Through its genoprotective, mitochondrial bioenergetic modulation, and antioxidant effects, Fucoxanthin and its metabolite minimize Ochratoxin A-induced nephrotoxicity in HK-2 human kidney cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Through its genoprotective, mitochondrial bioenergetic modulation, and antioxidant effects, Fucoxanthin and its metabolite minimize Ochratoxin A-induced nephrotoxicity in HK-2 human kidney cells Ekramy M. Elmorsy, Huda A. Al Doghaither, Ayat B. Al-Ghafari, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6077785/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Jul, 2025 Read the published version in BMC Nephrology → Version 1 posted 8 You are reading this latest preprint version Abstract Background Ochratoxin A (OTA) is a mycotoxin with reported multiorgan toxicity, especially kidney toxicity. Fucoxanthin (FX) and its hydrolyzed metabolite Fucoxanthinol (FXL) have reno-protective antioxidant and anti-inflammatory properties. This study evaluates the nephroprotective effects of FX and FLX on OTA-induced renal cytotoxicity using the HK-2 cell line. Methods Molecular docking was used to study the binding affinities with the main proteins of the studied pathways. Various in-vitro assays were used to test the hypothesis, including MTT, mitochondrial bioenergetics, oxidative stress, and apoptosis biomarkers. Results Docking revealed binding affinities of the tested chemicals with mitochondria, oxidative stress, and apoptosis. Data showed that OTA has a dose-dependent cytotoxic effect on HK-2 cells. Notably, FX and FXL improved cell viability. A significant deregulation of normal cellular pathways including genotoxicity (DNA damage percentage), mitochondrial bioenergetics disruption (PDH, α-KG, MCI and MCIII complexes activities, ATP levels and mitochondrial membrane potential), downregulation of some mitochondrial genes (ND1, ND5, CO-1 and ATP6/8) expression, mitophagy inhibition (PARK1 and parkin), Oxidative stress induction (ROS and TBARS), oxidative stress genes downregulation (HO-1 and Nrf2), antioxidant enzymatic activity reduction (ROS and CAT), and apoptotic mediator markers elevation ( Caspases- 3, 8 and 9, and Bax/Bcl-2 ratio) were observed in OTA mono-treated cells compared to untreated control cells. All parameters were markedly normalized by combining FX or FLX with OTA, providing more protection in FXL co-treated samples. Conclusion Our results suggest that FX and FXL may be effective novel therapies for treating OTA-induced nephrotoxicity in vitro. Fucoxanthin Fucoxanthinol Ochratoxin A Nephrotoxicity Oxidative stress Mitochondria Cellular bioenergetics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The estimates from the Food and Agriculture Organization (FAO) indicate that mycotoxin contamination impacts around 25% or more of food crops each year [1]. It is essential to note that just a particular group of mycotoxins presents considerable issues to food safety [2, 3]. Among these mycotoxins, Ochratoxin A (OTA) is a potent and highly toxic compound generated by species of Aspergillus and Penicillium that contaminate agricultural products, causing substantial health concerns for humans [4]. OTA commonly pollutes a wide variety of food commodities, such as cereals, coffee, cocoa, dried fruits, and spices [4–7]. Many studies have demonstrated that OTA presents various toxic effects, including nephrotoxicity, hepatotoxicity, teratogenicity, genotoxicity, immunotoxicity, neurotoxicity, and carcinogenicity, primarily affecting renal function, and is classified as a possible human carcinogen (Group 2B) [8–11]. Several processes, such as lipid peroxidation, suppression of protein synthesis, DNA damage, oxidative stress, and mitochondrial dysfunction, contribute to its harmful adverse effects [4]. Natural products are mixtures and monomers derived from natural sources, such as animals, plants, and microorganisms. Natural ingredients have historically been used to cure and prevent numerous diseases [12, 13]. Many compounds found in natural products have exhibited significant benefits and high efficacy in inhibiting cell death, oxidative stress, and inflammation [12]. Natural products can tackle cellular toxicity by utilizing their intrinsic bioactive compounds with antioxidant, anti-inflammatory, and detoxifying attributes, potentially alleviating damage inflicted by deleterious chemicals or environmental stressors, thus providing a less toxic alternative to synthetic chemicals in cellular protection and repair mechanisms [14]. Targeting mitochondrial dysfunction is one of the many biological functions these naturally occurring substances have demonstrated throughout thousands of years [15, 16]. Consequently, natural compounds may provide protective benefits for the kidneys. Even with these strategies, OTA remains a serious public health risk. The complexities of food product contamination necessitate comprehensive prevention, control, and management measures to minimize its negative consequences. Continued research and regulations have significance for protecting consumers and guaranteeing food safety [4]. Fucoxanthin (FX) is the most abundant carotenoid in marine brown algae. Because of its well-defined chemical structure, it has various beneficial properties against cancer, diabetes, obesity, cardiovascular disease, and neurological disorders [17]. It possesses multiple pharmacological properties, including antioxidant, anti-inflammatory, and anti-tumor effects, through which it exerts its renal protective effects in prevalent renal disorders, such as chronic kidney disease and ischemic renal injuries [18]. Digestive enzymes hydrolyze FX to produce Fucoxanthinol (FXL), which is then converted to amarouciaxanthin A in the liver and gastrointestinal tract [19]. Moreover, FXL was present in human plasma, although FX was not, after the oral treatment of kombu algae carrying FX [20]. Given their safer profile, we highlight FX and FXL, which may be highly promising in treating nephrotoxicity. Natural items are better for investigating potential treatments that control energy metabolism. Nevertheless, their role in addressing mitochondrial dysfunction in renal disorders has not been fully investigated. Thus, this study aimed to target oxidative stress, apoptosis, mitochondrial bioenergetics, mitophagy, and mitochondrial genes to extensively analyze and evaluate the nephroprotective effect of FX and FLX on OTA-induced renal toxicity using the HK-2 cell line as an experimental in vitro model. Additionally, the current study aims to provide side-effect-free alternatives to avoid OTA-contaminated food nephrotoxicity worldwide. Materials and methods Chemicals OTA, FX, and FLX were purchased from Sigma-Aldrich Chemical Company (St. Louis, MO, USA). DMSO was bought from ICI-UK. Subsequent laboratory chemicals were supplied by local vendors. Cell culture The human renal proximal tubular epithelial cells HK-2 cell line (model number: CRL-2190) used in this study were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Following the protocol used in [21], cells were grown in supplemented Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Prat de Llobregat, Barcelona, Spain)/Nutrient Mixture F-12 (HAM) (F-12, Gibco) (in 1:1 concentration), 37°C in an incubator with 95% humidity and 5% CO 2 . To keep up exponential growth, the cells were split using trypsin–EDTA and subcultured every two to three days. The consistency of experiments was maintained by using the same batch of HK-2 cells (within 5 passages), identical reagent lots, and standardized protocols for cell culture, treatment, and assay conditions. In all in vitro studies, the vehicle control group (negative control) comprised HK-2 cells treated with the same concentration of DMSO used to dissolve FX and FXL, without exposure to either chemical or OTA. The final concentration of DMSO in all treatment and control groups was kept at ≤ 0.1% (v/v), a level verified to have no cytotoxic effect on HK-2 cells. Cytotoxicity assessment using MTT assay The FX and FXL effect on the viability of HK-2 cells was assessed using the commonly used 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) test. HK-2 cells were grown to 90% confluence and placed into 96-well plates (TPP, Swiss). Cells (2 × 10 5 cells/ml) were then exposed to different OTA doses (5, 10, 20, 40, and 80 µM), and variable concentrations of FX and FXL (1, 2.5, 5, and 10 µM) were added to the cells for 24 hrs. In addition, a separate MTT assay applied where cells were treated with OTA (20 µM) alone as monotreatment or with 3 different subcellular cytotoxicity pathway inhibitors: anti-caspase-3 Z-vAD-fmk, antioxidant-reduced glutathione, and mitochondrial protective Co-Q10. The treatments’ media were taken out after 24 hrs, and medium containing MTT stain (Sigma, M5655-1G; 0.5 mg/ml) was added. The formed formazan crystals were solubilized with DMSO after four hours of incubation at 37°C. Using reading points of 590 nm, the microplate reader "TopCount" (Perkin Elmer, Ueberlingen, Germany) was utilized to estimate the absorbance levels for the MTT assay. The assessment for each experiment was carried out in triplicates. Cytotoxicity assessment using Trypan blue exclusion (TBE) assay In this assay, cells were cultured in 24-well plates for 24 hours and subsequently treated with OTA (20 µM), with or without FX or FXL (2.5 and 5 µM), after an additional 24 hours. Following a 24-hour post-treatment period, attached and floating cells were harvested and centrifuged. The resulting pellet was resuspended in 1 ml of phosphate-buffered saline (PBS), to which 100 µl of 0.4% wt/vol trypan blue was added. Cell viability was assessed using haemocytometer cell counts. Live cells exclude the dye, whereas apoptotic cells are stained due to compromised membrane integrity. Results are expressed as a percentage of viability. Each experiment was conducted a minimum of three times, with each treatment replicated in triplicate. Evaluation of genotoxic effects on DNA damage by comet assay in HK-2 cells DNA damage was evaluated using single cell gel electrophoresis on control and treated cells exposed to OTA (20 µM) with or without FX or FXL (2.5 and 5 µM) after 24 hrs. The alkaline comet test was conducted following a standardized protocol [22]. The cells were removed from the incubator and cooled down on ice-cold PBS before 30% ethanol was added. After the agarose was added to the infranatant, the slides were plated. Following the cell lysis with an alkaline lysis solution (pH = 10), it was electrophoresed for 30 minutes at 300 mA. After that, it was washed in a neutralizing solution (0.4 mM Tris-HCl) for 3 to 5 minutes, and the slides were then stained with PI (1 mg/ml) for 5 minutes. The cells were imaged using fluorescent microscopy at 546 nm excitation and 640 nm emission. It was finally analyzed using Comet Score IV software (Perspective Instruments, UK) to directly measure the percentage of the tail moment (TM), the amount of DNA in the tail (TD), and the length of the tail when quantifying DNA damage. Mitochondrial bioenergetic assays For biogenetics assays, cells were seeded and subjected to OTA (20 µM) for 24 hrs with or without adding FX and FXL (2.5 and 5 µM). Intracellular ATP levels assay ATP levels were assessed using the commercial kit and following the manufacturer's instructions (Abcam, Cambridge, UK; Catalog Number: ab83355). When ATP reacted with additional D-luciferin and luciferase, light was created. The luminescence signal was assessed with a "TopCount" luminometer (Perkin Elmer, Ueberlingen, Germany). The values of every cell well in the samples and controls were subtracted from the blank readings. ATP was calibrated to the total protein content of every sample. Three measures were carried out for each concentration used in the experiment. Mitochondrial membrane potential (MMP) assay Mitochondria MPP was investigated using rhodamine 123 (Rh-123), predominantly in energized mitochondria. At this point, the media were removed, and the cells were rinsed with phosphate-buffered saline. The cells were treated with Rh-123 (50 nM) for 10 minutes and then maintained in aluminum foil at 37ºC. Fluorescence was measured using a Top Count microplate reader (Perkin Elmer, Ueberlingen, Germany) at excitation and emission wavelengths of 480 nm and 530 nm, respectively. Experiments were conducted in triplicate. Mitochondrial complexes I (MCI) and III (MCIII) activities assays Following the Spinazzi et al. [23] protocol, MCI and MCIII activities were investigated using cell lyase and mitochondrial enriched fraction, respectively. While antimycin A was utilized as an MCIII inhibitor, decylubiquinol and cytochrome c were used as terminal electron acceptors. Rotenone was used as a specific MCI inhibitor, and NADH and ubiquinone were used as terminal electron acceptors. Experiments were repeated with at least five samples per treatment to get valid data, and controls were also measured. A temperature-controlled Beckman Coulter DU 800 spectrophotometer was used to calculate the absorbance read to 550 nm. The complexes' activities were expressed as nmol min -1 mg -1 of total protein. Pyruvate dehydrogenase (PDH) enzyme and alpha keto glutarate (α-KG) assays PDH activity and α-KG levels were evaluated using colorimetric commercial kits (Abcam, Cambridge, UK; Catalog Number: ab109902 and ab83431, respectively). following the company-supplied guidelines. Evaluation of PDH activity was based on reducing NAD + to NADH with reduction of the reporter and formation of the yellow reaction product, which was detected at OD450 nm. In contrast, α-KG is converted in the assay to pyruvate in the presence of colored probe, which can be read at 570 nm using an ELISA Dyne MRX microplate reader. Mitophagy assay After cells were plated and exposed to OTA (20 µM) with or without FX or FXL (2.5 and 5 µM) treatment for 24 hrs, the expression of PINK1 and Parkin proteins was analyzed with commercial ELISA kits and following the manufacturer's recommendations (Bioscience, Catalog Number: MBS7607221 and Abcam; Catalog Number: ab212159, respectively). using cell lysate. The impact of FX and FXL on mitophagy of the treated renal cells was investigated. After adding the stop solution, a Dyne MRX microplate reader was allocated to measure absorbance at 450 OD. The OD450 estimated values were inserted into the provided standard curve data, and the proteins’ levels were calculated. Oxidative stress biomarkers assays Cells were plated and exposed to OTA (20 µM) with or without FX or FXL (2.5 and 5 µM) treatment for 24 hrs. Reactive oxygen species (ROS) According to Elmorsy et al. [24], the levels of ROS were detected using the 2,7-dichlorodihydrofluorescein diacetate (DCFDA) test (25 uM in Hank's solution) at the time point. The fluorescence readings of the blank cell-free wells were subtracted from the total plate reading. Treatment-related ROS expression levels are presented as a percentage and compared to the controls. Every experiment was run in triplicates. Lipid peroxidation level While Malondialdehyde (MDA) is a legitimate lipid peroxidation biomarker, Thiobarbituric acid reactive substances (TBARS) are a common way to measure lipid peroxidation product and a well-known biomarker for oxidative stress. TBARS were evaluated using a purchased kit (Abcam, Cambridge, UK; Catalog Number: ab118970) under the recommended procedure. The cells were homogenized, sonicated, and centrifuged at 13,000 x g at the time point. The supernatant was then collected for the test. A "TopCount" plate reader (Perkin Elmer) assessed the absorbance at 532 nm. All the experiments were performed in triplicate. Enzymatic antioxidant activity Following Singh et al., catalase (CAT) activities were evaluated calorimetrically [25]. Following cell collection, each sample's protein content was assessed. For the reaction, 1 ml of 0.01 M pH 7 phosphate buffer, 0.1 ml of tissue homogenate, and 0.4 ml of 2 M H 2 O 2 tissue were mixed. Two milliliters of the dichromate acetic acid reagent were added to the starting solution to freeze the reaction. Finally, it was measured at 620 nm, and the absorbance point of CAT was expressed in terms of µmoles H 2 O 2 ingested/min/mg protein. Using a Colorimetric commercial test kit (Abcam, Cambridge, UK; Catalog Number: 277415), the superoxide dismutase (SOD) activity was calculated. The cells were harvested and centrifuged (14,000 x g for five minutes at + 4°C); the supernatants were then gathered and kept cold till analysis. The SOD level in the cells, including cytosolic and mitochondrial, is in the supernatant and measured with a "TopCount" plate reader; the SOD Absorbance rate was tracked at 440 nm. Apoptotic pathway markers analysis After cells were exposed to OTA (20 M) with or without FX and FXL (2.5 or 5 µM) for 24 hrs, the caspases − 3, -8, and − 9 activities were evaluated with BD Apo-Alert caspase fluorescence kits (Clontech Laboratories, CA, USA; catalog numbers: 630205, 630211, and 630218) in compliance with the manufacturer's instructions. Finally, excitation/emission fluorescence measurements were detected at 380/460 nm (for caspase − 9) and 400/505 nm (for caspase − 3 and − 8). RNA isolation and RT-qPCR analysis To summarize, a Qiagen RNeasy kit (Catalog No: 74134) was used to extract total RNA from both untreated and treated HK-2 cells after 24 hrs. A Bio-Rad iScript Reverse transcription supermix kit (Hercules, CA, USA; Catalog No: 1708841) was then used to reverse transcribe the extracted RNA. RNA's optical density (A260/A280 ratio) was measured using a NanoDrop 1000 Spectrophotometer (Wilmington, DE, USA). cDNA (1–100 ng) was amplified in triplicate using the primer sequences of GAPDH (internal control/housekeeping gene) and other genes as specified in Table 1 . The Maxima Syber Green/ROX qPCR Master Mix was utilized in triplicate for quantitative real-time PCR (qRT-PCR). The fold change of each mRNA was determined using threshold cycle (CT) values derived from the instrument's software. ∆CT was computed by subtracting the CT value of the housekeeping gene from that of the target mRNA. The ∆∆CT value for each mRNA was calculated by subtracting the experimental CT value from the control CT value. The formula 2 −∆∆CT was applied to figure out the fold change. Table 1 List of primers used in the study Gene Sense (5′-3′) Antisense (5′-3′) ND1 ACACTAGCAGAGACCAACCGAA GGGAGAGTGCGTCATATGTTGT ND5 CTATCTCGCACCTGAAACAAGC GGTGGAGTAGATTAGGCGTAGG CO1 TACGTTGTAGCCCACTTCCACT GGATAGGCCGAGAAAGTGTTGT ATP 6/8 CCATCAGCCTACTCATTCAACC GCGACAGCGATTTCTAGGATAG PARKIN AGCCTTGTCCTCGCTGCAAC CACCACTCCAGCTTGCACT PINK1 CCACCTTTCCCTTTGCCAT GCTCCTGGCTCATTTTGCTT Nrf2 CATCTACAAACGGGAATGTCTG AGTGGATCTGCCAACTACTC HO-1 AGGGAATTCTCTTGGCTGGC GACAGCTGCCACATTAGGGT Bax TCCACCAAGAAGCTGAGCGAG GTCCAGCCCATGATGGTT CT Bcl-2 CGACGACTTCTCCCGCCGCTACCG C CCGCATGCTGGGGCCGTACAG TTC C GAPDH GACAGTCAGCCGCATCTTCT GCGCCCAATACGACCAAATC Molecular docking Molecular docking was used to study FX, FXL, and OTA's interactions with mitochondrial function, oxidative stress, inflammation, and apoptotic proteins. The target proteins included MCI, MCIII, CAT, SOD, NRf2, HO-1, and caspase-3. In silico methods were used to discover protein structures, generate ligands, and simulate docking. Protein targets with biological importance and three-dimensional structures from the Protein Data Bank were selected. PubChem provided FX, FXL, and OTA ligand structures. Docking simulations used AutoDock Vina. Eliminating water molecules and non-essential ions, adding polar hydrogens, and assigning correct charges with AutoDockTools produced proteins. After geometrically optimizing ligand structures with Chem3D, docking grids were centered on active sites discovered through literature study and functional domain analysis using CASTp. Binding affinities (ΔG in kcal/mol) and molecular interactions (hydrogen bonds, hydrophobic interactions, and charge interactions) were evaluated to determine ligand-protein binding properties. The results were tabulated to clarify interaction characteristics. Statistical analysis For statistical data analysis, Graph Pad Prism 8.0 software was used. One-way analysis of variance and post hoc (Tukey and Dunnett) tests for multiple comparisons were used. The results of three independent experiments were expressed as mean ± standard deviation (SD), presented graphically as a bar chart, and *, **, and *** P values were considered statistically significant at (P < 0.05), (P < 0.01), and (P < 0.001), respectively. Results Evaluation of OTA, FX, and FLX impacts on the viability and genotoxicity of HK-2 kidney cells after 24 hrs of treatment An MTT assay was used to assess the cytotoxic effects of OTA, FX, and FLX, either alone or together, on the proliferation of the HK-2 cell line. As depicted in 1A, data from OTA mono-treatment in figure.1A showed a dose-dependent significant suppression of HK-2 cell line proliferation and mean OD which indicated viability percentage after using a range of OTA concentratiwhile the molecular docking inherently represents a theoretical prediction, it does not fully account for dynamic protein conformations or solvent effects. Hence, (Fig. 1 B). FXL showed more effect on the cells’ viability than FX at the same exact concentration without statistically significant differences (Fig. 1 B). In addition, each co-administration of FX or FXL at concentrations (2.5 and 5 µM) with OTA (20 µM) was shown to significantly counteract OTA (20 µM) monotreatment induced cytotoxicity in a concentration dependent pattern (Fig. 1 C). Cytotoxicity data was confirmed by trypan blue exclusion assay, which gives results aligned with the MTT assay outcomes (Fig. 1 D). For further evaluation of OTA-induced cytotoxicity pathways and protective effects of FX and FXL, bioenergetics assays, oxidative stress biomarkers, and apoptotic markers were selected to be investigated in the current study. Initially, three common subcellular cytotoxicity mechanisms as shown in (Fig. 1 E), were evaluated through their common pathways’ inhibitors (anti-caspase-3 Z-vAD-fmk, antioxidant-reduced glutathione, and mitochondrial protective Co-Q10). The data revealed that the three compounds significantly antagonized OTA (20 µM) cytotoxicity to different extents. However, Co-Q10 showed the most significant protection, while Z-vAD-fmk showed the least cytoprotective effect (Fig. 1 E). DNA damage of genetic materials was measured as a possible cause of cytotoxicity. The DNA strand breaks in OTA and combination-treated HK-2 cells were evaluated using the comet assay, which is an approach for measuring the genotoxicity test parameters, TM and TD, in Figs. 1 F and 1 G, respectively. The data demonstrated a substantial significant alleviation in OTA-induced genotoxicity after each co-administration of FX and FXL. Figure.1F exhibited a significant elevation in TD (% tail DNA content) in cells treated with OTA (20 µM), indicating genotoxicity in comparison to the untreated control cells. Subsequent to each FX and FXL cotreatment with OTA, the elevation of TD as an indicator of genotoxicity was dramatically reduced and restored to levels closer to the control. FX and FLX improved cellular bioenergetic markers in OTA treated HK-2 kidney cells On its own, OTA monotreatment significantly decreased bioenergetics; cellular ATP generation (Fig. 2 A), MMP (Fig. 2 B), MCI (Fig. 2 C), MCIII (Fig. 2 D), α-KG (main intermediate byproduct in Krebs cycle) (Fig. 2 H) levels, and PDH activity (Main Krebs cycle entry point) (Fig. 2 G) in comparison with untreated control cells. The results showed that co-administration of either FX or FLX with OTA significantly elevated the reduction in these bioenergetic measures. The inhibitory alterations in the levels of these six bioenergetic proteins in OTA-treated cells were reverted to near-normal control levels following treatment with either FX or FLX (OTA + FX and OTA + FLX cotreatment, respectively). The nephroprotective effect of both FX and FLX against OTA-induced toxicity was more pronounced at high doses than at low doses. FX and FLX normalized mRNA expression levels of mitochondrial genes in OTA treated HK-2 kidney cells OTA monotreatment independently resulted in a significant decrease of mRNA transcript levels of mitochondrial genes (mtDNA) essential for encoding the electron transport chain enzymes; ND1 (Fig. 3 A), ND5 (Fig. 3 B), CO1 (Fig. 3 C), ATP 6/8 (Fig. 3 D) in comparison with untreated control cells. As shown in figures (3A-D), Co-treatment of either FX or FLX with OTA demonstrated a significant upregulation in mRNA transcript levels of these tested genes in comparison with OTA-treated cells. The data revealed that the downregulation of expression levels of these four genes in OTA-treated cells, which exhibited adverse consequences, was restored to nearly normal control levels upon treatment with either FX or FLX (OTA + FX and OTA + FLX cotreatment, respectively). Interestingly, both FX and FLX treatments against OTA-induced toxicity showed more significant protection at high doses than at low doses. FX and FLX alleviated mitophagy players in OTA treated HK-2 kidney cells Our findings demonstrated that OTA monotreatment suppressed mitophagy signaling, as evidenced by downregulation of the levels of Parkin (Fig. 2 E) and PINK1 (Fig. 2 F) and dramatically reducing mRNA transcript levels of Parkin (Fig. 3 F) and PINK1 (Fig. 3 E) genes in compare with untreated control cells. The Co-treatment of either FX or FLX with OTA demonstrated a considerable increase of both protein levels and mRNA transcript levels of the examined genes compared to cells treated just with OTA. The results showed that, inhibitory ameliorations in both genes in OTA-treated cells were counteracted, returning to approach normal control levels following treatment with either FX or FLX (OTA + FX and OTA + FLX cotreatment, respectively). Additionally, both FX and FLX treatments significantly attenuated OTA-induced suppression of the tested markers, exhibiting greater protective effects at high dosages compared to lower ones. FX and FLX maintained redox status, mitigated oxidative stress and ameliorated antioxidants in OTA- induced oxidative damaged HK-2 cells The impact of combining OTA with either FX or FLX on antioxidants and oxidative stress was investigated, with results shown in figure. 4. In OTA mono-treated cells compared to untreated control cells over 24 hrs, a significant major increase in levels of intracellular ROS (Fig. 4 A) and TBARS (Fig. 4 B), which used as a biomarker for lipid peroxidation, was observed. Additionally, there was a significant decrease in the antioxidant enzymatic activities of CAT (Fig. 4 C) and SOD (Fig. 4 D), as well as a reduction in mRNA transcript levels of the HO-1 gene, which serves as a protective antioxidant against oxidative stress (Fig. 4 E), and the Nrf2 gene, which functions as the master regulator of antioxidant gene expression (Fig. 4 F). The concurrent administration of either FX or FLX with OTA resulted in the remarkable normalization of these redox parameters and oxidative stress indicators with more significant protection at high doses than at low doses. FX and FLX downregulated apoptotic markers in response to OTA treatment in HK-2 kidney cells The data from the current study demonstrated that OTA monotreatment modulated apoptosis, where a significant elevation in expression levels of caspase-3 (Fig. 5 A), caspase-8 (Fig. 5 B), caspase-9 (Fig. 5 C), and Bax/Bcl2 ratio of RNA transcript level (Fig. 5 D) was detected in compared to the control cells. This increase in apoptotic markers was significantly minimized or inhibited after the co-treatment of either FX or FLX with OTA. In addition, both FX and FLX treatments significantly reduced OTA-induced apoptosis with more significant neutralization at high doses than at low doses. Molecular docking The molecular docking study demonstrated varying binding affinities and interaction profiles of ochratoxin A (OTA), fucoxanthin (FX), and fucoxanthinol (FXL) with specific protein targets associated with oxidative stress and apoptosis pathways. Table 2 summarizes the docking scores (ΔG in kcal/mol) and key intermolecular interactions, such as hydrogen bonds and hydrophobic contacts. Both FX and FXL exhibited greater binding affinities for mitochondrial complexes I and III (MCI and MCIII) than OTA. In MCI, FX (–5.0 kcal/mol) established five hydrogen bonds and six hydrophobic contacts with residues including Asp134 and Tyr147. In contrast, FXL demonstrated a marginally greater binding affinity (–5.98 kcal/mol) through eight hydrophobic interactions with Pro32 and Gln154, although it did not form any hydrogen bonds. MCIII exhibited a distinct trend of increasing binding affinity, with values of − 6.1 kcal/mol for OTA, − 6.6 kcal/mol for FX, and − 7.2 kcal/mol for FXL. FXL engaged in extensive interactions through eleven hydrophobic contacts with residues including Phe187 and Ile188, suggesting a potentially enhanced stabilizing effect on the protein. Table 2 Binding affinities, key Residues, Interactions, and Interaction Types of ochratoxin A (OTA), fucoxanthin (FX), and fucoxanthinol (FXL) with the proteins involved in the pathways of mitochondrial complexes I (MCI) and III (MCIII), oxidative stress proteins; catalase (CAT), superoxide dismutase (SOD), Nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and caspase-3 (Cas-3). Protein Target legends Binding Affinities (ΔG in kcal/mol) Key Residues Hydrogen Bonds Hydrophobic Interactions MCI OTA -4.9 Tyr147, Asp150 0 2 FX -5 Asp134, Tyr147, Asp153, Val154, Ile133, Pro131, Asp150 5 6 FXL -5.98 Gln154,Pro32, Asp37, Val158, Tyr129, Pro166. 0 8 MCIII OTA -6.1 Ala193, Leu41, Leu37, Phe18 0 4 FX -6.6 Leu197, Ile42, Ala193, Leu119, Ile189, Leu41, Phe90, Leu37, leu49 0 10 FXL -7.2 Leu189, Met194, Ala191, Phe187, ILe188, Ile184, Leu49, Phe50 0 11 Catalase OTA -7.7 His364, Pro391 1 3 FX -7.9 His364, Arg66, Arg363, Pro391, Met392, Pro368 5 5 FXL 18.2 Pro391, Pro70, Leu366, Ile373, Gln331, Ile69 0 8 SOD OTA -8.2 Val25, Leu57, Tyr105, Thr121, Leu123, Leu133 1 7 FX -6.04 His59, Leu130, Leu123, Lys128,, Lys125, Phe86, Ala135, val25, Leu44, Phe107 2 10 FXL 13.9 Tyr17, Trp23, Tyr40, Phe68, leu130. Leu123, Leu57, Phe107, Ile119, Leu44, Leu57 3 13 Nrf2 OTA -9.7 Thr42, Pro65, Asn114, Tyr216, Trp236 1 4 FX -8.25 Thr560, Val369, Val561, Val514 4 2 FXL -8.45 Arg415, Val608, Val369, Val561, Ile559, Ala556,Arg514 3 5 HO-1 OTA -7 Glu62, His84, Lys86 0 4 FX -7.1 Pro80, Glu81, Val59, Glu63, Leu155, Glu66, Pro80, His84, Glu62, Lys86 4 8 FXL 2.8 Glu81, Asn171, Lys86, Val59, Ala87 0 6 Cas-3 OTA -4.54 Ile265, Met233 0 2 FX -4.2 Tyr195, Val266, Cys264, Ile265 1 4 FXL -3.7 Pro201, Ala200, Met233, Leu269, Glu272 1 4 Catalase exhibited the highest affinity for FX (–7.9 kcal/mol), involving five hydrogen bonds and five hydrophobic interactions, particularly with His364 and Pro391. OTA demonstrated a favorable affinity of − 7.7 kcal/mol, characterized by limited interactions, specifically one hydrogen bond and three hydrophobic contacts. FXL exhibited a positive binding energy of + 18.2 kcal/mol, suggesting unfavorable or non-specific binding, potentially attributed to steric hindrance or inadequate complementarity with the active site of catalase. Superoxide dismutase (SOD) exhibited the most favorable binding with OTA, quantified at − 8.2 kcal/mol. This interaction involved one hydrogen bond and seven hydrophobic interactions with critical residues, including Tyr105 and Leu133. FX exhibited a lower affinity of − 6.04 kcal/mol, establishing two hydrogen bonds and ten hydrophobic interactions. FXL demonstrated a positive binding energy of + 13.9 kcal/mol, indicating a weak affinity or possible repulsion within the binding cavity. The Nrf2 transcription factor exhibited the highest binding affinity for OTA, measured at − 9.7 kcal/mol. This interaction involved the formation of a hydrogen bond and four hydrophobic interactions, notably with residues Tyr216 and Trp236. FX and FXL exhibited moderately high affinities of − 8.25 and − 8.45 kcal/mol, respectively, with FXL demonstrating a greater density of hydrophobic interactions, indicating a potential for Nrf2 activation or stabilization. Heme oxygenase-1 (HO-1) exhibited comparable affinities for OTA (–7.0 kcal/mol) and FX (–7.1 kcal/mol). FX established four hydrogen bonds and eight hydrophobic interactions, suggesting enhanced binding strength. FXL demonstrated a notably positive binding score of + 2.8 kcal/mol, indicating weak interaction, which aligns with its catalase and SOD findings. All ligands exhibited relatively weak interactions with caspase-3. OTA (–4.54 kcal/mol) and FX (–4.2 kcal/mol) exhibited minimal hydrogen and hydrophobic interactions. FXL exhibited the lowest affinity (–3.7 kcal/mol), while preserving a comparable interaction profile with residues including Met233 and Glu272 (Table 2 , Figures S1 -S3). Discussion OTA is a mycotoxin often present in numerous food and feed products, adversely affecting humans as well as pets. OTA exerts a nephrotoxic detrimental impact on human health by exposure to food contaminated with OTA [26]. Prior researches has established that exposure to OTA can result in multiorgan toxicity [27–29]; nevertheless, the kidney is the primary target of OTA [30, 31]. A preliminary study in Egypt indicated that OTA may be associated with renal disease, evidenced by elevated serum OTA levels in end-stage renal disease (ESRD) patients, as well as increased serum and urine OTA levels in nephrotic syndrome and urothelial cancer [32]. The mechanisms of OTA-induced nephrotoxicity involve the reduction of protein synthesis, cell cycle arrest, DNA damage and apoptosis [30]. Diverse efforts are carried out to safeguard individuals from toxicity by elucidating the molecular mechanisms involved. Utilizing FX and its metabolites as interesting phytochemicals for various pharmacological targets. FX is a remarkable carotenoid characterized by the presence of an allenic link in its structure. FX is extracted from various algae and edible seaweeds. It has been demonstrated to offer several health advantages and preventive effects against diseases such as diabetes, obesity, liver cirrhosis, and malignant cancer [33]. Consequently, FX can serve as an effective supply of both pharmacological and nutritional components to mitigate OTA-induced kidney damage. The present study found that FX and its metabolite FXL, through their nephroprotective attributes covering antioxidant, anti-inflammatory, and anti-apoptotic effects, modulated the intracellular molecular processes and signalling pathways associated with OTA-induced nephrotoxicity in HK-2 cells. These cells are derived from the kidneys of healthy adult males and provide an excellent tool for toxicological research. To ensure data reproducibility, an immortalized cell line gives a single homogenous population of phenotypically similar cells as an alternative to the challenging-to-obtain primary human cell line. Human cell lines were chosen to avoid any interspecies effects on the credibility of the results. The cytotoxic effect of OTA was assessed at a concentration range between 5–80 µM, which was within the reported range of OTA in the human urine samples, which range from 0.0006–0.065 mg/ml (1.5–160 µM) in a study from Hungary [34]. FX and FXL effects were evaluated using concentrations 1–10 µM, which was effective in other cell lines’ studies [18, 35]. According to MTT assay outcomes, OTA showed cytotoxicity to the HK-2 cells, these are consistent with various studies that demonstrated the OTA cytotoxicity against human cells, other cell lines, and the same HK-2 cells used in our study [36–38]. FX and FXL were shown to improve the renal cells viability and mitigate OTA induced cytotoxicity. MTT assay was supposed to depend on metabolically active cells, not only cytotoxicity. Assessment of cell death and cytotoxicity of OTA with and without FX and FXL using a live-dead stain such as Trypan blue, which give similar outcomes to MTT assay. For further evaluation of OTA-induced cytotoxicity, three standard cytotoxicity subcellular mechanisms were evaluated using their common pathways inhibitors (anti-caspase-3 Z-vAD-fmk, antioxidant-reduced glutathione, and mitochondrial protective Co-Q10). Data revealed that the three compounds significantly antagonized OTA cytotoxicity to various extents. Co-Q10 demonstrated the most significant protection, while Z-vAD-fmk showed the least protective effect. Hence, the study considered different assays to explore the three cellular mechanisms of cytotoxicity and evaluate the cytoprotective impact of FX and FXL against OTA-induced nephrotoxicity. The current study showed that OTA inhibited the bioenergetics of the treated cells through oxidative stress and apoptosis induction. Similar effects of OTA were reported in previous studies. In the rats’ renal tubular cells, mitochondria were the primary target for the toxic activity of OTA [39]. Interestingly, While MTT data indicated that FX and FXL did not exert cytotoxic effects at the tested concentrations—and showed a slight increase in cell viability—which was not the focus of the current study. Hence, their potential proliferative or intrinsic bioactivity was not investigated without OTA. The increased cell viability may indicate a pro-survival or proliferative effect of FX and FXL. However, further mechanistic investigations are necessary to validate these effects, including cell proliferation assays, cell cycle analysis, and signalling pathway evaluation, which were not addressed in this study. Alkaline Comet assay TM and TD parameters showed that OTA was genotoxic to HK-2 cells with the geno-protective effect of FX and FXL against OTA-induced genotoxicity. The discrepancy between the % tail DNA and tail moment values in specific treatment groups of the comet assay was noted. Although these two parameters are typically correlated, they do not consistently change in tandem, representing distinct aspects of DNA damage. The percentage of tail DNA quantifies the proportion of fragmented DNA that migrates into the comet tail. In contrast, the tail moment, defined as the product of tail length and percentage of tail DNA, integrates both the extent and distribution of DNA damage. Variations in tail length, resulting from differences in DNA fragment size or chromatin structure, can cause divergence between these indices. The observed discrepancy likely indicates variability in DNA migration distance rather than inconsistency in the extent of damage. Localized differences in DNA repair kinetics, chromatin relaxation, and the physical nature of DNA breaks (such as single- versus double-strand breaks) may influence tail length independently of the total DNA amount in the tail [40]. Normal cell activity and human health depend on mitochondria, the organelles that provide energy for the cells and serve as biosynthetic and bioenergetic factories. Mitochondrial bioenergetics is regarded as a crucial metric for evaluating the pathogenesis of various diseases. Dysfunctional mitochondria impair or initiate multiple disorders affecting the most energy-demanding organs, such as the kidneys. This dysfunction may result from changes in mitochondrial enzymes, heightened oxidative stress, disruption of the electron transport chain and oxidative phosphorylation, or mutations in mitochondrial DNA, contributing to the pathophysiology of various pathological conditions, including neurological and metabolic disorders [41]. Natural medicines that target mitochondria are seen as more effective and safer for the treatment of various disorders [41]. This study demonstrated that FX and FLX markedly enhanced cellular mitochondrial bioenergetic indicators (ATP, MMP, MCI, MCIII, α-KG levels, and PDH activity) and effectively normalized mRNA expression levels of mitochondrial genes (ND1, ND5, CO1, ATP 6/8) in OTA-treated HK-2 kidney cells after a 24 hrs treatment period. This agrees with previously published data: co-treatment with palmitate (PA)-exposed macrophages, FX increased MCII, III, and V expression. Higher mitochondrial regulators, Pgc1a and Tfam levels indicated that cells co-treated with FX had reduced mitochondrial content but elevated mitochondrial biogenesis compared to macrophages treated with PA [42]. Through mitophagy, damaged, non-energizing mitochondria are broken down by lysosomes, allowing cells to get rid of themselves. The proteins Parkin and PINK1 are crucial for activating the mitophagy pathways [43]. Damaged mitochondria are removed via mitophagy, which can increase ROS formation, activate the NLRP3 inflammasome, and start apoptotic processes [44, 45]. According to our data, FX and FLX alleviated the mitophagy pathway in OTA-treated HK-2 kidney cells. OTA dramatically reduced the protein expression levels and downregulated mRNA transcript gene levels of PINK1 and Parkin. Thus, co-treatment of either FX or FLX with OTA demonstrated a considerable counteracting of this activity, where there was a significant upregulation in both of these tested genes' protein and mRNA transcript levels compared with OTA-treated cells. One reasonable explanation for this is a study that concluded that despite the reduced number of mitochondria present following FX therapy, increased mitophagy cleared out damaged mitochondria and may have helped restore mitochondrial function [46]. Multiple reports have shown that natural products have strong therapeutic values in promoting mitochondrial biogenetics and energetics, reducing mitochondrial ROS, enhancing mitophagy, and regulating mitochondrial dynamics [41]. However, the current study did not assess downstream functional endpoints of mitophagy, such as mitochondrial clearance, lysosomal engagement, or mitochondrial morphology and abundance (e.g., by Transmission electron microscopy, mtDNA copy number, or mitotracker-based imaging). This can be considered in further studies. OTA is a potent nephrotoxin due to its accumulation in proximal tubule epithelial cells, leading to cellular damage via oxidative stress, DNA damage, inflammatory, and apoptotic responses [30, 47]. A growing library of in vitro and in vivo research has accumulated, providing evidence that supports the involvement of oxidative stress in the toxicity and carcinogenicity of OTA. Numerous studies have been conducted to counteract the negative impacts of oxygen radicals generated due to OTA exposure [48]. Measurements of oxidative stress and antioxidants are critical in toxicity studies. Thus, current results showed that FX and FLX significantly reduced intracellular ROS and TBARS (biomarker of lipid peroxidation) levels, ameliorated oxidative stress genes (mRNA transcript levels of HO-1 and Nrf2 genes) and maintained antioxidants activity (CAT and SOD) in OTA- induced oxidative damaged HK-2 cells. A recent study indicated that OTA increases oxidative stress in rat kidneys and liver by elevating MDA, lipid peroxidation, and inhibiting glutathione (GSH), CAT, and SOD [49]. Furthermore, OTA elicited the generation of ROS in renal proximal tubular cells, resulting in higher DNA damage. N-acetylcysteine (NAC) administration reduced ROS levels and enhanced cell viability following OTA exposure [50]. OTA increases the expression of apoptosis signal-regulated kinase 1 (ASK-1), which controls ROS generation and reduce MMP, hence facilitating nephrotoxicity following OTA exposure [51]. ROS facilitated the translocation of Nrf2 to the nucleus, thereby augmenting the production of HO-1 to mitigate cellular damage [30, 52]. Hence, the regulation of Nrf2 by FX could possibly be considered as a strategy to prevent or treat OTA-induced toxicity. Experiments on rat primary hippocampal neurons displayed that FX therapy reduced the accumulation of superoxide in the mitochondria and shielded the loss of MMP from ROS stress. Furthermore, oral FX supplementation increased in the level of DJ-1 protein in middle-aged rats' hippocampal tissues, indicating its potential neuroprotective benefits against ROS-related mitochondrial dysfunction [53]. Furthermore, it was found that FX increased MMP, reduced oxidative stress, and triggered the AMP-activated protein kinase pathway to enhance mitochondrial bioenergetics in palmitate-treated HepG2 cells [54]. According to other studies, FX protected human osteoblasts from oxidative stress caused by H 2 O 2 . FX isolated from brown algae revealed potent DPPH radical scavenging and iron-chelating activity in cell-free experiments [55, 56]. In various in vitro cell lines, such as macrophages, liver cells (HepG2), colorectal adenocarcinoma epithelial (Caco-2) cells, and human cervical cancer cells (HeLa cells), FX showed promising antioxidant properties. The antioxidant glutathione level increased 3.3 times due to FX co-treatment, resulting in a concentration-based antioxidant effect [57]. According to animal research, FX reduced oxidative stress in rats with LPS-induced uveitis, mice with alcoholic liver injury, and mice with ovalbumin-induced asthma by raising total antioxidant capacity, inducing the Nrf2-mediated antioxidant pathway, and reducing lipid peroxidation [58, 59]. Also, the protective effects of FX against diabetic retinopathy in retinal epithelial cells of human origin were demonstrated, resulting in the induction of antioxidant enzyme activities and decreasing ROS levels, most likely because of Nrf2 activation's intense antioxidant activities [60]. Additionally, when FX was added to sunscreen at a concentration of 0.5% w/v, it significantly alleviated the ROS production in human skin reconstructions [61]. Furthermore, it was found that the injection of FX considerably restored the reduced activities of peroxidase, SOD, CAT, and ascorbate peroxidase in mice's renal tissues exposed to Cd. This restoration may have been achieved via antioxidant activities and the downregulation of ERK-mediated apoptotic pathways [62]. These results implied that FX greatly benefits the upcoming clinical trials and translational research because of its numerous cytoprotective activities. Many studies demonstrated that antioxidants can counteract the deleterious effects of chronic consumption or exposure to OTA and confirmed the potential effectiveness of dietary strategies with antioxidant properties, such as FX, to counteract OTA toxicity [48]. Meanwhile, our findings suggested an alternative or method against OTA toxicity by reducing ROS production, oxidative stress, inducing antioxidants, and activating the HO-1 and Nrf2 pathways using FX and FLX. Our results indicate that FX significantly reduced oxidative stress by reversing OTA-induced apoptosis in the treated cells. FX and FLX downregulated apoptotic markers (caspase-3, caspase-8, caspase-9 proteins, and Bax/Bcl2 ratio of RNA transcript level) in OTA-treated HK-2 kidney cells. Apoptosis, or programmed cell death, is regulated by genes, where cells increase the synthesis of Bax (proapoptotic) in response to various apoptotic triggers, which inhibit Bcl-2 (antiapoptotic) and initiate the mitochondrial apoptosis pathway. This resulted in the release of cytochrome c into the cytoplasm by the mitochondria, activating caspase-3 and caspase-9 to cause programmed cell death. Our research showed that when cells were exposed to OTA-induced apoptosis, FX and its metabolite, FXL, induced Bcl-2 expression and lessened Bax expression, improving cell survival. Similar results demonstrated that FX and FXL could prevent tributyltin-induced apoptosis in the liver HepG2 cell line [63]. Additionally, it was shown that FX prevented the formation of apoptotic bodies in the monkey kidney fibroblast cell line (Vero) when H 2 O 2 was localized, suggesting that it may be able to protect cells against atomic fragmentation in the event of oxidative stress [64]. Moreover, a recent report that treatment with OTA induced spectacular apoptosis accompanied by a notable loss in MMP and fragmentation [65]. Fascinatingly, the current investigation assessed the protective impact of FX and FXL against four underlying mechanisms: oxidative stress, apoptosis, mitochondrial disruption, and genotoxicity, which have been implicated in OTA-induced cytotoxicity in HK-2 cells. The data from the current study reported a significant protection against OTA-induced genotoxicity following each co-administration of FX and FXL, where a significant elevation in TD (% tail DNA content) after each FX and FXL co-treatment with OTA was dramatically reduced and restored to levels closer to the control. Our data suggested that FXL had a more significant impact than the parent carotenoid FX; the projected absorption by the cells with sufficient intracellular levels could explain that. This hypothesis is supported by earlier research that demonstrated that fatty acid esters of carotenoids underwent hydrolysis before human absorption [66]. The enzymes linked to hydrolysis may be lipase and carboxylesterase. A study found that when mice consumed FX, FXL but not FX appeared in their plasma and that FXL was released into the basolateral media in significantly higher amounts than FX in Caco-2 cells [67]. As a result, FXL is thought to be collected in the treated cells more efficiently than FX. Molecular docking data showed that FX exhibited consistently superior or comparable binding affinities relative to OTA across the majority of targets, alongside strong interaction networks, especially with catalase and MCIII. FXL demonstrated positive interactions with mitochondrial complexes; however, it did not significantly interact with antioxidant enzymes such as catalase and SOD. The findings supposed that FX exhibits a broader and more potent interaction profile, potentially explaining its enhanced biological effects in reducing oxidative stress and mitochondrial dysfunction. However, these assumptions were not supported by the in-vitro assay outcomes. Despite the lower binding affinity indicating a diminished interaction with the target proteins, the biological efficacy, specifically antioxidant activity, does not consistently correlate with binding affinity [68]. This phenomenon can be elucidated through various covariables, as FXL may demonstrate antioxidant effects through non-specific scavenging of reactive oxygen species (ROS), independent of protein binding. It may also activate additional pathways or transcription factors that play a role in antioxidant defense. FXL serves as a significant metabolite of fucoxanthin. It may exhibit enhanced cellular uptake, stability, or bioavailability, improving intracellular antioxidant activity despite weaker direct protein binding. Furthermore, FXL may indirectly modulate signaling pathways, such as the Keap1-Nrf2 axis, resulting in the upregulation of antioxidant enzymes without necessitating high binding affinity. Thus, the observation suggests that binding affinity alone is not a definitive predictor of functional outcome. Although protein-ligand interactions are weaker, the antioxidant efficacy of fucoxanthinol may be attributed to improved pharmacodynamics, indirect stimulation of antioxidant responses, or increased cellular bioavailability. Functional assays, such as ROS scavenging, lipid peroxidation, and total antioxidant capacity, offer a more pertinent assessment of biological effects than molecular docking data alone. The current study investigated four different underlying mechanisms of cytotoxicity covering mitochondrial disruption, genotoxicity, oxidative stress, and apoptosis, which are summarized in a schematic graph shown in Fig. 6 . There is much overlap between the four studied mechanisms. Free radicals and oxidative stress are thought to be the main contributors to genotoxicity and DNA damage [69, 70]. Free radicals can harm many cellular components simultaneously, resulting in lipid peroxidation, which can cause DNA and mitochondria damage [71, 72]. Conversely, the primary sites of electron leakage, particularly in cases of inhibited MCI and MCIII by altered electron transport chain disruption, led to the formation of ROS, such as superoxide anions, which subsequently react with nitric oxide to produce highly reactive peroxynitrites, which was linked to oxidative damage and genotoxicity [44]. Furthermore, cytochrome c leaking to the cytoplasm and activation of apoptotic pathways caused apoptosis through mitochondrial disruption [45]. Furthermore, it was demonstrated that oxidative stress triggered the apoptotic pathways, a finding that served as the foundation for the oxidation therapy application in cancer [73]Protection against OTA-induced DNA damage, lipid peroxidation, and cytotoxicity was observed, further confirming the link between OTA toxicity and oxidative damage. Study limitations The present investigation assessed the HK-2 cell line's susceptibility to the toxicity generated by OTA. It is reversed by FX and FXL using several assays, corroborating the notion that FX and FXL are cytoprotective for human kidney cells. The study is limited because it was conducted in vitro, meaning that the interactions between the pathways may not be as typical as in an in vivo microenvironment. Second, not all paths were examined, which opens the ground for more evaluation in future research. Studying immortalized cell lines might go through several in vitro dedifferentiation cycles; this supports the need to use the original tissues and explore how they respond to toxins. However, the study was based on passage three of the cell and secondary cell lines to obtain adequate cells for the various assays with repeatable results. Human cells were also used instead of animal-separated primary cell lines to counteract the effects of interspecies differences on the assays and results. Although the potential value of assessing combinatorial or synergistic effects is recognized, co-treatment studies were not conducted in this investigation, as simultaneous administration may not accurately represent the in vivo metabolic sequence. Future studies evaluating potential synergistic or additive interactions, utilizing methods such as isobologram or combination index analysis, may yield valuable insights, especially regarding exogenous FXL supplementation or metabolic modulation. Also, preclinical studies involving long-term animal exposure evaluate systemic toxicity, histopathological changes, and biochemical parameters. Moreover, dose-escalation studies and in vitro assays in non-renal cell lines could further clarify the safety window of these compounds. In addition, while the molecular docking inherently represents a theoretical prediction, it does not fully account for dynamic protein conformations or solvent effects. Hence, further experimental validation is recommended through biophysical methods such as surface plasmon resonance (SPR) or isothermal titration calorimetry (ITC). Also, molecular dynamics (MD) simulations are required to investigate the ligand-protein complexes' conformational stability and interaction dynamics in a more realistic biological context. However, the current study is not solely based on in silico data. Conclusions The current research clarifies the safeguarding protective impacts of FX and FXL in counteracting and mitigating the four fundamental pathways associated with OTA-induced cytotoxicity in HK-2 cells: oxidative stress, mitochondrial disruption, apoptosis, and genotoxicity. FX and FXL demonstrated significantly adequate levels of cytoprotection against the four investigated intracellular mechanisms of cytotoxicity. The data suggests a potential therapeutic role of FX and FXL in treating OTA-induced nephrotoxicity and other mechanisms associated with nephrotoxicity linked to the four cellular processes examined. This work provides possible insights and strategies to facilitate additional biochemical research for developing pharmacological assets and nutritional supplements combined with FX and its metabolites for the management of nephrotoxicity. Additional research employing in vivo models and searching for additional intracellular routes is advised to confirm the current findings. Also, further research is recommended to investigate the specific molecular mechanisms linking ROS to mitochondrial function and apoptosis pathways. Gene knockout or overexpression experiments could be conducted to study the roles of key genes (e.g., Nrf2, HO-1, Bax, Bcl-2) in OTA-induced nephrotoxicity. Declarations Authors’ contribution EME : conceptualization and experimental methodology; HAA: original draft preparation, ABA, SAA: investigation and editing; ZMSM: validation, software, and formal analysis; NAE: investigation and data interpretation; GEE: conceptualization and investigation; and SMS : data analysis, interpretation, and overall writing and editing. All authors have reviewed the final version of the manuscript. Funding sources The deanship of Scientific Research at Northern Border University, Arar, KSA, funded this research work through the project number "NBU-FFR-2025–2510-19. Ethics, Consent to Participate, and Consent to Publish Declarations Not applicable. Declaration of Competing Interest The authors confirm they have no competing interests (no conflict of interest) that could influence the study. Data Availability Statement The authors confirm that all relevant data and materials are within the article and its supporting information files. References Eskola, M., et al., Towards a dietary-exposome assessment of chemicals in food: An update on the chronic health risks for the European consumer. Critical Reviews in Food Science and Nutrition, 2020. 60 (11): p. 1890-1911. Chilaka, C.A., et al., Mycotoxin regulatory status in Africa: a decade of weak institutional efforts. Toxins, 2022. 14 (7): p. 442. Zhang, Q., et al., Formation of Furan from Linoleic Acid Thermal Oxidation:(E, E)-2, 4-Decadienal as a Critical Intermediate Product. Journal of Agricultural and Food Chemistry, 2024. 72 (8): p. 4384-4392. Banahene, J.C.M., et al., Ochratoxin A in food commodities: A review of occurrence, toxicity, and management strategies. Heliyon, 2024. Echodu, R., et al., Prevalence of aflatoxin, ochratoxin and deoxynivalenol in cereal grains in northern Uganda: Implication for food safety and health. Toxicology reports, 2019. 6 : p. 1012-1017. ul Hassan, S.W., et al., Unusual pattern of aflatoxins and ochratoxin in commercially grown maize varieties of Pakistan. Toxicon, 2020. 182 : p. 66-71. Costa da Silva, M., et al., Ochratoxin a levels in fermented specialty coffees from Caparaó, Brazil: Is it a cause of concern for coffee drinkers? Food Additives & Contaminants: Part A, 2021. 38 (11): p. 1948-1957. Stoev, S.D., New evidences about the carcinogenic effects of ochratoxin A and possible prevention by target feed additives. Toxins, 2022. 14 (6): p. 380. Perugino, F., et al., A mechanistic toxicology study to grasp the mechanics of zearalenone estrogenicity: Spotlighting aromatase and the effects of its genetic variability. Toxicology, 2024. 501 : p. 153686. Więckowska, M., et al., Ochratoxin A—the current knowledge concerning hepatotoxicity, mode of action and possible prevention. Molecules, 2023. 28 (18): p. 6617. Obafemi, B.A., I.A. Adedara, and J.B. Rocha, Neurotoxicity of ochratoxin A: Molecular mechanisms and neurotherapeutic strategies. Toxicology, 2023: p. 153630. Dias, M.C., D.C. Pinto, and A.M. Silva, Plant flavonoids: Chemical characteristics and biological activity. Molecules, 2021. 26 (17): p. 5377. Noor, F., et al., Network pharmacology approach for medicinal plants: review and assessment. Pharmaceuticals, 2022. 15 (5): p. 572. Kang, H.G., et al., A review of natural products for prevention of acute kidney injury. Medicina, 2021. 57 (11): p. 1266. Chodari, L., et al., Targeting mitochondrial biogenesis with polyphenol compounds. Oxidative Medicine and Cellular Longevity, 2021. 2021 (1): p. 4946711. Guo, X., et al., Mito‐bomb: targeting mitochondria for cancer therapy. Advanced Materials, 2021. 33 (43): p. 2007778. Bae, M., et al., Health benefits of fucoxanthin in the prevention of chronic diseases. Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids, 2020. 1865 (11): p. 158618. Mao, H., et al., Fucoxanthin attenuates oxidative damage by activating the Sirt1/Nrf2/HO‐1 signaling pathway to protect the kidney from ischemia‐reperfusion injury. Oxidative Medicine and Cellular Longevity, 2022. 2022 (1): p. 7444430. Asai, A., et al., Biotransformation of fucoxanthinol into amarouciaxanthin A in mice and HepG2 cells: formation and cytotoxicity of fucoxanthin metabolites. Drug Metabolism and Disposition, 2004. 32 (2): p. 205-211. Hashimoto, T., et al., Pharmacokinetics of fucoxanthinol in human plasma after the oral administration of kombu extract. British Journal of Nutrition, 2012. 107 (11): p. 1566-1569. Liu, S., et al., Arsenic Exposure-Induced Acute Kidney Injury by Regulating SIRT1/PINK1/Mitophagy Axis in Mice and in HK-2 Cells. Journal of Agricultural and Food Chemistry, 2023. 71 (42): p. 15809-15820. De Boeck, M., D. Lison, and M. Kirsch-Volders, Evaluation of the in vitro direct and indirect genotoxic effects of cobalt compounds using the alkaline comet assay. Influence of interdonor and interexperimental variability. Carcinogenesis, 1998. 19 (11): p. 2021-2029. Spinazzi, M., et al., Assessment of mitochondrial respiratory chain enzymatic activities on tissues and cultured cells. Nature protocols, 2012. 7 (6): p. 1235-1246. Elmorsy, E., et al., Adverse effects of antipsychotics on micro-vascular endothelial cells of the human blood–brain barrier. Brain research, 2014. 1583 : p. 255-268. Singh, R., et al., Comparative study of catalase-peroxidases (KatGs). Archives of biochemistry and biophysics, 2008. 471 (2): p. 207-214. Fuchs, R. and M. Peraica, Ochratoxin A in human kidney diseases. Food additives and contaminants, 2005. 22 (s1): p. 53-57. Gagliano, N., et al., Early cytotoxic effects of ochratoxin A in rat liver: A morphological, biochemical and molecular study. Toxicology, 2006. 225 (2-3): p. 214-224. Patil, R.D., P. Dwivedi, and A.K. Sharma, Critical period and minimum single oral dose of ochratoxin A for inducing developmental toxicity in pregnant Wistar rats. Reproductive Toxicology, 2006. 22 (4): p. 679-687. Sheu, M.-L., et al., Activation of PI3K in response to high glucose leads to regulation of SOCS-3 and STAT1/3 signals and induction of glomerular mesangial extracellular matrix formation. Oncotarget, 2017. 8 (10): p. 16925. Khoi, C.-S., et al., Ochratoxin A-induced nephrotoxicity: Up-to-date evidence. International journal of molecular sciences, 2021. 22 (20): p. 11237. Pfohl‐Leszkowicz, A., et al., New molecular and field evidences for the implication of mycotoxins but not aristolochic acid in human nephropathy and urinary tract tumor. Molecular nutrition & food research, 2007. 51 (9): p. 1131-1146. Wafa, E., et al., Human ochratoxicosis and nephropathy in Egypt: a preliminary study. Human & experimental toxicology, 1998. 17 (2): p. 124-129. Mumu, M., et al., Fucoxanthin: A promising phytochemical on diverse pharmacological targets. Frontiers in Pharmacology, 2022. 13 : p. 929442. Fazekas, B., A. Tar, and M. Kovács, Ochratoxin A content of urine samples of healthy humans in Hungary. Acta Veterinaria Hungarica, 2005. 53 (1): p. 35-44. Chen, Y., et al., Dietary protective potential of fucoxanthin as an active food component on neurological disorders. Journal of Agricultural and Food Chemistry, 2023. 71 (8): p. 3599-3619. Arbillaga, L., et al., Oxidative DNA damage induced by ochratoxin A in the HK-2 human kidney cell line: evidence of the relationship with cytotoxicity. Mutagenesis, 2007. 22 (1): p. 35-42. Kamp, H.G., et al., Ochratoxin A: induction of (oxidative) DNA damage, cytotoxicity and apoptosis in mammalian cell lines and primary cells. Toxicology, 2005. 206 (3): p. 413-425. Lee, H.J., H.D. Kim, and D. Ryu, Protective Effect of alpha-Tocopherol Against Ochratoxin A in Kidney Cell Line HK-2. Journal of Food Protection, 2023. 86 (5): p. 100082. Alam, M.S., G. Kaur, and R. Zalpouri, Current Trends and Techniques in the Nutraceutical Industry , in Fruits and Their Roles in Nutraceuticals and Functional Foods . 2023, CRC Press. p. 29-68. Walsh, K.D. and T.A. Kato, Alkaline comet assay to detect DNA damage , in Chromosome Analysis: Methods and Protocols . 2022, Springer. p. 65-72. Bhatti, G.K., et al., Targeting mitochondrial bioenergetics as a promising therapeutic strategy in metabolic and neurodegenerative diseases. biomedical journal, 2022. 45 (5): p. 733-748. Li, Y., et al., Fucoxanthin metabolites exert anti-fibrogenic and antioxidant effects in hepatic stellate cells. Journal of Agriculture and Food Research, 2021. 6 : p. 100245. Wang, S., et al., The mitophagy pathway and its implications in human diseases. Signal transduction and targeted therapy, 2023. 8 (1): p. 304. Liu, S.-X., et al., Mitochondrial damage mediates genotoxicity of arsenic in mammalian cells. Cancer research, 2005. 65 (8): p. 3236-3242. Kalpage, H.A., et al., Cytochrome c phosphorylation: Control of mitochondrial electron transport chain flux and apoptosis. The international journal of biochemistry & cell biology, 2020. 121 : p. 105704. Ip, W.K.E., et al., Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science, 2017. 356 (6337): p. 513-519. Ozcan, Z., G. Gul, and I. Yaman, Ochratoxin A activates opposing c-MET/PI3K/Akt and MAPK/ERK 1-2 pathways in human proximal tubule HK-2 cells. Arch Toxicol, 2015. 89 (8): p. 1313-27. Sorrenti, V., et al., Toxicity of ochratoxin A and its modulation by antioxidants: A review. Toxins, 2013. 5 (10): p. 1742-1766. Meki, A.-R.M. and A.A. Hussein, Melatonin reduces oxidative stress induced by ochratoxin A in rat liver and kidney. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 2001. 130 (3): p. 305-313. Schaaf, G., et al., The role of oxidative stress in the ochratoxin A-mediated toxicity in proximal tubular cells. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 2002. 1588 (2): p. 149-158. Liang, R., et al., Apoptosis signal-regulating kinase 1 promotes Ochratoxin A-induced renal cytotoxicity. Scientific reports, 2015. 5 (1): p. 8078. Lee, H.J., et al., Renal toxicity through AhR, PXR, and Nrf2 signaling pathway activation of ochratoxin A-induced oxidative stress in kidney cells. Food and Chemical Toxicology, 2018. 122 : p. 59-68. Ferdous, K.A., et al., Neuroprotective Function of Fucoxanthin in Oxidative Stress-Mediated Mitochondrial Dysfunction. Current Developments in Nutrition, 2022. 6 : p. 787. Yang, S., et al., Molecular Mechanisms of Fucoxanthin in Alleviating Lipid Deposition in Metabolic Associated Fatty Liver Disease. Journal of Agricultural and Food Chemistry, 2024. 72 (18): p. 10391-10405. Koduvayur Habeebullah, S.F., A. Surendraraj, and C. Jacobsen, Isolation of fucoxanthin from brown algae and its antioxidant activity: in vitro and 5% fish oil‐in‐water emulsion. Journal of the American Oil Chemists' Society, 2018. 95 (7): p. 835-843. Mousavi Nadushan, R. and I. Hosseinzade, Optimization of production and antioxidant activity of fucoxanthin from marine haptophyte algae, Isochrysis galbana. Iranian Journal of Fisheries Sciences, 2020. 19 (6): p. 2901-2908. Neumann, U., et al., Fucoxanthin, a carotenoid derived from Phaeodactylum tricornutum exerts antiproliferative and antioxidant activities in vitro. Antioxidants, 2019. 8 (6): p. 183. Yang, X., et al., Assessment of the therapeutic effects of fucoxanthin by attenuating inflammation in ovalbumin-induced asthma in an experimental animal model. Journal of Environmental Pathology, Toxicology and Oncology, 2019. 38 (3). Zheng, J., et al., Protective effects of fucoxanthin against alcoholic liver injury by activation of Nrf2-mediated antioxidant defense and inhibition of TLR4-mediated inflammation. Marine drugs, 2019. 17 (10): p. 552. Chiang, Y.-F., et al., Protective effects of fucoxanthin on high glucose-and 4-hydroxynonenal (4-HNE)-induced injury in human retinal pigment epithelial cells. Antioxidants, 2020. 9 (12): p. 1176. Tavares, R.S.N., et al., Fucoxanthin for topical administration, a phototoxic vs. photoprotective potential in a tiered strategy assessed by in vitro methods. Antioxidants, 2020. 9 (4): p. 328. Yang, H., et al., Role of Fucoxanthin towards Cadmium-induced renal impairment with the antioxidant and anti-lipid peroxide activities. Bioengineered, 2021. 12 (1): p. 7235-7247. Zeng, J., et al., Protective effects of fucoxanthin and fucoxanthinol against tributyltin-induced oxidative stress in HepG2 cells. Environmental Science and Pollution Research, 2018. 25 : p. 5582-5589. Heo, S.-J., et al., Cytoprotective effect of fucoxanthin isolated from brown algae Sargassum siliquastrum against H 2 O 2-induced cell damage. European food research and technology, 2008. 228 : p. 145-151. Fu, M., Y. Chen, and A. Yang, Ochratoxin A induces mitochondrial dysfunction, oxidative stress, and apoptosis of retinal ganglion cells (RGCs), leading to retinal damage in mice. International Ophthalmology, 2024. 44 (1): p. 72. Khachik, F., et al., Separation and identification of carotenoids and their oxidation products in the extracts of human plasma. Analytical Chemistry, 1992. 64 (18): p. 2111-2122. Sugawara, T., et al., Brown algae fucoxanthin is hydrolyzed to fucoxanthinol during absorption by Caco-2 human intestinal cells and mice. The Journal of nutrition, 2002. 132 (5): p. 946-951. Paggi, J.M., A. Pandit, and R.O. Dror, The art and science of molecular docking. Annual Review of Biochemistry, 2024. 93 . Costa, M., et al., The role of oxidative stress in nickel and chromate genotoxicity. Oxygen/Nitrogen Radicals: Cell Injury and Disease, 2002: p. 265-275. Hei, T.K. and M. Filipic, Role of oxidative damage in the genotoxicity of arsenic. Free Radical Biology and Medicine, 2004. 37 (5): p. 574-581. García-Sánchez, A., A.G. Miranda-Díaz, and E.G. Cardona-Muñoz, The role of oxidative stress in physiopathology and pharmacological treatment with pro‐and antioxidant properties in chronic diseases. Oxidative Medicine and Cellular Longevity, 2020. 2020 (1): p. 2082145. Teleanu, D.M., et al., An overview of oxidative stress, neuroinflammation, and neurodegenerative diseases. International journal of molecular sciences, 2022. 23 (11): p. 5938. Hanikoglu, A., et al., Hybrid compounds & oxidative stress induced apoptosis in cancer therapy. Current medicinal chemistry, 2020. 27 (13): p. 2118-2132. Additional Declarations No competing interests reported. Supplementary Files Supplementaryfiles.docx Cite Share Download PDF Status: Published Journal Publication published 12 Jul, 2025 Read the published version in BMC Nephrology → Version 1 posted Editorial decision: Revision requested 23 May, 2025 Reviews received at journal 22 May, 2025 Reviewers agreed at journal 21 May, 2025 Reviews received at journal 16 May, 2025 Reviewers agreed at journal 21 Apr, 2025 Reviewers invited by journal 21 Apr, 2025 Submission checks completed at journal 17 Apr, 2025 First submitted to journal 10 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6077785","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":445938106,"identity":"a5f9d283-c085-41ef-81e7-cb09389d4d0d","order_by":0,"name":"Ekramy M. Elmorsy","email":"","orcid":"","institution":"Northern Border University","correspondingAuthor":false,"prefix":"","firstName":"Ekramy","middleName":"M.","lastName":"Elmorsy","suffix":""},{"id":445938107,"identity":"6b6e3f67-604b-47af-8847-135052a741b3","order_by":1,"name":"Huda A. Al Doghaither","email":"","orcid":"","institution":"King Abdulaziz University","correspondingAuthor":false,"prefix":"","firstName":"Huda","middleName":"A. Al","lastName":"Doghaither","suffix":""},{"id":445938108,"identity":"7bc7d2b2-5574-4aa1-b107-c199ac888062","order_by":2,"name":"Ayat B. Al-Ghafari","email":"","orcid":"","institution":"King Abdulaziz University","correspondingAuthor":false,"prefix":"","firstName":"Ayat","middleName":"B.","lastName":"Al-Ghafari","suffix":""},{"id":445938109,"identity":"6aefe70a-1084-43d7-9c06-9f8a1bff4b71","order_by":3,"name":"Shaza A. Alyamani","email":"","orcid":"","institution":"Batterjee Medical college","correspondingAuthor":false,"prefix":"","firstName":"Shaza","middleName":"A.","lastName":"Alyamani","suffix":""},{"id":445938110,"identity":"0e6ebd23-e60b-4820-8fde-d0f69449a133","order_by":4,"name":"Zakariya M. S. Mohammed","email":"","orcid":"","institution":"Northern Border University","correspondingAuthor":false,"prefix":"","firstName":"Zakariya","middleName":"M. S.","lastName":"Mohammed","suffix":""},{"id":445938111,"identity":"80357017-618b-42ac-a57a-6c1f8ff95ef9","order_by":5,"name":"Neven A. Ebrahim","email":"","orcid":"","institution":"Taibah University","correspondingAuthor":false,"prefix":"","firstName":"Neven","middleName":"A.","lastName":"Ebrahim","suffix":""},{"id":445938112,"identity":"f5b78fa9-329f-4379-8bea-1c3479b0523b","order_by":6,"name":"Gehad E. Elshopakey","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Gehad","middleName":"E.","lastName":"Elshopakey","suffix":""},{"id":445938113,"identity":"92ce28e3-ff3d-4567-b3da-4dfb22e605dc","order_by":7,"name":"Sameh M. Shabana","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCElEQVRIiWNgGAWjYJACZgaGAwwGINYHHhsgydh4gGgtjDNk0kBUA/FamHlsDoNF8GqRbz+d+Ljgzx15c/azBz/OyDlvt7b9MNCWGptoXFoMzuRuNp7Z9sxwZ09essSHM7eTt51JBGo5lpbbgEsLQ+42ad6Gw4wbDuQYSM7suZ1sdgCohbHhME4t8v1vt//m+XPYfsP5N8a/ef+dSzY7/xC/FoYbuduYedgOJ264kWMmzcNzwM7sBgFbDG683SzN23Y4eeeMN2aWM3iSE8xuAG1JwOMX+f7cjZ+BDrPdzp9jfOMDj5292fn0hw8+1Njgdhg6SASrTCBWOQjYk6J4FIyCUTAKRgYAALKFbJIbqt0HAAAAAElFTkSuQmCC","orcid":"","institution":"Mansoura University","correspondingAuthor":true,"prefix":"","firstName":"Sameh","middleName":"M.","lastName":"Shabana","suffix":""}],"badges":[],"createdAt":"2025-02-21 08:53:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6077785/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6077785/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12882-025-04276-z","type":"published","date":"2025-07-12T15:57:38+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81091425,"identity":"8213b5af-e843-46f3-8de5-4ca2f54efb05","added_by":"auto","created_at":"2025-04-22 07:11:48","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":428628,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of OTA, FX, and FLX on the viability and DNA integrity of HK-2 cells after 24 hrs treatment.\u003c/strong\u003e Cytotoxic effects of \u003cstrong\u003e(A)\u003c/strong\u003e OTA, \u003cstrong\u003e(B)\u003c/strong\u003e FX and FLX, and \u003cstrong\u003e(C)\u003c/strong\u003ecombination of OTA with FX or FLX in various concentrations on HK-2 kidney cell line. \u003cstrong\u003e(D)\u003c/strong\u003eEffect of common inhibitors of cytotoxicity on HK-2 cells treated with 20 µM of OTA. The cell viability was determined after 24 hrs incubation by MTT assay. Percentage of comet assay parameters of DNA damage: tail moment (TM) (E), and tail DNA content (TD) (F) in OTA (20 µM) treated HK-2 cells, alone and in co-treatment with each of FX and FLX. Data are expressed as mean ± SD values from at least 3 independent experiments. Each treatment was applied to multiple wells and indicated a statistically significant difference between groups as *, **, and *** at p\u0026lt;0.05, p\u0026lt;0.01, and p\u0026lt;0.001, respectively. Ochratoxin A, OTA; Fucoxanthin, FX; Fucoxanthinol, FXL.\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/b1c64365d1c180f9749ee2b8.jpg"},{"id":81092021,"identity":"39a5a7e5-5ee1-4456-9135-642100000013","added_by":"auto","created_at":"2025-04-22 07:19:48","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1369467,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of FX and FLX treatment on the bioenergetics and mitophagy markers of OTA-induced nephrotoxicity in HK-2 cells after 24 hrs treatment. \u003c/strong\u003eBioenergetic parameters: cellular ATP \u003cstrong\u003e(A)\u003c/strong\u003e, MMP \u003cstrong\u003e(B)\u003c/strong\u003e, MCI \u003cstrong\u003e(C)\u003c/strong\u003e, MCIII \u003cstrong\u003e(D)\u003c/strong\u003e, α-KG \u003cstrong\u003e(H)\u003c/strong\u003e levels, and PDH activity \u003cstrong\u003e(G)\u003c/strong\u003e. Mitophagy markers; Parkin \u003cstrong\u003e(E)\u003c/strong\u003e and PINK1 \u003cstrong\u003e(F)\u003c/strong\u003e protein levels. The results are demonstrated as mean ± SD values from at least 3 independent experiments. *, **, *** indicate significance between different groups at (p \u0026lt; 0.05), (p \u0026lt; 0.01), and (p \u0026lt; 0. 001), respectively. Ochratoxin A, OTA; Fucoxanthin, FX; Fucoxanthinol, FXL.\u003c/p\u003e","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/1d3fcdc88c757a8841f2afaa.jpg"},{"id":81092019,"identity":"02488950-ed5f-4dee-bce6-e872974e60b7","added_by":"auto","created_at":"2025-04-22 07:19:48","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1126268,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of OTA (20 µM) treatment, alone and in co-administration with each of FX and FLX after 24 hrs treatment, on mRNA transcript levels of mitochondrial genes; ND1 \u003cstrong\u003e(A)\u003c/strong\u003e, ND5 \u003cstrong\u003e(B)\u003c/strong\u003e, CO1 \u003cstrong\u003e(C)\u003c/strong\u003e, ATP 6/8 \u003cstrong\u003e(D)\u003c/strong\u003e, and mitophagy coding genes; PINK1\u003cstrong\u003e(E)\u003c/strong\u003e and Parkin \u003cstrong\u003e(F)\u003c/strong\u003e. The gene expression was analysed by RT-qPCR, and the results are demonstrated as mean ± SD values from at least 3 independent experiments. *, **, *** indicate significance between different groups at (p \u0026lt; 0.05), (p \u0026lt; 0.01), and (p \u0026lt; 0. 001), respectively. Ochratoxin A, OTA; Fucoxanthin, FX; Fucoxanthinol, FXL.\u003c/p\u003e","description":"","filename":"fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/30769598cb4624c984a11821.jpg"},{"id":81091438,"identity":"5d14692e-fff2-4c03-b1ca-8e4f286e6c09","added_by":"auto","created_at":"2025-04-22 07:11:48","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1009562,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of OTA (20 µM) and its combination with FX and FLX for 24 hrs treatment on the intracellular ROS level, antioxidant profile, and oxidative stress markers in HK-2 cells after 24 hrs treatment.\u003c/strong\u003e ROS levels \u003cstrong\u003e(A)\u003c/strong\u003e, TBARS level \u003cstrong\u003e(B)\u003c/strong\u003e, CAT activity \u003cstrong\u003e(C)\u003c/strong\u003e, SOD activity, and mRNA transcript levels of oxidative stress genes; HO-1 (E) and Nrf2 (F). The gene expression was analysed by RT-qPCR. Results are displayed as mean ± SD values from at least 3 independent experiments. *, **, *** indicate significance between different groups at (p \u0026lt; 0.05), (p \u0026lt; 0.01), and (p \u0026lt; 0. 001), respectively. Ochratoxin A, OTA; Fucoxanthin, FX; Fucoxanthinol, FXL.\u003c/p\u003e","description":"","filename":"fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/6b6c7c661ff094ff250cdc68.jpg"},{"id":81091428,"identity":"f828ca3d-b287-4472-a178-8ca1256e35bd","added_by":"auto","created_at":"2025-04-22 07:11:48","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1003853,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eApoptotic pathway mediators expression levels\u003c/strong\u003e; caspase-3 \u003cstrong\u003e(A)\u003c/strong\u003e, caspase-8 \u003cstrong\u003e(B)\u003c/strong\u003e, caspase-9 \u003cstrong\u003e(C)\u003c/strong\u003e, and Bax/Bcl2 ratio of mRNA transcript level \u003cstrong\u003e(D)\u003c/strong\u003e, in control and different treated HK-2 cells with OTA (20 µM) and its combination with FX and FLX for 24 hrs. Results are displayed as mean ± SD values from at least 3 independent experiments. *, **, *** indicate significance between different groups at (p \u0026lt; 0.05), (p \u0026lt; 0.01), and (p \u0026lt; 0. 001), respectively. Ochratoxin A, OTA; Fucoxanthin, FX; Fucoxanthinol, FXL.\u003c/p\u003e","description":"","filename":"fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/7984d4d1d2a7e00dabfc0e64.jpg"},{"id":81091437,"identity":"316d165c-abe4-4f5f-9756-9b5c37097dfb","added_by":"auto","created_at":"2025-04-22 07:11:48","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":198489,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAn illustrated graphic summarizes the renoprotective effects of FX and FLX on OTA-induced kidney cytotoxicity utilizing the HK-2 cell line during 24 hours in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evitro.\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eData from various cytotoxicity mechanisms revealed that OTA had a dose-dependent cytotoxic effect on HK-2 cells after 24 hours. FX and FXL increased cell viability and provided cytoprotection. OTA (20 µM) mono-treated cells exhibited significant improper regulation of normal cellular pathways, including genotoxicity (percentage of DNA damage), disruption of mitochondrial bioenergetics (activities of PDH, α-KG, MCI, and MCIII complexes, ATP levels, and mitochondrial membrane potential), downregulation of specific mitochondrial quality control genes (mRNA transcript levels of ND1, ND5, CO-1, and ATP6/8), inhibition of mitophagy (PARK1 and parkin), induction of oxidative stress (ROS and TBARS), downregulation of oxidative stress genes (HO-1 and Nrf2), reduction of antioxidant enzymatic activity (ROS and CAT), and elevation of apoptotic mediator markers (Caspases-3, 8, and 9, and BAX-BCL-2 ratio). Combining FX or FLX with OTA (20 µM) significantly standardized all parameters, demonstrating enhanced protection at higher dosages than lower ones.\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/a10743e3295aff27ef2b8da9.jpg"},{"id":86699396,"identity":"17717d5f-bc40-421a-977d-9f41f1192872","added_by":"auto","created_at":"2025-07-14 16:08:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6969333,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/3a031f98-7dd8-44a4-8eff-76589859eb20.pdf"},{"id":81092030,"identity":"3119b3be-58bc-4400-839d-1790f2562086","added_by":"auto","created_at":"2025-04-22 07:19:51","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":695844,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfiles.docx","url":"https://assets-eu.researchsquare.com/files/rs-6077785/v1/9edcddb5d3484ccddca7e639.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Through its genoprotective, mitochondrial bioenergetic modulation, and antioxidant effects, Fucoxanthin and its metabolite minimize Ochratoxin A-induced nephrotoxicity in HK-2 human kidney cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe estimates from the Food and Agriculture Organization (FAO) indicate that mycotoxin contamination impacts around 25% or more of food crops each year [1]. It is essential to note that just a particular group of mycotoxins presents considerable issues to food safety [2, 3]. Among these mycotoxins, Ochratoxin A (OTA) is a potent and highly toxic compound generated by species of Aspergillus and Penicillium that contaminate agricultural products, causing substantial health concerns for humans [4]. OTA commonly pollutes a wide variety of food commodities, such as cereals, coffee, cocoa, dried fruits, and spices [4\u0026ndash;7]. Many studies have demonstrated that OTA presents various toxic effects, including nephrotoxicity, hepatotoxicity, teratogenicity, genotoxicity, immunotoxicity, neurotoxicity, and carcinogenicity, primarily affecting renal function, and is classified as a possible human carcinogen (Group 2B) [8\u0026ndash;11]. Several processes, such as lipid peroxidation, suppression of protein synthesis, DNA damage, oxidative stress, and mitochondrial dysfunction, contribute to its harmful adverse effects [4].\u003c/p\u003e \u003cp\u003eNatural products are mixtures and monomers derived from natural sources, such as animals, plants, and microorganisms. Natural ingredients have historically been used to cure and prevent numerous diseases [12, 13]. Many compounds found in natural products have exhibited significant benefits and high efficacy in inhibiting cell death, oxidative stress, and inflammation [12]. Natural products can tackle cellular toxicity by utilizing their intrinsic bioactive compounds with antioxidant, anti-inflammatory, and detoxifying attributes, potentially alleviating damage inflicted by deleterious chemicals or environmental stressors, thus providing a less toxic alternative to synthetic chemicals in cellular protection and repair mechanisms [14]. Targeting mitochondrial dysfunction is one of the many biological functions these naturally occurring substances have demonstrated throughout thousands of years [15, 16]. Consequently, natural compounds may provide protective benefits for the kidneys. Even with these strategies, OTA remains a serious public health risk. The complexities of food product contamination necessitate comprehensive prevention, control, and management measures to minimize its negative consequences. Continued research and regulations have significance for protecting consumers and guaranteeing food safety [4].\u003c/p\u003e \u003cp\u003eFucoxanthin (FX) is the most abundant carotenoid in marine brown algae. Because of its well-defined chemical structure, it has various beneficial properties against cancer, diabetes, obesity, cardiovascular disease, and neurological disorders [17]. It possesses multiple pharmacological properties, including antioxidant, anti-inflammatory, and anti-tumor effects, through which it exerts its renal protective effects in prevalent renal disorders, such as chronic kidney disease and ischemic renal injuries [18]. Digestive enzymes hydrolyze FX to produce Fucoxanthinol (FXL), which is then converted to amarouciaxanthin A in the liver and gastrointestinal tract [19]. Moreover, FXL was present in human plasma, although FX was not, after the oral treatment of kombu algae carrying FX [20]. Given their safer profile, we highlight FX and FXL, which may be highly promising in treating nephrotoxicity.\u003c/p\u003e \u003cp\u003eNatural items are better for investigating potential treatments that control energy metabolism. Nevertheless, their role in addressing mitochondrial dysfunction in renal disorders has not been fully investigated. Thus, this study aimed to target oxidative stress, apoptosis, mitochondrial bioenergetics, mitophagy, and mitochondrial genes to extensively analyze and evaluate the nephroprotective effect of FX and FLX on OTA-induced renal toxicity using the HK-2 cell line as an experimental in vitro model. Additionally, the current study aims to provide side-effect-free alternatives to avoid OTA-contaminated food nephrotoxicity worldwide.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eChemicals\u003c/h2\u003e \u003cp\u003eOTA, FX, and FLX were purchased from Sigma-Aldrich Chemical Company (St. Louis, MO, USA). DMSO was bought from ICI-UK. Subsequent laboratory chemicals were supplied by local vendors.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell culture\u003c/h3\u003e\n\u003cp\u003eThe human renal proximal tubular epithelial cells HK-2 cell line (model number: CRL-2190) used in this study were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Following the protocol used in [21], cells were grown in supplemented Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Prat de Llobregat, Barcelona, Spain)/Nutrient Mixture F-12 (HAM) (F-12, Gibco) (in 1:1 concentration), 37\u0026deg;C in an incubator with 95% humidity and 5% CO\u003csub\u003e2\u003c/sub\u003e. To keep up exponential growth, the cells were split using trypsin\u0026ndash;EDTA and subcultured every two to three days. The consistency of experiments was maintained by using the same batch of HK-2 cells (within 5 passages), identical reagent lots, and standardized protocols for cell culture, treatment, and assay conditions. In all in vitro studies, the vehicle control group (negative control) comprised HK-2 cells treated with the same concentration of DMSO used to dissolve FX and FXL, without exposure to either chemical or OTA. The final concentration of DMSO in all treatment and control groups was kept at \u0026le;\u0026thinsp;0.1% (v/v), a level verified to have no cytotoxic effect on HK-2 cells.\u003c/p\u003e\n\u003ch3\u003eCytotoxicity assessment using MTT assay\u003c/h3\u003e\n\u003cp\u003eThe FX and FXL effect on the viability of HK-2 cells was assessed using the commonly used 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) test. HK-2 cells were grown to 90% confluence and placed into 96-well plates (TPP, Swiss). Cells (2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/ml) were then exposed to different OTA doses (5, 10, 20, 40, and 80 \u0026micro;M), and variable concentrations of FX and FXL (1, 2.5, 5, and 10 \u0026micro;M) were added to the cells for 24 hrs. In addition, a separate MTT assay applied where cells were treated with OTA (20 \u0026micro;M) alone as monotreatment or with 3 different subcellular cytotoxicity pathway inhibitors: anti-caspase-3 Z-vAD-fmk, antioxidant-reduced glutathione, and mitochondrial protective Co-Q10. The treatments\u0026rsquo; media were taken out after 24 hrs, and medium containing MTT stain (Sigma, M5655-1G; 0.5 mg/ml) was added. The formed formazan crystals were solubilized with DMSO after four hours of incubation at 37\u0026deg;C. Using reading points of 590 nm, the microplate reader \"TopCount\" (Perkin Elmer, Ueberlingen, Germany) was utilized to estimate the absorbance levels for the MTT assay. The assessment for each experiment was carried out in triplicates.\u003c/p\u003e\n\u003ch3\u003eCytotoxicity assessment using Trypan blue exclusion (TBE) assay\u003c/h3\u003e\n\u003cp\u003eIn this assay, cells were cultured in 24-well plates for 24 hours and subsequently treated with OTA (20 \u0026micro;M), with or without FX or FXL (2.5 and 5 \u0026micro;M), after an additional 24 hours. Following a 24-hour post-treatment period, attached and floating cells were harvested and centrifuged. The resulting pellet was resuspended in 1 ml of phosphate-buffered saline (PBS), to which 100 \u0026micro;l of 0.4% wt/vol trypan blue was added. Cell viability was assessed using haemocytometer cell counts. Live cells exclude the dye, whereas apoptotic cells are stained due to compromised membrane integrity. Results are expressed as a percentage of viability. Each experiment was conducted a minimum of three times, with each treatment replicated in triplicate.\u003c/p\u003e\n\u003ch3\u003eEvaluation of genotoxic effects on DNA damage by comet assay in HK-2 cells\u003c/h3\u003e\n\u003cp\u003eDNA damage was evaluated using single cell gel electrophoresis on control and treated cells exposed to OTA (20 \u0026micro;M) with or without FX or FXL (2.5 and 5 \u0026micro;M) after 24 hrs. The alkaline comet test was conducted following a standardized protocol [22]. The cells were removed from the incubator and cooled down on ice-cold PBS before 30% ethanol was added. After the agarose was added to the infranatant, the slides were plated. Following the cell lysis with an alkaline lysis solution (pH\u0026thinsp;=\u0026thinsp;10), it was electrophoresed for 30 minutes at 300 mA. After that, it was washed in a neutralizing solution (0.4 mM Tris-HCl) for 3 to 5 minutes, and the slides were then stained with PI (1 mg/ml) for 5 minutes. The cells were imaged using fluorescent microscopy at 546 nm excitation and 640 nm emission. It was finally analyzed using Comet Score IV software (Perspective Instruments, UK) to directly measure the percentage of the tail moment (TM), the amount of DNA in the tail (TD), and the length of the tail when quantifying DNA damage.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMitochondrial bioenergetic assays\u003c/h2\u003e \u003cp\u003eFor biogenetics assays, cells were seeded and subjected to OTA (20 \u0026micro;M) for 24 hrs with or without adding FX and FXL (2.5 and 5 \u0026micro;M).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eIntracellular ATP levels assay\u003c/h3\u003e\n\u003cp\u003eATP levels were assessed using the commercial kit and following the manufacturer's instructions (Abcam, Cambridge, UK; Catalog Number: ab83355). When ATP reacted with additional D-luciferin and luciferase, light was created. The luminescence signal was assessed with a \"TopCount\" luminometer (Perkin Elmer, Ueberlingen, Germany). The values of every cell well in the samples and controls were subtracted from the blank readings. ATP was calibrated to the total protein content of every sample. Three measures were carried out for each concentration used in the experiment.\u003c/p\u003e\n\u003ch3\u003eMitochondrial membrane potential (MMP) assay\u003c/h3\u003e\n\u003cp\u003eMitochondria MPP was investigated using rhodamine 123 (Rh-123), predominantly in energized mitochondria. At this point, the media were removed, and the cells were rinsed with phosphate-buffered saline. The cells were treated with Rh-123 (50 nM) for 10 minutes and then maintained in aluminum foil at 37\u0026ordm;C. Fluorescence was measured using a Top Count microplate reader (Perkin Elmer, Ueberlingen, Germany) at excitation and emission wavelengths of 480 nm and 530 nm, respectively. Experiments were conducted in triplicate.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMitochondrial complexes I (MCI) and III (MCIII) activities assays\u003c/h2\u003e \u003cp\u003eFollowing the Spinazzi et al. [23] protocol, MCI and MCIII activities were investigated using cell lyase and mitochondrial enriched fraction, respectively. While antimycin A was utilized as an MCIII inhibitor, decylubiquinol and cytochrome c were used as terminal electron acceptors. Rotenone was used as a specific MCI inhibitor, and NADH and ubiquinone were used as terminal electron acceptors. Experiments were repeated with at least five samples per treatment to get valid data, and controls were also measured. A temperature-controlled Beckman Coulter DU 800 spectrophotometer was used to calculate the absorbance read to 550 nm. The complexes' activities were expressed as nmol min\u003csup\u003e-1\u003c/sup\u003e mg\u003csup\u003e-1\u003c/sup\u003e of total protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePyruvate dehydrogenase (PDH) enzyme and alpha keto glutarate (α-KG) assays\u003c/h2\u003e \u003cp\u003ePDH activity and α-KG levels were evaluated using colorimetric commercial kits (Abcam, Cambridge, UK; Catalog Number: ab109902 and ab83431, respectively). following the company-supplied guidelines. Evaluation of PDH activity was based on reducing NAD\u0026thinsp;+\u0026thinsp;to NADH with reduction of the reporter and formation of the yellow reaction product, which was detected at OD450 nm. In contrast, α-KG is converted in the assay to pyruvate in the presence of colored probe, which can be read at 570 nm using an ELISA Dyne MRX microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMitophagy assay\u003c/h2\u003e \u003cp\u003eAfter cells were plated and exposed to OTA (20 \u0026micro;M) with or without FX or FXL (2.5 and 5 \u0026micro;M) treatment for 24 hrs, the expression of PINK1 and Parkin proteins was analyzed with commercial ELISA kits and following the manufacturer's recommendations (Bioscience, Catalog Number: MBS7607221 and Abcam; Catalog Number: ab212159, respectively). using cell lysate. The impact of FX and FXL on mitophagy of the treated renal cells was investigated. After adding the stop solution, a Dyne MRX microplate reader was allocated to measure absorbance at 450 OD. The OD450 estimated values were inserted into the provided standard curve data, and the proteins\u0026rsquo; levels were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eOxidative stress biomarkers assays\u003c/h2\u003e \u003cp\u003eCells were plated and exposed to OTA (20 \u0026micro;M) with or without FX or FXL (2.5 and 5 \u0026micro;M) treatment for 24 hrs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eReactive oxygen species (ROS)\u003c/h2\u003e \u003cp\u003eAccording to Elmorsy \u003cem\u003eet al.\u003c/em\u003e [24], the levels of ROS were detected using the 2,7-dichlorodihydrofluorescein diacetate (DCFDA) test (25 uM in Hank's solution) at the time point. The fluorescence readings of the blank cell-free wells were subtracted from the total plate reading. Treatment-related ROS expression levels are presented as a percentage and compared to the controls. Every experiment was run in triplicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLipid peroxidation level\u003c/h2\u003e \u003cp\u003eWhile Malondialdehyde (MDA) is a legitimate lipid peroxidation biomarker, Thiobarbituric acid reactive substances (TBARS) are a common way to measure lipid peroxidation product and a well-known biomarker for oxidative stress. TBARS were evaluated using a purchased kit (Abcam, Cambridge, UK; Catalog Number: ab118970) under the recommended procedure. The cells were homogenized, sonicated, and centrifuged at 13,000 x g at the time point. The supernatant was then collected for the test. A \"TopCount\" plate reader (Perkin Elmer) assessed the absorbance at 532 nm. All the experiments were performed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEnzymatic antioxidant activity\u003c/h2\u003e \u003cp\u003eFollowing Singh et al., catalase (CAT) activities were evaluated calorimetrically [25]. Following cell collection, each sample's protein content was assessed. For the reaction, 1 ml of 0.01 M pH 7 phosphate buffer, 0.1 ml of tissue homogenate, and 0.4 ml of 2 M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e tissue were mixed. Two milliliters of the dichromate acetic acid reagent were added to the starting solution to freeze the reaction. Finally, it was measured at 620 nm, and the absorbance point of CAT was expressed in terms of \u0026micro;moles H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e ingested/min/mg protein. Using a Colorimetric commercial test kit (Abcam, Cambridge, UK; Catalog Number: 277415), the superoxide dismutase (SOD) activity was calculated. The cells were harvested and centrifuged (14,000 x g for five minutes at +\u0026thinsp;4\u0026deg;C); the supernatants were then gathered and kept cold till analysis. The SOD level in the cells, including cytosolic and mitochondrial, is in the supernatant and measured with a \"TopCount\" plate reader; the SOD Absorbance rate was tracked at 440 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eApoptotic pathway markers analysis\u003c/h2\u003e \u003cp\u003eAfter cells were exposed to OTA (20 M) with or without FX and FXL (2.5 or 5 \u0026micro;M) for 24 hrs, the caspases \u0026minus;\u0026thinsp;3, -8, and \u0026minus;\u0026thinsp;9 activities were evaluated with BD Apo-Alert caspase fluorescence kits (Clontech Laboratories, CA, USA; catalog numbers: 630205, 630211, and 630218) in compliance with the manufacturer's instructions. Finally, excitation/emission fluorescence measurements were detected at 380/460 nm (for caspase \u0026minus;\u0026thinsp;9) and 400/505 nm (for caspase \u0026minus;\u0026thinsp;3 and \u0026minus;\u0026thinsp;8).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and RT-qPCR analysis\u003c/h2\u003e \u003cp\u003eTo summarize, a Qiagen RNeasy kit (Catalog No: 74134) was used to extract total RNA from both untreated and treated HK-2 cells after 24 hrs. A Bio-Rad iScript Reverse transcription supermix kit (Hercules, CA, USA; Catalog No: 1708841) was then used to reverse transcribe the extracted RNA. RNA's optical density (A260/A280 ratio) was measured using a NanoDrop 1000 Spectrophotometer (Wilmington, DE, USA). cDNA (1\u0026ndash;100 ng) was amplified in triplicate using the primer sequences of GAPDH (internal control/housekeeping gene) and other genes as specified in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The Maxima Syber Green/ROX qPCR Master Mix was utilized in triplicate for quantitative real-time PCR (qRT-PCR). The fold change of each mRNA was determined using threshold cycle (CT) values derived from the instrument's software. ∆CT was computed by subtracting the CT value of the housekeeping gene from that of the target mRNA. The ∆∆CT value for each mRNA was calculated by subtracting the experimental CT value from the control CT value. The formula 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e was applied to figure out the fold change.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers used in the study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAntisense (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eND1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACTAGCAGAGACCAACCGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGAGAGTGCGTCATATGTTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eND5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTATCTCGCACCTGAAACAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGGAGTAGATTAGGCGTAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCO1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACGTTGTAGCCCACTTCCACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATAGGCCGAGAAAGTGTTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eATP 6/8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATCAGCCTACTCATTCAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGACAGCGATTTCTAGGATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePARKIN\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCTTGTCCTCGCTGCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCACTCCAGCTTGCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePINK1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACCTTTCCCTTTGCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCCTGGCTCATTTTGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNrf2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCTACAAACGGGAATGTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGGATCTGCCAACTACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHO-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGAATTCTCTTGGCTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACAGCTGCCACATTAGGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBax\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCACCAAGAAGCTGAGCGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCAGCCCATGATGGTT CT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBcl-2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACGACTTCTCCCGCCGCTACCG C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGCATGCTGGGGCCGTACAG TTC C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAGTCAGCCGCATCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGCCCAATACGACCAAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eMolecular docking\u003c/h2\u003e \u003cp\u003eMolecular docking was used to study FX, FXL, and OTA's interactions with mitochondrial function, oxidative stress, inflammation, and apoptotic proteins. The target proteins included MCI, MCIII, CAT, SOD, NRf2, HO-1, and caspase-3. In silico methods were used to discover protein structures, generate ligands, and simulate docking. Protein targets with biological importance and three-dimensional structures from the Protein Data Bank were selected. PubChem provided FX, FXL, and OTA ligand structures. Docking simulations used AutoDock Vina. Eliminating water molecules and non-essential ions, adding polar hydrogens, and assigning correct charges with AutoDockTools produced proteins. After geometrically optimizing ligand structures with Chem3D, docking grids were centered on active sites discovered through literature study and functional domain analysis using CASTp. Binding affinities (ΔG in kcal/mol) and molecular interactions (hydrogen bonds, hydrophobic interactions, and charge interactions) were evaluated to determine ligand-protein binding properties. The results were tabulated to clarify interaction characteristics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eFor statistical data analysis, Graph Pad Prism 8.0 software was used. One-way analysis of variance and post hoc (Tukey and Dunnett) tests for multiple comparisons were used. The results of three independent experiments were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD), presented graphically as a bar chart, and *, **, and *** P values were considered statistically significant at (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), respectively.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEvaluation of OTA, FX, and FLX impacts on the viability and genotoxicity of HK-2 kidney cells after 24 hrs of treatment\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAn MTT assay was used to assess the cytotoxic effects of OTA, FX, and FLX, either alone or together, on the proliferation of the HK-2 cell line. As depicted in 1A, data from OTA mono-treatment in figure.1A showed a dose-dependent significant suppression of HK-2 cell line proliferation and mean OD which indicated viability percentage after using a range of OTA concentratiwhile the molecular docking inherently represents a theoretical prediction, it does not fully account for dynamic protein conformations or solvent effects. Hence, (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). FXL showed more effect on the cells\u0026rsquo; viability than FX at the same exact concentration without statistically significant differences (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). In addition, each co-administration of FX or FXL at concentrations (2.5 and 5 \u0026micro;M) with OTA (20 \u0026micro;M) was shown to significantly counteract OTA (20 \u0026micro;M) monotreatment induced cytotoxicity in a concentration dependent pattern (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Cytotoxicity data was confirmed by trypan blue exclusion assay, which gives results aligned with the MTT assay outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor further evaluation of OTA-induced cytotoxicity pathways and protective effects of FX and FXL, bioenergetics assays, oxidative stress biomarkers, and apoptotic markers were selected to be investigated in the current study. Initially, three common subcellular cytotoxicity mechanisms as shown in (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), were evaluated through their common pathways\u0026rsquo; inhibitors (anti-caspase-3 Z-vAD-fmk, antioxidant-reduced glutathione, and mitochondrial protective Co-Q10). The data revealed that the three compounds significantly antagonized OTA (20 \u0026micro;M) cytotoxicity to different extents. However, Co-Q10 showed the most significant protection, while Z-vAD-fmk showed the least cytoprotective effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). DNA damage of genetic materials was measured as a possible cause of cytotoxicity. The DNA strand breaks in OTA and combination-treated HK-2 cells were evaluated using the comet assay, which is an approach for measuring the genotoxicity test parameters, TM and TD, in Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, respectively. The data demonstrated a substantial significant alleviation in OTA-induced genotoxicity after each co-administration of FX and FXL. Figure.1F exhibited a significant elevation in TD (% tail DNA content) in cells treated with OTA (20 \u0026micro;M), indicating genotoxicity in comparison to the untreated control cells. Subsequent to each FX and FXL cotreatment with OTA, the elevation of TD as an indicator of genotoxicity was dramatically reduced and restored to levels closer to the control.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003eFX and FLX improved cellular bioenergetic markers in OTA treated HK-2 kidney cells\u003c/h2\u003e \u003cp\u003eOn its own, OTA monotreatment significantly decreased bioenergetics; cellular ATP generation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), MMP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), MCI (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), MCIII (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), α-KG (main intermediate byproduct in Krebs cycle) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH) levels, and PDH activity (Main Krebs cycle entry point) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG) in comparison with untreated control cells. The results showed that co-administration of either FX or FLX with OTA significantly elevated the reduction in these bioenergetic measures. The inhibitory alterations in the levels of these six bioenergetic proteins in OTA-treated cells were reverted to near-normal control levels following treatment with either FX or FLX (OTA\u0026thinsp;+\u0026thinsp;FX and OTA\u0026thinsp;+\u0026thinsp;FLX cotreatment, respectively). The nephroprotective effect of both FX and FLX against OTA-induced toxicity was more pronounced at high doses than at low doses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFX and FLX normalized mRNA expression levels of mitochondrial genes in OTA treated HK-2 kidney cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOTA monotreatment independently resulted in a significant decrease of mRNA transcript levels of mitochondrial genes (mtDNA) essential for encoding the electron transport chain enzymes; ND1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), ND5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), CO1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), ATP 6/8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) in comparison with untreated control cells. As shown in figures (3A-D), Co-treatment of either FX or FLX with OTA demonstrated a significant upregulation in mRNA transcript levels of these tested genes in comparison with OTA-treated cells. The data revealed that the downregulation of expression levels of these four genes in OTA-treated cells, which exhibited adverse consequences, was restored to nearly normal control levels upon treatment with either FX or FLX (OTA\u0026thinsp;+\u0026thinsp;FX and OTA\u0026thinsp;+\u0026thinsp;FLX cotreatment, respectively). Interestingly, both FX and FLX treatments against OTA-induced toxicity showed more significant protection at high doses than at low doses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eFX and FLX alleviated mitophagy players in OTA treated HK-2 kidney cells\u003c/h2\u003e \u003cp\u003eOur findings demonstrated that OTA monotreatment suppressed mitophagy signaling, as evidenced by downregulation of the levels of Parkin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) and PINK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) and dramatically reducing mRNA transcript levels of Parkin (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) and PINK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) genes in compare with untreated control cells. The Co-treatment of either FX or FLX with OTA demonstrated a considerable increase of both protein levels and mRNA transcript levels of the examined genes compared to cells treated just with OTA. The results showed that, inhibitory ameliorations in both genes in OTA-treated cells were counteracted, returning to approach normal control levels following treatment with either FX or FLX (OTA\u0026thinsp;+\u0026thinsp;FX and OTA\u0026thinsp;+\u0026thinsp;FLX cotreatment, respectively). Additionally, both FX and FLX treatments significantly attenuated OTA-induced suppression of the tested markers, exhibiting greater protective effects at high dosages compared to lower ones.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFX and FLX maintained redox status, mitigated oxidative stress and ameliorated antioxidants in OTA- induced oxidative damaged HK-2 cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe impact of combining OTA with either FX or FLX on antioxidants and oxidative stress was investigated, with results shown in figure. 4. In OTA mono-treated cells compared to untreated control cells over 24 hrs, a significant major increase in levels of intracellular ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) and TBARS (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), which used as a biomarker for lipid peroxidation, was observed. Additionally, there was a significant decrease in the antioxidant enzymatic activities of CAT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) and SOD (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), as well as a reduction in mRNA transcript levels of the HO-1 gene, which serves as a protective antioxidant against oxidative stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), and the Nrf2 gene, which functions as the master regulator of antioxidant gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). The concurrent administration of either FX or FLX with OTA resulted in the remarkable normalization of these redox parameters and oxidative stress indicators with more significant protection at high doses than at low doses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eFX and FLX downregulated apoptotic markers in response to OTA treatment in HK-2 kidney cells\u003c/h2\u003e \u003cp\u003eThe data from the current study demonstrated that OTA monotreatment modulated apoptosis, where a significant elevation in expression levels of caspase-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), caspase-8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), caspase-9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), and Bax/Bcl2 ratio of RNA transcript level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) was detected in compared to the control cells. This increase in apoptotic markers was significantly minimized or inhibited after the co-treatment of either FX or FLX with OTA. In addition, both FX and FLX treatments significantly reduced OTA-induced apoptosis with more significant neutralization at high doses than at low doses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eMolecular docking\u003c/h2\u003e \u003cp\u003eThe molecular docking study demonstrated varying binding affinities and interaction profiles of ochratoxin A (OTA), fucoxanthin (FX), and fucoxanthinol (FXL) with specific protein targets associated with oxidative stress and apoptosis pathways. Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e summarizes the docking scores (ΔG in kcal/mol) and key intermolecular interactions, such as hydrogen bonds and hydrophobic contacts. Both FX and FXL exhibited greater binding affinities for mitochondrial complexes I and III (MCI and MCIII) than OTA. In MCI, FX (\u0026ndash;5.0 kcal/mol) established five hydrogen bonds and six hydrophobic contacts with residues including Asp134 and Tyr147. In contrast, FXL demonstrated a marginally greater binding affinity (\u0026ndash;5.98 kcal/mol) through eight hydrophobic interactions with Pro32 and Gln154, although it did not form any hydrogen bonds. MCIII exhibited a distinct trend of increasing binding affinity, with values of \u0026minus;\u0026thinsp;6.1 kcal/mol for OTA, \u0026minus;\u0026thinsp;6.6 kcal/mol for FX, and \u0026minus;\u0026thinsp;7.2 kcal/mol for FXL. FXL engaged in extensive interactions through eleven hydrophobic contacts with residues including Phe187 and Ile188, suggesting a potentially enhanced stabilizing effect on the protein.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBinding affinities, key Residues, Interactions, and Interaction Types of ochratoxin A (OTA), fucoxanthin (FX), and fucoxanthinol (FXL) with the proteins involved in the pathways of mitochondrial complexes I (MCI) and III (MCIII), oxidative stress proteins; catalase (CAT), superoxide dismutase (SOD), Nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and caspase-3 (Cas-3).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" colname=\"c1\"\u003e \u003cp\u003eProtein Target\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003elegends\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eBinding Affinities (ΔG in kcal/mol)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKey Residues\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eHydrogen Bonds\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eHydrophobic Interactions\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eMCI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-4.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTyr147, Asp150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAsp134, Tyr147, Asp153, Val154, Ile133, Pro131, Asp150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-5.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGln154,Pro32, Asp37,\u003c/p\u003e \u003cp\u003eVal158, Tyr129, Pro166.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eMCIII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-6.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAla193, Leu41, Leu37, Phe18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-6.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLeu197, Ile42, Ala193, Leu119,\u003c/p\u003e \u003cp\u003eIle189, Leu41, Phe90, Leu37, leu49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-7.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLeu189, Met194, Ala191, Phe187, ILe188, Ile184, Leu49, Phe50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eCatalase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-7.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHis364, Pro391\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-7.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHis364, Arg66, Arg363, Pro391, Met392, Pro368\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePro391, Pro70, Leu366,\u003c/p\u003e \u003cp\u003eIle373, Gln331, Ile69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eSOD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-8.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eVal25, Leu57, Tyr105, Thr121, Leu123, Leu133\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-6.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHis59, Leu130, Leu123, Lys128,, Lys125, Phe86, Ala135, val25,\u003c/p\u003e \u003cp\u003eLeu44, Phe107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTyr17, Trp23, Tyr40, Phe68, leu130. Leu123, Leu57, Phe107, Ile119, Leu44, Leu57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eNrf2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-9.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eThr42, Pro65, Asn114, Tyr216, Trp236\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-8.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eThr560, Val369, Val561, Val514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-8.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eArg415, Val608, Val369, Val561, Ile559, Ala556,Arg514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eHO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGlu62, His84, Lys86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-7.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePro80, Glu81, Val59, Glu63, Leu155, Glu66, Pro80, His84, Glu62, Lys86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGlu81, Asn171, Lys86, Val59, Ala87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c2\" namest=\"c1\" rowspan=\"3\"\u003e \u003cp\u003eCas-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eOTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-4.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIle265, Met233\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-4.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTyr195, Val266, Cys264, Ile265\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFXL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-3.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePro201, Ala200, Met233, Leu269, Glu272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCatalase exhibited the highest affinity for FX (\u0026ndash;7.9 kcal/mol), involving five hydrogen bonds and five hydrophobic interactions, particularly with His364 and Pro391. OTA demonstrated a favorable affinity of \u0026minus;\u0026thinsp;7.7 kcal/mol, characterized by limited interactions, specifically one hydrogen bond and three hydrophobic contacts. FXL exhibited a positive binding energy of +\u0026thinsp;18.2 kcal/mol, suggesting unfavorable or non-specific binding, potentially attributed to steric hindrance or inadequate complementarity with the active site of catalase. Superoxide dismutase (SOD) exhibited the most favorable binding with OTA, quantified at \u0026minus;\u0026thinsp;8.2 kcal/mol. This interaction involved one hydrogen bond and seven hydrophobic interactions with critical residues, including Tyr105 and Leu133. FX exhibited a lower affinity of \u0026minus;\u0026thinsp;6.04 kcal/mol, establishing two hydrogen bonds and ten hydrophobic interactions. FXL demonstrated a positive binding energy of +\u0026thinsp;13.9 kcal/mol, indicating a weak affinity or possible repulsion within the binding cavity. The Nrf2 transcription factor exhibited the highest binding affinity for OTA, measured at \u0026minus;\u0026thinsp;9.7 kcal/mol. This interaction involved the formation of a hydrogen bond and four hydrophobic interactions, notably with residues Tyr216 and Trp236. FX and FXL exhibited moderately high affinities of \u0026minus;\u0026thinsp;8.25 and \u0026minus;\u0026thinsp;8.45 kcal/mol, respectively, with FXL demonstrating a greater density of hydrophobic interactions, indicating a potential for Nrf2 activation or stabilization. Heme oxygenase-1 (HO-1) exhibited comparable affinities for OTA (\u0026ndash;7.0 kcal/mol) and FX (\u0026ndash;7.1 kcal/mol). FX established four hydrogen bonds and eight hydrophobic interactions, suggesting enhanced binding strength. FXL demonstrated a notably positive binding score of +\u0026thinsp;2.8 kcal/mol, indicating weak interaction, which aligns with its catalase and SOD findings. All ligands exhibited relatively weak interactions with caspase-3. OTA (\u0026ndash;4.54 kcal/mol) and FX (\u0026ndash;4.2 kcal/mol) exhibited minimal hydrogen and hydrophobic interactions. FXL exhibited the lowest affinity (\u0026ndash;3.7 kcal/mol), while preserving a comparable interaction profile with residues including Met233 and Glu272 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Figures \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-S3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOTA is a mycotoxin often present in numerous food and feed products, adversely affecting humans as well as pets. OTA exerts a nephrotoxic detrimental impact on human health by exposure to food contaminated with OTA [26]. Prior researches has established that exposure to OTA can result in multiorgan toxicity [27\u0026ndash;29]; nevertheless, the kidney is the primary target of OTA [30, 31]. A preliminary study in Egypt indicated that OTA may be associated with renal disease, evidenced by elevated serum OTA levels in end-stage renal disease (ESRD) patients, as well as increased serum and urine OTA levels in nephrotic syndrome and urothelial cancer [32]. The mechanisms of OTA-induced nephrotoxicity involve the reduction of protein synthesis, cell cycle arrest, DNA damage and apoptosis [30].\u003c/p\u003e \u003cp\u003eDiverse efforts are carried out to safeguard individuals from toxicity by elucidating the molecular mechanisms involved. Utilizing FX and its metabolites as interesting phytochemicals for various pharmacological targets. FX is a remarkable carotenoid characterized by the presence of an allenic link in its structure. FX is extracted from various algae and edible seaweeds. It has been demonstrated to offer several health advantages and preventive effects against diseases such as diabetes, obesity, liver cirrhosis, and malignant cancer [33]. Consequently, FX can serve as an effective supply of both pharmacological and nutritional components to mitigate OTA-induced kidney damage. The present study found that FX and its metabolite FXL, through their nephroprotective attributes covering antioxidant, anti-inflammatory, and anti-apoptotic effects, modulated the intracellular molecular processes and signalling pathways associated with OTA-induced nephrotoxicity in HK-2 cells. These cells are derived from the kidneys of healthy adult males and provide an excellent tool for toxicological research. To ensure data reproducibility, an immortalized cell line gives a single homogenous population of phenotypically similar cells as an alternative to the challenging-to-obtain primary human cell line. Human cell lines were chosen to avoid any interspecies effects on the credibility of the results.\u003c/p\u003e \u003cp\u003eThe cytotoxic effect of OTA was assessed at a concentration range between 5\u0026ndash;80 \u0026micro;M, which was within the reported range of OTA in the human urine samples, which range from 0.0006\u0026ndash;0.065 mg/ml (1.5\u0026ndash;160 \u0026micro;M) in a study from Hungary [34]. FX and FXL effects were evaluated using concentrations 1\u0026ndash;10 \u0026micro;M, which was effective in other cell lines\u0026rsquo; studies [18, 35]. According to MTT assay outcomes, OTA showed cytotoxicity to the HK-2 cells, these are consistent with various studies that demonstrated the OTA cytotoxicity against human cells, other cell lines, and the same HK-2 cells used in our study [36\u0026ndash;38]. FX and FXL were shown to improve the renal cells viability and mitigate OTA induced cytotoxicity. MTT assay was supposed to depend on metabolically active cells, not only cytotoxicity. Assessment of cell death and cytotoxicity of OTA with and without FX and FXL using a live-dead stain such as Trypan blue, which give similar outcomes to MTT assay.\u003c/p\u003e \u003cp\u003eFor further evaluation of OTA-induced cytotoxicity, three standard cytotoxicity subcellular mechanisms were evaluated using their common pathways inhibitors (anti-caspase-3 Z-vAD-fmk, antioxidant-reduced glutathione, and mitochondrial protective Co-Q10). Data revealed that the three compounds significantly antagonized OTA cytotoxicity to various extents. Co-Q10 demonstrated the most significant protection, while Z-vAD-fmk showed the least protective effect. Hence, the study considered different assays to explore the three cellular mechanisms of cytotoxicity and evaluate the cytoprotective impact of FX and FXL against OTA-induced nephrotoxicity. The current study showed that OTA inhibited the bioenergetics of the treated cells through oxidative stress and apoptosis induction. Similar effects of OTA were reported in previous studies. In the rats\u0026rsquo; renal tubular cells, mitochondria were the primary target for the toxic activity of OTA [39].\u003c/p\u003e \u003cp\u003eInterestingly, While MTT data indicated that FX and FXL did not exert cytotoxic effects at the tested concentrations\u0026mdash;and showed a slight increase in cell viability\u0026mdash;which was not the focus of the current study. Hence, their potential proliferative or intrinsic bioactivity was not investigated without OTA. The increased cell viability may indicate a pro-survival or proliferative effect of FX and FXL. However, further mechanistic investigations are necessary to validate these effects, including cell proliferation assays, cell cycle analysis, and signalling pathway evaluation, which were not addressed in this study.\u003c/p\u003e \u003cp\u003eAlkaline Comet assay TM and TD parameters showed that OTA was genotoxic to HK-2 cells with the geno-protective effect of FX and FXL against OTA-induced genotoxicity. The discrepancy between the % tail DNA and tail moment values in specific treatment groups of the comet assay was noted. Although these two parameters are typically correlated, they do not consistently change in tandem, representing distinct aspects of DNA damage. The percentage of tail DNA quantifies the proportion of fragmented DNA that migrates into the comet tail. In contrast, the tail moment, defined as the product of tail length and percentage of tail DNA, integrates both the extent and distribution of DNA damage. Variations in tail length, resulting from differences in DNA fragment size or chromatin structure, can cause divergence between these indices. The observed discrepancy likely indicates variability in DNA migration distance rather than inconsistency in the extent of damage. Localized differences in DNA repair kinetics, chromatin relaxation, and the physical nature of DNA breaks (such as single- versus double-strand breaks) may influence tail length independently of the total DNA amount in the tail [40].\u003c/p\u003e \u003cp\u003eNormal cell activity and human health depend on mitochondria, the organelles that provide energy for the cells and serve as biosynthetic and bioenergetic factories. Mitochondrial bioenergetics is regarded as a crucial metric for evaluating the pathogenesis of various diseases. Dysfunctional mitochondria impair or initiate multiple disorders affecting the most energy-demanding organs, such as the kidneys. This dysfunction may result from changes in mitochondrial enzymes, heightened oxidative stress, disruption of the electron transport chain and oxidative phosphorylation, or mutations in mitochondrial DNA, contributing to the pathophysiology of various pathological conditions, including neurological and metabolic disorders [41]. Natural medicines that target mitochondria are seen as more effective and safer for the treatment of various disorders [41]. This study demonstrated that FX and FLX markedly enhanced cellular mitochondrial bioenergetic indicators (ATP, MMP, MCI, MCIII, α-KG levels, and PDH activity) and effectively normalized mRNA expression levels of mitochondrial genes (ND1, ND5, CO1, ATP 6/8) in OTA-treated HK-2 kidney cells after a 24 hrs treatment period. This agrees with previously published data: co-treatment with palmitate (PA)-exposed macrophages, FX increased MCII, III, and V expression. Higher mitochondrial regulators, Pgc1a and Tfam levels indicated that cells co-treated with FX had reduced mitochondrial content but elevated mitochondrial biogenesis compared to macrophages treated with PA [42].\u003c/p\u003e \u003cp\u003eThrough mitophagy, damaged, non-energizing mitochondria are broken down by lysosomes, allowing cells to get rid of themselves. The proteins Parkin and PINK1 are crucial for activating the mitophagy pathways [43]. Damaged mitochondria are removed via mitophagy, which can increase ROS formation, activate the NLRP3 inflammasome, and start apoptotic processes [44, 45]. According to our data, FX and FLX alleviated the mitophagy pathway in OTA-treated HK-2 kidney cells. OTA dramatically reduced the protein expression levels and downregulated mRNA transcript gene levels of PINK1 and Parkin. Thus, co-treatment of either FX or FLX with OTA demonstrated a considerable counteracting of this activity, where there was a significant upregulation in both of these tested genes' protein and mRNA transcript levels compared with OTA-treated cells. One reasonable explanation for this is a study that concluded that despite the reduced number of mitochondria present following FX therapy, increased mitophagy cleared out damaged mitochondria and may have helped restore mitochondrial function [46]. Multiple reports have shown that natural products have strong therapeutic values in promoting mitochondrial biogenetics and energetics, reducing mitochondrial ROS, enhancing mitophagy, and regulating mitochondrial dynamics [41]. However, the current study did not assess downstream functional endpoints of mitophagy, such as mitochondrial clearance, lysosomal engagement, or mitochondrial morphology and abundance (e.g., by Transmission electron microscopy, mtDNA copy number, or mitotracker-based imaging). This can be considered in further studies.\u003c/p\u003e \u003cp\u003eOTA is a potent nephrotoxin due to its accumulation in proximal tubule epithelial cells, leading to cellular damage via oxidative stress, DNA damage, inflammatory, and apoptotic responses [30, 47]. A growing library of in vitro and in vivo research has accumulated, providing evidence that supports the involvement of oxidative stress in the toxicity and carcinogenicity of OTA. Numerous studies have been conducted to counteract the negative impacts of oxygen radicals generated due to OTA exposure [48]. Measurements of oxidative stress and antioxidants are critical in toxicity studies. Thus, current results showed that FX and FLX significantly reduced intracellular ROS and TBARS (biomarker of lipid peroxidation) levels, ameliorated oxidative stress genes (mRNA transcript levels of HO-1 and Nrf2 genes) and maintained antioxidants activity (CAT and SOD) in OTA- induced oxidative damaged HK-2 cells. A recent study indicated that OTA increases oxidative stress in rat kidneys and liver by elevating MDA, lipid peroxidation, and inhibiting glutathione (GSH), CAT, and SOD [49]. Furthermore, OTA elicited the generation of ROS in renal proximal tubular cells, resulting in higher DNA damage. N-acetylcysteine (NAC) administration reduced ROS levels and enhanced cell viability following OTA exposure [50]. OTA increases the expression of apoptosis signal-regulated kinase 1 (ASK-1), which controls ROS generation and reduce MMP, hence facilitating nephrotoxicity following OTA exposure [51]. ROS facilitated the translocation of Nrf2 to the nucleus, thereby augmenting the production of HO-1 to mitigate cellular damage [30, 52]. Hence, the regulation of Nrf2 by FX could possibly be considered as a strategy to prevent or treat OTA-induced toxicity.\u003c/p\u003e \u003cp\u003eExperiments on rat primary hippocampal neurons displayed that FX therapy reduced the accumulation of superoxide in the mitochondria and shielded the loss of MMP from ROS stress. Furthermore, oral FX supplementation increased in the level of DJ-1 protein in middle-aged rats' hippocampal tissues, indicating its potential neuroprotective benefits against ROS-related mitochondrial dysfunction [53]. Furthermore, it was found that FX increased MMP, reduced oxidative stress, and triggered the AMP-activated protein kinase pathway to enhance mitochondrial bioenergetics in palmitate-treated HepG2 cells [54]. According to other studies, FX protected human osteoblasts from oxidative stress caused by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. FX isolated from brown algae revealed potent DPPH radical scavenging and iron-chelating activity in cell-free experiments [55, 56]. In various \u003cem\u003ein vitro\u003c/em\u003e cell lines, such as macrophages, liver cells (HepG2), colorectal adenocarcinoma epithelial (Caco-2) cells, and human cervical cancer cells (HeLa cells), FX showed promising antioxidant properties. The antioxidant glutathione level increased 3.3 times due to FX co-treatment, resulting in a concentration-based antioxidant effect [57]. According to animal research, FX reduced oxidative stress in rats with LPS-induced uveitis, mice with alcoholic liver injury, and mice with ovalbumin-induced asthma by raising total antioxidant capacity, inducing the Nrf2-mediated antioxidant pathway, and reducing lipid peroxidation [58, 59]. Also, the protective effects of FX against diabetic retinopathy in retinal epithelial cells of human origin were demonstrated, resulting in the induction of antioxidant enzyme activities and decreasing ROS levels, most likely because of Nrf2 activation's intense antioxidant activities [60]. Additionally, when FX was added to sunscreen at a concentration of 0.5% w/v, it significantly alleviated the ROS production in human skin reconstructions [61]. Furthermore, it was found that the injection of FX considerably restored the reduced activities of peroxidase, SOD, CAT, and ascorbate peroxidase in mice's renal tissues exposed to Cd. This restoration may have been achieved via antioxidant activities and the downregulation of ERK-mediated apoptotic pathways [62]. These results implied that FX greatly benefits the upcoming clinical trials and translational research because of its numerous cytoprotective activities. Many studies demonstrated that antioxidants can counteract the deleterious effects of chronic consumption or exposure to OTA and confirmed the potential effectiveness of dietary strategies with antioxidant properties, such as FX, to counteract OTA toxicity [48]. Meanwhile, our findings suggested an alternative or method against OTA toxicity by reducing ROS production, oxidative stress, inducing antioxidants, and activating the HO-1 and Nrf2 pathways using FX and FLX.\u003c/p\u003e \u003cp\u003eOur results indicate that FX significantly reduced oxidative stress by reversing OTA-induced apoptosis in the treated cells. FX and FLX downregulated apoptotic markers (caspase-3, caspase-8, caspase-9 proteins, and Bax/Bcl2 ratio of RNA transcript level) in OTA-treated HK-2 kidney cells. Apoptosis, or programmed cell death, is regulated by genes, where cells increase the synthesis of Bax (proapoptotic) in response to various apoptotic triggers, which inhibit Bcl-2 (antiapoptotic) and initiate the mitochondrial apoptosis pathway. This resulted in the release of cytochrome c into the cytoplasm by the mitochondria, activating caspase-3 and caspase-9 to cause programmed cell death. Our research showed that when cells were exposed to OTA-induced apoptosis, FX and its metabolite, FXL, induced Bcl-2 expression and lessened Bax expression, improving cell survival. Similar results demonstrated that FX and FXL could prevent tributyltin-induced apoptosis in the liver HepG2 cell line [63]. Additionally, it was shown that FX prevented the formation of apoptotic bodies in the monkey kidney fibroblast cell line (Vero) when H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was localized, suggesting that it may be able to protect cells against atomic fragmentation in the event of oxidative stress [64]. Moreover, a recent report that treatment with OTA induced spectacular apoptosis accompanied by a notable loss in MMP and fragmentation [65].\u003c/p\u003e \u003cp\u003eFascinatingly, the current investigation assessed the protective impact of FX and FXL against four underlying mechanisms: oxidative stress, apoptosis, mitochondrial disruption, and genotoxicity, which have been implicated in OTA-induced cytotoxicity in HK-2 cells. The data from the current study reported a significant protection against OTA-induced genotoxicity following each co-administration of FX and FXL, where a significant elevation in TD (% tail DNA content) after each FX and FXL co-treatment with OTA was dramatically reduced and restored to levels closer to the control. Our data suggested that FXL had a more significant impact than the parent carotenoid FX; the projected absorption by the cells with sufficient intracellular levels could explain that. This hypothesis is supported by earlier research that demonstrated that fatty acid esters of carotenoids underwent hydrolysis before human absorption [66]. The enzymes linked to hydrolysis may be lipase and carboxylesterase. A study found that when mice consumed FX, FXL but not FX appeared in their plasma and that FXL was released into the basolateral media in significantly higher amounts than FX in Caco-2 cells [67]. As a result, FXL is thought to be collected in the treated cells more efficiently than FX.\u003c/p\u003e \u003cp\u003eMolecular docking data showed that FX exhibited consistently superior or comparable binding affinities relative to OTA across the majority of targets, alongside strong interaction networks, especially with catalase and MCIII. FXL demonstrated positive interactions with mitochondrial complexes; however, it did not significantly interact with antioxidant enzymes such as catalase and SOD. The findings supposed that FX exhibits a broader and more potent interaction profile, potentially explaining its enhanced biological effects in reducing oxidative stress and mitochondrial dysfunction. However, these assumptions were not supported by the in-vitro assay outcomes. Despite the lower binding affinity indicating a diminished interaction with the target proteins, the biological efficacy, specifically antioxidant activity, does not consistently correlate with binding affinity [68]. This phenomenon can be elucidated through various covariables, as FXL may demonstrate antioxidant effects through non-specific scavenging of reactive oxygen species (ROS), independent of protein binding. It may also activate additional pathways or transcription factors that play a role in antioxidant defense. FXL serves as a significant metabolite of fucoxanthin. It may exhibit enhanced cellular uptake, stability, or bioavailability, improving intracellular antioxidant activity despite weaker direct protein binding. Furthermore, FXL may indirectly modulate signaling pathways, such as the Keap1-Nrf2 axis, resulting in the upregulation of antioxidant enzymes without necessitating high binding affinity. Thus, the observation suggests that binding affinity alone is not a definitive predictor of functional outcome. Although protein-ligand interactions are weaker, the antioxidant efficacy of fucoxanthinol may be attributed to improved pharmacodynamics, indirect stimulation of antioxidant responses, or increased cellular bioavailability. Functional assays, such as ROS scavenging, lipid peroxidation, and total antioxidant capacity, offer a more pertinent assessment of biological effects than molecular docking data alone.\u003c/p\u003e \u003cp\u003eThe current study investigated four different underlying mechanisms of cytotoxicity covering mitochondrial disruption, genotoxicity, oxidative stress, and apoptosis, which are summarized in a schematic graph shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003e. There is much overlap between the four studied mechanisms. Free radicals and oxidative stress are thought to be the main contributors to genotoxicity and DNA damage [69, 70]. Free radicals can harm many cellular components simultaneously, resulting in lipid peroxidation, which can cause DNA and mitochondria damage [71, 72]. Conversely, the primary sites of electron leakage, particularly in cases of inhibited MCI and MCIII by altered electron transport chain disruption, led to the formation of ROS, such as superoxide anions, which subsequently react with nitric oxide to produce highly reactive peroxynitrites, which was linked to oxidative damage and genotoxicity [44]. Furthermore, cytochrome c leaking to the cytoplasm and activation of apoptotic pathways caused apoptosis through mitochondrial disruption [45]. Furthermore, it was demonstrated that oxidative stress triggered the apoptotic pathways, a finding that served as the foundation for the oxidation therapy application in cancer [73]Protection against OTA-induced DNA damage, lipid peroxidation, and cytotoxicity was observed, further confirming the link between OTA toxicity and oxidative damage.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eStudy limitations\u003c/h2\u003e \u003cp\u003eThe present investigation assessed the HK-2 cell line's susceptibility to the toxicity generated by OTA. It is reversed by FX and FXL using several assays, corroborating the notion that FX and FXL are cytoprotective for human kidney cells. The study is limited because it was conducted in vitro, meaning that the interactions between the pathways may not be as typical as in an in vivo microenvironment. Second, not all paths were examined, which opens the ground for more evaluation in future research. Studying immortalized cell lines might go through several in vitro dedifferentiation cycles; this supports the need to use the original tissues and explore how they respond to toxins. However, the study was based on passage three of the cell and secondary cell lines to obtain adequate cells for the various assays with repeatable results. Human cells were also used instead of animal-separated primary cell lines to counteract the effects of interspecies differences on the assays and results.\u003c/p\u003e \u003cp\u003eAlthough the potential value of assessing combinatorial or synergistic effects is recognized, co-treatment studies were not conducted in this investigation, as simultaneous administration may not accurately represent the in vivo metabolic sequence. Future studies evaluating potential synergistic or additive interactions, utilizing methods such as isobologram or combination index analysis, may yield valuable insights, especially regarding exogenous FXL supplementation or metabolic modulation. Also, preclinical studies involving long-term animal exposure evaluate systemic toxicity, histopathological changes, and biochemical parameters. Moreover, dose-escalation studies and in vitro assays in non-renal cell lines could further clarify the safety window of these compounds.\u003c/p\u003e \u003cp\u003eIn addition, while the molecular docking inherently represents a theoretical prediction, it does not fully account for dynamic protein conformations or solvent effects. Hence, further experimental validation is recommended through biophysical methods such as surface plasmon resonance (SPR) or isothermal titration calorimetry (ITC). Also, molecular dynamics (MD) simulations are required to investigate the ligand-protein complexes' conformational stability and interaction dynamics in a more realistic biological context. However, the current study is not solely based on in silico data.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe current research clarifies the safeguarding protective impacts of FX and FXL in counteracting and mitigating the four fundamental pathways associated with OTA-induced cytotoxicity in HK-2 cells: oxidative stress, mitochondrial disruption, apoptosis, and genotoxicity. FX and FXL demonstrated significantly adequate levels of cytoprotection against the four investigated intracellular mechanisms of cytotoxicity. The data suggests a potential therapeutic role of FX and FXL in treating OTA-induced nephrotoxicity and other mechanisms associated with nephrotoxicity linked to the four cellular processes examined. This work provides possible insights and strategies to facilitate additional biochemical research for developing pharmacological assets and nutritional supplements combined with FX and its metabolites for the management of nephrotoxicity. Additional research employing in vivo models and searching for additional intracellular routes is advised to confirm the current findings. Also, further research is recommended to investigate the specific molecular mechanisms linking ROS to mitochondrial function and apoptosis pathways. Gene knockout or overexpression experiments could be conducted to study the roles of key genes (e.g., Nrf2, HO-1, Bax, Bcl-2) in OTA-induced nephrotoxicity.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors’ contribution\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEME\u003c/strong\u003e: conceptualization and experimental methodology; \u003cstrong\u003eHAA:\u003c/strong\u003e original draft preparation, \u003cstrong\u003eABA, SAA:\u003c/strong\u003e investigation and editing; \u003cstrong\u003eZMSM:\u003c/strong\u003e validation, software, and formal analysis; \u003cstrong\u003eNAE:\u003c/strong\u003e investigation and data interpretation; \u003cstrong\u003eGEE:\u003c/strong\u003e conceptualization and investigation; and \u003cstrong\u003eSMS\u003c/strong\u003e: data analysis, interpretation, and overall writing and editing. All authors have reviewed the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe deanship of Scientific Research at Northern Border University, Arar, KSA, funded this research work through the project number \"NBU-FFR-2025–2510-19.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics, Consent to Participate, and Consent to Publish Declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm they have no competing interests (no conflict of interest) that could influence the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm that all relevant data and materials are within the article and its supporting information files.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eEskola, M., et al., \u003cem\u003eTowards a dietary-exposome assessment of chemicals in food: An update on the chronic health risks for the European consumer.\u003c/em\u003e Critical Reviews in Food Science and Nutrition, 2020. \u003cstrong\u003e60\u003c/strong\u003e(11): p. 1890-1911.\u003c/li\u003e\n\u003cli\u003eChilaka, C.A., et al., \u003cem\u003eMycotoxin regulatory status in Africa: a decade of weak institutional efforts.\u003c/em\u003e Toxins, 2022. \u003cstrong\u003e14\u003c/strong\u003e(7): p. 442.\u003c/li\u003e\n\u003cli\u003eZhang, Q., et al., \u003cem\u003eFormation of Furan from Linoleic Acid Thermal Oxidation:(E, E)-2, 4-Decadienal as a Critical Intermediate Product.\u003c/em\u003e Journal of Agricultural and Food Chemistry, 2024. \u003cstrong\u003e72\u003c/strong\u003e(8): p. 4384-4392.\u003c/li\u003e\n\u003cli\u003eBanahene, J.C.M., et al., \u003cem\u003eOchratoxin A in food commodities: A review of occurrence, toxicity, and management strategies.\u003c/em\u003e Heliyon, 2024.\u003c/li\u003e\n\u003cli\u003eEchodu, R., et al., \u003cem\u003ePrevalence of aflatoxin, ochratoxin and deoxynivalenol in cereal grains in northern Uganda: Implication for food safety and health.\u003c/em\u003e Toxicology reports, 2019. \u003cstrong\u003e6\u003c/strong\u003e: p. 1012-1017.\u003c/li\u003e\n\u003cli\u003eul Hassan, S.W., et al., \u003cem\u003eUnusual pattern of aflatoxins and ochratoxin in commercially grown maize varieties of Pakistan.\u003c/em\u003e Toxicon, 2020. \u003cstrong\u003e182\u003c/strong\u003e: p. 66-71.\u003c/li\u003e\n\u003cli\u003eCosta da Silva, M., et al., \u003cem\u003eOchratoxin a levels in fermented specialty coffees from Capara\u0026oacute;, Brazil: Is it a cause of concern for coffee drinkers?\u003c/em\u003e Food Additives \u0026amp; Contaminants: Part A, 2021. \u003cstrong\u003e38\u003c/strong\u003e(11): p. 1948-1957.\u003c/li\u003e\n\u003cli\u003eStoev, S.D., \u003cem\u003eNew evidences about the carcinogenic effects of ochratoxin A and possible prevention by target feed additives.\u003c/em\u003e Toxins, 2022. \u003cstrong\u003e14\u003c/strong\u003e(6): p. 380.\u003c/li\u003e\n\u003cli\u003ePerugino, F., et al., \u003cem\u003eA mechanistic toxicology study to grasp the mechanics of zearalenone estrogenicity: Spotlighting aromatase and the effects of its genetic variability.\u003c/em\u003e Toxicology, 2024. \u003cstrong\u003e501\u003c/strong\u003e: p. 153686.\u003c/li\u003e\n\u003cli\u003eWięckowska, M., et al., \u003cem\u003eOchratoxin A\u0026mdash;the current knowledge concerning hepatotoxicity, mode of action and possible prevention.\u003c/em\u003e Molecules, 2023. \u003cstrong\u003e28\u003c/strong\u003e(18): p. 6617.\u003c/li\u003e\n\u003cli\u003eObafemi, B.A., I.A. Adedara, and J.B. Rocha, \u003cem\u003eNeurotoxicity of ochratoxin A: Molecular mechanisms and neurotherapeutic strategies.\u003c/em\u003e Toxicology, 2023: p. 153630.\u003c/li\u003e\n\u003cli\u003eDias, M.C., D.C. Pinto, and A.M. Silva, \u003cem\u003ePlant flavonoids: Chemical characteristics and biological activity.\u003c/em\u003e Molecules, 2021. \u003cstrong\u003e26\u003c/strong\u003e(17): p. 5377.\u003c/li\u003e\n\u003cli\u003eNoor, F., et al., \u003cem\u003eNetwork pharmacology approach for medicinal plants: review and assessment.\u003c/em\u003e Pharmaceuticals, 2022. \u003cstrong\u003e15\u003c/strong\u003e(5): p. 572.\u003c/li\u003e\n\u003cli\u003eKang, H.G., et al., \u003cem\u003eA review of natural products for prevention of acute kidney injury.\u003c/em\u003e Medicina, 2021. \u003cstrong\u003e57\u003c/strong\u003e(11): p. 1266.\u003c/li\u003e\n\u003cli\u003eChodari, L., et al., \u003cem\u003eTargeting mitochondrial biogenesis with polyphenol compounds.\u003c/em\u003e Oxidative Medicine and Cellular Longevity, 2021. \u003cstrong\u003e2021\u003c/strong\u003e(1): p. 4946711.\u003c/li\u003e\n\u003cli\u003eGuo, X., et al., \u003cem\u003eMito‐bomb: targeting mitochondria for cancer therapy.\u003c/em\u003e Advanced Materials, 2021. \u003cstrong\u003e33\u003c/strong\u003e(43): p. 2007778.\u003c/li\u003e\n\u003cli\u003eBae, M., et al., \u003cem\u003eHealth benefits of fucoxanthin in the prevention of chronic diseases.\u003c/em\u003e Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids, 2020. \u003cstrong\u003e1865\u003c/strong\u003e(11): p. 158618.\u003c/li\u003e\n\u003cli\u003eMao, H., et al., \u003cem\u003eFucoxanthin attenuates oxidative damage by activating the Sirt1/Nrf2/HO‐1 signaling pathway to protect the kidney from ischemia‐reperfusion injury.\u003c/em\u003e Oxidative Medicine and Cellular Longevity, 2022. \u003cstrong\u003e2022\u003c/strong\u003e(1): p. 7444430.\u003c/li\u003e\n\u003cli\u003eAsai, A., et al., \u003cem\u003eBiotransformation of fucoxanthinol into amarouciaxanthin A in mice and HepG2 cells: formation and cytotoxicity of fucoxanthin metabolites.\u003c/em\u003e Drug Metabolism and Disposition, 2004. \u003cstrong\u003e32\u003c/strong\u003e(2): p. 205-211.\u003c/li\u003e\n\u003cli\u003eHashimoto, T., et al., \u003cem\u003ePharmacokinetics of fucoxanthinol in human plasma after the oral administration of kombu extract.\u003c/em\u003e British Journal of Nutrition, 2012. \u003cstrong\u003e107\u003c/strong\u003e(11): p. 1566-1569.\u003c/li\u003e\n\u003cli\u003eLiu, S., et al., \u003cem\u003eArsenic Exposure-Induced Acute Kidney Injury by Regulating SIRT1/PINK1/Mitophagy Axis in Mice and in HK-2 Cells.\u003c/em\u003e Journal of Agricultural and Food Chemistry, 2023. \u003cstrong\u003e71\u003c/strong\u003e(42): p. 15809-15820.\u003c/li\u003e\n\u003cli\u003eDe Boeck, M., D. Lison, and M. Kirsch-Volders, \u003cem\u003eEvaluation of the in vitro direct and indirect genotoxic effects of cobalt compounds using the alkaline comet assay. Influence of interdonor and interexperimental variability.\u003c/em\u003e Carcinogenesis, 1998. \u003cstrong\u003e19\u003c/strong\u003e(11): p. 2021-2029.\u003c/li\u003e\n\u003cli\u003eSpinazzi, M., et al., \u003cem\u003eAssessment of mitochondrial respiratory chain enzymatic activities on tissues and cultured cells.\u003c/em\u003e Nature protocols, 2012. \u003cstrong\u003e7\u003c/strong\u003e(6): p. 1235-1246.\u003c/li\u003e\n\u003cli\u003eElmorsy, E., et al., \u003cem\u003eAdverse effects of antipsychotics on micro-vascular endothelial cells of the human blood\u0026ndash;brain barrier.\u003c/em\u003e Brain research, 2014. \u003cstrong\u003e1583\u003c/strong\u003e: p. 255-268.\u003c/li\u003e\n\u003cli\u003eSingh, R., et al., \u003cem\u003eComparative study of catalase-peroxidases (KatGs).\u003c/em\u003e Archives of biochemistry and biophysics, 2008. \u003cstrong\u003e471\u003c/strong\u003e(2): p. 207-214.\u003c/li\u003e\n\u003cli\u003eFuchs, R. and M. Peraica, \u003cem\u003eOchratoxin A in human kidney diseases.\u003c/em\u003e Food additives and contaminants, 2005. \u003cstrong\u003e22\u003c/strong\u003e(s1): p. 53-57.\u003c/li\u003e\n\u003cli\u003eGagliano, N., et al., \u003cem\u003eEarly cytotoxic effects of ochratoxin A in rat liver: A morphological, biochemical and molecular study.\u003c/em\u003e Toxicology, 2006. \u003cstrong\u003e225\u003c/strong\u003e(2-3): p. 214-224.\u003c/li\u003e\n\u003cli\u003ePatil, R.D., P. Dwivedi, and A.K. Sharma, \u003cem\u003eCritical period and minimum single oral dose of ochratoxin A for inducing developmental toxicity in pregnant Wistar rats.\u003c/em\u003e Reproductive Toxicology, 2006. \u003cstrong\u003e22\u003c/strong\u003e(4): p. 679-687.\u003c/li\u003e\n\u003cli\u003eSheu, M.-L., et al., \u003cem\u003eActivation of PI3K in response to high glucose leads to regulation of SOCS-3 and STAT1/3 signals and induction of glomerular mesangial extracellular matrix formation.\u003c/em\u003e Oncotarget, 2017. \u003cstrong\u003e8\u003c/strong\u003e(10): p. 16925.\u003c/li\u003e\n\u003cli\u003eKhoi, C.-S., et al., \u003cem\u003eOchratoxin A-induced nephrotoxicity: Up-to-date evidence.\u003c/em\u003e International journal of molecular sciences, 2021. \u003cstrong\u003e22\u003c/strong\u003e(20): p. 11237.\u003c/li\u003e\n\u003cli\u003ePfohl‐Leszkowicz, A., et al., \u003cem\u003eNew molecular and field evidences for the implication of mycotoxins but not aristolochic acid in human nephropathy and urinary tract tumor.\u003c/em\u003e Molecular nutrition \u0026amp; food research, 2007. \u003cstrong\u003e51\u003c/strong\u003e(9): p. 1131-1146.\u003c/li\u003e\n\u003cli\u003eWafa, E., et al., \u003cem\u003eHuman ochratoxicosis and nephropathy in Egypt: a preliminary study.\u003c/em\u003e Human \u0026amp; experimental toxicology, 1998. \u003cstrong\u003e17\u003c/strong\u003e(2): p. 124-129.\u003c/li\u003e\n\u003cli\u003eMumu, M., et al., \u003cem\u003eFucoxanthin: A promising phytochemical on diverse pharmacological targets.\u003c/em\u003e Frontiers in Pharmacology, 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 929442.\u003c/li\u003e\n\u003cli\u003eFazekas, B., A. Tar, and M. Kov\u0026aacute;cs, \u003cem\u003eOchratoxin A content of urine samples of healthy humans in Hungary.\u003c/em\u003e Acta Veterinaria Hungarica, 2005. \u003cstrong\u003e53\u003c/strong\u003e(1): p. 35-44.\u003c/li\u003e\n\u003cli\u003eChen, Y., et al., \u003cem\u003eDietary protective potential of fucoxanthin as an active food component on neurological disorders.\u003c/em\u003e Journal of Agricultural and Food Chemistry, 2023. \u003cstrong\u003e71\u003c/strong\u003e(8): p. 3599-3619.\u003c/li\u003e\n\u003cli\u003eArbillaga, L., et al., \u003cem\u003eOxidative DNA damage induced by ochratoxin A in the HK-2 human kidney cell line: evidence of the relationship with cytotoxicity.\u003c/em\u003e Mutagenesis, 2007. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 35-42.\u003c/li\u003e\n\u003cli\u003eKamp, H.G., et al., \u003cem\u003eOchratoxin A: induction of (oxidative) DNA damage, cytotoxicity and apoptosis in mammalian cell lines and primary cells.\u003c/em\u003e Toxicology, 2005. \u003cstrong\u003e206\u003c/strong\u003e(3): p. 413-425.\u003c/li\u003e\n\u003cli\u003eLee, H.J., H.D. Kim, and D. Ryu, \u003cem\u003eProtective Effect of alpha-Tocopherol Against Ochratoxin A in Kidney Cell Line HK-2.\u003c/em\u003e Journal of Food Protection, 2023. \u003cstrong\u003e86\u003c/strong\u003e(5): p. 100082.\u003c/li\u003e\n\u003cli\u003eAlam, M.S., G. Kaur, and R. Zalpouri, \u003cem\u003eCurrent Trends and Techniques in the Nutraceutical Industry\u003c/em\u003e, in \u003cem\u003eFruits and Their Roles in Nutraceuticals and Functional Foods\u003c/em\u003e. 2023, CRC Press. p. 29-68.\u003c/li\u003e\n\u003cli\u003eWalsh, K.D. and T.A. Kato, \u003cem\u003eAlkaline comet assay to detect DNA damage\u003c/em\u003e, in \u003cem\u003eChromosome Analysis: Methods and Protocols\u003c/em\u003e. 2022, Springer. p. 65-72.\u003c/li\u003e\n\u003cli\u003eBhatti, G.K., et al., \u003cem\u003eTargeting mitochondrial bioenergetics as a promising therapeutic strategy in metabolic and neurodegenerative diseases.\u003c/em\u003e biomedical journal, 2022. \u003cstrong\u003e45\u003c/strong\u003e(5): p. 733-748.\u003c/li\u003e\n\u003cli\u003eLi, Y., et al., \u003cem\u003eFucoxanthin metabolites exert anti-fibrogenic and antioxidant effects in hepatic stellate cells.\u003c/em\u003e Journal of Agriculture and Food Research, 2021. \u003cstrong\u003e6\u003c/strong\u003e: p. 100245.\u003c/li\u003e\n\u003cli\u003eWang, S., et al., \u003cem\u003eThe mitophagy pathway and its implications in human diseases.\u003c/em\u003e Signal transduction and targeted therapy, 2023. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 304.\u003c/li\u003e\n\u003cli\u003eLiu, S.-X., et al., \u003cem\u003eMitochondrial damage mediates genotoxicity of arsenic in mammalian cells.\u003c/em\u003e Cancer research, 2005. \u003cstrong\u003e65\u003c/strong\u003e(8): p. 3236-3242.\u003c/li\u003e\n\u003cli\u003eKalpage, H.A., et al., \u003cem\u003eCytochrome c phosphorylation: Control of mitochondrial electron transport chain flux and apoptosis.\u003c/em\u003e The international journal of biochemistry \u0026amp; cell biology, 2020. \u003cstrong\u003e121\u003c/strong\u003e: p. 105704.\u003c/li\u003e\n\u003cli\u003eIp, W.K.E., et al., \u003cem\u003eAnti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages.\u003c/em\u003e Science, 2017. \u003cstrong\u003e356\u003c/strong\u003e(6337): p. 513-519.\u003c/li\u003e\n\u003cli\u003eOzcan, Z., G. Gul, and I. Yaman, \u003cem\u003eOchratoxin A activates opposing c-MET/PI3K/Akt and MAPK/ERK 1-2 pathways in human proximal tubule HK-2 cells.\u003c/em\u003e Arch Toxicol, 2015. \u003cstrong\u003e89\u003c/strong\u003e(8): p. 1313-27.\u003c/li\u003e\n\u003cli\u003eSorrenti, V., et al., \u003cem\u003eToxicity of ochratoxin A and its modulation by antioxidants: A review.\u003c/em\u003e Toxins, 2013. \u003cstrong\u003e5\u003c/strong\u003e(10): p. 1742-1766.\u003c/li\u003e\n\u003cli\u003eMeki, A.-R.M. and A.A. Hussein, \u003cem\u003eMelatonin reduces oxidative stress induced by ochratoxin A in rat liver and kidney.\u003c/em\u003e Comparative Biochemistry and Physiology Part C: Toxicology \u0026amp; Pharmacology, 2001. \u003cstrong\u003e130\u003c/strong\u003e(3): p. 305-313.\u003c/li\u003e\n\u003cli\u003eSchaaf, G., et al., \u003cem\u003eThe role of oxidative stress in the ochratoxin A-mediated toxicity in proximal tubular cells.\u003c/em\u003e Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 2002. \u003cstrong\u003e1588\u003c/strong\u003e(2): p. 149-158.\u003c/li\u003e\n\u003cli\u003eLiang, R., et al., \u003cem\u003eApoptosis signal-regulating kinase 1 promotes Ochratoxin A-induced renal cytotoxicity.\u003c/em\u003e Scientific reports, 2015. \u003cstrong\u003e5\u003c/strong\u003e(1): p. 8078.\u003c/li\u003e\n\u003cli\u003eLee, H.J., et al., \u003cem\u003eRenal toxicity through AhR, PXR, and Nrf2 signaling pathway activation of ochratoxin A-induced oxidative stress in kidney cells.\u003c/em\u003e Food and Chemical Toxicology, 2018. \u003cstrong\u003e122\u003c/strong\u003e: p. 59-68.\u003c/li\u003e\n\u003cli\u003eFerdous, K.A., et al., \u003cem\u003eNeuroprotective Function of Fucoxanthin in Oxidative Stress-Mediated Mitochondrial Dysfunction.\u003c/em\u003e Current Developments in Nutrition, 2022. \u003cstrong\u003e6\u003c/strong\u003e: p. 787.\u003c/li\u003e\n\u003cli\u003eYang, S., et al., \u003cem\u003eMolecular Mechanisms of Fucoxanthin in Alleviating Lipid Deposition in Metabolic Associated Fatty Liver Disease.\u003c/em\u003e Journal of Agricultural and Food Chemistry, 2024. \u003cstrong\u003e72\u003c/strong\u003e(18): p. 10391-10405.\u003c/li\u003e\n\u003cli\u003eKoduvayur Habeebullah, S.F., A. Surendraraj, and C. Jacobsen, \u003cem\u003eIsolation of fucoxanthin from brown algae and its antioxidant activity: in vitro and 5% fish oil‐in‐water emulsion.\u003c/em\u003e Journal of the American Oil Chemists\u0026apos; Society, 2018. \u003cstrong\u003e95\u003c/strong\u003e(7): p. 835-843.\u003c/li\u003e\n\u003cli\u003eMousavi Nadushan, R. and I. Hosseinzade, \u003cem\u003eOptimization of production and antioxidant activity of fucoxanthin from marine haptophyte algae, Isochrysis galbana.\u003c/em\u003e Iranian Journal of Fisheries Sciences, 2020. \u003cstrong\u003e19\u003c/strong\u003e(6): p. 2901-2908.\u003c/li\u003e\n\u003cli\u003eNeumann, U., et al., \u003cem\u003eFucoxanthin, a carotenoid derived from Phaeodactylum tricornutum exerts antiproliferative and antioxidant activities in vitro.\u003c/em\u003e Antioxidants, 2019. \u003cstrong\u003e8\u003c/strong\u003e(6): p. 183.\u003c/li\u003e\n\u003cli\u003eYang, X., et al., \u003cem\u003eAssessment of the therapeutic effects of fucoxanthin by attenuating inflammation in ovalbumin-induced asthma in an experimental animal model.\u003c/em\u003e Journal of Environmental Pathology, Toxicology and Oncology, 2019. \u003cstrong\u003e38\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eZheng, J., et al., \u003cem\u003eProtective effects of fucoxanthin against alcoholic liver injury by activation of Nrf2-mediated antioxidant defense and inhibition of TLR4-mediated inflammation.\u003c/em\u003e Marine drugs, 2019. \u003cstrong\u003e17\u003c/strong\u003e(10): p. 552.\u003c/li\u003e\n\u003cli\u003eChiang, Y.-F., et al., \u003cem\u003eProtective effects of fucoxanthin on high glucose-and 4-hydroxynonenal (4-HNE)-induced injury in human retinal pigment epithelial cells.\u003c/em\u003e Antioxidants, 2020. \u003cstrong\u003e9\u003c/strong\u003e(12): p. 1176.\u003c/li\u003e\n\u003cli\u003eTavares, R.S.N., et al., \u003cem\u003eFucoxanthin for topical administration, a phototoxic vs. photoprotective potential in a tiered strategy assessed by in vitro methods.\u003c/em\u003e Antioxidants, 2020. \u003cstrong\u003e9\u003c/strong\u003e(4): p. 328.\u003c/li\u003e\n\u003cli\u003eYang, H., et al., \u003cem\u003eRole of Fucoxanthin towards Cadmium-induced renal impairment with the antioxidant and anti-lipid peroxide activities.\u003c/em\u003e Bioengineered, 2021. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 7235-7247.\u003c/li\u003e\n\u003cli\u003eZeng, J., et al., \u003cem\u003eProtective effects of fucoxanthin and fucoxanthinol against tributyltin-induced oxidative stress in HepG2 cells.\u003c/em\u003e Environmental Science and Pollution Research, 2018. \u003cstrong\u003e25\u003c/strong\u003e: p. 5582-5589.\u003c/li\u003e\n\u003cli\u003eHeo, S.-J., et al., \u003cem\u003eCytoprotective effect of fucoxanthin isolated from brown algae Sargassum siliquastrum against H 2 O 2-induced cell damage.\u003c/em\u003e European food research and technology, 2008. \u003cstrong\u003e228\u003c/strong\u003e: p. 145-151.\u003c/li\u003e\n\u003cli\u003eFu, M., Y. Chen, and A. Yang, \u003cem\u003eOchratoxin A induces mitochondrial dysfunction, oxidative stress, and apoptosis of retinal ganglion cells (RGCs), leading to retinal damage in mice.\u003c/em\u003e International Ophthalmology, 2024. \u003cstrong\u003e44\u003c/strong\u003e(1): p. 72.\u003c/li\u003e\n\u003cli\u003eKhachik, F., et al., \u003cem\u003eSeparation and identification of carotenoids and their oxidation products in the extracts of human plasma.\u003c/em\u003e Analytical Chemistry, 1992. \u003cstrong\u003e64\u003c/strong\u003e(18): p. 2111-2122.\u003c/li\u003e\n\u003cli\u003eSugawara, T., et al., \u003cem\u003eBrown algae fucoxanthin is hydrolyzed to fucoxanthinol during absorption by Caco-2 human intestinal cells and mice.\u003c/em\u003e The Journal of nutrition, 2002. \u003cstrong\u003e132\u003c/strong\u003e(5): p. 946-951.\u003c/li\u003e\n\u003cli\u003ePaggi, J.M., A. Pandit, and R.O. Dror, \u003cem\u003eThe art and science of molecular docking.\u003c/em\u003e Annual Review of Biochemistry, 2024. \u003cstrong\u003e93\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eCosta, M., et al., \u003cem\u003eThe role of oxidative stress in nickel and chromate genotoxicity.\u003c/em\u003e Oxygen/Nitrogen Radicals: Cell Injury and Disease, 2002: p. 265-275.\u003c/li\u003e\n\u003cli\u003eHei, T.K. and M. Filipic, \u003cem\u003eRole of oxidative damage in the genotoxicity of arsenic.\u003c/em\u003e Free Radical Biology and Medicine, 2004. \u003cstrong\u003e37\u003c/strong\u003e(5): p. 574-581.\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-S\u0026aacute;nchez, A., A.G. Miranda-D\u0026iacute;az, and E.G. Cardona-Mu\u0026ntilde;oz, \u003cem\u003eThe role of oxidative stress in physiopathology and pharmacological treatment with pro‐and antioxidant properties in chronic diseases.\u003c/em\u003e Oxidative Medicine and Cellular Longevity, 2020. \u003cstrong\u003e2020\u003c/strong\u003e(1): p. 2082145.\u003c/li\u003e\n\u003cli\u003eTeleanu, D.M., et al., \u003cem\u003eAn overview of oxidative stress, neuroinflammation, and neurodegenerative diseases.\u003c/em\u003e International journal of molecular sciences, 2022. \u003cstrong\u003e23\u003c/strong\u003e(11): p. 5938.\u003c/li\u003e\n\u003cli\u003eHanikoglu, A., et al., \u003cem\u003eHybrid compounds \u0026amp; oxidative stress induced apoptosis in cancer therapy.\u003c/em\u003e Current medicinal chemistry, 2020. \u003cstrong\u003e27\u003c/strong\u003e(13): p. 2118-2132.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-nephrology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bnep","sideBox":"Learn more about [BMC Nephrology](http://bmcnephrol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bnep/default.aspx","title":"BMC Nephrology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Fucoxanthin, Fucoxanthinol, Ochratoxin A, Nephrotoxicity, Oxidative stress, Mitochondria, Cellular bioenergetics","lastPublishedDoi":"10.21203/rs.3.rs-6077785/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6077785/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eOchratoxin A (OTA) is a mycotoxin with reported multiorgan toxicity, especially kidney toxicity. Fucoxanthin (FX) and its hydrolyzed metabolite Fucoxanthinol (FXL) have reno-protective antioxidant and anti-inflammatory properties. This study evaluates the nephroprotective effects of FX and FLX on OTA-induced renal cytotoxicity using the HK-2 cell line.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eMolecular docking was used to study the binding affinities with the main proteins of the studied pathways. Various in-vitro assays were used to test the hypothesis, including MTT, mitochondrial bioenergetics, oxidative stress, and apoptosis biomarkers.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eDocking revealed binding affinities of the tested chemicals with mitochondria, oxidative stress, and apoptosis. Data showed that OTA has a dose-dependent cytotoxic effect on HK-2 cells. Notably, FX and FXL improved cell viability. A significant deregulation of normal cellular pathways including genotoxicity (DNA damage percentage), mitochondrial bioenergetics disruption (PDH, α-KG, MCI and MCIII complexes activities, ATP levels and mitochondrial membrane potential), downregulation of some mitochondrial genes (ND1, ND5, CO-1 and ATP6/8) expression, mitophagy inhibition (PARK1 and parkin), Oxidative stress induction (ROS and TBARS), oxidative stress genes downregulation (HO-1 and Nrf2), antioxidant enzymatic activity reduction (ROS and CAT), and apoptotic mediator markers elevation ( Caspases- 3, 8 and 9, and Bax/Bcl-2 ratio) were observed in OTA mono-treated cells compared to untreated control cells. All parameters were markedly normalized by combining FX or FLX with OTA, providing more protection in FXL co-treated samples.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur results suggest that FX and FXL may be effective novel therapies for treating OTA-induced nephrotoxicity in vitro.\u003c/p\u003e","manuscriptTitle":"Through its genoprotective, mitochondrial bioenergetic modulation, and antioxidant effects, Fucoxanthin and its metabolite minimize Ochratoxin A-induced nephrotoxicity in HK-2 human kidney cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-22 07:11:43","doi":"10.21203/rs.3.rs-6077785/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-23T18:06:31+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-22T14:11:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"299821217914645080132724915812268011754","date":"2025-05-21T22:41:51+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-17T03:26:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"2481129044536938953066685231612215443","date":"2025-04-21T21:11:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-21T15:09:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-17T09:16:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Nephrology","date":"2025-04-10T06:24:12+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-nephrology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bnep","sideBox":"Learn more about [BMC Nephrology](http://bmcnephrol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bnep/default.aspx","title":"BMC Nephrology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6951740a-1a0f-4d3c-9c2e-7863e9f03bd3","owner":[],"postedDate":"April 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-07-14T16:02:20+00:00","versionOfRecord":{"articleIdentity":"rs-6077785","link":"https://doi.org/10.1186/s12882-025-04276-z","journal":{"identity":"bmc-nephrology","isVorOnly":false,"title":"BMC Nephrology"},"publishedOn":"2025-07-12 15:57:38","publishedOnDateReadable":"July 12th, 2025"},"versionCreatedAt":"2025-04-22 07:11:43","video":"","vorDoi":"10.1186/s12882-025-04276-z","vorDoiUrl":"https://doi.org/10.1186/s12882-025-04276-z","workflowStages":[]},"version":"v1","identity":"rs-6077785","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6077785","identity":"rs-6077785","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.