Analysis of core promoter and transcription factors screening of porcine DHRS3 gene

Analysis of core promoter and transcription factors screening of porcine DHRS3 gene | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Analysis of core promoter and transcription factors screening of porcine DHRS3 gene Jifeng Li, Yong Ruan, Chuanmei Jiang, Bo Zhou, Houqiang Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5175349/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Dehydrogenase/Reductase (SDR) Family Member 3 ( DHRS3 , also known as Rsdr1 and retSDR1) is a membrane-bound enzyme with critical roles in embryonic development and animal growth. Studying the porcine DHRS3 gene promoter can provide a foundation for understanding growth, development, and reproduction in pigs. In this study, we first analyzed the promoter region structure of the porcine DHRS3 gene and constructed five promoter region dual-luciferase reporter vectors with sequential deletion fragments. Through dual-luciferase assays, all five truncated promoter reporter constructs exhibited transcriptional activity, with the core promoter region localized between +210 bp and -842 bp. Bioinformatics analysis then predicted key transcription factors in this region. Combining site-directed mutagenesis and RNA interference experiments, we demonstrated that mutation or knockdown of CDX1, MYOD, and MYOG transcription factor binding sites significantly increased transcriptional activity compared to wild-type controls, whereas USF2 site mutation or knockdown resulted in significantly decreased activity ( P< 0.05). These results suggest that CDX1, MYOD, and MYOG negatively regulate the porcine DHRS3 gene, while USF2 acts as a positive regulator. These findings suggest the potential for further genetic and breeding applications aimed at modulating the DHRS3 gene expression in pigs. Biological sciences/Genetics/Gene regulation Biological sciences/Molecular biology/Transcription Biological sciences/Cell biology Biological sciences/Genetics Porcine DHRS3 Promoter Transcription factor Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Dehydrogenase/Reductase (SDR) Family Member 3 ( DHRS3 ), also referred to as Rsdr1 and retSDR1, is a highly conserved member of the SDR16C family within the short-chain dehydrogenase/reductase superfamily. It plays a crucial role in the metabolism of retinol (vitamin A) 1 , 2 . Vitamin A is predominantly stored in hepatocytes and adipocytes, with the liver accounting for over 70% of the body's total vitamin A in most vitamin A-sufficient animals 3 – 5 . Vitamin A and its metabolites regulate gene expression, thereby influencing cell proliferation, differentiation, and immune function. These processes are vital for growth, development, and reproductive regulation in animals 6 , 7 . Since mammals cannot synthesize vitamin A, it must be obtained through the diet. Vitamin A deficiency impairs growth and development and reduces fertility in male animals 8 – 10 . DHRS3 plays a pivotal role in regulating the biosynthesis of retinoic acid, a vital molecule for normal embryonic development. DHRS3 deficiency can prevent excessive retinoic acid accumulation during embryogenesis, significantly disrupting normal development 11 – 13 . Molecular and biochemical studies have demonstrated the expression of DHRS3 in the liver, testes, and small intestine of humans, as confirmed by q-PCR and Western blot analyses 14 . Vitamin A is primarily converted into retinol and retinoic acid for storage and biological function. During muscle development, DHRS3 mainly converts VA1 to retinaldehyde (RAL), which is further converted into retinoic acid (RA). As a new regulator of C2C12 myoblast differentiation, DHRS3 also participates in the regeneration of mouse skeletal muscle injury injuries. DHRS3 is recognized as a novel regulatory factor for myoblast differentiation and also contributes to skeletal muscle regeneration in mice following injury 15 . In lipid formation studies, a new mechanism of lipid droplet formation in fish cells has been proposed, with DHRS3 a identified as a key protein involved in lipid droplet growth at an early stage. HIF1α, a primary transcription factor, regulates DHRS3 a, and the HIF1α/ DHRS3 a pathway contributes to lipid droplet accumulation in fish liver cells via retinol and Ppar-γ 16 . Additionally, research has explored the role of DHRS3 in inflammation and neurodevelopment. DHRS3 mRNA is abundantly expressed in the liver of adult rats, and reduced expression of DHRS3 during inflammation may impact vitamin A metabolism in the liver 17 . In Xenopus laevis, DHRS3 has been shown to be expressed at multiple stages of embryonic and neurodevelopment 18 . The DHRS3 gene encodes a protein that regulates various biological processes through the modulation of gene expression. Recent studies have shown that DHRS3 is involved in embryonic development, lipid droplet accumulation, cell differentiation, and skeletal muscle regeneration 19 . However, transcriptional regulation of DHRS3 and its roles in livestock and poultry have been rarely reported, and the functions and underlying mechanisms of the porcine DHRS3 gene remain unclear. This study aims to explore the structure and regulatory mechanisms of the DHRS3 gene by identifying its core promoter region and predicting key transcription factors, thereby providing a theoretical foundation for further investigations into the role of DHRS3 in pig growth, development, and reproduction. This study constructed recombinant vectors containing deletion fragments of varying lengths from the promoter region and identified the core transcription start site using a dual-luciferase reporter assay. Bioinformatics analysis was performed to predict potential transcription factor binding sites within the core promoter region, and site-directed mutagenesis was employed to validate the key transcription factors for the DHRS3 gene. The findings offer valuable insights for further investigation into the function of the DHRS3 gene and provide a foundation for exploring its transcriptional regulatory mechanisms in pigs. 2. Material and methods 2.1 Ethical statement The animal study was approved by the Animal Welfare Committee of Guizhou University (EAE-GZU-2023-E053). The study was conducted in accordance with the local legislation and in-stitutional requirements. 2.2 Bioinformatics analysis of promoter The NCBI and Ensembl website was searched for approximately 2000 bp sequence information before the transcription start site and nearly 1000 bp sequence information after the transcription start site of the porcine DHRS3 gene (NC_010448.4). The core promoter region was predicted and analyzed by biological analysis Promoter. 2.0 (https://services. healthtech.dtu.dk/services/ Promoter-2.0/), Promoter Scan (https: //www-bimas.cit.nih.gov/molbio/proscan/), FPROM (https://www.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), BDGP (https://www.fruitfly.org/seq_ tools/promoter.html), Plant CARE (https://bioinformatics. psb.ugent.be/webtools/plantcare/html/) and other software for gene promoter analysis; CpG islands that the target gene might contain were analyzed with CpG Finder (http://www.softberry. com/berry.phtml?topic=cpgfinder&group=programs &subgroup=promoter) and MethPrime (https://www.urogene.org/cgi-bin/methprimer /methprimer.cgi), PROMO HOME PAGE (https://alggen.lsi.upc.es/cgi-bin/promo_v3/ promo/promoinit.cgi?dirDB=TF_8.3) and JASPAR (https:// jaspar.genereg.net/) were used to predictive analysis of promoter transcription factors and binding sites. 2.3 Deletion plasmids construction Using the pig DHRS3 gene sequence (NCBI accession number: NC_010448.4), a 2000 bp upstream region and a 1000 bp downstream region of the transcription start site were selected as the promoter region. This promoter region was analyzed using online prediction software. Based on the predictions, five pairs of primers with varying lengths were designed by fixing the 3' end and shortening the 5' end of the promoter sequence. KpnI and XhoI restriction sites were introduced at the upstream and downstream ends of the truncated fragments, respectively. The primers were synthesized by Chongqing Qingke Biotechnology Co., Ltd. (Chongqing, China). The pGL4.10-Basic vector and the amplified products were digested with KpnI and XhoI, and the resulting fragments were ligated using T4 DNA ligase. The ligated products were then transformed into DH5α competent cells. After 12 hours, positive clones were selected, expanded, and sent to Chongqing Qingke Biotechnology Co., Ltd. for sequencing to confirm the quality of the recombinant plasmids. The recombinant plasmids were designated as P1-107(210~103), P2-230(210~-20), P3-820(210~-610), P4-1052(210~-842), and P5-1460(210~-1250). Table 1. Primer information in this study Primer name Sequence (5′-3′) Tm /°C Length /bp Region P1-F GGTACC CGGGAGCGAATGGATAAGGCGCCGGA 60 107 +103/+210 P2-F GGTACC GAGCCCGCGGCAGCCACTCACAGGAACG 60 230 -20/+210 P3-F GGTACC GTAATTCTAGCCCAGATGAGCAATAAAT 60 820 -610/+210 P4-F GGTACC CCAGACTTCCTGCAACAGACAACTCTAAAT 60 1052 -842/+210 P5-F GGTACC GGTCCAGATAACGATTTTCCCAATTCAC 60 1460 -1250/+210 P1~5-R CTCGAG CATTTATTGCCTTCTTTTTGTCCTTTCCAA - - - p DHRS3 -CDX1 F:GCCCAGATGAGC TTATT ATACGCTCCCAG - 1052 -589/-584 R:CTGGGAGCGTAT AATAA GCTCATCTGGGC - p DHRS3 -MYOD F:CCTACTCCCCAG GACGA CCCCCCCACCCC - 1052 -483/-478 R:GGGGTGGGGGGG TCGTC CTGGGGAGTAGG - p DHRS3 -MYOG F:AACCCTACTCCC GTCGA GCTCCCCCCCAC - 1052 -480/-475 R:GTGGGGGGGAGC TCGAC GGGAGTAGGGTT - p DHRS3 -USF2 F:CGCAGAGGGGGT GTGGA GGCCTGCGGGCG - 1052 -263/-257 R:CGCCCGCAGGCC TCCAC ACCCCCTCTGCG - CDX1-RT F:GGGCTATGTGCTGGACAAGGAT 58 138 - R:ACGTGCAAGTAGCCGGTGAAGT - MYOD-RT F:GCAAACGCAAGACCACTAACGC 60 126 - R:GCTGATTCGGGTTGCTAGACGT - MYOG-RT F:TGCCCAGTGAATGCAGTTCC 60 164 - R:ATCCTCCACTGTGATGCTGTCC - USF2-RT F:AGATAATAGCAAGACGGGAGCGA 62 183 - R:AGCACGGCATTCTCGTTCTTC - GAPDH-RT F:TTTGTGATGGGCGTGAACC 60 171 - R:AGTCTTCTGGGTGGCAGTGAT - si-CDX1 F:ACGCAGUGUGGCGGCUGGATT - - - R:UCCAGCCGCCACACUGCGUTT - - - si-MYOD F:CAACAGCGGACGACUUCUATT - - - R:UAGAAGUCGUCCGCUGUUGTT - - - si-MYOG F:GCAGGCUCAAGAAGGUGAATT - - - R:UUCACCUUCUUGAGCCUGCTT - - - si-USF2 F:GAUUGUAACGCAGAUAAUATT - - - R:UAUUAUCUGCGUUACAAUCTT - - - F, forward; R, reverse; The underline is the restriction site, the bold text indicates the mutation sites of transcription factor binding sites. 2.4 Cell Isolation and Culture Porcine myoblasts were isolated from the longissimus dorsi muscle of 3-day-old piglets using methods described by Zhang et al. (2018) 20 and Yang et al. (2014) 21 . The isolated longissimus dorsi muscle was washed once with 75% ethanol solution and three times with PBS. After removing connective tissues, the minced tissues were digested with 1 mg/ml collagenase type II at 37℃ for 90 min. Digestion was terminated by adding growth medium (DMEM/F12 (gibco, USA), 15% fetal bovine serum (gibco, USA), and 1% antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin) (gibco, USA)). The digested products were filtered through 70-μm and 40-μm cell strainers. The filtrate was centrifuged at 1500 × g for 10 min, and the resulting pellet was resuspended in growth medium. Cells were purified using the differential adhesion method. Previously cryopreserved HK293T cells were thawed and cultured in high-glucose DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37℃ in a humidified incubator with 5% CO₂. When cells reached 90% confluence, they were detached with 0.25% trypsin and neutralized with complete medium. Cells were passaged into 24-well plates and transfected when the density reached 70%-90%. 2.5 Cell Transfection and Firefly Luciferase Reporter Assay The experiment was conducted using Lipofectamine 3000 transfection reagent. The recombinant plasmids with promoter deletion fragments and pGL - 4.10 (a luciferase reporter plasmid) were co - transfected with pRL - TK (a Renilla luciferase control plasmid) into HK293T cells at a ratio of 10:1. Three replicates were set for each group, and the cells were collected 48 hours later. The firefly luciferase reporter gene assay was performed according to the manufacturer's instructions of the Dualucif@Firefly & Renilla Assay Kit (Uelandy, China) at room temperature. For each well, 100 μL of the sample was taken and placed in an opaque 96 - well plate. Then, 100 μL of firefly luciferase working solution was added, and the relative light unit (RLU) value was detected. Subsequently, 100 μL of Renilla luciferase working solution was added, and the RLU value was measured again. The ratio of the firefly luciferase intensity to the Renilla luciferase intensity was calculated as the relative luciferase activity (RLA). 2.6 Transcription Factor Binding Site Mutagenesis and RNA Interference in the DHRS3 Gene Promoter Based on bioinformatics analysis and dual-luciferase activity assay results, site-directed mutagenesis was performed on CDX1, MYOD, MYOG, and USF2 transcription factor binding sites. Mutated fragments were synthesized by Servier Biotech Co., Ltd. (Wuhan, China), with primer details listed in Table 1. The mutated vectors were named p DHRS3 -WT, p DHRS3 -CDX1, p DHRS3 -MYOD, p DHRS3 -MYOG, and p DHRS3 -USF2. After amplification, the products were digested with KpnI and XhoI enzymes and ligated into similarly digested pGL4.10-basic vectors. The constructs were transformed into DH5α cells, and positive plasmids with mutated fragments were selected and sent to Wuhan Servier Biotech Co., Ltd. for sequencing verification. siRNAs used in this study were designed and synthesized by GEMA Ltd. (Shanghai, China), with primer sequences provided in Table 1. Mutation of transcription factor binding sites in the DHRS3 Gene Promoter. 2.7 Extraction of Total Cellular RNA, Synthesis of cDNA, and qRT - PCR Cells after transfection treatment were collected. Total RNA was extracted using the TRIzol kit (Thermo Fisher Scientific, USA). For the reverse - transcription reaction, according to the instructions of the reverse - transcription kit (StarScript III, Genstar, China), RNA was reverse - transcribed into the first - strand cDNA. qRT - PCR was carried out following the instructions of the 2×RealStar Fast SYBR qPCR Mix (GenStar, China). GAPDH was used as the internal reference gene to detect the relative expression levels of the target genes. The qRT - PCR reaction system (20 μL) consisted of 10 μL of 2×RealStar Fast SYBR qPCR Mix, 3.2 μL of sterile water, 0.2 μL of each of the forward and reverse primers, and 0.4 μL of cDNA. The reaction program was as follows: pre - denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at the optimal temperature of 60°C for 30 s, and extension at 72°C for 30 s, with a total of 40 cycles. The information of the primers used in this experiment is shown in Table 1. Relative quantitative results were processed using the 2–ΔΔCt method 22 . 2.8 Statistical analysis Statistical analysis of the experimental data was performed using SPSS software (Version 25.0) (https://www.ibm.com/support/pages/downloading-ibm-spss-statistics-25). In this study, Levene’s Test was conducted to assess the homogeneity of variance and the Shapiro–Wilk Test was also employed to evaluate the normal distribution of the data. An independent - samples t - test (for detecting interference efficiency) and Duncan's test in one - way analysis of variance (for luciferase detection) were used for the analysis of significant differences. All test results were expressed as mean ± standard deviation. The symbol “*” indicated a significant difference at P< 0.01. GraphPad Prism (Version 8.0.1) (https://www.graphpad.com/updates/prism-801-release-note) was used to plot the analysis results. 3. Results 3.1 Structural analysis of DHRS3 gene A search of the NCBI and Ensembl databases identified the pig DHRS3 gene on chromosome 6, with a total length of 43,000 bp and consisting of six exons. The promoter region was predicted by analyzing 2000 bp upstream and 1000 bp downstream of the gene's transcription start site, totaling 3000 bp. Using the FPROM tool, the core promoter and TATA-box were identified, while BDGP analysis revealed five segments with scores exceeding 0.8. Plant CARE analysis indicated the presence of several regulatory elements, including the TATA-box and CATT-box (Fig. 1A). CpG island analysis was performed using the MethPrimer database, applying filtering criteria of GC content >50%, island size >100 bp, and Obs/Exp >0.60. This analysis identified three CpG islands in the promoter region of the pig DHRS3 gene, located at -1818~-1691 bp (129 bp), -237~-17 bp (255 bp), and 46~417 bp (372 bp) (Fig. 1B). 3.2 Active region screening of the DHRS3 promoter Based on the aforementioned analysis, we constructed a series of progressively truncated fragments of the pig DHRS3 gene promoter, named P1-107(210~103), P2-230(210~ -20), P3-820(210~ -610), P4-1052(210~ -842), and P5-1450(210~ -1250) （Fig. 2A）. The vector construction and PCR amplification products were analyzed by agarose gel electrophoresis, as shown in Fig. 2B. Sequencing of the constructed vectors confirmed the correct insertion of the fragments, validating the successful construction of the pig DHRS3 gene 5′UTR dual-luciferase deletion vectors. The results of the dual-luciferase reporter assay revealed that all promoter fragments of varying lengths displayed activity in HK293T cells. The activity of the five promoter fragments increased progressively, with significantly higher activity observed in cells transfected with P1-107(210~103), P2-230(210~ -20), P3-820(210~ -610), P4-1052(210~ -842), and P5-1450(210~ -1250) compared to cells transfected with pGL4.10. Duncan's multiple comparisons analysis showed that cells transfected with P3-820(210~ -610), P4-1052(210~ -842), and P5-1450(210~ -1250) exhibited the highest relative activity, while those transfected with P2-230(210~ -20) showed moderate activity, and those transfected with P1-107(210~103) exhibited the lowest relative activity ( P< 0.001, Fig.2C). These findings suggest that the core promoter region is located between 210 and -842 bp. 3.3 Prediction and Activity Identification of Key Transcription Factors Transcription factor binding sites within the core promoter region of the pig DHRS3 gene (+210 bp to -842 bp) were predicted using the PRPMO online tool. The analysis identified several key transcription factors, including MYOD, MYOG, CDX1, and USF2, in this region. Using the JASPAR online tool, the four highest-scoring binding sites for these transcription factors were selected. A wild-type p DHRS3 -WT vector was then constructed and used as a template for site-directed mutagenesis at these binding sites. After digestion and sequencing confirmation, five recombinant reporter gene plasmids were successfully obtained: p DHRS3 -WT, p DHRS3 -CDX1, p DHRS3 -MYOD, p DHRS3 -MYOG, and p DHRS3 -USF2 (Fig. 3A-D). The dual-luciferase activity of pGL4.10-Basic and p DHRS3 -WT was used as a reference to evaluate the activity of the constructed mutant plasmids, which were co-transfected with pRL-TK into HK293T cells. Results showed that dual-luciferase activity was significantly increased in p DHRS3 -CDX1, p DHRS3 -MYOD, and p DHRS3 -MYOG transfection groups, whereas it was significantly decreased in the p DHRS3 -USF2 group. These findings suggest that CDX1, MYOD, and MYOG act as negative regulators of the porcine DHRS3 gene, while USF2 functions as a positive regulator. (Fig.3E). 3.4 Effects of CDX1, MYOD, MYOG, and USF2 Expression Knockdown on DHRS3 Gene Promoter Activity To further validate the role of CDX1, MYOD, MYOG, and USF2 binding sites in the core promoter region of the DHRS3 gene, siRNA-mediated silencing of selected transcription factors was performed. Porcine myoblasts were transfected with siRNAs targeting CDX1, MYOD, MYOG, and USF2. Interference efficiency was evaluated 48 hours post-transfection using negative control siNC. Results showed significant downregulation of target transcription factor expression, confirming successful knockdown of si-CDX1, si-MYOD, si-MYOG, and si-USF2 (Fig. 4A). Subsequently, these knockdown vectors were co-transfected with p DHRS3 -WT to assess luciferase activity. Compared to the control group, luciferase activity was significantly increased in si-CDX1, si-MYOD, and si-MYOG groups, whereas it was significantly reduced in the si-USF2 group (Fig. 4B). 4. Discussion Promoter studies are critical for understanding the transcriptional regulation of genes, as they provide insights into the structural and functional aspects of these regulatory regions. The core promoter, located upstream of the gene, is a key element that defines the initiation of transcription. This region encompasses essential cis-regulatory elements, including the transcription start site (TSS), which play a pivotal role in regulating gene transcription efficiency and tissue specificity 2 3 ,2 4 . Key regulatory elements within eukaryotic promoters include the TATA-box, CAAT-box, and GC-box, all of which significantly influence gene expression. The TATA-box is primarily responsible for recruiting RNA polymerase II (Pol II) and defining the TSS, while the CAAT-box and GC-box can either activate or suppress transcription 2 5 . In this study, an online tool was employed to predict the promoter region of the pig DHRS3 gene. Six high-scoring core promoter regions were identified, each containing typical eukaryotic transcription regulatory elements, including the TATA-box, CAAT-box, and GC-box. CpG islands are crucial structural elements in eukaryotic gene promoters. They regulate the binding of transcription factors to the promoter by modulating DNA methylation, which in turn affects gene expression 2 6 ,2 7 . These islands play a key role in the transcriptional regulation of genes in eukaryotes 2 8 ,2 9 . Bioinformatic analysis of the pig DHRS3 gene identified three CpG islands, two of which are located within the core promoter region, suggesting that DNA methylation may influence the transcriptional activity of DHRS3 . A study investigating human cancer found that the DNA methylation of the DHRS3 promoter is negatively correlated with gene expression. In addition to DNA methylation, promoter deletion analysis is another important approach for studying promoter function 30 . In this study, five truncation fragments of the promoter region, of varying lengths, were generated through 5' end deletion, and dual-luciferase reporter assays revealed that the core promoter region of the pig DHRS3 gene spans from +210 to -842 bp. Bioinformatic analysis predicted that the core promoter region of the pig DHRS3 gene harbors binding sites for several transcription factors, including CDX1, MYOD, MYOG, and USF2. Based on these findings, we constructed mutant luciferase reporter plasmids targeting the binding sites of p DHRS3 -CDX1, p DHRS3 -MYOD, p DHRS3 -MYOG, and p DHRS3 -USF2. Caudal - related homeobox 1 (CDX1), a member of the CDX family, has been shown by previous studies to be a crucial transcriptional regulator during mouse development. It exerts significant effects on the morphology of the vertebral column and the development of the intestine 31-33 . Our study revealed that mutations in the CDX1 binding site significantly enhanced the activity of the DHRS3 gene's core promoter, suggesting that CDX1 may act as a negative regulator of DHRS3 expression. Myogenic determination factor (MYOD) and myogenin (MYOG), key members of the Myogenic Regulatory Factors (MRFs) family, play essential roles in muscle fiber formation, maturation, and regeneration, contributing to muscle development 3 4 ,3 5 . Previous studies have demonstrated that MYOD and MYF-5 are essential regulators in the development of mouse skeletal muscle cells and myoblasts. Deletion of both MYOD and MYF-5 completely inhibits the initiation of muscle development in mice, whereas the absence of either gene results in only minor disruptions to muscle development 3 6 . Furthermore, overexpression of MYOD in sheep fibroblasts can induce their conversion into myoblasts, leading to myotube formation 3 7 . MYOG plays a critical role in muscle cell differentiation by regulating myoblast fusion and muscle fiber formation 3 8 . It is essential for early skeletal muscle development and prenatal survival, with MYOG knockout resulting in defects in postnatal muscle development 3 9 , 40 . Numerous studies have demonstrated that MYOD primarily exerts a tissue-specific regulatory role in skeletal muscle, directing muscle development. While it is expressed in minimal amounts in other tissues, no evidence indicates that MYOD plays a similarly critical regulatory role outside of skeletal muscle. Likewise, MYOG exhibits a high degree of tissue specificity, acting as a key "executor" in muscle tissue development and maturation. There is limited evidence suggesting that MYOG performs a comparable regulatory function in other tissues. In this study, we found that mutations in MYOD and MYOG led to a significant increase in the activity of the core promoter region of the pig DHRS3 gene, indicating that MYOD and MYOG negatively regulate DHRS3 expression. Upstream Stimulatory Factor (USF), a member of the basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factor family, regulates genes involved in cell growth and metabolism 41 , 42 . USF2, in particular, plays a critical role in processes such as embryonic development and metabolism. Studies on USF mutant mice have shown that USF deficiency predisposes to spontaneous seizures, underscoring its vital role in maintaining normal brain function. Moreover, embryonic lethality observed in these mutants further emphasizes the essential role of USF in embryonic development 43 . In this study, mutations in USF2 led to a reduction in the activity of the core promoter region of the pig DHRS3 gene, suggesting that USF2 functions as a positive regulator of DHRS3 expression. Based on these findings, we hypothesize that DHRS3 may be involved in animal growth and development. Collectively, transcription factors CDX1, MYOD, MYOG, and USF2 can regulate the expression of multiple genes and participate in diverse biological processes related to growth and development. Therefore, we propose that these transcription factors may serve as critical regulators of the DHRS3 gene. This study may provide a positive reference for further investigations into the transcriptional regulatory mechanisms of the DHRS3 gene. 5. Conclusion In summary, this study identified the core promoter region of the porcine DHRS3 gene between +210 and -842 bp, screened potential transcription factors binding to this region, and suggested that USF2 acts as a positive regulator while CDX1, MYOD, and MYOG function as negative regulators of this gene. These findings provide a theoretical basis for subsequent investigations into the regulatory mechanisms of DHRS3 in porcine growth and reproduction. Declarations Funding sources The author(s) declare financial support was received for the research, authorship, and to or publication of this article. This study was supported by Guizhou Provincial Science and Technology Engineering Project [QKHFQ-2018,4007, (002)] and Guizhou Provincial Agricultural Major Industry Scientific Research Engineering Project (QKHKYZ-2019,011). Acknowledgments The authors would like to thank all the reviewers who participated in the review and all the researchers who helped in the process of writing this manuscript. Author contributions HX received funding for this project. JL, YR and HX wrote and revised the manuscript and participated in the production of the images. CJ anf BZ contributes to the acquisition and analysis of data. All authors reviewed and contributed to manuscript drafts and revisions. Data availability statement Data is provided within the manuscript or supplementary information files. Conflict of interest The authors declare that there is no conflict of interest that biased or influenced this study. References Melissa, M.& Lisa, S. Enzymatic metabolism of vitamin a in developing vertebrate embryos. Nutrients . 8, 812. https://doi.org/10.3390/nu8120812 (2016) Haeseleer, F., Huang, J., Lebioda, L., Saari, J. C.& Palczewski, K. Molecular characterization of a novel short-chain dehydrogenase/reductase that reduces all-trans-retinal. Journal of Biological Chemistry . 273, 21790. https://doi.org/10.1074/jbc.273.34.21790 (1998) Tang, X. H.& Gudas, L. J. Retinoids, retinoic acid receptors, and cancer. Annual Review of Pathology . 6, 345. https://doi.org/10.1146/annurev-pathol-011110-130303 (2011) Blaner, W. S., O Byrne, S. M., Wongsiriroj, N., Kluwe, J., D Ambrosio, D. M.& Jiang, H.; et al. Hepatic stellate cell lipid droplets: a specialized lipid droplet for retinoid storage. Biochimica Et Biophysica Acta . 1791, 467-473. https://doi.org/10.1016/j.bbalip.2008.11.001 (2009) Tsutsumi, C., Okuno, M., Tannous, L., Piantedosi, R.& Blaner, W. S. Retinoids and retinoid-binding protein expression in rat adipocytes. Journal of Biological Chemistry . 267, 1805-1810. https://doi.org/10.1016/S0021-9258(18)46017-6 (1992) Injoo, H., Eun Ju, L., Hyomin, P., Dodam, M.& Hyo-Soo, K. Retinol from hepatic stellate cells via stra6 induces lipogenesis on hepatocytes during fibrosis. Cell Biosci. 11 , 3. https://doi.org/10.1186/s13578-020-00509-w (2021) Guoxun, C., Sabine, W.& Ralf, W. Vitamin a: too good to be bad? Front. Pharmacol. 14 , :1186336. https://doi.org/10.3389/fphar.2023.1186336 (2023) Takatsuka, J., Takahashi, N.& De Luca, L. M. Retinoic acid metabolism and inhibition of cell proliferation: an unexpected liaison. Cancer Res. 56, 675-678. (1996) Livera, G., Rouiller-Fabre, V., Pairault, C., Levacher, C.& Habert, R. Regulation and perturbation of testicular functions by vitamin a. Reproduction . 124, 173-180. https://doi.org/10.1530/rep.0.1240173 (2002) Maya W, H., Arie B, V.& J Bernd, H. Retinoids in health and disease: a role for hepatic stellate cells in affecting retinoid levels. Biochim. Biophys. Acta Mol. Cell Biol. Lipids . 1865 , 158674. https://doi.org/10.1016/j.bbalip.2020.158674 (2020) Billings, S. E., Pierzchalski, K., Tjaden, N. E. B., Pang, X. Y.& Moise, A. R. The retinaldehyde reductase DHRS3 is essential for preventing the formation of excess retinoic acid during embryonic development. Faseb Journal Official Publication of the Federation of American Societies for Experimental Biology . 27, 4877-4889. https://doi.org/10.1096/fj.13-227967 (2013) Feng, L., Hernandez, R. E., Waxman, J. S., Yelon, D.& Moens, C. B. DHRS3 a regulates retinoic acid biosynthesis through a feedback inhibition mechanism. Dev. Biol. 338, 1-14. https://doi.org/10.1016/j.ydbio.2009.10.029 (2010) Stigliani, S., Amaro, A., Reggiani, F., Maccarini, E., Massarotti, C.& Lambertini, M.; et al. P-098 cryopreservation process deregulates the expression of pathways important for fertility in human spermatozoa. Hum. Reprod. 38, dead93-dead462. https://doi.org/10.1093/humrep/dead093.462 (2023) Lundová, T., Zemanová, L., Malčeková, B., Skarka, A., štambergová, H.& Havránková, J.; et al. Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 ( DHRS3 ). Chem. Biol. Interact. 234, 178-187. https://doi.org/10.1016/j.cbi.2014.10.018 (2015) Wen-Yu, Z., Jia-Hui, X., Chun-Yu, Z., Hui-Li, T., Shu-Feng, L.& Yun-Qin, Y. Effects of DHRS3 in c2c12 myoblast differentiation and mouse skeletal muscle injury. Journal of Northeast Agricultural University (English Edition) . 28, 10 (2021) Jingjing, T., Yihui, D., Binbin, W., Mengmeng, J., Hongyan, L.& Yun, X.; et al. Hif1α/ DHRS3 a pathway participates in lipid droplet accumulation via retinol and ppar-γ in fish hepatocytes. International Journal of Molecular Sciences . 24 , 10236. https://doi.org/10.3390/ijms241210236 (2023) Zolfaghari, R., Chen, Q.& Ross, A. C. DHRS3 , a retinal reductase, is differentially regulated by retinoic acid and lipopolysaccharide-induced inflammation in thp-1 cells and rat liver. American Journal of Physiology Gastrointestinal & Liver Physiology . 303, G578. https://doi.org/10.1152/ajpgi.00234.2012 (2012) Richard K T, K., Yonglong, C., Sun-On, C., Wood-Yee, C., Igor B, D.& Hui, Z. Developmental expression of xenopus short-chain dehydrogenase/reductase 3. Int. J. Dev. Biol. 54 , 1355-1360. https://doi.org/10.1387/ijdb.092984rk (2010) Deisenroth, C., Itahana, Y., Tollini, L., Jin, A.& Zhang, Y. P53-inducible DHRS3 is an endoplasmic reticulum protein associated with lipid droplet accumulation. Journal of Biological Chemistry . 286, 28343-28356. https://doi.org/10.1074/jbc.M111.254227 (2011) Zhang, S., Chen, X., Huang, Z., Chen, D., Yu, B.& Chen, H.; et al. Leucine promotes differentiation of porcine myoblasts through the protein kinase b (akt)/forkhead box o1 signalling pathway. The British Journal of Nutrition . 119, 727-733. https://doi.org/10.1017/S0007114518000181. (2018) Yang, T., Chen, X. L., Huang, Z. Q., Wen, W. X., Xu, M.& Chen, D. W.; et al. Microrna-27a promotes porcine myoblast proliferation by downregulating myostatin expression. Animal . 8, 1867-1872. https://doi.org/10.1017/S1751731114001694 (2014) Livak, K. J.& Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative pcr and the 2−δδct method. Methods . 25, 402-408. https://doi.org/10.1006/meth.2001.1262 (2001) Aditi, K.& Manju, B. Structural properties of promoters: similarities and differences between prokaryotes and eukaryotes. Nucleic. Acids. Res. 33 , 3165–3175. https://doi.org/10.1093/nar/gki627 (2005) Kageyama, R., Merlino, G. T.& Pastan, I. Nuclear factor etf specifically stimulates transcription from promoters without a tata box. J. Biol. Chem. 264, 15508-15514. https://doi.org/10.1016/S0021-9258(19)84859-7 (1989) Bernardini, A., Hollinger, C., Willgenss, D., Müller, F., Devys, D.& Tora, L. Transcription factor iid parks and drives preinitiation complexes at sharp or broad promoters. Trends Biochem.Sci. 48, 839-848. https://doi.org/10.1016/j.tibs.2023.07.009 (2023) Yong, X., Qinxi, C., Qingbo, L., Canxin, L.& Weisheng, C. The expression level of chicken telomerase reverse transcriptase in tumors induced by alv-j is positively correlated with methylation and mutation of its promoter region. Vet. Res. 53 , 49. https://doi.org/10.1186/s13567-022-01069-2 (2022) Young Mi, O., Marcus, M., Eric E, E., Kathleen M, L., Guoyan, Z.& Valeria, C. Epigenetic regulator uhrf1 inactivates rest and growth suppressor gene expression via dna methylation to promote axon regeneration. Proc. Natl. Acad. Sci. U. S. A. 115 , E12417-E12426. https://doi.org/10.1073/pnas.1812518115 (2018) Deaton, A. M.& Bird, A. Cpg islands and the regulation of transcription. Genes. Dev. 25, 1010-1022. http://www.genesdev.org/cgi/doi/10.1101/gad.2037511 (2011) Angeloni, A.& Bogdanovic, O. Sequence determinants, function, and evolution of cpg islands. Biochem. Soc. Trans. 49, 1109-1119. https://doi.org/10.1042/BST20200695 (2021) Sha, S., Kong, X., Chen, F., Sun, X., Hu, S.& Bai, B.; et al. Hypermethylation of DHRS3 as a novel tumor suppressor involved in tumor growth and prognosis in gastric cancer. Front. Cell. Dev. Biol. 9 , 624871. http://dx.doi.org/10.3389/fcell.2021.624871 (2021) Eric, V. D. A., Sylvie, F., Kallayanee, C., Wim, D. G., Felix, B.& Barbara I, M.; et al. Cdx1 and cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development. 129 , 2181–2193. https://doi.org/10.1242/dev.129.9.2181 (2002) Subramanian, V., Meyer, B. I.& Gruss, P. Disruption of the murine homeobox gene cdx1 affects axial skeletal identities by altering the mesodermal expression domains of hox genes. Cell . 83, 641-653. https://doi.org/10.1016/0092-8674(95)90104-3 (1995) Silberg, D. G., Swain, G. P., Suh, E. R.& Traber, P. G. Cdx1 and cdx2 expression during intestinal development. Gastroenterology . 119, 961-971. https://doi.org/10.1053/gast.2000.18142 (2000) Davis, R. L., Weintraub, H.& Lassar, A. B. Expression of a single transfected cdna converts fibroblasts to myoblasts. Cell . 51, 987-1000. https://doi.org/10.1002/j.1460-2075.1989.tb03429.x (1987) Braun, T., Buschhausen Denker, G., Bober, E., Tannich, E.& Arnold, H. H. A novel human muscle factor related to but distinct from myod1 induces myogenic conversion in 10t1/2 fibroblasts. The Embo Journal . 8, 701-709. https://doi.org/10.1002/j.1460-2075.1989.tb03429.x (1989) Rudnicki, M. A., Schnegelsberg, P. N. J., Stead, R. H., Braun, T., Arnold, H.& Jaenisch, R. Myod or myf-5 is required for the formation of skeletal muscle. Cell . 75, 1351-1359. 10.1016/0092-8674(93)90621-v https://doi.org/10.1016/0092-8674(93)90621-V (1993) Sousa-Junior, L. P. B., Meira, A. N., Azevedo, H. C., Muniz, E. N., Coutinho, L. L.& Mourão, G. B.; et al. Variants in myostatin and myod family genes are associated with meat quality traits in santa inês sheep. Anim. Biotechnol. 33, 201-213. https://doi.org/10.1080/10495398.2020.1781651 (2022) Adhikari, A., Kim, W.& Davie, J. Myogenin is required for assembly of the transcription machinery on muscle genes during skeletal muscle differentiation. Plos One . 16, e245618. https://doi.org/10.1371/journal.pone.0245618 (2021) Ganassi, M., Badodi, S., Wanders, K., Zammit, P. S.& Hughes, S. M. Myogenin is an essential regulator of adult myofibre growth and muscle stem cell homeostasis. Elife . 9 , e60445. https://doi.org/10.7554/eLife.60445 (2020) Bharathy, N., Ling, B. M. T.& Taneja, R. Epigenetic regulation of skeletal muscle development and differentiation. Sub-Cellular Biochemistry . 61, 139-150. https://link.springer.com/chapter/10.1007/978-94-007-4525-4_7 (2013) Vallet, V. S., Casado, M., Henriona, A. A., Bucchini, D., Raymondjean, M.& Kahn, A.; et al. Differential roles of upstream stimulatory factors 1 and 2 in the transcriptional response of liver genes to glucose. The Journal of Biological Chemistry . 273, 20175-20179. https://doi.org/10.1074/jbc.273.32.20175 (1998) Wutthisathapornchai, A., Vongpipatana, T., Muangsawat, S., Boonsaen, T., Macdonald, M. J.& Jitrapakdee, S. Multiple e-boxes in the distal promoter of the rat pyruvate carboxylase gene function as a glucose-responsive element. Plos One . 9, e102730. https://doi.org/10.1371/journal.pone.0102730 (2014) Sirito, M., Lin, Q., M, D. J., Behringer, R. R.& Sawadogo, M. Overlapping roles and asymmetrical cross-regulation of the usf proteins in mice. Proc. Natl. Acad. Sci. U. S. A. 95, 3758-3763. https://doi.org/10.1073/pnas.95.7.3758 (1998) Additional Declarations No competing interests reported. Supplementary Files initialdata.xlsx Fig.2A.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5175349","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":438024028,"identity":"0d8342d9-a395-4ecb-8eb8-e58d0b612f27","order_by":0,"name":"Jifeng Li","email":"","orcid":"","institution":"Guizhou University","correspondingAuthor":false,"prefix":"","firstName":"Jifeng","middleName":"","lastName":"Li","suffix":""},{"id":438024029,"identity":"750930ed-9d39-4076-9d10-df66c1d24cb9","order_by":1,"name":"Yong Ruan","email":"","orcid":"","institution":"Guizhou University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Ruan","suffix":""},{"id":438024033,"identity":"cdd7e62e-52ea-48e0-9f93-2c0f42ff8ba2","order_by":2,"name":"Chuanmei Jiang","email":"","orcid":"","institution":"Guizhou University","correspondingAuthor":false,"prefix":"","firstName":"Chuanmei","middleName":"","lastName":"Jiang","suffix":""},{"id":438024034,"identity":"de34dbe7-3daa-451c-a714-bace07a7f2a4","order_by":3,"name":"Bo Zhou","email":"","orcid":"","institution":"Guizhou University","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Zhou","suffix":""},{"id":438024036,"identity":"8676204c-ff57-40d0-912e-656632c158bb","order_by":4,"name":"Houqiang Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtElEQVRIiWNgGAWjYHACAwbGBgY5Nvb2A6RpMebjOZNAmpbEeRIOBsSpl/c/vE2ad4d1epsEQwLDj4pthLUYHjhWbDjzTHpum3TjAcaeM7eJ0NLYY/jgY9vh3DaZAwnMjG3EaGnmMTiQ2HY4nU0iwYA4LfJsPGBbEojXYsDDBvRLW7phGzCQDxLlF/l+UIi1WcvLt7cffPCjghhbDoApZjB5gLB6kC0NSFpGwSgYBaNgFGAFAMMCO4lDHiBVAAAAAElFTkSuQmCC","orcid":"","institution":"Guizhou University","correspondingAuthor":true,"prefix":"","firstName":"Houqiang","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2024-09-29 14:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5175349/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5175349/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":79884329,"identity":"cbd5ca11-e445-4d46-b5b6-a9f243f55dad","added_by":"auto","created_at":"2025-04-04 05:34:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":167864,"visible":true,"origin":"","legend":"\u003cp\u003ePrediction and analysis of the promoter region of the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene. A：Prediction of \u003cem\u003eDHRS3\u003c/em\u003e promoter position by different software; B: Prediction of CpG islands in the promoter region of \u003cem\u003eDHRS3\u003c/em\u003e(-2000-1000bp).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/c6e215bb560f154c63dd9b38.png"},{"id":79884330,"identity":"db5f4077-98b9-4c94-8780-a40c6639af66","added_by":"auto","created_at":"2025-04-04 05:34:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":100476,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eDHRS3\u003c/em\u003e Promoter core region analysis.. A: Schematic of porcine \u003cem\u003eDHRS3\u003c/em\u003egene 5′UTR different promoter fragments; B: Agarose gel of PCR amplification product of different promoter fragments in porcine \u003cem\u003eDHRS3\u003c/em\u003e gene 5′UTR; 1 ~ 5. PCR amplification products of P1 ~ P5 primers; M: DNA markerr (DL5000). C: Relative luciferase activity (firefly: Renilla fluorescence) of porcine \u003cem\u003eDHRS3\u003c/em\u003epromoter constructs. The pGL4.10 plasmid is used as a negative control. The porcine \u003cem\u003eDHRS3\u003c/em\u003e promoter constructs are shown on the left, and the luciferase activity is shown on the right. The error bars on the right chart represent the standard deviation of three biological replicates. Different capital letters indicate significant differences in promoter activity between groups, and the same letter indicates no significant difference. （P=2.3134E-13）\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/63326e783f97f4814155747c.png"},{"id":79885209,"identity":"6bcee6b9-60ff-402f-b716-6e85443389a4","added_by":"auto","created_at":"2025-04-04 05:42:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":269723,"visible":true,"origin":"","legend":"\u003cp\u003eMutation analysis of key transcription factor binding sites. A-D: Site-directed mutation map of transcription factor binding site of \u003cem\u003eDHRS3\u003c/em\u003e. A：p\u003cem\u003eDHRS3\u003c/em\u003e-CDX1；B：p\u003cem\u003eDHRS3\u003c/em\u003e-MYOD；C：p\u003cem\u003eDHRS3\u003c/em\u003e-MYOG；D：p\u003cem\u003eDHRS3\u003c/em\u003e-USF2.The transcription factor binding sites are in red font, and the mutation positions are underlined. E: Relative luciferase activities of transcription factor-binding site mutations in the core region of \u003cem\u003eDHRS3\u003c/em\u003e (Firefly: Renilla). The black figure is the mutant type，and the white figure is the wild type. The error bars on the right graph represent the SD of three biological replicates. Different capital letters indicate significant differences in promoter activity between groups, while identical letters indicate no significant differences. (P=2.7769E-15)\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/26e229c9ba0056a6dc9da1ba.png"},{"id":79885211,"identity":"b4548700-dff3-45e2-bca4-79c2600bcb4d","added_by":"auto","created_at":"2025-04-04 05:42:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":45253,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of CDX1，MYOD，MYOG and USF2 TFs by siRNA. A: Interference efficiency of CDX1，MYOD，MYOG and USF2 . B: Luciferase activity after co- transfection of si-CDX1、si-MYOD、si-MYOG and si-USF2 with p\u003cem\u003eDHRS3\u003c/em\u003e-WT. “*” indicates \u003cem\u003eP\u0026lt;\u003c/em\u003e 0.05,\u003c/p\u003e\n\u003cp\u003e(P=2.9123E-11)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/8485c8a0f34730f8042352da.png"},{"id":85635492,"identity":"7eb20684-a4cc-453a-93bc-4798786d23d1","added_by":"auto","created_at":"2025-06-30 05:40:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1124125,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/3e4a1285-9625-4aae-b0c5-5bbc5d464241.pdf"},{"id":79884336,"identity":"570c7466-4b74-434f-802a-338924a9030f","added_by":"auto","created_at":"2025-04-04 05:34:57","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":12534,"visible":true,"origin":"","legend":"","description":"","filename":"initialdata.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/ead631e7e9c1ea4c263a7a2d.xlsx"},{"id":79884340,"identity":"bc0fae00-4fd8-41ce-ad34-8dd24a82b013","added_by":"auto","created_at":"2025-04-04 05:34:57","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":18746,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2A.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5175349/v1/3b1a4f2840cb9d8340b3293d.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Analysis of core promoter and transcription factors screening of porcine DHRS3 gene","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDehydrogenase/Reductase (SDR) Family Member 3 (\u003cem\u003eDHRS3\u003c/em\u003e), also referred to as Rsdr1 and retSDR1, is a highly conserved member of the SDR16C family within the short-chain dehydrogenase/reductase superfamily. It plays a crucial role in the metabolism of retinol (vitamin A) \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Vitamin A is predominantly stored in hepatocytes and adipocytes, with the liver accounting for over 70% of the body's total vitamin A in most vitamin A-sufficient animals \u003csup\u003e\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Vitamin A and its metabolites regulate gene expression, thereby influencing cell proliferation, differentiation, and immune function. These processes are vital for growth, development, and reproductive regulation in animals \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Since mammals cannot synthesize vitamin A, it must be obtained through the diet. Vitamin A deficiency impairs growth and development and reduces fertility in male animals \u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eDHRS3\u003c/em\u003e plays a pivotal role in regulating the biosynthesis of retinoic acid, a vital molecule for normal embryonic development. \u003cem\u003eDHRS3\u003c/em\u003e deficiency can prevent excessive retinoic acid accumulation during embryogenesis, significantly disrupting normal development \u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Molecular and biochemical studies have demonstrated the expression of \u003cem\u003eDHRS3\u003c/em\u003e in the liver, testes, and small intestine of humans, as confirmed by q-PCR and Western blot analyses \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Vitamin A is primarily converted into retinol and retinoic acid for storage and biological function. During muscle development, \u003cem\u003eDHRS3\u003c/em\u003e mainly converts VA1 to retinaldehyde (RAL), which is further converted into retinoic acid (RA). As a new regulator of C2C12 myoblast differentiation, \u003cem\u003eDHRS3\u003c/em\u003e also participates in the regeneration of mouse skeletal muscle injury injuries. \u003cem\u003eDHRS3\u003c/em\u003e is recognized as a novel regulatory factor for myoblast differentiation and also contributes to skeletal muscle regeneration in mice following injury \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. In lipid formation studies, a new mechanism of lipid droplet formation in fish cells has been proposed, with \u003cem\u003eDHRS3\u003c/em\u003ea identified as a key protein involved in lipid droplet growth at an early stage. HIF1α, a primary transcription factor, regulates \u003cem\u003eDHRS3\u003c/em\u003ea, and the HIF1α/\u003cem\u003eDHRS3\u003c/em\u003ea pathway contributes to lipid droplet accumulation in fish liver cells via retinol and Ppar-γ \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Additionally, research has explored the role of \u003cem\u003eDHRS3\u003c/em\u003e in inflammation and neurodevelopment. \u003cem\u003eDHRS3\u003c/em\u003e mRNA is abundantly expressed in the liver of adult rats, and reduced expression of \u003cem\u003eDHRS3\u003c/em\u003e during inflammation may impact vitamin A metabolism in the liver \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In Xenopus laevis, \u003cem\u003eDHRS3\u003c/em\u003e has been shown to be expressed at multiple stages of embryonic and neurodevelopment \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eDHRS3\u003c/em\u003e gene encodes a protein that regulates various biological processes through the modulation of gene expression. Recent studies have shown that \u003cem\u003eDHRS3\u003c/em\u003e is involved in embryonic development, lipid droplet accumulation, cell differentiation, and skeletal muscle regeneration \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. However, transcriptional regulation of \u003cem\u003eDHRS3\u003c/em\u003e and its roles in livestock and poultry have been rarely reported, and the functions and underlying mechanisms of the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene remain unclear. This study aims to explore the structure and regulatory mechanisms of the \u003cem\u003eDHRS3\u003c/em\u003e gene by identifying its core promoter region and predicting key transcription factors, thereby providing a theoretical foundation for further investigations into the role of \u003cem\u003eDHRS3\u003c/em\u003e in pig growth, development, and reproduction.\u003c/p\u003e \u003cp\u003eThis study constructed recombinant vectors containing deletion fragments of varying lengths from the promoter region and identified the core transcription start site using a dual-luciferase reporter assay. Bioinformatics analysis was performed to predict potential transcription factor binding sites within the core promoter region, and site-directed mutagenesis was employed to validate the key transcription factors for the \u003cem\u003eDHRS3\u003c/em\u003e gene. The findings offer valuable insights for further investigation into the function of the \u003cem\u003eDHRS3\u003c/em\u003e gene and provide a foundation for exploring its transcriptional regulatory mechanisms in pigs.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cp\u003e2.1 Ethical statement\u003c/p\u003e\n\u003cp\u003eThe animal study was approved by the Animal Welfare Committee of Guizhou University (EAE-GZU-2023-E053). The study was conducted in accordance with the local legislation and in-stitutional requirements.\u003c/p\u003e\n\u003cp\u003e2.2 Bioinformatics analysis of promoter\u003c/p\u003e\n\u003cp\u003eThe NCBI and Ensembl website was searched for approximately 2000 bp sequence information before the transcription start site and nearly 1000 bp sequence information after the transcription start site of the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene (NC_010448.4). The core promoter region was predicted and analyzed by biological analysis Promoter. 2.0 (https://services. healthtech.dtu.dk/services/ Promoter-2.0/), Promoter Scan (https: //www-bimas.cit.nih.gov/molbio/proscan/), FPROM (https://www.softberry.com/berry.phtml?topic=fprom\u0026amp;group=programs\u0026amp;subgroup=promoter), BDGP (https://www.fruitfly.org/seq_ tools/promoter.html), Plant CARE (https://bioinformatics. psb.ugent.be/webtools/plantcare/html/) and other software for gene promoter analysis; CpG islands that the target gene might contain were analyzed with CpG Finder (http://www.softberry. com/berry.phtml?topic=cpgfinder\u0026amp;group=programs \u0026amp;subgroup=promoter) and MethPrime (https://www.urogene.org/cgi-bin/methprimer /methprimer.cgi), PROMO HOME PAGE (https://alggen.lsi.upc.es/cgi-bin/promo_v3/ promo/promoinit.cgi?dirDB=TF_8.3) and JASPAR (https:// jaspar.genereg.net/) were used to predictive analysis of promoter transcription factors and binding sites.\u003c/p\u003e\n\u003cp\u003e2.3 Deletion plasmids construction\u003c/p\u003e\n\u003cp\u003eUsing the pig \u003cem\u003eDHRS3\u003c/em\u003e gene sequence (NCBI accession number: NC_010448.4), a 2000 bp upstream region and a 1000 bp downstream region of the transcription start site were selected as the promoter region. This promoter region was analyzed using online prediction software. Based on the predictions, five pairs of primers with varying lengths were designed by fixing the 3' end and shortening the 5' end of the promoter sequence. KpnI and XhoI restriction sites were introduced at the upstream and downstream ends of the truncated fragments, respectively. The primers were synthesized by Chongqing Qingke Biotechnology Co., Ltd.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;(Chongqing, China). The pGL4.10-Basic vector and the amplified products were digested with KpnI and XhoI, and the resulting fragments were ligated using T4 DNA ligase. The ligated products were then transformed into DH5α competent cells. After 12 hours, positive clones were selected, expanded, and sent to Chongqing Qingke Biotechnology Co., Ltd. for sequencing to confirm the quality of the recombinant plasmids. The recombinant plasmids were designated as P1-107(210~103), P2-230(210~-20), P3-820(210~-610), P4-1052(210~-842), and P5-1460(210~-1250).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1. Primer information in this study\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"625\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSequence (5′-3′)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTm\u003c/p\u003e\n \u003cp\u003e/°C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLength\u003c/p\u003e\n \u003cp\u003e/bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;Region\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eP1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cu\u003eGGTACC\u003c/u\u003eCGGGAGCGAATGGATAAGGCGCCGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e107\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+103/+210\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eP2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cu\u003eGGTACC\u003c/u\u003eGAGCCCGCGGCAGCCACTCACAGGAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-20/+210\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eP3-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cu\u003eGGTACC\u003c/u\u003eGTAATTCTAGCCCAGATGAGCAATAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e820\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-610/+210\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eP4-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cu\u003eGGTACC\u003c/u\u003eCCAGACTTCCTGCAACAGACAACTCTAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-842/+210\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eP5-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cu\u003eGGTACC\u003c/u\u003eGGTCCAGATAACGATTTTCCCAATTCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1460\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-1250/+210\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eP1~5-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cu\u003eCTCGAG\u003c/u\u003eCATTTATTGCCTTCTTTTTGTCCTTTCCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003ep\u003cem\u003eDHRS3\u003c/em\u003e-CDX1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:GCCCAGATGAGC\u003cstrong\u003eTTATT\u003c/strong\u003eATACGCTCCCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e1052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e-589/-584\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:CTGGGAGCGTAT\u003cstrong\u003eAATAA\u003c/strong\u003eGCTCATCTGGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003ep\u003cem\u003eDHRS3\u003c/em\u003e-MYOD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:CCTACTCCCCAG\u003cstrong\u003eGACGA\u003c/strong\u003eCCCCCCCACCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e1052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e-483/-478\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:GGGGTGGGGGGG\u003cstrong\u003eTCGTC\u003c/strong\u003eCTGGGGAGTAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003ep\u003cem\u003eDHRS3\u003c/em\u003e-MYOG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:AACCCTACTCCC\u003cstrong\u003eGTCGA\u003c/strong\u003eGCTCCCCCCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e1052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e-480/-475\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:GTGGGGGGGAGC\u003cstrong\u003eTCGAC\u003c/strong\u003eGGGAGTAGGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003ep\u003cem\u003eDHRS3\u003c/em\u003e-USF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:CGCAGAGGGGGT\u003cstrong\u003eGTGGA\u003c/strong\u003eGGCCTGCGGGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e1052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e-263/-257\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:CGCCCGCAGGCC\u003cstrong\u003eTCCAC\u003c/strong\u003eACCCCCTCTGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eCDX1-RT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:GGGCTATGTGCTGGACAAGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e138\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:ACGTGCAAGTAGCCGGTGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eMYOD-RT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:GCAAACGCAAGACCACTAACGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:GCTGATTCGGGTTGCTAGACGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eMYOG-RT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:TGCCCAGTGAATGCAGTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e164\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:ATCCTCCACTGTGATGCTGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eUSF2-RT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:AGATAATAGCAAGACGGGAGCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e183\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:AGCACGGCATTCTCGTTCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eGAPDH-RT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:TTTGTGATGGGCGTGAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e171\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:AGTCTTCTGGGTGGCAGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003esi-CDX1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:ACGCAGUGUGGCGGCUGGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:UCCAGCCGCCACACUGCGUTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003esi-MYOD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:CAACAGCGGACGACUUCUATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:UAGAAGUCGUCCGCUGUUGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003esi-MYOG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:GCAGGCUCAAGAAGGUGAATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:UUCACCUUCUUGAGCCUGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003esi-USF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF:GAUUGUAACGCAGAUAAUATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eR:UAUUAUCUGCGUUACAAUCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eF, forward; R, reverse; The underline is the restriction site, the bold text indicates the mutation sites of transcription factor binding sites.\u003c/p\u003e\n\u003cp\u003e2.4 Cell Isolation and Culture\u003c/p\u003e\n\u003cp\u003ePorcine myoblasts were isolated from the longissimus dorsi muscle of 3-day-old piglets using methods described by Zhang et al. (2018) \u003csup\u003e20\u003c/sup\u003e and Yang et al. (2014) \u003csup\u003e21\u003c/sup\u003e. The isolated longissimus dorsi muscle was washed once with 75% ethanol solution and three times with PBS. After removing connective tissues, the minced tissues were digested with 1 mg/ml collagenase type II at 37℃\u0026nbsp;for 90 min. Digestion was terminated by adding growth medium (DMEM/F12 (gibco, USA), 15% fetal bovine serum (gibco, USA), and 1% antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin) (gibco, USA)). The digested products were filtered through 70-μm and 40-μm cell strainers. The filtrate was centrifuged at 1500\u0026nbsp;×\u0026nbsp;g for 10 min, and the resulting pellet was resuspended in growth medium. Cells were purified using the differential adhesion method.\u003c/p\u003e\n\u003cp\u003ePreviously cryopreserved HK293T cells were thawed and cultured in high-glucose DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37℃\u0026nbsp;in a humidified incubator with 5% CO₂. When cells reached 90% confluence, they were detached with 0.25% trypsin and neutralized with complete medium. Cells were passaged into 24-well plates and transfected when the density reached 70%-90%.\u003c/p\u003e\n\u003cp\u003e2.5 Cell Transfection and Firefly Luciferase Reporter Assay\u003c/p\u003e\n\u003cp\u003eThe experiment was conducted using Lipofectamine 3000 transfection reagent. The recombinant plasmids with promoter deletion fragments and pGL - 4.10 (a luciferase reporter plasmid) were co - transfected with pRL - TK (a Renilla luciferase control plasmid) into HK293T cells at a ratio of 10:1. Three replicates were set for each group, and the cells were collected 48 hours later.\u003c/p\u003e\n\u003cp\u003eThe firefly luciferase reporter gene assay was performed according to the manufacturer's instructions of the Dualucif@Firefly \u0026amp; Renilla Assay Kit (Uelandy, China)\u0026nbsp;at room temperature. For each well, 100 μL of the sample was taken and placed in an opaque 96 - well plate. Then, 100 μL of firefly luciferase working solution was added, and the relative light unit (RLU) value was detected. Subsequently, 100 μL of Renilla luciferase working solution was added, and the RLU value was measured again. The ratio of the firefly luciferase intensity to the Renilla luciferase intensity was calculated as the relative luciferase activity (RLA).\u003c/p\u003e\n\u003cp\u003e2.6 Transcription Factor Binding Site Mutagenesis and RNA Interference in the \u003cem\u003eDHRS3\u003c/em\u003e Gene Promoter\u003c/p\u003e\n\u003cp\u003eBased on bioinformatics analysis and dual-luciferase activity assay results, site-directed mutagenesis was performed on CDX1, MYOD, MYOG, and USF2 transcription factor binding sites. Mutated fragments were synthesized by Servier Biotech Co., Ltd. (Wuhan, China), with primer details listed in Table 1. The mutated vectors were named p\u003cem\u003eDHRS3\u003c/em\u003e-WT, p\u003cem\u003eDHRS3\u003c/em\u003e-CDX1, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOD, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOG, and p\u003cem\u003eDHRS3\u003c/em\u003e-USF2. After amplification, the products were digested with KpnI and XhoI enzymes and ligated into similarly digested pGL4.10-basic vectors. The constructs were transformed into DH5α cells, and positive plasmids with mutated fragments were selected and sent to Wuhan Servier Biotech Co., Ltd. for sequencing verification. siRNAs used in this study were designed and synthesized by GEMA Ltd. (Shanghai, China), with primer sequences provided in Table 1. Mutation of transcription factor binding sites in the \u003cem\u003eDHRS3\u003c/em\u003e Gene Promoter.\u003c/p\u003e\n\u003cp\u003e2.7 Extraction of Total Cellular RNA, Synthesis of cDNA, and qRT - PCR\u003c/p\u003e\n\u003cp\u003eCells after transfection treatment were collected. Total RNA was extracted using the TRIzol kit (Thermo Fisher Scientific, USA). For the reverse - transcription reaction, according to the instructions of the reverse - transcription kit (StarScript III, Genstar, China), RNA was reverse - transcribed into the first - strand cDNA.\u003c/p\u003e\n\u003cp\u003eqRT - PCR was carried out following the instructions of the 2×RealStar Fast SYBR qPCR Mix (GenStar, China). GAPDH was used as the internal reference gene to detect the relative expression levels of the target genes. The qRT - PCR reaction system (20 μL) consisted of 10 μL of 2×RealStar Fast SYBR qPCR Mix, 3.2\u0026nbsp;μL of sterile water, 0.2\u0026nbsp;μL of each of the forward and reverse primers, and 0.4\u0026nbsp;μL of cDNA. The reaction program was as follows: pre - denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at the optimal temperature of 60°C for 30 s, and extension at 72°C for 30 s, with a total of 40 cycles. The information of the primers used in this experiment is shown in Table 1. Relative quantitative results were processed using the 2–ΔΔCt method \u003csup\u003e22\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.8 Statistical analysis\u003c/p\u003e\n\u003cp\u003eStatistical analysis of the experimental data was performed using SPSS software (Version 25.0) (https://www.ibm.com/support/pages/downloading-ibm-spss-statistics-25). In this study, Levene’s Test was conducted to assess the homogeneity of variance and the Shapiro–Wilk Test was also employed to evaluate the normal distribution of the data. An independent - samples t - test (for detecting interference efficiency) and Duncan's test in one - way analysis of variance (for luciferase detection) were used for the analysis of significant differences. All test results were expressed as mean ± standard deviation. The symbol “*” indicated a significant difference at \u003cem\u003eP\u0026lt;\u003c/em\u003e 0.01. GraphPad Prism (Version 8.0.1) (https://www.graphpad.com/updates/prism-801-release-note) was used to plot the analysis results.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e3.1 Structural analysis of \u003cem\u003eDHRS3\u003c/em\u003e gene\u003c/p\u003e\n\u003cp\u003eA search of the NCBI and Ensembl databases identified the pig \u003cem\u003eDHRS3\u003c/em\u003e gene on chromosome 6, with a total length of 43,000 bp and consisting of six exons. The promoter region was predicted by analyzing 2000 bp upstream and 1000 bp downstream of the gene\u0026apos;s transcription start site, totaling 3000 bp. Using the FPROM tool, the core promoter and TATA-box were identified, while BDGP analysis revealed five segments with scores exceeding 0.8. Plant CARE analysis indicated the presence of several regulatory elements, including the TATA-box and CATT-box (Fig. 1A). CpG island analysis was performed using the MethPrimer database, applying filtering criteria of GC content \u0026gt;50%, island size \u0026gt;100 bp, and Obs/Exp \u0026gt;0.60. This analysis identified three CpG islands in the promoter region of the pig \u003cem\u003eDHRS3\u003c/em\u003e gene, located at -1818~-1691 bp (129 bp), -237~-17 bp (255 bp), and 46~417 bp (372 bp) (Fig. 1B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3.2 Active region screening of the \u003cem\u003eDHRS3\u003c/em\u003e promoter\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on the aforementioned analysis, we constructed a series of progressively truncated fragments of the pig \u003cem\u003eDHRS3\u003c/em\u003e gene promoter, named P1-107(210~103), P2-230(210~ -20), P3-820(210~ -610), P4-1052(210~ -842), and P5-1450(210~ -1250) （Fig. 2A）. The vector construction and PCR amplification products were analyzed by agarose gel electrophoresis, as shown in Fig. 2B. Sequencing of the constructed vectors confirmed the correct insertion of the fragments, validating the successful construction of the pig \u003cem\u003eDHRS3\u003c/em\u003e gene 5\u0026prime;UTR dual-luciferase deletion vectors. The results of the dual-luciferase reporter assay revealed that all promoter fragments of varying lengths displayed activity in HK293T cells. The activity of the five promoter fragments increased progressively, with significantly higher activity observed in cells transfected with P1-107(210~103), P2-230(210~ -20), P3-820(210~ -610), P4-1052(210~ -842), and P5-1450(210~ -1250) compared to cells transfected with pGL4.10. Duncan\u0026apos;s multiple comparisons analysis showed that cells transfected with P3-820(210~ -610), P4-1052(210~ -842), and P5-1450(210~ -1250) exhibited the highest relative activity, while those transfected with P2-230(210~ -20) showed moderate activity, and those transfected with P1-107(210~103) exhibited the lowest relative activity (\u003cem\u003eP\u0026lt;\u003c/em\u003e0.001, Fig.2C). These findings suggest that the core promoter region is located between 210 and -842 bp.\u003c/p\u003e\n\u003cp\u003e3.3 Prediction and Activity Identification of Key Transcription Factors\u003c/p\u003e\n\u003cp\u003eTranscription factor binding sites within the core promoter region of the pig \u003cem\u003eDHRS3\u003c/em\u003e gene (+210 bp to -842 bp) were predicted using the PRPMO online tool. The analysis identified several key transcription factors, including MYOD, MYOG, CDX1, and USF2, in this region. Using the JASPAR online tool, the four highest-scoring binding sites for these transcription factors were selected. A wild-type p\u003cem\u003eDHRS3\u003c/em\u003e-WT vector was then constructed and used as a template for site-directed mutagenesis at these binding sites. After digestion and sequencing confirmation, five recombinant reporter gene plasmids were successfully obtained: p\u003cem\u003eDHRS3\u003c/em\u003e-WT, p\u003cem\u003eDHRS3\u003c/em\u003e-CDX1, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOD, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOG, and p\u003cem\u003eDHRS3\u003c/em\u003e-USF2 (Fig. 3A-D). The dual-luciferase activity of pGL4.10-Basic and p\u003cem\u003eDHRS3\u003c/em\u003e-WT was used as a reference to evaluate the activity of the constructed mutant plasmids, which were co-transfected with pRL-TK into HK293T cells. Results showed that dual-luciferase activity was significantly increased in p\u003cem\u003eDHRS3\u003c/em\u003e-CDX1, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOD, and p\u003cem\u003eDHRS3\u003c/em\u003e-MYOG transfection groups, whereas it was significantly decreased in the p\u003cem\u003eDHRS3\u003c/em\u003e-USF2 group. These findings suggest that CDX1, MYOD, and MYOG act as negative regulators of the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene, while USF2 functions as a positive regulator. (Fig.3E).\u003c/p\u003e\n\u003cp\u003e3.4 Effects of CDX1, MYOD, MYOG, and USF2 Expression Knockdown on \u003cem\u003eDHRS3\u003c/em\u003e Gene Promoter Activity\u003c/p\u003e\n\u003cp\u003eTo further validate the role of CDX1, MYOD, MYOG, and USF2 binding sites in the core promoter region of the \u003cem\u003eDHRS3\u003c/em\u003e gene, siRNA-mediated silencing of selected transcription factors was performed. Porcine myoblasts were transfected with siRNAs targeting CDX1, MYOD, MYOG, and USF2. Interference efficiency was evaluated 48 hours post-transfection using negative control siNC. Results showed significant downregulation of target transcription factor expression, confirming successful knockdown of si-CDX1, si-MYOD, si-MYOG, and si-USF2 (Fig. 4A). Subsequently, these knockdown vectors were co-transfected with p\u003cem\u003eDHRS3\u003c/em\u003e-WT to assess luciferase activity. Compared to the control group, luciferase activity was significantly increased in si-CDX1, si-MYOD, and si-MYOG groups, whereas it was significantly reduced in the si-USF2 group (Fig. 4B).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePromoter studies are critical for understanding the transcriptional regulation of genes, as they provide insights into the structural and functional aspects of these regulatory regions. The core promoter, located upstream of the gene, is a key element that defines the initiation of transcription. This region encompasses essential cis-regulatory elements, including the transcription start site (TSS), which play a pivotal role in regulating gene transcription efficiency and tissue specificity \u003csup\u003e2\u003c/sup\u003e\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e,2\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e. Key regulatory elements within eukaryotic promoters include the TATA-box, CAAT-box, and GC-box, all of which significantly influence gene expression. The TATA-box is primarily responsible for recruiting\u0026nbsp;\u003cem\u003eRNA\u003c/em\u003e polymerase II (Pol II) and defining the TSS, while the CAAT-box and GC-box can either activate or suppress transcription\u0026nbsp;\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e. In this study, an online tool was employed to predict the promoter region of the pig\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene. Six high-scoring core promoter regions were identified, each containing typical eukaryotic transcription regulatory elements, including the TATA-box, CAAT-box, and GC-box.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCpG islands are crucial structural elements in eukaryotic gene promoters. They regulate the binding of transcription factors to the promoter by modulating DNA methylation, which in turn affects gene expression\u0026nbsp;\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e6\u003c/sup\u003e\u003csup\u003e,2\u003c/sup\u003e\u003csup\u003e7\u003c/sup\u003e. These islands play a key role in the transcriptional regulation of genes in eukaryotes\u0026nbsp;\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e8\u003c/sup\u003e\u003csup\u003e,2\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. Bioinformatic analysis of the pig\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene identified three CpG islands, two of which are located within the core promoter region, suggesting that DNA methylation may influence the transcriptional activity of\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e. A study investigating human cancer found that the DNA methylation of the\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e promoter is negatively correlated with gene expression. In addition to DNA methylation, promoter deletion analysis is another important approach for studying promoter function\u0026nbsp;\u003csup\u003e30\u003c/sup\u003e. In this study, five truncation fragments of the promoter region, of varying lengths, were generated through 5\u0026apos; end deletion, and dual-luciferase reporter assays revealed that the core promoter region of the pig\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene spans from +210 to -842 bp.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBioinformatic analysis predicted that the core promoter region of the pig\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene harbors binding sites for several transcription factors, including CDX1, MYOD, MYOG, and USF2. Based on these findings, we constructed mutant luciferase reporter plasmids targeting the binding sites of p\u003cem\u003eDHRS3\u003c/em\u003e-CDX1, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOD, p\u003cem\u003eDHRS3\u003c/em\u003e-MYOG, and p\u003cem\u003eDHRS3\u003c/em\u003e-USF2. Caudal - related homeobox 1 (CDX1), a member of the CDX family, has been shown by previous studies to be a crucial transcriptional regulator during mouse development. It exerts significant effects on the morphology of the vertebral column and the development of the intestine\u003csup\u003e31-33\u003c/sup\u003e. Our study revealed that mutations in the CDX1 binding site significantly enhanced the activity of the\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene\u0026apos;s core promoter, suggesting that CDX1 may act as a negative regulator of\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e expression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMyogenic determination factor (MYOD) and myogenin (MYOG), key members of the Myogenic Regulatory Factors (MRFs) family, play essential roles in muscle fiber formation, maturation, and regeneration, contributing to muscle development\u0026nbsp;\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e\u003csup\u003e,3\u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e. Previous studies have demonstrated that MYOD and MYF-5 are essential regulators in the development of mouse skeletal muscle cells and myoblasts. Deletion of both MYOD and MYF-5 completely inhibits the initiation of muscle development in mice, whereas the absence of either gene results in only minor disruptions to muscle development\u0026nbsp;\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e6\u003c/sup\u003e. Furthermore, overexpression of MYOD in sheep fibroblasts can induce their conversion into myoblasts, leading to myotube formation\u0026nbsp;\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e7\u003c/sup\u003e. MYOG plays a critical role in muscle cell differentiation by regulating myoblast fusion and muscle fiber formation\u0026nbsp;\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e8\u003c/sup\u003e. It is essential for early skeletal muscle development and prenatal survival, with MYOG knockout resulting in defects in postnatal muscle development\u003csup\u003e\u0026nbsp;3\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e40\u003c/sup\u003e. Numerous studies have demonstrated that MYOD primarily exerts a tissue-specific regulatory role in skeletal muscle, directing muscle development. While it is expressed in minimal amounts in other tissues, no evidence indicates that MYOD plays a similarly critical regulatory role outside of skeletal muscle. Likewise, MYOG exhibits a high degree of tissue specificity, acting as a key \u0026quot;executor\u0026quot; in muscle tissue development and maturation. There is limited evidence suggesting that MYOG performs a comparable regulatory function in other tissues. In this study, we found that mutations in MYOD and MYOG led to a significant increase in the activity of the core promoter region of the pig\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene, indicating that MYOD and MYOG negatively regulate\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e expression.\u003c/p\u003e\n\u003cp\u003eUpstream Stimulatory Factor (USF), a member of the basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factor family, regulates genes involved in cell growth and metabolism\u0026nbsp;\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e42\u003c/sup\u003e. USF2, in particular, plays a critical role in processes such as embryonic development and metabolism. Studies on USF mutant mice have shown that USF deficiency predisposes to spontaneous seizures, underscoring its vital role in maintaining normal brain function. Moreover, embryonic lethality observed in these mutants further emphasizes the essential role of USF in embryonic development\u0026nbsp;\u003csup\u003e43\u003c/sup\u003e. In this study, mutations in USF2 led to a reduction in the activity of the core promoter region of the pig\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene, suggesting that USF2 functions as a positive regulator of\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e expression. Based on these findings, we hypothesize that\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e may be involved in animal growth and development. Collectively, transcription factors CDX1, MYOD, MYOG, and USF2 can regulate the expression of multiple genes and participate in diverse biological processes related to growth and development. Therefore, we propose that these transcription factors may serve as critical regulators of the\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene. This study may provide a positive reference for further investigations into the transcriptional regulatory mechanisms of the\u0026nbsp;\u003cem\u003eDHRS3\u003c/em\u003e gene.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, this study identified the core promoter region of the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene between +210 and -842 bp, screened potential transcription factors binding to this region, and suggested that USF2 acts as a positive regulator while CDX1, MYOD, and MYOG function as negative regulators of this gene. These findings provide a theoretical basis for subsequent investigations into the regulatory mechanisms of \u003cem\u003eDHRS3\u003c/em\u003e in porcine growth and reproduction.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding sources\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe author(s) declare financial support was received for the research, authorship, and to or publication of this article. This study was supported by Guizhou Provincial Science and Technology Engineering Project [QKHFQ-2018,4007, (002)] and Guizhou Provincial Agricultural Major Industry Scientific Research Engineering Project (QKHKYZ-2019,011).\u003c/p\u003e\n\u003cp\u003eAcknowledgments\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank all the reviewers who participated in the review and all the researchers who helped in the process of writing this manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAuthor contributions\u003c/p\u003e\n\u003cp\u003eHX received funding for this project. JL, YR and HX wrote and revised the manuscript and participated in the production of the images. CJ anf BZ contributes to the acquisition and analysis of data. All authors reviewed and contributed to manuscript drafts and revisions.\u003c/p\u003e\n\u003cp\u003eData availability statement\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript or supplementary information files.\u003c/p\u003e\n\u003cp\u003eConflict of interest\u003c/p\u003e\n\u003cp\u003eThe authors declare that there is no conflict of interest that biased or influenced this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMelissa, M.\u0026amp; Lisa, S. Enzymatic metabolism of vitamin a in developing vertebrate embryos. \u003cem\u003eNutrients\u003c/em\u003e.\u003cstrong\u003e 8,\u003c/strong\u003e 812. https://doi.org/10.3390/nu8120812 (2016)\u003c/li\u003e\n\u003cli\u003eHaeseleer, F., Huang, J., Lebioda, L., Saari, J. C.\u0026amp; Palczewski, K. Molecular characterization of a novel short-chain dehydrogenase/reductase that reduces all-trans-retinal. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e.\u003cstrong\u003e 273,\u003c/strong\u003e 21790. https://doi.org/10.1074/jbc.273.34.21790 (1998)\u003c/li\u003e\n\u003cli\u003eTang, X. H.\u0026amp; Gudas, L. J. Retinoids, retinoic acid receptors, and cancer. \u003cem\u003eAnnual Review of Pathology\u003c/em\u003e.\u003cstrong\u003e 6,\u003c/strong\u003e 345. https://doi.org/10.1146/annurev-pathol-011110-130303 (2011)\u003c/li\u003e\n\u003cli\u003eBlaner, W. S., O Byrne, S. M., Wongsiriroj, N., Kluwe, J., D Ambrosio, D. M.\u0026amp; Jiang, H.; et al. Hepatic stellate cell lipid droplets: a specialized lipid droplet for retinoid storage. \u003cem\u003eBiochimica Et Biophysica Acta\u003c/em\u003e.\u003cstrong\u003e 1791,\u003c/strong\u003e 467-473. https://doi.org/10.1016/j.bbalip.2008.11.001 (2009)\u003c/li\u003e\n\u003cli\u003eTsutsumi, C., Okuno, M., Tannous, L., Piantedosi, R.\u0026amp; Blaner, W. S. Retinoids and retinoid-binding protein expression in rat adipocytes. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e.\u003cstrong\u003e 267,\u003c/strong\u003e 1805-1810. https://doi.org/10.1016/S0021-9258(18)46017-6 (1992)\u003c/li\u003e\n\u003cli\u003eInjoo, H., Eun Ju, L., Hyomin, P., Dodam, M.\u0026amp; Hyo-Soo, K. Retinol from hepatic stellate cells via stra6 induces lipogenesis on hepatocytes during fibrosis. \u003cem\u003eCell Biosci.\u003c/em\u003e\u003cstrong\u003e 11\u003c/strong\u003e, 3. https://doi.org/10.1186/s13578-020-00509-w (2021)\u003c/li\u003e\n\u003cli\u003eGuoxun, C., Sabine, W.\u0026amp; Ralf, W. Vitamin a: too good to be bad? \u003cem\u003eFront. Pharmacol.\u003c/em\u003e\u003cstrong\u003e 14\u003c/strong\u003e, :1186336. https://doi.org/10.3389/fphar.2023.1186336 (2023)\u003c/li\u003e\n\u003cli\u003eTakatsuka, J., Takahashi, N.\u0026amp; De Luca, L. M. Retinoic acid metabolism and inhibition of cell proliferation: an unexpected liaison. \u003cem\u003eCancer Res.\u003c/em\u003e\u003cstrong\u003e 56,\u003c/strong\u003e 675-678. (1996)\u003c/li\u003e\n\u003cli\u003eLivera, G., Rouiller-Fabre, V., Pairault, C., Levacher, C.\u0026amp; Habert, R. Regulation and perturbation of testicular functions by vitamin a. \u003cem\u003eReproduction\u003c/em\u003e.\u003cstrong\u003e 124,\u003c/strong\u003e 173-180. https://doi.org/10.1530/rep.0.1240173 (2002)\u003c/li\u003e\n\u003cli\u003eMaya W, H., Arie B, V.\u0026amp; J Bernd, H. Retinoids in health and disease: a role for hepatic stellate cells in affecting retinoid levels. \u003cem\u003eBiochim. Biophys. Acta Mol. Cell Biol. Lipids\u003c/em\u003e.\u003cstrong\u003e 1865\u003c/strong\u003e, 158674. https://doi.org/10.1016/j.bbalip.2020.158674 (2020)\u003c/li\u003e\n\u003cli\u003eBillings, S. E., Pierzchalski, K., Tjaden, N. E. B., Pang, X. Y.\u0026amp; Moise, A. R. The retinaldehyde reductase \u003cem\u003eDHRS3\u003c/em\u003e is essential for preventing the formation of excess retinoic acid during embryonic development. \u003cem\u003eFaseb Journal Official Publication of the Federation of American Societies for Experimental Biology\u003c/em\u003e.\u003cstrong\u003e 27,\u003c/strong\u003e 4877-4889. https://doi.org/10.1096/fj.13-227967 (2013)\u003c/li\u003e\n\u003cli\u003eFeng, L., Hernandez, R. E., Waxman, J. S., Yelon, D.\u0026amp; Moens, C. B. \u003cem\u003eDHRS3\u003c/em\u003ea regulates retinoic acid biosynthesis through a feedback inhibition mechanism. \u003cem\u003eDev. Biol.\u003c/em\u003e\u003cstrong\u003e 338,\u003c/strong\u003e 1-14. https://doi.org/10.1016/j.ydbio.2009.10.029 (2010)\u003c/li\u003e\n\u003cli\u003eStigliani, S., Amaro, A., Reggiani, F., Maccarini, E., Massarotti, C.\u0026amp; Lambertini, M.; et al. P-098\u0026emsp;cryopreservation process deregulates the expression of pathways important for fertility in human spermatozoa. \u003cem\u003eHum. Reprod.\u003c/em\u003e\u003cstrong\u003e 38,\u003c/strong\u003e dead93-dead462. https://doi.org/10.1093/humrep/dead093.462 (2023)\u003c/li\u003e\n\u003cli\u003eLundov\u0026aacute;, T., Zemanov\u0026aacute;, L., Malčekov\u0026aacute;, B., Skarka, A., \u0026scaron;tambergov\u0026aacute;, H.\u0026amp; Havr\u0026aacute;nkov\u0026aacute;, J.; et al. Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (\u003cem\u003eDHRS3\u003c/em\u003e). \u003cem\u003eChem. Biol. Interact.\u003c/em\u003e\u003cstrong\u003e 234,\u003c/strong\u003e 178-187. https://doi.org/10.1016/j.cbi.2014.10.018 (2015)\u003c/li\u003e\n\u003cli\u003eWen-Yu, Z., Jia-Hui, X., Chun-Yu, Z., Hui-Li, T., Shu-Feng, L.\u0026amp; Yun-Qin, Y. Effects of \u003cem\u003eDHRS3\u003c/em\u003e in c2c12 myoblast differentiation and mouse skeletal muscle injury. \u003cem\u003eJournal of Northeast Agricultural University (English Edition)\u003c/em\u003e.\u003cstrong\u003e 28,\u003c/strong\u003e 10 (2021)\u003c/li\u003e\n\u003cli\u003eJingjing, T., Yihui, D., Binbin, W., Mengmeng, J., Hongyan, L.\u0026amp; Yun, X.; et al. Hif1\u0026alpha;/\u003cem\u003eDHRS3\u003c/em\u003ea pathway participates in lipid droplet accumulation via retinol and ppar-\u0026gamma; in fish hepatocytes. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e.\u003cstrong\u003e 24\u003c/strong\u003e, 10236. https://doi.org/10.3390/ijms241210236 (2023)\u003c/li\u003e\n\u003cli\u003eZolfaghari, R., Chen, Q.\u0026amp; Ross, A. C. \u003cem\u003eDHRS3\u003c/em\u003e, a retinal reductase, is differentially regulated by retinoic acid and lipopolysaccharide-induced inflammation in thp-1 cells and rat liver. \u003cem\u003eAmerican Journal of Physiology Gastrointestinal \u0026amp; Liver Physiology\u003c/em\u003e.\u003cstrong\u003e 303,\u003c/strong\u003e G578. https://doi.org/10.1152/ajpgi.00234.2012 (2012)\u003c/li\u003e\n\u003cli\u003eRichard K T, K., Yonglong, C., Sun-On, C., Wood-Yee, C., Igor B, D.\u0026amp; Hui, Z. Developmental expression of xenopus short-chain dehydrogenase/reductase 3. \u003cem\u003eInt. J. Dev. Biol.\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 1355-1360. https://doi.org/10.1387/ijdb.092984rk (2010)\u003c/li\u003e\n\u003cli\u003eDeisenroth, C., Itahana, Y., Tollini, L., Jin, A.\u0026amp; Zhang, Y. P53-inducible \u003cem\u003eDHRS3\u003c/em\u003e is an endoplasmic reticulum protein associated with lipid droplet accumulation. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e.\u003cstrong\u003e 286,\u003c/strong\u003e 28343-28356. https://doi.org/10.1074/jbc.M111.254227 (2011)\u003c/li\u003e\n\u003cli\u003eZhang, S., Chen, X., Huang, Z., Chen, D., Yu, B.\u0026amp; Chen, H.; et al. Leucine promotes differentiation of porcine myoblasts through the protein kinase b (akt)/forkhead box o1 signalling pathway. \u003cem\u003eThe British Journal of Nutrition\u003c/em\u003e.\u003cstrong\u003e 119,\u003c/strong\u003e 727-733. https://doi.org/10.1017/S0007114518000181. (2018)\u003c/li\u003e\n\u003cli\u003eYang, T., Chen, X. L., Huang, Z. Q., Wen, W. X., Xu, M.\u0026amp; Chen, D. W.; et al. Microrna-27a promotes porcine myoblast proliferation by downregulating myostatin expression. \u003cem\u003eAnimal\u003c/em\u003e.\u003cstrong\u003e 8,\u003c/strong\u003e 1867-1872. https://doi.org/10.1017/S1751731114001694 (2014)\u003c/li\u003e\n\u003cli\u003eLivak, K. J.\u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative pcr and the 2\u0026minus;\u0026delta;\u0026delta;ct method. \u003cem\u003eMethods\u003c/em\u003e.\u003cstrong\u003e 25,\u003c/strong\u003e 402-408. https://doi.org/10.1006/meth.2001.1262 (2001)\u003c/li\u003e\n\u003cli\u003eAditi, K.\u0026amp; Manju, B. Structural properties of promoters: similarities and differences between prokaryotes and eukaryotes. \u003cem\u003eNucleic. Acids. Res.\u003c/em\u003e\u003cstrong\u003e 33\u003c/strong\u003e, 3165\u0026ndash;3175. https://doi.org/10.1093/nar/gki627 (2005)\u003c/li\u003e\n\u003cli\u003eKageyama, R., Merlino, G. T.\u0026amp; Pastan, I. Nuclear factor etf specifically stimulates transcription from promoters without a tata box. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e\u003cstrong\u003e 264, \u003c/strong\u003e15508-15514. https://doi.org/10.1016/S0021-9258(19)84859-7 (1989)\u003c/li\u003e\n\u003cli\u003eBernardini, A., Hollinger, C., Willgenss, D., M\u0026uuml;ller, F., Devys, D.\u0026amp; Tora, L. Transcription factor iid parks and drives preinitiation complexes at sharp or broad promoters. \u003cem\u003eTrends Biochem.Sci.\u003c/em\u003e\u003cstrong\u003e 48,\u003c/strong\u003e 839-848. https://doi.org/10.1016/j.tibs.2023.07.009 (2023)\u003c/li\u003e\n\u003cli\u003eYong, X., Qinxi, C., Qingbo, L., Canxin, L.\u0026amp; Weisheng, C. The expression level of chicken telomerase reverse transcriptase in tumors induced by alv-j is positively correlated with methylation and mutation of its promoter region. \u003cem\u003eVet. Res.\u003c/em\u003e\u003cstrong\u003e 53\u003c/strong\u003e, 49. https://doi.org/10.1186/s13567-022-01069-2 (2022)\u003c/li\u003e\n\u003cli\u003eYoung Mi, O., Marcus, M., Eric E, E., Kathleen M, L., Guoyan, Z.\u0026amp; Valeria, C. Epigenetic regulator uhrf1 inactivates rest and growth suppressor gene expression via dna methylation to promote axon regeneration. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e\u003cstrong\u003e 115\u003c/strong\u003e, E12417-E12426. https://doi.org/10.1073/pnas.1812518115 (2018)\u003c/li\u003e\n\u003cli\u003eDeaton, A. M.\u0026amp; Bird, A. Cpg islands and the regulation of transcription. \u003cem\u003eGenes. Dev.\u003c/em\u003e\u003cstrong\u003e 25,\u003c/strong\u003e 1010-1022. http://www.genesdev.org/cgi/doi/10.1101/gad.2037511 (2011)\u003c/li\u003e\n\u003cli\u003eAngeloni, A.\u0026amp; Bogdanovic, O. Sequence determinants, function, and evolution of cpg islands. \u003cem\u003eBiochem. Soc. Trans.\u003c/em\u003e\u003cstrong\u003e 49,\u003c/strong\u003e 1109-1119. https://doi.org/10.1042/BST20200695 (2021)\u003c/li\u003e\n\u003cli\u003eSha, S., Kong, X., Chen, F., Sun, X., Hu, S.\u0026amp; Bai, B.; et al. Hypermethylation of \u003cem\u003eDHRS3\u003c/em\u003e as a novel tumor suppressor involved in tumor growth and prognosis in gastric cancer. \u003cem\u003eFront. Cell. Dev. Biol.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 624871. http://dx.doi.org/10.3389/fcell.2021.624871 (2021)\u003c/li\u003e\n\u003cli\u003eEric, V. D. A., Sylvie, F., Kallayanee, C., Wim, D. G., Felix, B.\u0026amp; Barbara I, M.; et al. Cdx1 and cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. \u003cem\u003eDevelopment.\u003c/em\u003e\u003cstrong\u003e 129\u003c/strong\u003e, 2181\u0026ndash;2193. https://doi.org/10.1242/dev.129.9.2181 (2002)\u003c/li\u003e\n\u003cli\u003eSubramanian, V., Meyer, B. I.\u0026amp; Gruss, P. Disruption of the murine homeobox gene cdx1 affects axial skeletal identities by altering the mesodermal expression domains of hox genes. \u003cem\u003eCell\u003c/em\u003e.\u003cstrong\u003e 83,\u003c/strong\u003e 641-653. https://doi.org/10.1016/0092-8674(95)90104-3 (1995)\u003c/li\u003e\n\u003cli\u003eSilberg, D. G., Swain, G. P., Suh, E. R.\u0026amp; Traber, P. G. Cdx1 and cdx2 expression during intestinal development. \u003cem\u003eGastroenterology\u003c/em\u003e.\u003cstrong\u003e 119,\u003c/strong\u003e 961-971. https://doi.org/10.1053/gast.2000.18142 (2000)\u003c/li\u003e\n\u003cli\u003eDavis, R. L., Weintraub, H.\u0026amp; Lassar, A. B. Expression of a single transfected cdna converts fibroblasts to myoblasts. \u003cem\u003eCell\u003c/em\u003e.\u003cstrong\u003e 51,\u003c/strong\u003e 987-1000. https://doi.org/10.1002/j.1460-2075.1989.tb03429.x (1987)\u003c/li\u003e\n\u003cli\u003eBraun, T., Buschhausen Denker, G., Bober, E., Tannich, E.\u0026amp; Arnold, H. H. A novel human muscle factor related to but distinct from myod1 induces myogenic conversion in 10t1/2 fibroblasts. \u003cem\u003eThe Embo Journal\u003c/em\u003e.\u003cstrong\u003e 8,\u003c/strong\u003e 701-709. https://doi.org/10.1002/j.1460-2075.1989.tb03429.x (1989)\u003c/li\u003e\n\u003cli\u003eRudnicki, M. A., Schnegelsberg, P. N. J., Stead, R. H., Braun, T., Arnold, H.\u0026amp; Jaenisch, R. Myod or myf-5 is required for the formation of skeletal muscle. \u003cem\u003eCell\u003c/em\u003e.\u003cstrong\u003e 75,\u003c/strong\u003e 1351-1359. 10.1016/0092-8674(93)90621-v https://doi.org/10.1016/0092-8674(93)90621-V (1993)\u003c/li\u003e\n\u003cli\u003eSousa-Junior, L. P. B., Meira, A. N., Azevedo, H. C., Muniz, E. N., Coutinho, L. L.\u0026amp; Mour\u0026atilde;o, G. B.; et al. Variants in myostatin and myod family genes are associated with meat quality traits in santa in\u0026ecirc;s sheep. \u003cem\u003eAnim. Biotechnol.\u003c/em\u003e\u003cstrong\u003e 33,\u003c/strong\u003e 201-213. https://doi.org/10.1080/10495398.2020.1781651 (2022)\u003c/li\u003e\n\u003cli\u003eAdhikari, A., Kim, W.\u0026amp; Davie, J. Myogenin is required for assembly of the transcription machinery on muscle genes during skeletal muscle differentiation. \u003cem\u003ePlos One\u003c/em\u003e.\u003cstrong\u003e 16,\u003c/strong\u003e e245618. https://doi.org/10.1371/journal.pone.0245618 (2021)\u003c/li\u003e\n\u003cli\u003eGanassi, M., Badodi, S., Wanders, K., Zammit, P. S.\u0026amp; Hughes, S. M. Myogenin is an essential regulator of adult myofibre growth and muscle stem cell homeostasis. \u003cem\u003eElife\u003c/em\u003e.\u003cstrong\u003e 9\u003c/strong\u003e, e60445. https://doi.org/10.7554/eLife.60445 (2020)\u003c/li\u003e\n\u003cli\u003eBharathy, N., Ling, B. M. T.\u0026amp; Taneja, R. Epigenetic regulation of skeletal muscle development and differentiation. \u003cem\u003eSub-Cellular Biochemistry\u003c/em\u003e.\u003cstrong\u003e 61,\u003c/strong\u003e 139-150. https://link.springer.com/chapter/10.1007/978-94-007-4525-4_7 (2013)\u003c/li\u003e\n\u003cli\u003eVallet, V. S., Casado, M., Henriona, A. A., Bucchini, D., Raymondjean, M.\u0026amp; Kahn, A.; et al. Differential roles of upstream stimulatory factors 1 and 2 in the transcriptional response of liver genes to glucose. \u003cem\u003eThe Journal of Biological Chemistry\u003c/em\u003e.\u003cstrong\u003e 273,\u003c/strong\u003e 20175-20179. https://doi.org/10.1074/jbc.273.32.20175 (1998)\u003c/li\u003e\n\u003cli\u003eWutthisathapornchai, A., Vongpipatana, T., Muangsawat, S., Boonsaen, T., Macdonald, M. J.\u0026amp; Jitrapakdee, S. Multiple e-boxes in the distal promoter of the rat pyruvate carboxylase gene function as a glucose-responsive element. \u003cem\u003ePlos One\u003c/em\u003e.\u003cstrong\u003e 9,\u003c/strong\u003e e102730. https://doi.org/10.1371/journal.pone.0102730 (2014)\u003c/li\u003e\n\u003cli\u003eSirito, M., Lin, Q., M, D. J., Behringer, R. R.\u0026amp; Sawadogo, M. Overlapping roles and asymmetrical cross-regulation of the usf proteins in mice. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e\u003cstrong\u003e 95,\u003c/strong\u003e 3758-3763. https://doi.org/10.1073/pnas.95.7.3758 (1998)\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Porcine, DHRS3, Promoter, Transcription factor","lastPublishedDoi":"10.21203/rs.3.rs-5175349/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5175349/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDehydrogenase/Reductase (SDR) Family Member 3 (\u003cem\u003eDHRS3\u003c/em\u003e, also known as Rsdr1 and retSDR1) is a membrane-bound enzyme with critical roles in embryonic development and animal growth. Studying the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene promoter can provide a foundation for understanding growth, development, and reproduction in pigs. In this study, we first analyzed the promoter region structure of the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene and constructed five promoter region dual-luciferase reporter vectors with sequential deletion fragments. Through dual-luciferase assays, all five truncated promoter reporter constructs exhibited transcriptional activity, with the core promoter region localized between +210 bp and -842 bp. Bioinformatics analysis then predicted key transcription factors in this region. Combining site-directed mutagenesis and RNA interference experiments, we demonstrated that mutation or knockdown of CDX1, MYOD, and MYOG transcription factor binding sites significantly increased transcriptional activity compared to wild-type controls, whereas USF2 site mutation or knockdown resulted in significantly decreased activity (\u003cem\u003eP\u0026lt;\u003c/em\u003e0.05). These results suggest that CDX1, MYOD, and MYOG negatively regulate the porcine \u003cem\u003eDHRS3\u003c/em\u003e gene, while USF2 acts as a positive regulator. These findings suggest the potential for further genetic and breeding applications aimed at modulating the \u003cem\u003eDHRS3 \u003c/em\u003egene expression in pigs.\u003c/p\u003e","manuscriptTitle":"Analysis of core promoter and transcription factors screening of porcine DHRS3 gene","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-04 05:34:51","doi":"10.21203/rs.3.rs-5175349/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4c8564f0-3b67-47dc-8faf-8bf237f12e38","owner":[],"postedDate":"April 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":46644123,"name":"Biological sciences/Genetics/Gene regulation"},{"id":46644124,"name":"Biological sciences/Molecular biology/Transcription"},{"id":46644125,"name":"Biological sciences/Cell biology"},{"id":46644126,"name":"Biological sciences/Genetics"}],"tags":[],"updatedAt":"2025-06-30T05:24:18+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-04 05:34:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5175349","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5175349","identity":"rs-5175349","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}