquo;moving mulberry from east to west\u0026rdquo;, the planting area of the mulberry in Yunnan Province has gradually increased, and it has become one of the important provinces for the development of sericulture in western China [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Luliang County is the largest mulberry planting area in Yunnan Province and the occurrence of mulberry RKN disease in this county is more harmful, which restricts the development of mulberry silkworm industry. At present, seven RKNs species (\u003cem\u003eM. incognita\u003c/em\u003e, \u003cem\u003eM. arenaria\u003c/em\u003e, \u003cem\u003eM. javanica\u003c/em\u003e, \u003cem\u003eM. hapla\u003c/em\u003e, \u003cem\u003eM. enterolobii\u003c/em\u003e, \u003cem\u003eM. mali\u003c/em\u003e, \u003cem\u003eM. thamesi\u003c/em\u003e) have been reported to harm mulberry. In this study, a high density RKNs was found to infect mulberry in Luliang County, Yunnan Province and the pathogen nematode was identified as \u003cem\u003eM. vitis\u003c/em\u003e by systematic identification, which was the first report that \u003cem\u003eM. vitis\u003c/em\u003e parasitizing mulberry.\u003c/p\u003e\u003cp\u003e\u003cem\u003eM. vitis\u003c/em\u003e is a new species of RKN parasitic on grapes discovered by our research group in 2021 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Since the discovery of \u003cem\u003eM. vitis\u003c/em\u003e, no reports of new hosts for this nematode have been seen yet. In this study, we found that the morphological characteristics (females, perineal pattern, J2s, males) of RKNs parasitizing mulberry were basically consistent with the original reported \u003cem\u003eM. vitis\u003c/em\u003e populations, except for the morphological measurements of the males were slightly different. Its longer gubermaculum length (10.60-19.91 vs. 8.15\u0026ndash;14.88 \u0026micro;m), smaller head region height (2.17\u0026ndash;4.31 vs. 4.70\u0026ndash;5.76 \u0026micro;m) and head region width (5.43\u0026ndash;8.25 vs. 8.33\u0026ndash;12.32 \u0026micro;m). Ghaderi \u003cem\u003eet al\u003c/em\u003e reported that there exist considerable variations in measurements of adult RKNs between different populations because of their great body size [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Morphology and morphometric of \u003cem\u003eM. javanica\u003c/em\u003e from different countries are also exist variations [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The differences between the male gubermaculum length and head region height/width identified in this study and the original description of \u003cem\u003eM. vitis\u003c/em\u003e may be caused by differences among individuals and errors in measurement data.\u003c/p\u003e\u003cp\u003eIn particular, the phylogenetic trees in this research based on rDNA-ITS1-5.8S-ITS2 and mtDNA-coxII sequences showed that the pathogenic RKNs isolated from mulberry and \u003cem\u003eM. vitis\u003c/em\u003e and \u003cem\u003eM. suginamiensis\u003c/em\u003e (the sequences are from the report by Gu \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]) formed one group with high bootstrap support (100%), this indicates that \u003cem\u003eM. vitis\u003c/em\u003e have a closer genetic relationship with \u003cem\u003eM. suginamiensis\u003c/em\u003e. Therefore, \u003cem\u003eM. vitis\u003c/em\u003e was compared with the original description (only contains morphological descriptions and lacks molecular information) of \u003cem\u003eM. suginamiensis\u003c/em\u003e [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], the result shows that \u003cem\u003eM. vitis\u003c/em\u003e are different from \u003cem\u003eM. Suginamiensis\u003c/em\u003e in that the body of the female is pear-shaped and milky white (pearly white, sometimes yellow brown in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the excretory pore of the female is located on the ventral region between 23rd and 25th annule behind lips (being on 22-28th annule from anterior end in \u003cem\u003eM. suginamiensis\u003c/em\u003e), no obvious lateral lips of the female (lateral lips fused to the upper surface of head in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the perineal pattern of the female is round to ovoid, with smooth and fine striae (slightly squarish outline, wavy striae in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the distance between two phasmids of the perineal pattern is wider than or equal to the length of the vulval slit and in very few specimens, this value is slightly smaller (slightly wider than the length of vulval slit in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the head region of the male lacks annulus (one or two annules in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the body of the male slightly bends towards the ventral side after being heated and killed (body almost straight and twist in posterior portion in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the labial disc of the male is horizontally ovoid-squared, no obvious lateral lips and a prominent slit-like opening between the labial disc and medial lips (labial disc large, lozenge\u0026shy;shaped and lateral lips clear in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the lateral field of the male having four incisures forming 3 lateral bands, which are full of reticular striae (four incisures forming 3 lateral bands, the outermost two side bands have reticular patterns, while the middle side band has discontinuous striae in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the tail of male is mostly straight and short with a humped tip (tail shorter and with rounded broad tip in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the tip end of the spicules of the male resemble slightly curves to form a hook-like shape (not described in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the lateral field of the second stage juveniles having four incisures forming 3 lateral bands, which are full of reticular striae (four incisures, of which outer two slightly crenated, and not areolated in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the tail of the second stage juveniles is conical and constricted of tail tip (tail conoid, short, deeply constricting, with rounded, blunt tip in \u003cem\u003eM. suginamiensis\u003c/em\u003e), the hyaline tail of the second stage juveniles is longer (9.72\u0026ndash;15.73 um vs 3\u0026ndash;5 um). Furthermore, the hosts are different, peppers are the host of \u003cem\u003eM. suginamiensis\u003c/em\u003e but not of \u003cem\u003eM. vitis\u003c/em\u003e [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRKNs are a global menace to agricultural crop production [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and identifying their species is complex and crucial to understand the host-parasite relationships and to implement appropriate management strategies [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], reliable detection and identification technology is necessary for the protection of agricultural production systems and formulating effective prevention and control measures [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. At the moment, more than 100 genus \u003cem\u003eMeloidogyne\u003c/em\u003e have been described [\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], however, some nematodes have similar morphology and is difficult to distinguish due to interspecies similarity [\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. PCR analysis is a more practical method for routine and rapid diagnosis of RKN species and having increasingly become the preferred approach for unidentified samples [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The DNA-based methods, sequences of ribosomal (rDNA-ITS, 28S rDNA-D2/D3) and mitochondrial DNA (mtDNA-coxI, mtDNA-coxII) and sequence characterized amplified regions (SCAR) markers are considered to be more effective molecular markers for RKNs identification [\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. However, some studies have suggested that the sequences of rDNA-ITS, 28S rDNA-D2/D3, rDNA-18S of some RKNs are extremely conserved and remains difficult to distinguish [\u003cspan additionalcitationids=\"CR49 CR50\" citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. This study also found that the \u003cem\u003eM. vitis\u003c/em\u003e has a relatively close genetic relationship with the \u003cem\u003eM. suginamiensis\u003c/em\u003e, but there are significant differences in morphology. Therefore, to accurately identify the RKNs species, it is necessary to combine morphological characteristics with molecular biological identification [\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In this research, the field symptom observation and morphological identification, molecular biology techniques of polygene tandem (rDNA-ITS-PCR, mtDNA-CoxI PCR, mtDNA-CoxII PCR, SCAR-PCR), phylogenetic tree construction analysis and pathogenicity determination were combined to identify the species of the RKNs parasitizing mulberry, the pathogen was confirmed to be \u003cem\u003eM. vitis\u003c/em\u003e, the identification results are accurate and reliable. New hosts of this nematode have been identified again, which is of great significance.\u003c/p\u003e\u003cp\u003e\u003cem\u003eM. vitis\u003c/em\u003e was previously found parasitizing grape in 2021 and caused serious damage to grape [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], to our knowledge, this is the first report of \u003cem\u003eM. vitis\u003c/em\u003e attacking mulberry, this findings are important information for mulberry disease diagnosis and control. \u003cem\u003eM. vitis\u003c/em\u003e may spread rapidly in a certain region of the world, further investigations are essential to monitoring its new potential hosts, distribution and spread and to implementing future effective and integrated nematodes management strategy to safeguard plant cultivation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eRoot-knot nematodes (RKNs) attack a wide array of plant species and cause significant damage, resulting in economic losses. In this study, we found a high density RKNs parasitizing Mulberry in Yunnan, China. To accomplish this, we assayed the morphometric traits and measurements, rDNA/mtDNA-based phylogenetic relationships of this nematode and SCAR-PCR analysis to identify RKNs, the pathogen nematodes were identified as \u003cem\u003eM. vitis\u003c/em\u003e. This is the first report of \u003cem\u003eM. vitis\u003c/em\u003e attacking mulberry. The pathogenicity of \u003cem\u003eM. vitis\u003c/em\u003e to mulberry was detected and with the result of inducing typical root-knot symptoms and egg mass formation. Since the discovery of \u003cem\u003eM. vitis\u003c/em\u003e, new hosts of this nematode have been identified again. Valuably, the results of this study have significantly expanded our understanding of the new hosts of \u003cem\u003eM. vitis\u003c/em\u003e, providing a basis for assessing the distribution range of \u003cem\u003eM. vitis\u003c/em\u003e, providing a theoretical basis for accurately identifying and implementing future effective and integrated nematodes management strategy to safeguard mulberry cultivation.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003cdiv id=\"Sec12\" class=\"Section3\"\u003e\u003ch2\u003eExperimental Material\u003c/h2\u003e\u003cp\u003eThe mulberry RKNs disease samples: Collected from the planting field of mulberry (n\u0026uuml; sang) in Xiaojie Street, Zhongshu Subdistrict, Luliang County, Yunnan Province (24˚96\u0026rsquo; N, 103˚66\u0026rsquo; E), a total of 6 samples were collected, named SS-1, SS-2, SS-3, SS-4, SS-5, SS-6.\u003c/p\u003e\u003cp\u003eMulberry seedlings (n\u0026uuml; sang): cutting seedling, the branches of n\u0026uuml; sang used for cutting propagation were collected from the fields where the mulberry RKNs disease was discovered, brought back to the laboratory for cutting and wait for rooting and then used for nematode inoculation to test their pathogenicity.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eObservation the disease symptom\u003c/h2\u003e\u003cp\u003eThe symptoms of the aboveground and underground parts of the infected mulberry were carefully observed and photographed when the samples were collected in the field. After the collected samples were cleaned and dried, they were observed and photographed under the stereomicroscope (Discovery.V12, Carl Zeiss, Germany).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eNematode population isolation and morphological identification\u003c/h2\u003e\u003cp\u003eFemale and eggs samples were extracted from the root tissues of mulberry, parts of the females were stored in a refrigerator at -80℃ for DNA extraction. Others were photographed under an inverted microscope (Axio Vert. A1, Carl Zeiss, Germany), and the morphologic index were measured following the method described by Yang \u003cem\u003eet al\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePart of single egg mass was directly extracted and inoculated on the root of cucumber (Jinyan No. 4) for purification and propagation, others were cultured in a constant temperature incubator at 28℃ to collect the second stage juveniles (J2s), at the same time, the males attached to the eggs mass were free in water and collect them. J2s and males were heat-killed and fixed using 4% formaldehyde solution for morphological observation and measurement.\u003c/p\u003e\u003cp\u003ePerineal patterns of female adults were made following the method of Zhang \u003cem\u003eet al\u003c/em\u003e [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. The perineal pattern was cleaned with a 45% lactic acid solution, placed on a glass slide and covered with coverslip, using pure glycerine as a floating carrier. The finished perineal pattern was placed under a microscope for observation and photographing.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eDNA extraction, PCR amplification and sequencing\u003c/h2\u003e\u003cp\u003eDNA extraction, DNA was extracted from a single female adult following the method described by Yang \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Worm lysis buffer (WLB, 100 \u0026micro;L) was prepared: 10\u0026times;PCR Buffer (Mg\u003csup\u003e2+\u003c/sup\u003e, free) 20 \u0026micro;L, MgCL\u003csub\u003e2\u003c/sub\u003e 16 \u0026micro;L, protease K 1 \u0026micro;L, ddH\u003csub\u003e2\u003c/sub\u003eO 63 \u0026micro;L. The females were pierced with sterilized skewer, added with 5 \u0026micro;L WLB, frozen in liquid nitrogen for 20 min, added with 10 \u0026micro;L paraffin oil, and kept at 56℃ for 80 min and 95℃ for 15 min in a PCR apparatus.\u003c/p\u003e\u003cp\u003ePCR amplification, rDNA ITS1-5.8S-ITS2 fragments and two mtDNA fragments (partial coxI and 16S rRNA coxII) were amplified using the primer pairs 18S/26S [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], cox1F/cox1R [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] and C2F3/1108 [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], respectively. SCAR-PCR was amplified using the primer pairs Mv-F/Mv-R [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. All of the polymerase chain reactions (PCRs) were performed in 25.00 \u0026micro;L mixed solution containing 10\u0026times; PCR buffer (Mg\u003csup\u003e2་\u003c/sup\u003e, plus) 2.50 \u0026micro;L, dNTPs 2.00 \u0026micro;L, forward and reverse primers (10 \u0026micro;mol/L) 1.00 \u0026micro;L, template DNA 2.50 \u0026micro;L, Taq DNA polymerase (5 U/\u0026micro;L) 0.25 \u0026micro;L, and ddH\u003csub\u003e2\u003c/sub\u003eO 15.75 \u0026micro;L. The PCR amplification procedure is showed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. PCR products were electrophoresed.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe primers used\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers code\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReferences\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e18S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGATTACGTCCCTGCCCTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eVrain \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e26S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTCCGCTAAATGATATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecox1F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGTCATCCTGAAGTTTATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTrinh \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecox1R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTACA ACATAATAAGTATCATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eC2F3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGTCAATGTTCAGAAATTTGTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ePowers \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1108\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTACCTTTGACCAATCACGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMv-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGGTTCAGGGTCATTTATAAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eYang \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMv-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTATACGCTTGTGTGGATGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe PCR amplification procedure of primers\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ePrimers code\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ePre degeneration\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e\u003cp\u003eResponse parameter (35 cycle)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eFinal extension\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDegeneration\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAnnealing\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eExtension\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e18S/26S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94 ℃ 4 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e94 ℃ 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e55 ℃ 45 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e72 ℃ 1 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e72 ℃ 10 min\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecox1F/cox1R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94 ℃ 4 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e94 ℃ 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e54 ℃ 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e72 ℃ 1 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e72 ℃ 10 min\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eC2F3/1108\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94 ℃ 4 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e94 ℃ 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e51 ℃ 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e72 ℃ 1 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e72 ℃ 10 min\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMv-F/Mv-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94\u0026deg;C 4 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e94\u0026deg;C 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e53\u0026deg;C 30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e72\u0026deg;C 1 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e72\u0026deg;C 10 min\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eSequencing, PCR products were purified using the EasyPure Quick Gel Extraction Kit (TransGen Biotech). The recovered product was ligated with pmD18 cloning vector and transformed into DH5α competent cells. The positive clones were selected and sequenced.\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003eThe primers used\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e \u003cb\u003eThe PCR amplification procedure of primers\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003ePhylogenetic analyses\u003c/h2\u003e\u003cp\u003ePCR products were cloned, and the positive clones were selected and sequenced, the obtained sequences were compared with those from other nematodes available in the GenBank database using the BLAST homology search program. The sequence of rDNA ITS1-5.8S-ITS, and mtDNA coxI and coxII from \u003cem\u003eMeloidogyne\u003c/em\u003e spp. were selected for phylogenetic reconstruction. A phylogenetic tree was constructed based on the neighbor-joining (NJ) method in MEGA 5.1 to analyze the phylogenetic relationships among nematodes.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003ePathogenicity detection\u003c/h2\u003e\u003cp\u003eThe mulberry materials tested were cutting seedling, and the cutting were planted in plastic flower pots (18 cm diamete\u0026times;15 cm high) containing a sterilized mixed soil (humus soil/laterite soil/perlite\u0026thinsp;=\u0026thinsp;3:1:1). After 6 months, \u003cem\u003eM. vitis\u003c/em\u003e was artificially inoculated into mulberry root following the method of Velloso \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], 10 mulberry seeding were inoculated, each plant was inoculated with 2500 J2s, three noninoculated mulberry were used as the negative control. All plants were cultured in greenhouse at approximately 14 ℃ to 26 ℃. After 90 days, all plants were observed. The morphology of nematodes at different growth stages in the roots of mulberry were observed using the acid fusion staining method followed by Tian \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Galled roots of mulberry were collected for histopathological studies using the paraffin section staining method followed by Arun \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (32560631) and the National Key Research and Development Program of China (2023YFD1400400).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY. Y. performed all experiments and was a major contributor in writing the manuscript. X. Y. collected samples, analyzed data and assisted with writing. D. T. investigation and collected samples. W. X. and Z. Z. collected samples and data curation. P.W. and S. Y. analysed the data, Wrote-reviewd \u0026amp;amp; edited the main draft of the manuscript and prepared the figures. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll sequences are available from the GenBank database (accession number: PQ452305, PQ452306, PQ451475, PQ451474, PQ639275, PQ639276). Other relevant data are within the paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArunakumar GS, Gnanesh BN, Manojkumar HB, Doss G, Mogili T, Sivaprasad V, et al. Genetic diversity, identification, and utilization of novel genetic resources for resistance to \u003cem\u003eMeloidogyne incognita\u003c/em\u003e in Mulberry (Morus spp). Plant Dis. 2021;105(10):2919\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa B, Wang HH, Liu JC, Chen L, Xia XY, Wei WQ, et al. The gap-free genome of mulberry elucidates the architecture and evolution of polycentric chromosomes. Hortic Res. 2023;10(7):1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHao JY, Gao YF, Xue JB, Yang YY, Yin JJ, Wu T, et al. Phytochemicals, pharmacological effects and molecular mechanisms of mulberry. Foods. 2022;11(8):1\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui WY, Luo KY, Xiao Q, Sun ZY, Wang YF, Cui CF, et al. Effect of mulberry leaf or mulberry leaf extract on glycemic traits: a systematic review and meta-analysis. Food Funct. 2023;14(3):1277\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi RL, Wang J, Liu JY, Li MY, Lu JY, Zhou JN, et al. Mulberry leaf and its effects against obesity: a systematic review of phytochemistry, molecular mechanisms and applications. Phytomedicine. 2024;128:155528.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaqsood M, Saeed RA, Sahar A, Khan MI. Mulberry plant as a source of functional food with therapeutic and nutritional applications: A review. J Food Biochem. 2022;46(11):1\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXia ZQ, Fan W, Liu DY, Chen YN, Lv J, Xu MX, Zhang MR. Haplotype-resolved chromosomal-level genome assembly reveals regulatory variations in mulberry fruit anthocyanin content. Hortic Res. 2024;11(6):1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTian ZD. A Summary of the harm and control of mulberry root- knot nematodiasis. GuangXi Seric. 2000;37(4):17\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun TG, Fang DW, Sun Y, Li YJ. Preliminary report of selecting effective agents for controlling mulberry root nematodiasis. Cany Kexue. 2004;30(4):421\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang RX, Chen ZA. The identification of root-knot nematodes on mulberr. Acta Agriculturae Boreali-Occidentalis Sinica. 1989;17(2):1115\u0026ndash;116.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen LJ, Jiang YP. Inhibition effect of clayey soil on nematodes of mulberry. Jiangsu Seric, 1993;(4):46\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang JY, Shi SQ, Hu XQ, Zhang Z. Preliminary study on mulberry root-knot nematode disease in luliang county Yunnan Province. J Yunnan Agricultural Univ. 2002;17(3):294\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo LH, Huang YX, Meng F, Yuan T, Zhang XN, Wang YQ, et al. Morphological and molecular identification of root-knot nematode from mulberry field of Guangzho. Sci Seric. 2021;47(2):147\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu JP. The New progress in identification and molecular detection of \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e. Newsl Sericultural Sci. 2021;41(3):58.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eToida Y, Yaegashi T. Description of \u003cem\u003eMeloidogyne suginamiensis\u003c/em\u003e n. sp. (Nematoda: Meloidogynidae) from mulberry in Japan. Japanese J Nematology. 1984;14:49\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTong TXF, Gao ZX. Growth and development of nematodes and mulberr. Jiangsu Sericul Ture. 1985;(02):58\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNaik VN, Sharma DD, Govindaiah G. Incidence and intensity of root disease complex due to nematode and soilborne fungal pathogens in mulberry (Morus alba L). Int J Industrial Entomol. 2008;16(2):49\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCastillo P, Di Vito M, Vovlas N, Jim\u0026eacute;nez-D\u0026iacute;az RM. Host-parasite relationships in root-knot disease of white mulberry. Plant Dis. 2001;85(3):277\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSoares MRC, Lopes APM, Dias-Arieira CR, Souto ER, Manenti ER, Mattei DC. First report on \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e in Morus celtidifolia in Paran\u0026aacute; State, Brazil. Plant Dis. 2018;102(8):1671.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLafi HA, AI-Yahya FA, AI-Hazmi AS. First report of \u003cem\u003eMeloidogyne incognita\u003c/em\u003e on mulberry in Saudi Arabia. Plant Dis. 2021;105(12):4171.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCong Z, Huang G, Huo S, Liao X, Gao S, Zheng J, et al. The nuclear hormone receptor family transcription factor Dd-NHR-1 is required for embryonic development in Ditylenchus destructor. New Plant Prot. 2025;2:e70009.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJones JT, Haegeman A, Danchin EGJ, Gaur H, Helder J, Jones MGK, et al. Top 10 plant-parasitic nematodes in molecular plant pathology. Mol Plant Pathol. 2013;14(9):946\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen YP, Liu Q, Sun XQ, Liu L, Zhao JL, Yang SS, et al. \u003cem\u003eMeloidogyne enterolobii MeMSP1\u003c/em\u003e effector targets the glutathione-S-transferase phi GSTF family in arabidopsis to manipulate host metabolism and promote nematode parasitism. New Phytol. 2023;240(6):2468\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLei SM, Li G, Yang L, Li JJ, Yang JF. Occurrence, harm and control of mulberry root knot nematode disease in Yunnan Province. Guangxi Seric. 2012;49(1):13\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumari NV, Sujathamma P. Integrated management of root knot nematode \u003cem\u003eMeloidogyne incognita\u003c/em\u003e chitwood in mulberry (Morus spp). IOSR J Pharm Biol Sci. 2014;9(1):30\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRashidifard M, Fourie H, Daneel MS, Marais M. Morphological and morphometrical identification of \u003cem\u003eMeloidogyne\u003c/em\u003e populations from various crop production areas in south africa with emphasis on \u003cem\u003eM. enterolobii\u003c/em\u003e. Zootaxa. 2019;4658(2):251\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSebastian K, E, F. J., and, Andrea B-K. Development and validation of LNA-Based quantitative real-time PCR assays for detection and identification of the root-knot nematode \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e in complex DNA backgrounds. Phytopathology. 2015;105(9):1245\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang YM, Hu XQ, Liu P, Chen L, Peng H, Wang QM, et al. A new root-knot nematode, \u003cem\u003eMeloidogyne vitis\u003c/em\u003e sp. nov. (Nematoda: Meloidogynidae), parasitizing grape in Yunnan. PLoS ONE. 2021;16(2):1\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhaderi R, Dehghan AA, Hesa AM, Karega A. Genetic intraspecific diversity of \u003cem\u003eMeloidogyne javanica\u003c/em\u003e parasitizing vegetables in southern Iran. J nematol. 2020;52:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePhan KL, Le TML, Nguyen HT, Nguyen TD, Trinh QP. First report and new molecular and morphological characterizations of root-knot nematode, \u003cem\u003eMeloidogyne javanica\u003c/em\u003e, infecting ginger and long coriander in Vietnam. J nematol. 2021;53:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGu JF, Fang YW, Liu LL. First Report of the Suginami Root-knot nematode, \u003cem\u003eMeloidogyne suginamiensis\u003c/em\u003e, infecting maple trees, acer palmatum, from Japan. Plant Dis. 2019;104(1):1.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang YM. Studies on the identification, biological characteristics and candidate pathogenic genes of \u003cem\u003eMeloidogyne vitis\u003c/em\u003e sp. nov. Thesis, Yunnan Agricultural University. 2021.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLa SK, Li JF, Ma S, Liu XQ, Gao LH, Tian YQ. Protective role of native root-associated bacterial consortium against root-knot nematode infection in susceptible plants. Nat Commun. 2024;15(1):1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRusinque L, Maleita C, Abrantes I, Palomares-Rius JE, In\u0026aacute;cio ML. \u003cem\u003eMeloidogyne graminicola\u003c/em\u003e-A threat to rice production review update on distribution, biology, identification, and management. Biology. 2021;10(1163):1\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRusinque L, Camacho MJ, Serra C, No\u0026acute;brega F, Ina\u0026acute;cio ML. Root-knot nematode assessment: species identification, distribution, and new host records in Portugal. Front plant sci. 2023;14:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKiewnick S, Frey JE, Braun-Kiewnick A. Development and validation of LNA-based quantitative real time PCR assays for detection and identification of the root-knot nematode \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e in complex DNA backgrounds. Phytopathology. 2015;105(9):1245\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaleita C, Cardoso JMS, Rusinque L, Esteves I, Abrantes I. Species-specific molecular detection of the root knot Nematode \u003cem\u003eMeloidogyne luci\u003c/em\u003e. Biology. 2021;10(775):1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao Y, Xu CL, Yuan CF, Wang HH, Borong Lin BR, Zhuo K, Liao JL. \u003cem\u003eMeloidogyne aberrans\u003c/em\u003e sp. nov. (Nematoda: Meloidogynidae), a new root-knot nematode parasitizing kiwifruit in China. PLoS ONE. 2017;12(8):1\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRusinque L, N\u0026oacute;brega F, Serra C, In\u0026aacute;cio ML. The northern root-knot nematode \u003cem\u003eMeloidogyne hapla\u003c/em\u003e: new host records in Portugal. Biology. 2022;11(11):1567.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRiva G, Brito JA, Oliveira CD, Marin M, Gu M, Bui HX, et al. Identification, distribution, and hosts of \u003cem\u003eMeloidogyne\u003c/em\u003e spp. infecting horticultural crops in Florida, USA with focus on \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e. J nematol. 2024;56(1):1\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun BX, Gao B, Wang RY, Chen SL, Li XH, Dong YH, et al. Development of enzyme-mediated duplex exponential amplification assay for detection and identification of \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e in Field. Microorganisms. 2025;13(6):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOliveira SA, Oliveira CMG, Maleita CMN, Silva MFA, Abrantes IMO. Wilcken S R S. First report of \u003cem\u003eMeloidogyne graminis\u003c/em\u003e on golf courses turfgrass in Brazil. PLoS ONE. 2018;13(2):1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarquez J, Hajihassani A. Identification and Virulence of Five Isolates of root-knot nematode \u003cem\u003eMeloidogyne floridensis\u003c/em\u003e on vegetables. Plant Dis. 2023;107(5):1522\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBacic J, Lalicevic I, Sirca S, Theuerschuh M, Susic N, Stare BG. Occurrence and distribution of root-knot nematodes \u003cem\u003eMeloidogyne\u003c/em\u003e spp. Serbia Agron. 2025;15(2):1\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSkantar AM, Handoo ZA, Kantor MR, Hult MN. First report of barley root-knot nematode, \u003cem\u003eMeloidogyne naasi\u003c/em\u003e from turfgrass in Idaho, with multigene molecular characterization. J nematol. 2023;55(1):1\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnderson SD, Gleason CA. A molecular beacon real-time polymerase chain reaction assay for the identification of \u003cem\u003eM. chitwoodi\u003c/em\u003e, \u003cem\u003eM. fallax\u003c/em\u003e, and \u003cem\u003eM. minor\u003c/em\u003e. Front Plant Sci. 2023;14:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWendimu GY. Biology, taxonomy, and management of the root-knot nematode (\u003cem\u003eMeloidogyne incognita\u003c/em\u003e) in Sweet Potato. Adv Agric. 2021;1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePowers TO, Todd TC, Burnell AM, Murray PCB, Fleming CC, Szalanski AL, et al. The rDNA internal transcribed spacer region as a taxonomic marker for nematodes. J nematol. 1997;29(4):441\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLanda BB, Rius JEP, Vovlas N, Carneiro RM, D G, Maleita CMN, Abrantes IM, O, et al. Molecular characterization of \u003cem\u003eMeloidogyne hispanica\u003c/em\u003e (Nematoda, Meloidogynidae) by phylogenetic analysis of genes within the rDNA in \u003cem\u003eMeloidogyne\u003c/em\u003e spp. Plant Dis. 2008;92(7):1104\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePan S, Wei PY, Li Y, Chen ZJ, Peng DL, Wang L, et al. Identification of \u003cem\u003eMeloidogyne\u003c/em\u003e Species on traditional chinese medicine plants in the qinling mountain area of china and their aggressiveness to different medicinal herbs. Plant Dis. 2024;108(5):1202\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHabteweld A, Davidson W, Desaeger J, Crow WT. First Report of \u003cem\u003eMeloidogyne incognita\u003c/em\u003e Infecting Mitragyna speciosa in the United States. J nematol. 2022;54(1):1\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSuwanngam A, Schiffer PH, Sasnarukkit A, Siripattanapipong S, Jindapunnapat K, Chinnasri B, et al. Development of colorimetric and fluorescent closed tube LAMP assay using simplified extraction for diagnosis of \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e in root tissues. Sci Rep. 2025;15(1):1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTrinh QP, Le TML, Nguyen TD, Nguyen HT, Morphologic. Morphometric, and Characterization of Vietnamese Populations of \u003cem\u003eMeloidogyne incognita\u003c/em\u003e. Plant Dis. 2023;107(12):3693\u0026ndash;700.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaleita C, Cardoso JMS, Rusinque L, Esteves I, Abrantes I. Species-Specific Molecular Detection of the root knot nematode \u003cem\u003eMeloidogyne luci\u003c/em\u003e. Biology. 2021;10(8):1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang XX, Zhao W, Lin YM, Shan B, Yang SS. Identification of \u003cem\u003eMeloidogyne panyuensis\u003c/em\u003e (Nematoda: Meloidogynidae) infecting Orah (Citrus reticulata Blanco) and its impact on rhizosphere microbial dynamics: Guangxi, China. Peer J. 2024;12:1\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang YM, Liu P, Li HM, Peng H, Du X, Dong Y, et al. Study on PCR rapid molecular detection technique of \u003cem\u003eMeloidogyne vitis\u003c/em\u003e. J Integr Agr. 2022;21(11):3408\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVrain TC, Wakarchuk DA, Laplantelevesque AC, Hamilton RI. Intraspecific rDNA restrietion fragment length polymorphisrms in the Xiphinema americanum group. Fundamental Appl nematology. 1992;15(6):563\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTrinh QP, Le TML, Nguyen TD, Nguyen HT, Liebanas G, Nguyen TAD. \u003cem\u003eMeloidogyne daklakensis\u003c/em\u003e n. sp. (Nematoda: Meloidogynidae), a new root-knot nematode associated with Robusta coffee (Coffea canephora Pierre ex A. Froehner) in the Western Highlands. Vietnam J helminthol. 2019;93(2):242\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePowers TO, Harris TS. A polymerase chain reaction method for identification of five major \u003cem\u003eMeloidogyne\u003c/em\u003e species. J nematol. 1993;25(1):1\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVelloso JA, Maquilan MAD, Campos VP, Brito JA, Dickson DW. Temperature Effects on Development of \u003cem\u003eMeloidogyne enterolobii\u003c/em\u003e and \u003cem\u003eM. floridensis\u003c/em\u003e. J nematol. 2022;54(1):1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTiian ZL, Shi HL, Maria M, Zheng JW. Pectate lyase is a factor in the adaptability for \u003cem\u003eHeterodera glycines\u003c/em\u003e infecting tobacco. J Integr Agr. 2019;18(3):618\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArun A, Shanthi A, Raveendran M, Pushpam R, Shandeep G. An insight into occurrence, biology, and pathogenesis of rice root-knot nematode \u003cem\u003eMeloidogyne graminicola\u003c/em\u003e. Biology. 2023;12(7):1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Meloidogyne vitis, Mulberry (Morus spp.), New host plant, Phylogenetic relationship, Pathogenicity","lastPublishedDoi":"10.21203/rs.3.rs-8170667/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8170667/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eMulberry is an economically important sericulture crop, however, root-knot nematodes (RKNs) infection pose a serious threat to the production of mulberry. We found a high density RKNs parasitizing mulberry in Yunnan, China. In order to clarify the pathogenic species, the morphometric traits and measurements, rDNA/mtDNA-based phylogenetic relationships of this nematode and SCAR-PCR analysis were used to identify RKNs, and the mulberry healthy seedlings were inoculated artificially with second-stage juveniles to research pathogenicity.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eThe perineal pattern of females is round to ovoid with a moderately high dorsal arch and two large and prominent phasmids, similar to \u003cem\u003eMeloidogyne vitis\u003c/em\u003e. The morphological characteristics and morphometric values of females, second-stage juveniles and males were similar to \u003cem\u003eM. vitis\u003c/em\u003e. The nucleotide sequence of rDNA ITS1-5.8S-ITS2, mtDNA coxI and coxII of this nematode were highly similar to \u003cem\u003eM. vitis\u003c/em\u003e, with a similarity of more than 99%, and all were clustered within the same clade with those of \u003cem\u003eM. vitis\u003c/em\u003e with a high support rate of 100%. Moreover, species identity was further confirmed using \u003cem\u003eM. vitis\u003c/em\u003e-specific primers Mv-F/R, a single specific fragment of 174 bp was obtained. Artificial inoculation showed that the RKN isolated and purified from mulberry could complete its life history in the roots of healthy seedlings of mulberry, and produced typical root-knot and egg masses.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThe RKN parasitizing in mulberry was confirmed as \u003cem\u003eM. vitis\u003c/em\u003e based on the morphological features and molecular results. This is the first report of \u003cem\u003eM. vitis\u003c/em\u003e attacking mulberry. \u003cem\u003eM. vitis\u003c/em\u003e could infect and damage mulberry and may constitute a potential threat to mulberry production. The results of this study providing a theoretical basis for accurately identifying and implementing future effective and integrated nematodes management strategy to safeguard mulberry cultivation.\u003c/p\u003e","manuscriptTitle":"Meloidogyne vitis, a new infecting nematode species on mulberry in Yunnan, China","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-08 19:35:12","doi":"10.21203/rs.3.rs-8170667/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-23T05:01:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-23T04:42:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-21T22:30:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"222459622860212049235406244814079044285","date":"2025-12-12T01:21:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"106611928009784431604348935951238254473","date":"2025-12-08T20:40:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"206141656417774485754257736576969799756","date":"2025-12-08T00:56:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-05T23:50:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-05T23:49:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58341861204276834665462229167449089705","date":"2025-12-05T16:33:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-03T07:01:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-03T06:58:44+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-12-03T06:53:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-03T03:51:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2025-12-03T03:43:20+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ca4246e8-4cfc-471b-ac3c-4f6ac01b2901","owner":[],"postedDate":"December 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-20T06:09:13+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-08 19:35:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8170667","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8170667","identity":"rs-8170667","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}