Sex difference in BAT thermogenesis depends on PGC-1α-ChREBPβ mediated de novo lipogenesis in mice

Sex difference in BAT thermogenesis depends on PGC-1α-ChREBPβ mediated de novo lipogenesis in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Article Sex difference in BAT thermogenesis depends on PGC-1α-ChREBPβ mediated de novo lipogenesis in mice Kazutaka Tsujimoto, Akira Takeuchi, Kenji Ikeda, Jun Aoki, Yoshihiro Niitsu, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3968646/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Jul, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract Brown adipose tissue (BAT), a thermogenic tissue that plays an important role in systemic energy expenditure, has histological and functional sex differences. BAT thermogenic activity is higher in female mice than in male mice. However, the molecular mechanism underlying this functional sex difference has not been fully elucidated. Herein, we demonstrate the role and mechanism of PGC-1α in this sex difference. Inducible adipocyte-specific PGC-1α knockout (KO) mice displayed decreased BAT thermogenesis only in females. Expression of carbohydrate response-element binding protein beta (Chrebpβ) and downstream de novo lipogenesis (DNL) related genes were both reduced only in female KO mice. BAT-specific knockdown of Chrebpβ reduced the DNL-related gene expression and BAT thermogenesis in female wild-type mice. Furthermore, PGC-1α enhanced the sensitivity of female BAT estrogen signaling, thereby increasing Chrebpβ and its downstream DNL-related gene expression. These findings demonstrate that PGC-1α-ChREBPβ mediated DNL plays a pivotal role in BAT thermogenesis in a sex-dependent manner. Biological sciences/Molecular biology Health sciences/Diseases/Endocrine system and metabolic diseases/Metabolic syndrome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Obesity is a major risk factor for type 2 diabetes mellitus, various metabolic diseases, and cardiovascular diseases, and its growing prevalence is a serious public health crisis 1 . Conversely, while the frequency of obesity in women is reported to be comparable to that in men or slightly higher 1, 2 , the prevalence of diabetes or cardiovascular disease, especially in premenopausal women, is clearly lower than that in men of the same ages 2, 3 . Although there have been various reports on the “metabolic advantage of women” from the viewpoints of sex hormones, chromosomes, and lifestyle 4 , the underlying molecular mechanism has not yet been fully elucidated. Brown adipose tissue (BAT) has the unique ability to catabolize energy substrates and release them as thermal energy, and numerous reports have established the importance of BAT in human energy metabolism 5 . In recent years, it has also been reported that the presence of BAT is inversely correlated with the risk of diabetes and cardiovascular disease 6 . Therefore, BAT is expected to be a promising target for the treatment of these diseases. Notably, it has been reported that BAT in females surpasses that in males in terms of prevalence, quantity, and metabolic activity, exhibiting a higher level in each of these aspects 6 . Therefore, BAT is considered a potential mechanism contributing to the metabolic advantage observed in women. Studies in rodents have already revealed that BAT has the potential to reduce obesity and impaired glucose tolerance by increasing energy expenditure 7 . Moreover, several reports have shown histological and functional sex differences in rodent BAT, including that female rat BAT has larger and more densely populated mitochondria than males, that female BAT initiates lipolysis with weaker β3-adrenergic stimulation 8 , and that uncoupling protein-1(UCP1), which is responsible for thermogenesis in BAT, is more highly expressed in female 9 . These findings indicate that female BAT has higher metabolic activity than male BAT. However, the molecular mechanism underlying these sex differences in the function of BAT has not been fully elucidated. Peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α) is a transcriptional coactivator that acts as a master regulator of mitochondrial metabolism and is responsible for the transcription of genes involved in the mitochondrial electron transport chain, fatty acid oxidation, and oxidative stress management in response to cellular energy demand 10 . Although PGC-1α is regarded as a key regulator of thermogenesis in BAT, a report on adipocyte-specific Pgc1a knockout male mice 11 showed only minor changes in BAT gene expression and histology, and the prominent metabolic phenotype observed was impaired glucose tolerance rather than cold intolerance 11 . Therefore, the in vivo role of PGC-1α in BAT has not been fully clarified. In this study, we found a sex difference in PGC-1α function in BAT and further showed that PGC-1α in the BAT of female mice serves a unique role in thermogenesis regulation, distinct from its function in males, and plays a pivotal role in regulating systemic energy expenditure. Results PGC-1α deletion in BAT suppresses thermogenesis and impairs acute cold tolerance only in female mice. We first examined PGC-1α gene and protein expression in BAT of male and female mice. Female mice BAT expressed significantly higher PGC-1α compared to male mice, whereas there was no sex difference in white adipose tissue (WAT), and its expression was much lower than that in BAT at room temperature (Fig. 1 a, b). Sex differences in Pgc1a expression in BAT were attenuated under thermoneutral conditions and enhanced under cold exposure (Fig. 1 c). In addition, the adenylate cyclase 3 (Adcy3) gene, which has been reported to be a marker gene of brown adipocytes 12 and cause severe obesity by its loss-of-function mutation in human 13,14 , exhibited higher expression in female mice than in male mice (Fig S1a) and showed a strong positive correlation with Pgc1a expression in both sexes (Fig S1b). Moreover, the cAMP level in BAT upon norepinephrine (NE) administration was significantly higher in females than in males (Fig S1c). These results suggest that equivalent adrenergic stimulation results in more robust intracellular signaling in female BAT, which may contribute to the sex difference in Pgc1a gene expression. Next, to explore the biological significance of Pgc1a highly expressed in female BAT, we generated acquired adipocyte-specific Pgc1a knockout (KO) mice using tamoxifen (TMX)-inducible Adipoq-Cre-ERT2 mice, which express Cre recombinase under the regulatory elements of Adipoq (referred to as Male control, Male KO, Female Control, and Female KO, respectively). Considering the possible effect of TMX on sex differences, the following analyses were performed at least 8 weeks after administration (Fig S1d, e). Using sexually mature male and female Pgc1a KO mice, rectal temperature was measured under acute cold exposure, along with controls. While the rectal temperature of Male KO mice did not show any significant difference compared with that of Male Control mice, Female KO mice exhibited a markedly lower rectal temperature compared with that of Female Control mice (Fig. 1 d). Similar results were obtained from the thermographic measurement of the interscapular surface temperature, an indicator of BAT-derived thermogenesis (Fig. 1 e, f). We additionally measured the enhancement of oxygen consumption (VO2) after NE administration, which mainly reflects BAT function. Male KO mice showed no significant difference in VO2 compared with Male Control mice, whereas Female KO mice showed a marked decrease in VO2 compared with Female Control mice (Fig. 1 g). On the other hand, the glucose tolerance test showed that glucose tolerance was markedly reduced in Male KO mice (Fig S1f), which is consistent with the result of male congenital adipocyte-specific Pgc1a knockout mice reported in a previous study 11 . These results suggest that PGC-1α in female BAT plays a crucial role in thermogenesis upon adrenergic stimulation, possibly contributing to the cold tolerance of female mice. PGC-1α deletion abolishes the augmented mitochondrial membrane structure specific to female BAT Since PGC-1α facilitates mitochondrial biogenesis 10 , we next examined the mitochondrial morphology in BAT of Control and KO mice of both sexes. We found that Female Control mice had larger mitochondria and denser cristae compared with Male Control mice by electron microscopy imaging of BAT (Fig. 2 a, b). Quantitative analysis showed a significantly longer total cristae length per mitochondrion in Female Control mice than in Male Control mice (Fig. 2 c). However, only Female KO mice exhibited a decrease in mitochondrial size and disruption or loss of cristae, resulting in a significant reduction in the total cristae length per mitochondrion. (Fig. 2 a–c). Assuming that PGC-1α deletion is involved in the observed mitochondrial membrane structure degradation in BAT of Female KO mice, we then performed protein expression analysis of mitochondrial electron transport chain complexes in BAT of Control and KO mice of both sexes. We observed higher protein expression of electron transport chain complexes in Female Control mice than in Male Control mice, particularly that of Complex I and Complex IV. However, the expression of these complexes was reduced due to PGC-1α deletion only in female mice (Fig. 2 d). Nuclear respiratory factor 1 (NRF-1) and Transcription factor A (TFAM), which have been reported to play an important role in mitochondrial regulation by PGC-1α 15,16 , as well as the genes responsible for mitochondrial fusion/fission (Mitofusin-1; Mfn1, Mitofusin-2; Mfn2, Optic atrophy 1; Opa1 and Dynamin-related protein 1; Drp1), were expressed significantly higher in females than in males, but were unchanged or mildly reduced in females due to PGC-1α deletion (Fig S2). These results prompted us the hypothesis that PGC-1α in female BAT may regulate mitochondrial morphology and function in a manner other than canonical pathways, such as transcriptional regulation of NRF-1/TFAM or mitochondrial fusion/fission-related genes. PGC-1α deletion downregulates DNL-related gene expression only in female BAT To investigate the mechanism by which PGC-1α in female BAT contributes to enhanced thermogenesis and augmented mitochondrial membrane structure, RNA-seq analysis was performed in the BAT of Control and KO mice of both sexes. The expression of 182 genes was downregulated in Male KO mice compared with Male Control mice, and 240 genes were downregulated in Female KO mice compared with Female Control mice. Only 47 genes were downregulated in both sexes (Fig. 3 a). These results suggest that the genes transcriptionally regulated by PGC-1α are widely different between male and female mice. We next performed gene ontology analysis of genes downregulated only in female mice due to PGC-1α deletion, which revealed enrichment in central carbon metabolism-related pathways such as “NADH regeneration, canonical glycolysis, and fatty acid derivative biosynthetic process” (Fig. 3 b). In particular, the expression of genes related to de novo lipogenesis (DNL) and carbohydrate response-element binding protein beta (Chrebpβ), a transcriptional regulator of DNL 17 , was markedly downregulated only in Female KO mice (Fig. 3 c). These results suggest that PGC-1α in female BAT is responsible for the transcriptional regulation of genes related to central carbon metabolism and DNL. PGC-1α deletion suppresses mitochondrial TCA cycle metabolism only in female BAT To investigate the dynamics of energy substrate metabolism, we performed metabolomic analysis of central carbon metabolism in the BAT of Control and KO mice of both sexes. As shown in (Fig. 4 a), heatmap analysis revealed marked differences between Male Control and Female Control mice, as well as between Female Control and Female KO mice. Among the 116 metabolites analyzed, there were 54 metabolites that were higher in Female Control mice than in Male Control mice but were lower in Female KO mice than in Female Control mice. Enrichment analysis of metabolic pathways showed that the citric acid cycle, ketones body metabolism, and butyrate metabolism pathways were significantly altered in Female KO mice compared with female control mice (Fig. 4 b). Principal component analysis showed a large difference between Female Control and Female KO mice, whereas only a small difference between Male Control and Male KO mice was observed (Fig. 4 c). The top 5 metabolites contributing positively to PC2, defining the difference between female control and female KO mice, include NADH and tricarboxylic acid (TCA) cycle intermediates such as fumaric acid, malic acid, and acetyl-CoA (Fig. 4 d). Actually, TCA cycle intermediates were more abundant in female control mice than in male control mice and significantly decreased only in female KO mice (Fig. 4 e). In addition, in females, a positive correlation was observed between the levels of TCA cycle metabolites and the peak of VO2 upon NE administration (Fig. 4 f), suggesting that in female BAT, the activity of the TCA cycle may be a primary determinant of thermogenesis by acute adrenergic stimulation. PGC-1α deletion in female BAT modulates mitochondrial membrane lipid profiles, including cardiolipin DNL is involved in controlling lipid profiles in BAT 17,18 . Considering these findings, along with the mitochondrial morphological and functional defects and downregulation of DNL-related genes observed in the BAT of Female KO mice, we speculated that female PGC-1α may affect BAT mitochondrial membrane lipid profile through DNL. Therefore, we performed lipidomics analysis in the BAT of Control and KO mice of both sexes. The analysis showed, first that the overall lipid profile of the BAT was significantly different between males and females, with females having less triglycerides and more abundant glycerophospholipids, which comprise the membranes of cells and organelles, compared with males (Fig. 5 a). These results are consistent with those of a previous study of lipidomics analysis in BAT of male and female wild-type mice 19 . Partial least squares (PLS) analysis also revealed that phospholipids with fatty acid residues with C > 17 were more abundant in females than in males, and this pattern remained consistent even in PGC-1α KO mice (Fig. 5 b, c, Fig S3). We next examined changes in cardiolipin (CL), a phospholipid specifically localized in the mitochondrial membrane and essential for regulating its morphology and respiratory capacity 20 . The percentage of total CL was higher in Female Control mice than in Male Control mice and did not change significantly in female KO mice (Fig. 5 d). However, the percentage of CL(18:2)4 molecule, which plays an essential role in regulating mitochondrial respiratory capacity 20–22 , constituted the largest proportion of total CL in BAT (Fig. 5 e) and was significantly higher in Female Control mice than in Male Control mice (Fig. 5 f). In addition, in Female KO mice, this ratio was significantly reduced to a level similar to that observed in Male mice. We also found that many species of ether-linked phospholipids (Fig. 5 g, h) and coenzyme Q (CoQ) (Fig. 5 i) were more abundant in Female Control mice than in Male Control mice, and their levels were significantly reduced only in Female KO mice (Fig. 5 g-i). Taken together, the lipidomics analysis revealed that sex differences exist in the phospholipid profiles of BAT and that female PGC-1α regulates the profiles of CL, ether-linked phospholipids, and coenzyme Q, all of which are crucial for mitochondrial respiratory function. ChREBPβ-mediated DNL regulates thermogenesis and mitochondrial membrane structure in female BAT The aforementioned data suggest that in female BAT PGC-1α regulates thermogenesis by controlling the mitochondrial membrane structure and that ChREBPβ plays a pivotal role in this regulation. To further test this hypothesis, we performed Chrebp knockdown in the BAT of female mice by injecting adeno-associated viruses (AAV) containing short hairpin RNA (shRNA) targeting Chrebp (AAV-shChrebp) or scramble shRNA (AAV-Scramble) into the interscapular BAT. One week after AAV injection, in the BAT of AAV-shChrebp mice, the expression of Chrebpβ and its downstream DNL-related genes were markedly reduced (Fig. 6 a), whereas the expression of Pgc1a was significantly increased compared with that in AAV-Scramble mice (Fig. 6 b). In addition, AAV-shChrebp mice displayed reduced BAT tissue weight and fat droplet size compared with AAV-Scramble mice (Fig. 6 c, d), indicating that DNL was actually inhibited in the BAT of AAV-shChrebp mice. At this point, we found that VO2 upon NE administration in the AAV-shChrebp mice was significantly lower than that in the AAV-Scramble mice (Fig. 6 e). Electron microscopic examination of mitochondria showed that the total cristae length per mitochondrion was significantly shorter and the size of mitochondria was also significantly reduced in the AAV-shChrebp mice compared with the AAV-Scramble mice (Fig. 6 f-h). The results demonstrated that the phenotype observed only in female BAT due to PGC-1α deletion was recapitulated by Chrebp knockdown. Estrogen signaling and PGC-1α interdependently regulate the expression of DNL-related genes in female BAT, thereby contributing to thermogenesis and mitochondrial membrane structure Because estrogen has previously been implicated in contributing to sex differences in BAT 23 , we investigated the interaction between the female BAT-specific role of PGC-1α and estrogen signaling. We administered the estrogen receptor antagonist TMX or vehicle (Veh) to male and female wild-type mice and measured VO2 upon NE administration, 1 week after TMX treatment (Fig S4a, b). In males, no difference was observed between the TMX-treated and Veh-treated mice, whereas in females, VO2 was significantly lower in the TMX-treated mice than in the Veh-treated mice (Fig. 7 a). Electron microscopic images of BAT showed that the length of mitochondrial cristae was significantly shortened by TMX treatment only in females (Fig. 7 b, c). In addition, transcriptome analysis of BAT revealed that genes involved in energy substrate metabolism, especially in DNL, were downregulated by TMX treatment only in female mice (Fig. 7 d-f). These results demonstrated that PGC-1α KO and TMX treatment share many metabolic phenotypes, histological changes, and transcriptional alterations only in female BAT. However, TMX treatment did not downregulate Pgc1a expression in female BAT (Fig. 7 g), and a similar tendency was observed in ovariectomized mice (Fig S4c). Estrogen signaling upregulates the expression of DNL-related genes in a PGC-1α-dependent manner only in female BAT To investigate whether sex differences exist in the regulation of DNL-related gene expression in BAT by estrogen signaling, we performed an ex vivo experiment in which 17β estradiol (E2) was applied to BAT explants from male and female wild-type mice. E2 treatment did not alter the expression of Chrebpβ and DNL-related genes in male BAT; however, it increased the expression of Chrebpβ and DNL-related genes in female BAT (Fig S4d). In addition, the substantial increase in gene expression with E2 treatment observed in BAT from Female Control mice was attenuated in BAT from Female KO mice (Fig. 7 h). To further investigate the mechanisms underlying sex differences in the PGC-1α dependent estrogen responsiveness, we examined the expression of Esr1, the gene encoding ERα, in the BAT of Control and KO mice of both sexes. We found that Esr1 gene expression was significantly higher in female BAT than in male, but not affected by PGC-1α deletion in both sexes (Fig S4e). Collectively, these results suggest that the downstream molecule(s) of estrogen receptor (ERα) signaling pathway, which regulate Chrebpβ and DNL-related gene expressions, fundamentally differs between male and female BAT, and that PGC-1α plays a pivotal role in this difference. Discussion Here we showed that PGC-1α in BAT of female mice is highly expressed compared with that in male mice and plays a crucial role in regulating systemic energy expenditure by contributing to the maintenance of female BAT-specific cristae-rich mitochondria and high TCA cycle activity. Estrogen signaling interdependently regulates this mechanism with PGC-1α, and ChREBPβ-mediated DNL plays a pivotal role as a central hub of both pathways. In general, the role of PGC-1α in BAT has been recognized to promote thermogenesis through the upregulation of UCP1 expression 24,25 . However, a previous report of adipocyte-specific PGC-1α knockout mice revealed that its main phenotypes include insufficient induction of beige adipose tissue and impaired glucose tolerance, with limited changes in gene expression in BAT 11 . This report was based on male mouse model of congenital PGC-1α knockout, and there have been no investigations into the acquired knockout of PGC-1α in adult male and female adipose tissue. Thus, a distinct role of PGC-1α in female BAT may have been overlooked. In our study, BAT Pgc1a was more highly expressed in females than in males under various conditions, particularly under cold exposure and upon adrenergic stimulation, and its gene expression positively correlated with that of Adcy3. In addition, adipocyte-specific PGC-1α deletion resulted in a lower body temperature during acute cold exposure and suppression of VO2 upon NE administration only in female mice. These data suggests that PGC-1α in BAT of female mice is regulated by strong adrenergic stimulation and contributes to an efficient response to rapidly increasing energy demand. Recently, it was reported that PGC-1α has female-specific functions in some organs. For example, PGC-1α regulates oxidative stress responses in coordination with estrogen signaling in the liver of female mice 26 and intracellular and extracellular calcium dynamics in the female myocardium 27 . Considering the results of these reports and our study, PGC-1α may be a molecule that mediates sex differences across multiple organs, especially the characteristics of females. In this study, we found a distinctive mitochondrial morphology in female BAT, which was characterized by a significantly longer total cristae length and larger size than that in male mice. Moreover, not only in terms of morphology but also in functional aspects, mitochondria in female BAT were found to exhibit high NADH-producing capacity and TCA cycle activity. In previous reports, the significance of TCA cycle metabolism in BAT thermogenesis has been demonstrated 28,29 . We have also shown that these morphological and functional features of BAT in female mice are generated by PGC-1α. CL is a phospholipid that is specific to mitochondrial membranes and is essential for the maintenance of mitochondrial structure, respiratory capacity, and energy substrate metabolism, including the TCA cycle 20,30–32 . CL has also been reported to be a strong regulator of BAT thermogenesis 33 . In this study, we found that the percentage of CL(18:2)4, which is especially important for mitochondrial respiration 20–22 , was higher in females than in males and decreased only in females due to PGC-1α deletion. These data suggest that the percentage of CL (18:2)4 is the major contributing factor to sex differences in mitochondrial structure and thermogenesis in BAT of mice. It was reported that cardiomyocyte PGC-1α/β regulated total CL content and mitochondrial morphology by regulating CDP-diglyceride synthetase 1(CDS1) gene expression, an enzyme in the phospholipid synthesis pathway 34 . However, in our study, CDS1 gene expression in BAT showed little change in both males and females due to PGC-1α deletion (data not shown), suggesting the existence of a tissue-specific molecular mechanism(s) in PGC-1α mediated CL production. Although female mitochondria reportedly exhibit a higher energy-producing capacity than male mitochondria in several mitochondria-rich organs, such as the liver, brain, and skeletal muscle 15 , studies investigating the underlying molecular mechanism are limited. While little is known about sex differences in TCA cycle metabolism, a previous study analyzing human brain samples reported that the activities of enzymes involved in the TCA cycle, such as succinate dehydrogenase and citrate synthase, were higher in females than in males 35 . In addition, a previous study reported that female rats had a higher total CL amount in the liver than males 36,37 but did not analyze the fatty acid profile of CL. Considering these findings, it is probable that sex differences in the fatty acid profiles of CL and their regulatory mechanisms exist in organs/tissues beyond BAT. We observed that estrogen receptor antagonist administration suppressed VO2, impaired mitochondrial structure and reduced expression of Chrebpβ and downstream DNL-related genes only in BAT of female mice without reducing Pgc1a expression. These results suggest that estrogen signaling and PGC-1α interdependently regulate mitochondrial structure and thermogenesis in female BAT, and we further demonstrated that the transcriptional regulation of Chrebpβ serves a central hub in coordinating these two regulatory pathways. There are limited reports on the regulation of DNL by PGC1-α 38 , while the association between DNL and estrogen has been reported in various cells and organs. In estrogen-sensitive breast and gynecological cancers, estrogen signaling promoted DNL, which in turn contributed to cell proliferation 39,40 . Given the high estrogen sensitivity of female BAT, these estrogen-sensitive cancer cells may have mechanisms similar to those of female BAT for maintaining its high metabolic activity. A previous report has shown that estrogen signaling in the central nervous system enhances BAT thermogenesis in female rats by increasing sympathetic nervous system activation 41 . On the other hand, our BAT explant analyses indicated that the regulatory system of estrogen, PGC-1α and DNL in female BAT is tissue-autonomous. Taken together, the previous findings and our results suggest that estrogen signaling may enhance BAT thermogenesis in direct and indirect manners. Based on previous reports that serum estrogen levels are extremely lower in male mice compared to female 42 , the strong involvement of PGC-1α in the estrogen-DNL regulatory mechanism in female BAT may provide one explanation for why the deletion of PGC-1α in male BAT does not result in the same phenotype observed in female BAT. On the other hand, even considering the sex differences in Esr1 expression levels, the absence of an upregulation in DNL-related gene expression in male BAT explants upon direct E2 supplementation suggests that the estrogen-DNL regulatory system itself does not exist in male BAT. The previous report of no enhancement in BAT thermogenesis in male rats following peripheral estrogen administration 43 aligns with our results of the ex vivo experiment. In addition, it has been reported that male-to-female transsexuals undergoing estrogen replacement therapy exhibit a tendency toward obesity. Estrogens have been reported to potentially increase body fat through mechanisms such as the proliferation of preadipocyte 44 . Therefore, estrogen administration to men may increase WAT abundance but may not enhance BAT energy expenditure, which is one possible reason why men cannot benefit from the estrogen that women receive. In summary, our findings demonstrate that PGC-1α in female BAT plays a crucial role in controlling systemic energy expenditure by regulating the distinct morphology and function of mitochondria in coordination with estrogen signaling. While PGC-1α has been generally recognized as a master regulator of mitochondria, we have elucidated a novel mitochondrial regulatory mechanism of PGC-1α specific to female BAT. Given the inverse correlation between BAT and metabolic or cardiovascular disease, it is likely that this mechanism could contribute to the metabolic advantage in females. PGC-1α and estrogen signaling are interdependent in this system, meaning that the absence of either one severely impairs thermogenesis function. This “overdependence” of female BAT on estrogen may in turn explain why postmenopausal women rapidly lose their metabolic advantage, and thus may be a new therapeutic target for metabolic diseases in postmenopausal women. Methods Animals All animal experiments were performed under the guidelines of the Tokyo Medical and Dental University Committee on Animal Research (A2023-020A, G2023-073A) and the Fundamental Guidelines for Proper Conduct of Animal Experiment and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science and Technology of Japan. C57BL/6J wild-type mice were purchased from CLEA Japan, Inc., and Adipoq-CreERT2 (stock number: 025124) and Ppargc1a (Pgc1a) flox/flox (stock number: 009666) mice were purchased from The Jackson Laboratory. To generate tamoxifen-inducible adipocyte-specific PGC-1α knockout (KO) mice, Pgc1a flox/flox mice were crossed with Adipoq-CreERT2 mice. The animals were housed alone at 25°C with a 12-h light/dark cycle and allowed free access to water and a standard diet (CE-2; 343 kcal/100 g, CLEA Japan, Inc.). Eight-week-old male and female KO or Pgc1a flox/flox (Control) mice were injected intraperitoneally with 100 mg/kg tamoxifen (Sigma-Aldrich) for 5 consecutive days and analyzed at least 8 weeks after the last administration of tamoxifen. For the experiment of tamoxifen administration to wild-type mice according to the same protocol and analyzed after 2 weeks. For cold exposure experiments, mice were maintained at thermoneutrality (30°C) in a temperature-controlled chamber (HC-100, Shin Factory, Japan) for one week before cold challenge and allowed free access to water and a standard diet. Food was removed 1 h before the start of cold exposure, and the animals were placed at 4°C. During cold exposure, the rectal temperatures (TD-300, NATSUME, Japan) and interscapular surface temperatures (E53, FLIR Systems Inc, USA) of mice were measured every 30–60 min. The method for measuring interscapular surface temperatures is described in detail in a previous report (1). References 1. Oelkrug, R. & Mittag, J. An improved method for the precise unravelment of non-shivering brown fat thermokinetics. Sci Rep 11 , 4799 (2021). https://doi.org/10.1038/s41598-021-84200-1 NE-Induced oxygen consumption Oxygen consumption was measured using a metabolic chamber (Shin Factory, JAPAN) coupled to a mass spectrometer (ARCO-2000; Arco system, Tokyo, JAPAN). Mice were anesthetized, and measurements were performed for 30 min at 33℃ to obtain basal values. Each mouse was then briefly removed from the chamber, treated with norepinephrine (1 mg norepinephrine/kgBW), and returned to the chamber, and oxygen consumption was measured for another 30–40 min. Glucose tolerance test The glucose tolerance test was performed via an intraperitoneal injection of glucose at 2.0 g/kg body weight, and blood glucose levels were measured before and 15, 30, 60, 90, and 120 min after the injection. Blood glucose was measured using a glucometer (Stat Strip Xpress; Nova biomedical, USA). Western blotting Protein lysates were extracted from Brown adipose tissue using RIPA buffer (nacalai) supplemented with a protease inhibitor cocktail (cOmplete tm , Sigma-Aldrich). Immunoblotting was performed with Anti-PGC-1α Mouse mAb (Sigma-Aldrich, ST1202, 1:1000) and total OXPHOS rodent WB antibody cocktail (Abcam, ab110413, 1:1000). α-tublin (Cell Signaling, #2144, 1:1000) was used as the loading control. Immunoblots were detected and analyzed using ECL Prime Western Blotting Detection Reagent and ImageQuant LAS 4000 mini (GE Healthcare). HE staining BAT was fixed with 4% paraformaldehyde and embedded in paraffin. Sections were stained with hematoxylin and eosin (HE). Electron microscopy The BAT were fixed in 4% PFA and 2.5% GA in 0.1M phosphate buffer (PB) for 2 h, washed with 0.1 M PB, post-fixed in 1% OsO4 buffered with 0.1 M PB for 2 h, dehydrated in a graded series of ethanol, and embedded in Epon 812. Ultrathin sections (70 nm) were collected on copper grids, double-stained with uranyl acetate and lead citrate, and then examined by transmission electron microscopy (JEM-1400Flash, JEOL, Japan). Quantification of mitochondrial size and content was performed using ImageJ software. RNA isolation and quantitative RT-PCR Total RNA was isolated using the RNeasy Plus Universal Mini Kit (Qiagen). cDNA was synthesized using Random Primer (Thermo Fisher Scientific Inc.) and ReverTra Ace (Toyobo Co., Ltd.). Quantitative PCR was performed using the QuantStudio 6 Flex Real-Time PCR System with Fast SYBR Green Master Mix Reagent. The primer sequences are presented in (Supplemental Table 1). RNA sequencing RNA-seq experiments were performed by Novogene (Beijing, China) using RNA extracted from BAT. Sequencing libraries were built using the NEBNext UltraTM RNA Library Prep Kit (Illumina, USA). The library preparations were sequenced on an Illumina Novaseq 6000 platform, and 150-bp paired-end reads were generated. Differentially expressed genes were determined by fold change (>1.5), and gene ontology analysis was conducted using Metasape 3.5. Metabolomics BAT samples for metabolomics were obtained from mice 30 min after NE administration at 33°C to evaluate the metabolic dynamics of BAT exhibiting maximal oxygen consumption. Approximately 25–30 mg of frozen BAT tissue was placed in a homogenization tube along with zirconia beads (5mmφ and 3mmφ). Next, 1,500 µL of 50% acetonitrile/Milli-Q water containing internal standards (H3304-1002, Human Metabolome Technologies, Inc. (HMT), Tsuruoka, Yamagata, Japan) was added to the tube, after which the tissue was completely homogenized at 1,500 rpm, 4°C for 60 s using a bead shaker (Shake Master NEO, Bio Medical Science, Tokyo, Japan). The homogenate was then centrifuged at 2,300 × g, 4°C for 5 min. Subsequently, 800 µL of upper aqueous layer was centrifugally filtered through a Millipore 5-kDa cutoff filter (UltrafreeMC-PLHCC, HMT) at 9,100 ×g, 4°C for 180 min to remove macromolecules. The filtrate was evaporated to dryness under vacuum and reconstituted in 50 µL of Milli-Q water for metabolome analysis at HMT. Metabolome analysis was conducted according to HMT’s C-SCOPE package, using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS) for cation analysis and CE-tandem mass spectrometry (CE-MS/MS) for anion analysis based on the methods described previously (1, 2). Briefly, CE-TOFMS and CE-MS/MS analyses were performed using an Agilent CE capillary electrophoresis system equipped with an Agilent 6210 time-of-flight mass spectrometer (Agilent Technologies, Inc., Santa Clara, CA, USA) and Agilent 6460 Triple Quadrupole LC/MS (Agilent Technologies), respectively. The systems were controlled using Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i. d. × 80 cm total length) with commercial electrophoresis buffer (H3301-1001 and I3302-1023 for cation and anion analyses, respectively, HMT) as the electrolyte. The time-of-flight mass spectrometer was scanned from m/z 50 to 1,000 (1), and the triple quadrupole mass spectrometer was used to detect compounds in dynamic MRM mode. Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (3) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) to obtain peak information, including m/z, peak area, and migration time (MT). Signal peaks were annotated according to the HMT metabolite database based on their m/z values and MTs. The peak area of each metabolite was normalized to internal standards, and the metabolite concentration was evaluated by standard curves with three-point calibrations using each standard compound. Hierarchical cluster analysis and principal component analysis (PCA) (4) were performed using HMT’s proprietary MATLAB and R programs, respectively. Detected metabolites were plotted on metabolic pathway maps using the VANTED software (5). References 1. Ohashi, Y. et al . Depiction of metabolome changes in histidine-starved Escherichia coli by CE-TOFMS. Mol. Biosyst . 4, 135–147, 2008. 2. Ooga, T. et al . Metabolomic anatomy of an animal model revealing homeostatic imbalances in dyslipidaemia. Mol. Biosyst . 7, 1217–1223 (2011). 3. Sugimoto, M., Wong, D. T., Hirayama, A., Soga, T. & Tomita, M. Capillary electrophoresis mass spectrometry-based saliva metabolomics identified oral, breast and pancreatic cancer–specific profiles. Metabolomics 6, 78–95 (2009). 4. Yamamoto, H., Fujimori, T., Sato, H., Ishikawa, G., Kami, K. & Ohashi, Y: Statistical hypothesis testing of factor loading in principal component analysis and its application to metabolite set enrichment analysis. BMC Bioinform . 15, 51 (2014). 5. Junker, B. H., Klukas, C. & Schreiber F. VANTED: a system for advanced data analysis and visualization in the context of biological networks. BMC Bioinform . 7, 109 (2006). Partial least squares (PLS) discriminant analysis Metabolomics data were normalized and analyzed by partial least squares (PLS) (1) using R programs (2) developed by Human Metabolome Technologies, Inc. References 1. Yamamoto, H. PLS-ROG: partial least squares with rank order of groups. J. Chemom . 33, e2883 (2017). 2. R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ (2021). Lipidomics BAT samples for lipidomics were obtained from mice 30 minutes after NE administration at 33°C to evaluate the lipid profile of BAT exhibiting maximal oxygen consumption. Lipidome analysis was conducted according to lipidome lab Non-targeted lipidome Scan package (lipidome lab, Akita, Japan), using liquid chromatograph orbitrap mass spectrometry (LC-OrbitrapMS) based on the methods described previously 1,2 . Briefly, total lipids were extracted from 10 µL brown adipose tissue samples with the modified Bligh-Dyer method. An aliquot of the lower/organic phase was evaporated to dryness under N2, and the residue was dissolved in methanol for LC-MS/MS measurements. Liquid chromatography (LC)-electrospray ionization-MS/MS analysis was performed by using Q-Exactive Plus mass spectrometer with an UltiMate 3000 LC system (Thermo Fisher Scientific). Samples were separated on L-column3 C18 metal-free column (2.0 µm, 2.0 mm × 100 mm i.d.) at 40°C using a gradient solvent system: mobile phase A (isopropanol/methanol/water (5/1/4 v/v/v) supplemented with 5 mM ammonium formate and 0.05% ammonium hydroxide (28% in water))/mobile phase B (isopropanol supplemented with 5 mM ammonium formate and 0.05% ammonium hydroxide (28% in water)) ratios of 60%/40% (0 min), 40%/60% (0–1 min), 20%/80% (1–9 min), 5%/95% (9–11 min), 5%/95% (11–22 min), 95%/5% (22–22.1 min), 95%/5% (22.1–25 min), 60%/40% (25–25.1 min) and 60%/40% (25.1–30 min). The injection volume was 10 µl and the flow rate was 0.1 mL/min. A heated electrospray ionization (HESI-II) source conditions were as follows: ionization mode, positive or negative; sheath gas, 60 arbitrary units; auxiliary gas, 10 arbitrary units; sweep gas, 0 arbitrary units; spray voltage, 3.2 kV in positive and −3.0 kV in negative mode; heater temperature, 325°C; ion transfer capillary temperature, 300°C in positive and −320°C in negative mode; and S-lens RF level, 50. The orbitrap mass analyzer was operated at a resolving power of 70,000 in full-scan mode (scan range 200–1,800 m/z in positive and 190–1,800 m/z in negative mode; automatic gain control (AGC) target 1e6 in positive and 3e6 in negative mode) and resolving power of 17,500 in positive and 35,000 in negative mode in the top 20 data-dependent MS2 mode (stepped normalized collision energy 20, 30 and 40; isolation window 4.0 m/z; AGC target 1e5) with dynamic exclusion setting of 10.0 s. Post-processing of the raw data files for diacylglycerol and ceramide were done using the lipid molecular identification software, Lipid Search 5.1 (Mitsui Knowledge Industries co., ltd., JAPAN) which is identifies individual intact lipid molecules on the basis of their molecular weight and fragmentation patterns from headgroup and fatty acid composition. In this method, biological matrix effects cannot be normalized in all detected peaks, because it is not possible to prepare appropriate internal standards corresponding to all the detected peaks. The relative values were calculated using the ratio of the chromatographic peak area of each analyte to that of the total analyte. The annotation method used in this study corresponds to equivalent to "Fatty Acyl/Alkyl Level or Hydroxyl Group Level" defined by the lipidomics Standard Initiative 3 . References 1. Nishiumi, S. et al . Comparative evaluation of plasma metabolomic data from multiple laboratories. Metabolites 2, 135 (2022). 2. Takumi, H. et al . Comprehensive analysis of lipid composition in human foremilk and hindmilk. J Oleo Sci . 7, 947–957 (2022). 3. Lipidomics Standards Initiative Consortium. Lipidomics needs more standardization. Nat. Metab . 1, 745–747 (2019). BAT-specific ChREBP knock down by AAV injection AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively). Wild-type female mice were anesthetized and the interscapular skin was incised to expose the BAT. 2.4*10 10 GC vectors were injected into the BAT using 10μL syringe (HAMILTON, 80330), the skin was sutured, and the anesthesia was antagonized. These mice were used for experiments of measurement of VO2, gene expression analyses and histological analyses after 1 week of injection. Ovariectomy 12-week-old wild-type mice were bilaterally ovariectomized (OVX) or sham operated under a combination of medetomidine, midazolam, and butorphanol anesthesia (subcutaneously administered). They were sacrificed and analyzed one week after ovariectomy. BAT ex vivo assay BAT was collected, surface washed with PBS and kept in PBS at 37C. BAT explants were cut into 1–2 mm pieces with scissors in PBS at 37°C and transferred to serum and phenol red free high glucose DMEM supplemented with 100 nM 17β-Estradiol (Sigma) or vehicle (ethanol). After incubation in a CO 2 incubator for 24 hours, BAT was collected and used for RNA extraction. Declarations Acknowledgments We thank Ms. K. Katakura and T. Haba for technical assistance. This work was supported by a Grant-in-Aid for Scientific Research to T.Y. (22H03126) and K.T. (21K16350) from the Japan Society for the Promotion of Science (JSPS). This research was also supported by Moonshot R&D [Grant Number JPMJPS2023] to T.Y. from the Japan Science and Technology Agency (JST). References World Health Organization. Obesity and Overweight. Key Facts. (2021). Available online at: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed February 15, 2024). Tsao, C. W. et al. Heart Disease and Stroke Statistics-2023 Update: A Report From the American Heart Association. Circulation 147 , e93-e621 (2023). https://doi.org/10.1161/CIR.0000000000001123 Sun, H. et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res Clin Pract 183 , 109119 (2022). https://doi.org/10.1016/j.diabres.2021.109119 Kaikaew, K., Grefhorst, A. & Visser, J. A. Sex Differences in Brown Adipose Tissue Function: Sex Hormones, Glucocorticoids, and Their Crosstalk. Front Endocrinol (Lausanne) 12 , 652444 (2021). https://doi.org/10.3389/fendo.2021.652444 Carpentier, A. C., Blondin, D. P., Haman, F. & Richard, D. Brown Adipose Tissue-A Translational Perspective. Endocr Rev 44 , 143-192 (2023). https://doi.org/10.1210/endrev/bnac015 Becher, T. et al. Brown adipose tissue is associated with cardiometabolic health. Nat Med 27 , 58-65 (2021). https://doi.org/10.1038/s41591-020-1126-7 Gaspar, R. C., Pauli, J. R., Shulman, G. I. & Munoz, V. R. An update on brown adipose tissue biology: a discussion of recent findings. Am J Physiol Endocrinol Metab 320 , E488-E495 (2021). https://doi.org/10.1152/ajpendo.00310.2020 Rodriguez-Cuenca, S. et al. Sex-dependent thermogenesis, differences in mitochondrial morphology and function, and adrenergic response in brown adipose tissue. J Biol Chem 277 , 42958-42963 (2002). https://doi.org/10.1074/jbc.M207229200 Quevedo, S., Roca, P., Pico, C. & Palou, A. Sex-associated differences in cold-induced UCP1 synthesis in rodent brown adipose tissue. Pflugers Arch 436 , 689-695 (1998). https://doi.org/10.1007/s004240050690 Villena, J. A. New insights into PGC-1 coactivators: redefining their role in the regulation of mitochondrial function and beyond. FEBS J 282 , 647-672 (2015). https://doi.org/10.1111/febs.13175 Kleiner, S. et al. Development of insulin resistance in mice lacking PGC-1alpha in adipose tissues. Proc Natl Acad Sci U S A 109 , 9635-9640 (2012). https://doi.org/10.1073/pnas.1207287109 Perdikari, A. et al. BATLAS: Deconvoluting Brown Adipose Tissue. Cell Rep 25 , 784-797 e784 (2018). https://doi.org/10.1016/j.celrep.2018.09.044 Saeed, S. et al. Loss-of-function mutations in ADCY3 cause monogenic severe obesity. Nat Genet 50 , 175-179 (2018). https://doi.org/10.1038/s41588-017-0023-6 Grarup, N. et al. Loss-of-function variants in ADCY3 increase risk of obesity and type 2 diabetes. Nat Genet 50 , 172-174 (2018). https://doi.org/10.1038/s41588-017-0022-7 Ventura-Clapier, R. et al. Mitochondria: a central target for sex differences in pathologies. Clin Sci (Lond) 131 , 803-822 (2017). https://doi.org/10.1042/CS20160485 Klinge, C. M. Estrogenic control of mitochondrial function. Redox Biol 31 , 101435 (2020). https://doi.org/10.1016/j.redox.2020.101435 Sanchez-Gurmaches, J. et al. Brown Fat AKT2 Is a Cold-Induced Kinase that Stimulates ChREBP-Mediated De Novo Lipogenesis to Optimize Fuel Storage and Thermogenesis. Cell Metab 27 , 195-209 e196 (2018). https://doi.org/10.1016/j.cmet.2017.10.008 Schlein, C. et al. Endogenous Fatty Acid Synthesis Drives Brown Adipose Tissue Involution. Cell Rep 34 , 108624 (2021). https://doi.org/10.1016/j.celrep.2020.108624 Hoene, M. et al. The lipid profile of brown adipose tissue is sex-specific in mice. Biochim Biophys Acta 1842 , 1563-1570 (2014). https://doi.org/10.1016/j.bbalip.2014.08.003 Dudek, J. Role of Cardiolipin in Mitochondrial Signaling Pathways. Front Cell Dev Biol 5 , 90 (2017). https://doi.org/10.3389/fcell.2017.00090 Yamaoka, S., Urade, R. & Kito, M. Cardiolipin molecular species in rat heart mitochondria are sensitive to essential fatty acid-deficient dietary lipids. J Nutr 120 , 415-421 (1990). https://doi.org/10.1093/jn/120.5.415 Sparagna, G. C. et al. Loss of cardiac tetralinoleoyl cardiolipin in human and experimental heart failure. J Lipid Res 48 , 1559-1570 (2007). https://doi.org/10.1194/jlr.M600551-JLR200 Frank, A. P., Palmer, B. F. & Clegg, D. J. Do estrogens enhance activation of brown and beiging of adipose tissues? Physiol Behav 187 , 24-31 (2018). https://doi.org/10.1016/j.physbeh.2017.09.026 Puigserver, P. et al. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92 , 829-839 (1998). https://doi.org/10.1016/s0092-8674(00)81410-5 Tiraby, C. et al. Acquirement of brown fat cell features by human white adipocytes. J Biol Chem 278 , 33370-33376 (2003). https://doi.org/10.1074/jbc.M305235200 Besse-Patin, A. et al. Estrogen Signals Through Peroxisome Proliferator-Activated Receptor-gamma Coactivator 1alpha to Reduce Oxidative Damage Associated With Diet-Induced Fatty Liver Disease. Gastroenterology 152 , 243-256 (2017). https://doi.org/10.1053/j.gastro.2016.09.017 Naumenko, N. et al. PGC-1alpha deficiency reveals sex-specific links between cardiac energy metabolism and EC-coupling during development of heart failure in mice. Cardiovasc Res 118 , 1520-1534 (2022). https://doi.org/10.1093/cvr/cvab188 Panic, V. et al. Mitochondrial pyruvate carrier is required for optimal brown fat thermogenesis. Elife 9 (2020). https://doi.org/10.7554/eLife.52558 Mills, E. L. et al. Accumulation of succinate controls activation of adipose tissue thermogenesis. Nature 560 , 102-106 (2018). https://doi.org/10.1038/s41586-018-0353-2 Ban, T. et al. Molecular basis of selective mitochondrial fusion by heterotypic action between OPA1 and cardiolipin. Nat Cell Biol 19 , 856-863 (2017). https://doi.org/10.1038/ncb3560 Klingenberg, M. Cardiolipin and mitochondrial carriers. Biochim Biophys Acta 1788 , 2048-2058 (2009). https://doi.org/10.1016/j.bbamem.2009.06.007 Li, Y. et al. Cardiolipin-induced activation of pyruvate dehydrogenase links mitochondrial lipid biosynthesis to TCA cycle function. J Biol Chem 294 , 11568-11578 (2019). https://doi.org/10.1074/jbc.RA119.009037 Sustarsic, E. G. et al. Cardiolipin Synthesis in Brown and Beige Fat Mitochondria Is Essential for Systemic Energy Homeostasis. Cell Metab 28 , 159-174 e111 (2018). https://doi.org/10.1016/j.cmet.2018.05.003 Lai, L. et al. A role for peroxisome proliferator-activated receptor gamma coactivator 1 (PGC-1) in the regulation of cardiac mitochondrial phospholipid biosynthesis. J Biol Chem 289 , 2250-2259 (2014). https://doi.org/10.1074/jbc.M113.523654 Harish, G. et al. Mitochondrial function in human brains is affected by pre- and post mortem factors. Neuropathol Appl Neurobiol 39 , 298-315 (2013). https://doi.org/10.1111/j.1365-2990.2012.01285.x Justo, R. et al. Gender dimorphism in rat liver mitochondrial oxidative metabolism and biogenesis. Am J Physiol Cell Physiol 289 , C372-378 (2005). https://doi.org/10.1152/ajpcell.00035.2005 Moulin, M. et al. Sexual dimorphism of doxorubicin-mediated cardiotoxicity: potential role of energy metabolism remodeling. Circ Heart Fail 8 , 98-108 (2015). https://doi.org/10.1161/CIRCHEARTFAILURE.114.001180 Bhalla, K. et al. PGC1alpha promotes tumor growth by inducing gene expression programs supporting lipogenesis. Cancer Res 71 , 6888-6898 (2011). https://doi.org/10.1158/0008-5472.CAN-11-1011 Santolla, M. F. et al. G protein-coupled estrogen receptor mediates the up-regulation of fatty acid synthase induced by 17beta-estradiol in cancer cells and cancer-associated fibroblasts. J Biol Chem 287 , 43234-43245 (2012). https://doi.org/10.1074/jbc.M112.417303 Pizer, E. S., Lax, S. F., Kuhajda, F. P., Pasternack, G. R. & Kurman, R. J. Fatty acid synthase expression in endometrial carcinoma: correlation with cell proliferation and hormone receptors. Cancer 83 , 528-537 (1998). Martinez de Morentin, P. B. et al. Estradiol regulates brown adipose tissue thermogenesis via hypothalamic AMPK. Cell Metab 20 , 41-53 (2014). https://doi.org/10.1016/j.cmet.2014.03.031 Nilsson, M. E. et al. Measurement of a Comprehensive Sex Steroid Profile in Rodent Serum by High-Sensitive Gas Chromatography-Tandem Mass Spectrometry. Endocrinology 156 , 2492-2502 (2015). https://doi.org/10.1210/en.2014-1890 Sievers, W. et al. The effect of estrogen on brown adipose tissue activity in male rats. BMC Res Notes 15 , 28 (2022). https://doi.org/10.1186/s13104-022-05910-x Anderson, L. A., McTernan, P. G., Barnett, A. H. & Kumar, S. The effects of androgens and estrogens on preadipocyte proliferation in human adipose tissue: influence of gender and site. J Clin Endocrinol Metab 86 , 5045-5051 (2001). https://doi.org/10.1210/jcem.86.10.7955 Additional Declarations There is NO Competing Interest. Supplementary Files 240215SupplementalTable1.xlsx Supplemental Table 1 SuppFigure.pdf SupplementaryFigurelegends.docx Cite Share Download PDF Status: Published Journal Publication published 14 Jul, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3968646","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":275003381,"identity":"4189337e-5c76-4661-bcac-c2d3eb34032c","order_by":0,"name":"Kazutaka Tsujimoto","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYBACCTBhAOfbAHECiMGGWwsbVAsPhJ8mQZwWEIBqOQzTghtIzm9/JmFRsE3Onr2BdcPHnPN1uu0JjB9+MPDl4dIizcZjJiFhcNuYh+cA282Z225LmJ15wCzZw8BWjEuLHBsPG0hLYo9EAtttXpCWGwkM0kC/JDbg1ML+DKHl77ZzIC3Mv/FpkWZjMENoYdx2AKSFDa8tkm05xhZgv5w52Hazd1uy5LYzD9ssewxw+0Xi8PGHtyX+3JZjb28+duPnNjt+s+PJh2/8qDiGM8RAgBmcBBgYYS4BMQyOJeDTwvgBi2ANXi2jYBSMglEwogAA7vtR6R2HH0oAAAAASUVORK5CYII=","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Kazutaka","middleName":"","lastName":"Tsujimoto","suffix":""},{"id":275003382,"identity":"0d3e98f8-87e5-426d-8491-06b267a2ccac","order_by":1,"name":"Akira Takeuchi","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Akira","middleName":"","lastName":"Takeuchi","suffix":""},{"id":275003383,"identity":"3bb81263-6cd2-4f4c-9b4c-79ce3555893e","order_by":2,"name":"Kenji Ikeda","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kenji","middleName":"","lastName":"Ikeda","suffix":""},{"id":275003384,"identity":"d18019a9-34f3-4fe0-b966-5ad3b1e2a067","order_by":3,"name":"Jun Aoki","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Aoki","suffix":""},{"id":275003385,"identity":"f2c463cc-a3fa-4bd3-b341-6dac37fd2e7a","order_by":4,"name":"Yoshihiro Niitsu","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yoshihiro","middleName":"","lastName":"Niitsu","suffix":""},{"id":275003386,"identity":"45ee1d85-3caa-4aab-ac52-b8cda6ce6993","order_by":5,"name":"Masato Horino","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Masato","middleName":"","lastName":"Horino","suffix":""},{"id":275003387,"identity":"82227813-fcea-40a1-831a-c92710486090","order_by":6,"name":"Kazunari Hara","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kazunari","middleName":"","lastName":"Hara","suffix":""},{"id":275003388,"identity":"1d691093-802c-41e3-8c98-039c92566428","order_by":7,"name":"Rei Okazaki","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rei","middleName":"","lastName":"Okazaki","suffix":""},{"id":275003389,"identity":"2b31cf07-ba27-4e36-9281-54aea12f9997","order_by":8,"name":"Ryo Kaneda","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ryo","middleName":"","lastName":"Kaneda","suffix":""},{"id":275003390,"identity":"c3a076c2-a0ed-40a5-aca7-22aafb0de1ba","order_by":9,"name":"Masanori Murakami","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Masanori","middleName":"","lastName":"Murakami","suffix":""},{"id":275003391,"identity":"5645c518-1c8a-4a96-afd3-a8e156c54568","order_by":10,"name":"Kumiko Shiba","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kumiko","middleName":"","lastName":"Shiba","suffix":""},{"id":275003392,"identity":"9f9db1d1-c69f-4089-8df7-e70b36c5d860","order_by":11,"name":"Chikara Komiya","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chikara","middleName":"","lastName":"Komiya","suffix":""},{"id":275003393,"identity":"7df11add-31bf-4ad1-912f-9c31653076f4","order_by":12,"name":"Tetsuya Yamada","email":"","orcid":"","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tetsuya","middleName":"","lastName":"Yamada","suffix":""}],"badges":[],"createdAt":"2024-02-19 02:35:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3968646/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3968646/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-025-61219-w","type":"published","date":"2025-07-14T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":52580656,"identity":"ca24d6bf-0f42-4867-84f2-22f376ce94d8","added_by":"auto","created_at":"2024-03-13 08:08:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":279083,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePGC-1α is highly expressed in BAT and is essential for maintaining cold tolerance in female mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a) \u003c/strong\u003e\u003cem\u003ePpargc1a\u003c/em\u003emRNA levels in BAT, inguinal WAT (iWAT), and gonadal WAT (gWAT) of male and female mice. n = 7–8 per group. \u0026nbsp;\u003cstrong\u003e(b)\u003c/strong\u003e Western blots for PGC-1α proteins in BAT (left) and protein levels normalized to α-tubulin (right). n = 3 per group. \u003cstrong\u003e(c)\u003c/strong\u003e \u003cem\u003ePpargc1a\u003c/em\u003e mRNA levels in BAT at various temperatures. n = 8–10 per group. \u003cstrong\u003e(d)\u003c/strong\u003e Rectal temperature in Control and KO mice under acute cold exposure. n = 7–8 per group. \u003cstrong\u003e(e)(f)\u003c/strong\u003e Representative thermal images of interscapular surface \u003cstrong\u003e(e)\u003c/strong\u003e and interscapular surface temperature \u003cstrong\u003e(f)\u003c/strong\u003e in Control and KO mice. n = 5–8 per group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(g) \u003c/strong\u003eOxygen consumption (VO2) recordings in response to NE in Control and KO mice. n = 8 per group. Data are expressed as the mean ± SEM. Data were analyzed using unpaired two-sided t-test \u003cstrong\u003e(a–c)\u003c/strong\u003e and two-way repeated measures ANOVA \u003cstrong\u003e(d, f–g)\u003c/strong\u003e. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). ns, not significant.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/3e2f2cd3ddadc29f69c0e069.png"},{"id":52580657,"identity":"7c27f03a-7999-41fd-b1a3-e6e49cb56e1d","added_by":"auto","created_at":"2024-03-13 08:08:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":822494,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePGC-1α modulates mitochondrial membrane structure in female BAT cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a)\u003c/strong\u003e Representative electron micrographs of mitochondria from the BAT of Control and KO mice. The areas outlined in red boxes indicate enlarged images of mitochondria. Scale bars = 1 μm.\u003cstrong\u003e (b)\u003c/strong\u003e Histograms showing the distribution frequency (%) of mitochondrial section areas (0–3 µm\u003csup\u003e2\u003c/sup\u003e). \u003cstrong\u003e(c)\u003c/strong\u003e Total cristae length per mitochondrion. \u003cstrong\u003e(d) \u003c/strong\u003eRepresentative blots for electron transport chain complexes (upper panel) and protein levels normalized to α-tubulin (lower panel). n = 6 per group. Data are expressed as the mean ± SEM. Data were analyzed by one-way ANOVA with Tukey’s post hoc test \u003cstrong\u003e(c)(d)\u003c/strong\u003e. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). ns, not significant.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/aa88eb544a57718d7f8c11c1.png"},{"id":52580659,"identity":"7644bf4e-01d0-4f93-9645-453244c52c78","added_by":"auto","created_at":"2024-03-13 08:08:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":37438,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePGC-1α regulates DNL-related gene expression in female BAT cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a)\u003c/strong\u003e Venn diagram showing the number of downregulated genes in Male and Female KO mice compared with Controls. \u003cstrong\u003e(b)\u003c/strong\u003e Gene Ontology analysis of genes downregulated only in Female KO mice. The top 10 enriched terms showing Metascape-generated enrichment p-values using cumulative hypergeometric distributions. \u003cstrong\u003e(c)\u003c/strong\u003eGene expression of Chrebp β and de novo lipogenesis (DNL) -related genes in BAT of Control and KO mice. n = 9–10 per group. Data are expressed as the mean ± SEM. Data were analyzed by one-way ANOVA with Tukey’s post hoc test. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/602bce23a5c3abb397fa1c9a.png"},{"id":52580837,"identity":"e9c01c9d-f9ae-4565-b027-5e912c4bd544","added_by":"auto","created_at":"2024-03-13 08:16:39","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":144004,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePGC-1α regulates TCA cycle metabolism in female BAT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a)\u003c/strong\u003e Heat map illustrating differential metabolites based on metabolomic analysis in the BAT of Control and KO mice of both sexes. n = 5 per group.\u003cstrong\u003e (b) \u003c/strong\u003eEnrichment analysis of metabolic pathways using MetaboAnalyst. The x-axis indicates the pathway impact values derived from the pathway topology analysis, and the y-axis indicates the p-values obtained from the pathway enrichment analysis. \u003cstrong\u003e(c)\u003c/strong\u003eScore plot of principal component analysis (PCA) of all metabolites. Each point represents an individual sample. \u003cstrong\u003e(d)\u003c/strong\u003e Top 5 metabolites contributing to PC2 loading. \u003cstrong\u003e(e)\u003c/strong\u003e Concentration of TCA cycle metabolites in BAT of each group. n = 5 per group. \u003cstrong\u003e(f)\u003c/strong\u003e Correlation between the levels of TCA cycle metabolites and the peak of VO2 upon NE administration. Data are expressed as the mean ± SEM. Data were analyzed by one-way analysis of variance with Tukey’s post hoc test \u003cstrong\u003e(e)\u003c/strong\u003e or linear regression \u003cstrong\u003e(f)\u003c/strong\u003e. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/944cd17341468b437eb31b56.png"},{"id":52580662,"identity":"1db7fac8-2c53-4382-8608-78e7ef405215","added_by":"auto","created_at":"2024-03-13 08:08:39","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":166718,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePGC-1α changes the mitochondrial membrane lipid profiles of female BAT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a)\u003c/strong\u003e Heat map illustrating differential lipid species based on lipidemic analysis in the BAT of Control and KO mice of both sexes. n = 5 per group.\u003cstrong\u003e (b)\u003c/strong\u003e Score plot of partial least squares (PLS) discriminant analysis of all lipids. Each point represents an individual sample.\u003cstrong\u003e (c)\u003c/strong\u003eTop 5 lipids contributing to PLS1 loading. \u003cstrong\u003e(d)\u003c/strong\u003e Relative amounts of total cardiolipin (CL). \u003cstrong\u003e(e)\u003c/strong\u003e Various molecular species of cardiolipin. Numbers above the bar graph represent the molecular species composition. \u003cstrong\u003e(f)\u003c/strong\u003ePercentage of CL(18:2)4 in total lipid. \u003cstrong\u003e(g)(h)\u003c/strong\u003e Relative amounts of various molecular species of ether-linked phosphatidylethanolamine (PE) \u003cstrong\u003e(g)\u003c/strong\u003eand phosphatidylcholine (PC) \u003cstrong\u003e(h)\u003c/strong\u003e. \u003cstrong\u003e(i)\u003c/strong\u003e Relative amounts of coenzyme Q (CoQ). Data are expressed as the mean ± SEM. Data were analyzed by one-way ANOVA with Tukey’s post hoc test \u003cstrong\u003e(d)–(i)\u003c/strong\u003e. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). ns, not significant.\u003c/p\u003e","description":"","filename":"fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/1382142cd0f49bb437e40b20.png"},{"id":52580660,"identity":"9ab602f4-f755-42de-a658-e156b74a98b4","added_by":"auto","created_at":"2024-03-13 08:08:39","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":681018,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBAT-specific Chrebp knockdown in female mice recapitulates the metabolic phenotype of female PGC-1α knockout mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a)\u003c/strong\u003e Gene expression of Chrebp β and DNL-related genes in female BAT injected with AAV-shScramble or AAV-shChrebp. n = 6 per group. \u003cstrong\u003e(b)\u003c/strong\u003e Gene expression of PGC-1α. \u003cstrong\u003e(c)\u003c/strong\u003e BAT Weight. \u003cstrong\u003e(d)\u003c/strong\u003e Representative 20× Hematoxylin and eosin staining of BAT. \u003cstrong\u003e(e)\u003c/strong\u003e Oxygen consumption (VO2) recordings in response to NE. n = 6–7 per group. \u003cstrong\u003e(f)\u003c/strong\u003e Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm.\u003cstrong\u003e (g)\u003c/strong\u003e Total cristae length per mitochondrion.\u003cstrong\u003e (h)\u003c/strong\u003e Histograms showing the distribution frequency (%) of mitochondrial section areas (0–3 µm\u003csup\u003e2\u003c/sup\u003e). Data are expressed as the mean ± SEM. Data were analyzed using unpaired two-sided t-test \u003cstrong\u003e(a-c)\u003c/strong\u003e and two-way repeated measures ANOVA \u003cstrong\u003e(e)\u003c/strong\u003e. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/1ef0cc51cec6c632f3c97408.png"},{"id":52580664,"identity":"42e9d424-9de3-4cb1-86f7-4bc5bce55f3e","added_by":"auto","created_at":"2024-03-13 08:08:39","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":371970,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFemale BAT PGC-1α regulates systemic energy metabolism in coordination with estrogen signaling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a) \u003c/strong\u003eOxygen consumption (VO2) recordings in response to NE in control and tamoxifen (TMX) -treated mice. n = 4 per group. \u003cstrong\u003e(b)\u003c/strong\u003e Representative electron micrographs of mitochondria from BAT of control and TMX-treated mice. Scale bar = 1 μm.\u003cstrong\u003e (c)\u003c/strong\u003eTotal cristae length per mitochondrion. \u003cstrong\u003e(d)\u003c/strong\u003e Venn diagram showing the number of downregulated genes in male and female TMX-treated mice compared with controls. \u003cstrong\u003e(e)\u003c/strong\u003e Gene Ontology analysis of genes downregulated only in Female KO mice. The top 10 enriched terms showing Metascape-generated enrichment p-values using cumulative hypergeometric distributions.\u003cstrong\u003e (f)\u003c/strong\u003e Gene expression of Chrebp β and DNL-related genes in BAT. \u003cstrong\u003e(g)\u003c/strong\u003e Gene expression of PGC-1α. \u003cstrong\u003e(h)\u003c/strong\u003e Gene expression in BAT explants from the BAT of Control and KO mice of both sexes treated with vehicle or 17β-estradiol (E2, 100 nM, 24 hours). Data are expressed as the mean ± SEM. Data were analyzed by two-way repeated measures ANOVA \u003cstrong\u003e(a)\u003c/strong\u003e and one-way ANOVA with Tukey’s post hoc test \u003cstrong\u003e(c, f-h)\u003c/strong\u003e. Significance is indicated (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). ns, not significant.\u003c/p\u003e","description":"","filename":"fig10.png","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/490cc33b2d6625c0108df702.png"},{"id":86741806,"identity":"48862cc3-1f99-48b3-bc0a-572525558dab","added_by":"auto","created_at":"2025-07-15 07:06:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4678177,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/8a054c19-9dd4-472b-9de4-a56233c6bb9c.pdf"},{"id":52580654,"identity":"ce41c54b-7f2e-4462-b8a5-be9759889acf","added_by":"auto","created_at":"2024-03-13 08:08:38","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":9507,"visible":true,"origin":"","legend":"Supplemental Table 1","description":"","filename":"240215SupplementalTable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/a793e140ac357b2414b3e3f7.xlsx"},{"id":52580655,"identity":"c5f3b71a-645b-42dd-acaf-f19a4e8fdf38","added_by":"auto","created_at":"2024-03-13 08:08:38","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":94929,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFigure.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/2b2de70f5fb8b1fb7eae387d.pdf"},{"id":52580836,"identity":"5fb9c029-6270-41b2-84cc-d72b15df33c0","added_by":"auto","created_at":"2024-03-13 08:16:39","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":14060,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigurelegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-3968646/v1/d924f6c62d807d328b823b65.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Sex difference in BAT thermogenesis depends on PGC-1α-ChREBPβ mediated de novo lipogenesis in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eObesity is a major risk factor for type 2 diabetes mellitus, various metabolic diseases, and cardiovascular diseases, and its growing prevalence is a serious public health crisis\u003csup\u003e1\u003c/sup\u003e. Conversely, while the frequency of obesity in women is reported to be comparable to that in men or slightly higher\u003csup\u003e1, 2\u003c/sup\u003e, the prevalence of diabetes or cardiovascular disease, especially in premenopausal women, is clearly lower than that in men of the same ages\u003csup\u003e2, 3\u003c/sup\u003e. Although there have been various reports on the \u0026ldquo;metabolic advantage of women\u0026rdquo; from the viewpoints of sex hormones, chromosomes, and lifestyle\u003csup\u003e4\u003c/sup\u003e, the underlying molecular mechanism has not yet been fully elucidated.\u003c/p\u003e \u003cp\u003eBrown adipose tissue (BAT) has the unique ability to catabolize energy substrates and release them as thermal energy, and numerous reports have established the importance of BAT in human energy metabolism\u003csup\u003e5\u003c/sup\u003e. In recent years, it has also been reported that the presence of BAT is inversely correlated with the risk of diabetes and cardiovascular disease\u003csup\u003e6\u003c/sup\u003e. Therefore, BAT is expected to be a promising target for the treatment of these diseases. Notably, it has been reported that BAT in females surpasses that in males in terms of prevalence, quantity, and metabolic activity, exhibiting a higher level in each of these aspects\u003csup\u003e6\u003c/sup\u003e. Therefore, BAT is considered a potential mechanism contributing to the metabolic advantage observed in women.\u003c/p\u003e \u003cp\u003eStudies in rodents have already revealed that BAT has the potential to reduce obesity and impaired glucose tolerance by increasing energy expenditure\u003csup\u003e7\u003c/sup\u003e. Moreover, several reports have shown histological and functional sex differences in rodent BAT, including that female rat BAT has larger and more densely populated mitochondria than males, that female BAT initiates lipolysis with weaker β3-adrenergic stimulation\u003csup\u003e8\u003c/sup\u003e, and that uncoupling protein-1(UCP1), which is responsible for thermogenesis in BAT, is more highly expressed in female\u003csup\u003e9\u003c/sup\u003e. These findings indicate that female BAT has higher metabolic activity than male BAT. However, the molecular mechanism underlying these sex differences in the function of BAT has not been fully elucidated.\u003c/p\u003e \u003cp\u003ePeroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α) is a transcriptional coactivator that acts as a master regulator of mitochondrial metabolism and is responsible for the transcription of genes involved in the mitochondrial electron transport chain, fatty acid oxidation, and oxidative stress management in response to cellular energy demand\u003csup\u003e10\u003c/sup\u003e. Although PGC-1α is regarded as a key regulator of thermogenesis in BAT, a report on adipocyte-specific Pgc1a knockout male mice\u003csup\u003e11\u003c/sup\u003e showed only minor changes in BAT gene expression and histology, and the prominent metabolic phenotype observed was impaired glucose tolerance rather than cold intolerance\u003csup\u003e11\u003c/sup\u003e. Therefore, the \u003cem\u003ein vivo\u003c/em\u003e role of PGC-1α in BAT has not been fully clarified.\u003c/p\u003e \u003cp\u003eIn this study, we found a sex difference in PGC-1α function in BAT and further showed that PGC-1α in the BAT of female mice serves a unique role in thermogenesis regulation, distinct from its function in males, and plays a pivotal role in regulating systemic energy expenditure.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003ePGC-1α deletion in BAT suppresses thermogenesis and impairs acute cold tolerance only in female mice.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe first examined PGC-1α gene and protein expression in BAT of male and female mice. Female mice BAT expressed significantly higher PGC-1α compared to male mice, whereas there was no sex difference in white adipose tissue (WAT), and its expression was much lower than that in BAT at room temperature (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). Sex differences in Pgc1a expression in BAT were attenuated under thermoneutral conditions and enhanced under cold exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). In addition, the adenylate cyclase 3 (Adcy3) gene, which has been reported to be a marker gene of brown adipocytes\u003csup\u003e12\u003c/sup\u003e and cause severe obesity by its loss-of-function mutation in human\u003csup\u003e13,14\u003c/sup\u003e, exhibited higher expression in female mice than in male mice (Fig S1a) and showed a strong positive correlation with Pgc1a expression in both sexes (Fig S1b). Moreover, the cAMP level in BAT upon norepinephrine (NE) administration was significantly higher in females than in males (Fig S1c). These results suggest that equivalent adrenergic stimulation results in more robust intracellular signaling in female BAT, which may contribute to the sex difference in Pgc1a gene expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, to explore the biological significance of Pgc1a highly expressed in female BAT, we generated acquired adipocyte-specific Pgc1a knockout (KO) mice using tamoxifen (TMX)-inducible Adipoq-Cre-ERT2 mice, which express Cre recombinase under the regulatory elements of Adipoq (referred to as Male control, Male KO, Female Control, and Female KO, respectively). Considering the possible effect of TMX on sex differences, the following analyses were performed at least 8 weeks after administration (Fig S1d, e). Using sexually mature male and female Pgc1a KO mice, rectal temperature was measured under acute cold exposure, along with controls. While the rectal temperature of Male KO mice did not show any significant difference compared with that of Male Control mice, Female KO mice exhibited a markedly lower rectal temperature compared with that of Female Control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Similar results were obtained from the thermographic measurement of the interscapular surface temperature, an indicator of BAT-derived thermogenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee, f). We additionally measured the enhancement of oxygen consumption (VO2) after NE administration, which mainly reflects BAT function. Male KO mice showed no significant difference in VO2 compared with Male Control mice, whereas Female KO mice showed a marked decrease in VO2 compared with Female Control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg). On the other hand, the glucose tolerance test showed that glucose tolerance was markedly reduced in Male KO mice (Fig S1f), which is consistent with the result of male congenital adipocyte-specific Pgc1a knockout mice reported in a previous study\u003csup\u003e11\u003c/sup\u003e. These results suggest that PGC-1α in female BAT plays a crucial role in thermogenesis upon adrenergic stimulation, possibly contributing to the cold tolerance of female mice.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePGC-1α deletion abolishes the augmented mitochondrial membrane structure specific to female BAT\u003c/h2\u003e \u003cp\u003eSince PGC-1α facilitates mitochondrial biogenesis\u003csup\u003e10\u003c/sup\u003e, we next examined the mitochondrial morphology in BAT of Control and KO mice of both sexes. We found that Female Control mice had larger mitochondria and denser cristae compared with Male Control mice by electron microscopy imaging of BAT (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b). Quantitative analysis showed a significantly longer total cristae length per mitochondrion in Female Control mice than in Male Control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). However, only Female KO mice exhibited a decrease in mitochondrial size and disruption or loss of cristae, resulting in a significant reduction in the total cristae length per mitochondrion. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u0026ndash;c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAssuming that PGC-1α deletion is involved in the observed mitochondrial membrane structure degradation in BAT of Female KO mice, we then performed protein expression analysis of mitochondrial electron transport chain complexes in BAT of Control and KO mice of both sexes. We observed higher protein expression of electron transport chain complexes in Female Control mice than in Male Control mice, particularly that of Complex I and Complex IV. However, the expression of these complexes was reduced due to PGC-1α deletion only in female mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). Nuclear respiratory factor 1 (NRF-1) and Transcription factor A (TFAM), which have been reported to play an important role in mitochondrial regulation by PGC-1α\u003csup\u003e15,16\u003c/sup\u003e, as well as the genes responsible for mitochondrial fusion/fission (Mitofusin-1; Mfn1, Mitofusin-2; Mfn2, Optic atrophy 1; Opa1 and Dynamin-related protein 1; Drp1), were expressed significantly higher in females than in males, but were unchanged or mildly reduced in females due to PGC-1α deletion (Fig S2). These results prompted us the hypothesis that PGC-1α in female BAT may regulate mitochondrial morphology and function in a manner other than canonical pathways, such as transcriptional regulation of NRF-1/TFAM or mitochondrial fusion/fission-related genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePGC-1α deletion downregulates DNL-related gene expression only in female BAT\u003c/h2\u003e \u003cp\u003eTo investigate the mechanism by which PGC-1α in female BAT contributes to enhanced thermogenesis and augmented mitochondrial membrane structure, RNA-seq analysis was performed in the BAT of Control and KO mice of both sexes. The expression of 182 genes was downregulated in Male KO mice compared with Male Control mice, and 240 genes were downregulated in Female KO mice compared with Female Control mice. Only 47 genes were downregulated in both sexes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). These results suggest that the genes transcriptionally regulated by PGC-1α are widely different between male and female mice. We next performed gene ontology analysis of genes downregulated only in female mice due to PGC-1α deletion, which revealed enrichment in central carbon metabolism-related pathways such as \u0026ldquo;NADH regeneration, canonical glycolysis, and fatty acid derivative biosynthetic process\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). In particular, the expression of genes related to \u003cem\u003ede novo\u003c/em\u003e lipogenesis (DNL) and carbohydrate response-element binding protein beta (Chrebpβ), a transcriptional regulator of DNL\u003csup\u003e17\u003c/sup\u003e, was markedly downregulated only in Female KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). These results suggest that PGC-1α in female BAT is responsible for the transcriptional regulation of genes related to central carbon metabolism and DNL.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePGC-1α deletion suppresses mitochondrial TCA cycle metabolism only in female BAT\u003c/h2\u003e \u003cp\u003eTo investigate the dynamics of energy substrate metabolism, we performed metabolomic analysis of central carbon metabolism in the BAT of Control and KO mice of both sexes. As shown in (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), heatmap analysis revealed marked differences between Male Control and Female Control mice, as well as between Female Control and Female KO mice. Among the 116 metabolites analyzed, there were 54 metabolites that were higher in Female Control mice than in Male Control mice but were lower in Female KO mice than in Female Control mice. Enrichment analysis of metabolic pathways showed that the citric acid cycle, ketones body metabolism, and butyrate metabolism pathways were significantly altered in Female KO mice compared with female control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Principal component analysis showed a large difference between Female Control and Female KO mice, whereas only a small difference between Male Control and Male KO mice was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). The top 5 metabolites contributing positively to PC2, defining the difference between female control and female KO mice, include NADH and tricarboxylic acid (TCA) cycle intermediates such as fumaric acid, malic acid, and acetyl-CoA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Actually, TCA cycle intermediates were more abundant in female control mice than in male control mice and significantly decreased only in female KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). In addition, in females, a positive correlation was observed between the levels of TCA cycle metabolites and the peak of VO2 upon NE administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef), suggesting that in female BAT, the activity of the TCA cycle may be a primary determinant of thermogenesis by acute adrenergic stimulation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePGC-1α deletion in female BAT modulates mitochondrial membrane lipid profiles, including cardiolipin\u003c/h2\u003e \u003cp\u003eDNL is involved in controlling lipid profiles in BAT\u003csup\u003e17,18\u003c/sup\u003e. Considering these findings, along with the mitochondrial morphological and functional defects and downregulation of DNL-related genes observed in the BAT of Female KO mice, we speculated that female PGC-1α may affect BAT mitochondrial membrane lipid profile through DNL. Therefore, we performed lipidomics analysis in the BAT of Control and KO mice of both sexes. The analysis showed, first that the overall lipid profile of the BAT was significantly different between males and females, with females having less triglycerides and more abundant glycerophospholipids, which comprise the membranes of cells and organelles, compared with males (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). These results are consistent with those of a previous study of lipidomics analysis in BAT of male and female wild-type mice\u003csup\u003e19\u003c/sup\u003e. Partial least squares (PLS) analysis also revealed that phospholipids with fatty acid residues with C\u0026thinsp;\u0026gt;\u0026thinsp;17 were more abundant in females than in males, and this pattern remained consistent even in PGC-1α KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb, c, Fig S3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next examined changes in cardiolipin (CL), a phospholipid specifically localized in the mitochondrial membrane and essential for regulating its morphology and respiratory capacity\u003csup\u003e20\u003c/sup\u003e. The percentage of total CL was higher in Female Control mice than in Male Control mice and did not change significantly in female KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). However, the percentage of CL(18:2)4 molecule, which plays an essential role in regulating mitochondrial respiratory capacity\u003csup\u003e20\u0026ndash;22\u003c/sup\u003e, constituted the largest proportion of total CL in BAT (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee) and was significantly higher in Female Control mice than in Male Control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). In addition, in Female KO mice, this ratio was significantly reduced to a level similar to that observed in Male mice. We also found that many species of ether-linked phospholipids (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg, h) and coenzyme Q (CoQ) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ei) were more abundant in Female Control mice than in Male Control mice, and their levels were significantly reduced only in Female KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-i).\u003c/p\u003e \u003cp\u003eTaken together, the lipidomics analysis revealed that sex differences exist in the phospholipid profiles of BAT and that female PGC-1α regulates the profiles of CL, ether-linked phospholipids, and coenzyme Q, all of which are crucial for mitochondrial respiratory function.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eChREBPβ-mediated DNL regulates thermogenesis and mitochondrial membrane structure in female BAT\u003c/h2\u003e \u003cp\u003eThe aforementioned data suggest that in female BAT PGC-1α regulates thermogenesis by controlling the mitochondrial membrane structure and that ChREBPβ plays a pivotal role in this regulation. To further test this hypothesis, we performed Chrebp knockdown in the BAT of female mice by injecting adeno-associated viruses (AAV) containing short hairpin RNA (shRNA) targeting Chrebp (AAV-shChrebp) or scramble shRNA (AAV-Scramble) into the interscapular BAT. One week after AAV injection, in the BAT of AAV-shChrebp mice, the expression of Chrebpβ and its downstream DNL-related genes were markedly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea), whereas the expression of Pgc1a was significantly increased compared with that in AAV-Scramble mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). In addition, AAV-shChrebp mice displayed reduced BAT tissue weight and fat droplet size compared with AAV-Scramble mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec, d), indicating that DNL was actually inhibited in the BAT of AAV-shChrebp mice. At this point, we found that VO2 upon NE administration in the AAV-shChrebp mice was significantly lower than that in the AAV-Scramble mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee). Electron microscopic examination of mitochondria showed that the total cristae length per mitochondrion was significantly shorter and the size of mitochondria was also significantly reduced in the AAV-shChrebp mice compared with the AAV-Scramble mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef-h). The results demonstrated that the phenotype observed only in female BAT due to PGC-1α deletion was recapitulated by Chrebp knockdown.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEstrogen signaling and PGC-1α interdependently regulate the expression of DNL-related genes in female BAT, thereby contributing to thermogenesis and mitochondrial membrane structure\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBecause estrogen has previously been implicated in contributing to sex differences in BAT\u003csup\u003e23\u003c/sup\u003e, we investigated the interaction between the female BAT-specific role of PGC-1α and estrogen signaling. We administered the estrogen receptor antagonist TMX or vehicle (Veh) to male and female wild-type mice and measured VO2 upon NE administration, 1 week after TMX treatment (Fig S4a, b). In males, no difference was observed between the TMX-treated and Veh-treated mice, whereas in females, VO2 was significantly lower in the TMX-treated mice than in the Veh-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea). Electron microscopic images of BAT showed that the length of mitochondrial cristae was significantly shortened by TMX treatment only in females (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb, c). In addition, transcriptome analysis of BAT revealed that genes involved in energy substrate metabolism, especially in DNL, were downregulated by TMX treatment only in female mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed-f). These results demonstrated that PGC-1α KO and TMX treatment share many metabolic phenotypes, histological changes, and transcriptional alterations only in female BAT. However, TMX treatment did not downregulate Pgc1a expression in female BAT (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eg), and a similar tendency was observed in ovariectomized mice (Fig S4c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEstrogen signaling upregulates the expression of DNL-related genes in a PGC-1α-dependent manner only in female BAT\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate whether sex differences exist in the regulation of DNL-related gene expression in BAT by estrogen signaling, we performed an \u003cem\u003eex vivo\u003c/em\u003e experiment in which 17β estradiol (E2) was applied to BAT explants from male and female wild-type mice. E2 treatment did not alter the expression of Chrebpβ and DNL-related genes in male BAT; however, it increased the expression of Chrebpβ and DNL-related genes in female BAT (Fig S4d). In addition, the substantial increase in gene expression with E2 treatment observed in BAT from Female Control mice was attenuated in BAT from Female KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eh). To further investigate the mechanisms underlying sex differences in the PGC-1α dependent estrogen responsiveness, we examined the expression of Esr1, the gene encoding ERα, in the BAT of Control and KO mice of both sexes. We found that Esr1 gene expression was significantly higher in female BAT than in male, but not affected by PGC-1α deletion in both sexes (Fig S4e).\u003c/p\u003e \u003cp\u003eCollectively, these results suggest that the downstream molecule(s) of estrogen receptor (ERα) signaling pathway, which regulate Chrebpβ and DNL-related gene expressions, fundamentally differs between male and female BAT, and that PGC-1α plays a pivotal role in this difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eHere we showed that PGC-1α in BAT of female mice is highly expressed compared with that in male mice and plays a crucial role in regulating systemic energy expenditure by contributing to the maintenance of female BAT-specific cristae-rich mitochondria and high TCA cycle activity. Estrogen signaling interdependently regulates this mechanism with PGC-1α, and ChREBPβ-mediated DNL plays a pivotal role as a central hub of both pathways.\u003c/p\u003e \u003cp\u003eIn general, the role of PGC-1α in BAT has been recognized to promote thermogenesis through the upregulation of UCP1 expression\u003csup\u003e24,25\u003c/sup\u003e. However, a previous report of adipocyte-specific PGC-1α knockout mice revealed that its main phenotypes include insufficient induction of beige adipose tissue and impaired glucose tolerance, with limited changes in gene expression in BAT\u003csup\u003e11\u003c/sup\u003e. This report was based on male mouse model of congenital PGC-1α knockout, and there have been no investigations into the acquired knockout of PGC-1α in adult male and female adipose tissue. Thus, a distinct role of PGC-1α in female BAT may have been overlooked.\u003c/p\u003e \u003cp\u003eIn our study, BAT Pgc1a was more highly expressed in females than in males under various conditions, particularly under cold exposure and upon adrenergic stimulation, and its gene expression positively correlated with that of Adcy3. In addition, adipocyte-specific PGC-1α deletion resulted in a lower body temperature during acute cold exposure and suppression of VO2 upon NE administration only in female mice. These data suggests that PGC-1α in BAT of female mice is regulated by strong adrenergic stimulation and contributes to an efficient response to rapidly increasing energy demand.\u003c/p\u003e \u003cp\u003eRecently, it was reported that PGC-1α has female-specific functions in some organs. For example, PGC-1α regulates oxidative stress responses in coordination with estrogen signaling in the liver of female mice\u003csup\u003e26\u003c/sup\u003e and intracellular and extracellular calcium dynamics in the female myocardium\u003csup\u003e27\u003c/sup\u003e. Considering the results of these reports and our study, PGC-1α may be a molecule that mediates sex differences across multiple organs, especially the characteristics of females.\u003c/p\u003e \u003cp\u003eIn this study, we found a distinctive mitochondrial morphology in female BAT, which was characterized by a significantly longer total cristae length and larger size than that in male mice. Moreover, not only in terms of morphology but also in functional aspects, mitochondria in female BAT were found to exhibit high NADH-producing capacity and TCA cycle activity. In previous reports, the significance of TCA cycle metabolism in BAT thermogenesis has been demonstrated\u003csup\u003e28,29\u003c/sup\u003e. We have also shown that these morphological and functional features of BAT in female mice are generated by PGC-1α.\u003c/p\u003e \u003cp\u003eCL is a phospholipid that is specific to mitochondrial membranes and is essential for the maintenance of mitochondrial structure, respiratory capacity, and energy substrate metabolism, including the TCA cycle\u003csup\u003e20,30\u0026ndash;32\u003c/sup\u003e. CL has also been reported to be a strong regulator of BAT thermogenesis\u003csup\u003e33\u003c/sup\u003e. In this study, we found that the percentage of CL(18:2)4, which is especially important for mitochondrial respiration\u003csup\u003e20\u0026ndash;22\u003c/sup\u003e, was higher in females than in males and decreased only in females due to PGC-1α deletion. These data suggest that the percentage of CL (18:2)4 is the major contributing factor to sex differences in mitochondrial structure and thermogenesis in BAT of mice. It was reported that cardiomyocyte PGC-1α/β regulated total CL content and mitochondrial morphology by regulating CDP-diglyceride synthetase 1(CDS1) gene expression, an enzyme in the phospholipid synthesis pathway\u003csup\u003e34\u003c/sup\u003e. However, in our study, CDS1 gene expression in BAT showed little change in both males and females due to PGC-1α deletion (data not shown), suggesting the existence of a tissue-specific molecular mechanism(s) in PGC-1α mediated CL production.\u003c/p\u003e \u003cp\u003eAlthough female mitochondria reportedly exhibit a higher energy-producing capacity than male mitochondria in several mitochondria-rich organs, such as the liver, brain, and skeletal muscle\u003csup\u003e15\u003c/sup\u003e, studies investigating the underlying molecular mechanism are limited. While little is known about sex differences in TCA cycle metabolism, a previous study analyzing human brain samples reported that the activities of enzymes involved in the TCA cycle, such as succinate dehydrogenase and citrate synthase, were higher in females than in males\u003csup\u003e35\u003c/sup\u003e. In addition, a previous study reported that female rats had a higher total CL amount in the liver than males\u003csup\u003e36,37\u003c/sup\u003e but did not analyze the fatty acid profile of CL. Considering these findings, it is probable that sex differences in the fatty acid profiles of CL and their regulatory mechanisms exist in organs/tissues beyond BAT.\u003c/p\u003e \u003cp\u003eWe observed that estrogen receptor antagonist administration suppressed VO2, impaired mitochondrial structure and reduced expression of Chrebpβ and downstream DNL-related genes only in BAT of female mice without reducing Pgc1a expression. These results suggest that estrogen signaling and PGC-1α interdependently regulate mitochondrial structure and thermogenesis in female BAT, and we further demonstrated that the transcriptional regulation of Chrebpβ serves a central hub in coordinating these two regulatory pathways. There are limited reports on the regulation of DNL by PGC1-α\u003csup\u003e38\u003c/sup\u003e, while the association between DNL and estrogen has been reported in various cells and organs. In estrogen-sensitive breast and gynecological cancers, estrogen signaling promoted DNL, which in turn contributed to cell proliferation\u003csup\u003e39,40\u003c/sup\u003e. Given the high estrogen sensitivity of female BAT, these estrogen-sensitive cancer cells may have mechanisms similar to those of female BAT for maintaining its high metabolic activity.\u003c/p\u003e \u003cp\u003eA previous report has shown that estrogen signaling in the central nervous system enhances BAT thermogenesis in female rats by increasing sympathetic nervous system activation\u003csup\u003e41\u003c/sup\u003e. On the other hand, our BAT explant analyses indicated that the regulatory system of estrogen, PGC-1α and DNL in female BAT is tissue-autonomous. Taken together, the previous findings and our results suggest that estrogen signaling may enhance BAT thermogenesis in direct and indirect manners.\u003c/p\u003e \u003cp\u003eBased on previous reports that serum estrogen levels are extremely lower in male mice compared to female\u003csup\u003e42\u003c/sup\u003e, the strong involvement of PGC-1α in the estrogen-DNL regulatory mechanism in female BAT may provide one explanation for why the deletion of PGC-1α in male BAT does not result in the same phenotype observed in female BAT. On the other hand, even considering the sex differences in Esr1 expression levels, the absence of an upregulation in DNL-related gene expression in male BAT explants upon direct E2 supplementation suggests that the estrogen-DNL regulatory system itself does not exist in male BAT. The previous report of no enhancement in BAT thermogenesis in male rats following peripheral estrogen administration\u003csup\u003e43\u003c/sup\u003e aligns with our results of the ex vivo experiment. In addition, it has been reported that male-to-female transsexuals undergoing estrogen replacement therapy exhibit a tendency toward obesity. Estrogens have been reported to potentially increase body fat through mechanisms such as the proliferation of preadipocyte\u003csup\u003e44\u003c/sup\u003e. Therefore, estrogen administration to men may increase WAT abundance but may not enhance BAT energy expenditure, which is one possible reason why men cannot benefit from the estrogen that women receive.\u003c/p\u003e \u003cp\u003eIn summary, our findings demonstrate that PGC-1α in female BAT plays a crucial role in controlling systemic energy expenditure by regulating the distinct morphology and function of mitochondria in coordination with estrogen signaling. While PGC-1α has been generally recognized as a master regulator of mitochondria, we have elucidated a novel mitochondrial regulatory mechanism of PGC-1α specific to female BAT. Given the inverse correlation between BAT and metabolic or cardiovascular disease, it is likely that this mechanism could contribute to the metabolic advantage in females. PGC-1α and estrogen signaling are interdependent in this system, meaning that the absence of either one severely impairs thermogenesis function. This \u0026ldquo;overdependence\u0026rdquo; of female BAT on estrogen may in turn explain why postmenopausal women rapidly lose their metabolic advantage, and thus may be a new therapeutic target for metabolic diseases in postmenopausal women.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were performed under the guidelines of the Tokyo Medical and Dental University Committee on Animal Research (A2023-020A, G2023-073A) and the Fundamental Guidelines for Proper Conduct of Animal Experiment and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science and Technology of Japan. C57BL/6J wild-type mice were purchased from CLEA Japan, Inc., and Adipoq-CreERT2 (stock number: 025124) and Ppargc1a (Pgc1a) flox/flox (stock number:\u0026nbsp;009666) mice were purchased from The Jackson Laboratory. To generate tamoxifen-inducible adipocyte-specific PGC-1\u0026alpha; knockout (KO) mice, Pgc1a flox/flox mice were crossed with Adipoq-CreERT2 mice. The animals were housed alone at 25\u0026deg;C with a 12-h light/dark cycle and allowed free access to water and a standard diet (CE-2; 343 kcal/100 g, CLEA Japan, Inc.). Eight-week-old male and female KO or Pgc1a flox/flox (Control) mice were injected intraperitoneally with 100 mg/kg tamoxifen (Sigma-Aldrich) for 5 consecutive days and analyzed at least 8 weeks after the last administration of tamoxifen. For the experiment of tamoxifen administration to wild-type mice according to the same protocol and analyzed after 2 weeks.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor cold exposure experiments, mice were maintained at thermoneutrality (30\u0026deg;C) in a temperature-controlled chamber (HC-100, Shin Factory, Japan) for one week before cold challenge and allowed free access to water and a standard diet. Food was removed 1 h before the start of cold exposure, and the animals were placed at 4\u0026deg;C. During cold exposure, the rectal temperatures (TD-300, NATSUME, Japan) and interscapular surface temperatures (E53, FLIR Systems Inc, USA) of mice were measured every 30\u0026ndash;60 min. The method for measuring interscapular surface temperatures is described in detail in a previous report (1).\u003c/p\u003e\n\u003cp\u003eReferences\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e1. Oelkrug, R. \u0026amp; Mittag, J. An improved method for the precise unravelment of non-shivering brown fat thermokinetics. \u003cem\u003eSci Rep\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 4799 (2021). https://doi.org/10.1038/s41598-021-84200-1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNE-Induced oxygen consumption\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOxygen consumption was measured using a metabolic chamber (Shin Factory, JAPAN) coupled to a mass spectrometer (ARCO-2000; Arco system, Tokyo, JAPAN). Mice were anesthetized, and measurements were performed for 30 min at 33℃ to obtain basal values. Each mouse was then briefly removed from the chamber, treated with norepinephrine (1 mg norepinephrine/kgBW), and returned to the chamber, and oxygen consumption was measured for another 30\u0026ndash;40 min.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGlucose tolerance test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe glucose tolerance test was performed via an intraperitoneal injection of glucose at 2.0\u0026thinsp;g/kg body weight, and blood glucose levels were measured before and 15, 30, 60, 90, and 120\u0026thinsp;min after the injection. Blood glucose was measured using a glucometer (Stat Strip Xpress; Nova biomedical, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein lysates were extracted from Brown adipose tissue using RIPA buffer (nacalai) supplemented with a protease inhibitor cocktail (cOmplete\u003csup\u003etm\u003c/sup\u003e, Sigma-Aldrich). Immunoblotting was performed with Anti-PGC-1\u0026alpha; Mouse mAb (Sigma-Aldrich, ST1202, 1:1000) and total OXPHOS rodent WB antibody cocktail (Abcam, ab110413, 1:1000). \u0026alpha;-tublin (Cell Signaling, #2144, 1:1000) was used as the loading control. Immunoblots were detected and analyzed using ECL Prime Western Blotting Detection Reagent and ImageQuant LAS 4000 mini (GE Healthcare).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHE staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBAT was fixed with 4% paraformaldehyde and embedded in paraffin. Sections were stained with hematoxylin and eosin (HE).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElectron microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe BAT were fixed in 4% PFA and 2.5% GA in 0.1M phosphate buffer (PB) for 2 h, washed with 0.1 M PB, post-fixed in 1% OsO4 buffered with 0.1 M PB for 2 h, dehydrated in a graded series of ethanol, and embedded in Epon 812. Ultrathin sections (70 nm) were collected on copper grids, double-stained with uranyl acetate and lead citrate, and then examined by transmission electron microscopy (JEM-1400Flash, JEOL, Japan). Quantification of mitochondrial size and content was performed using ImageJ software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA isolation and quantitative RT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated using the RNeasy Plus Universal Mini Kit (Qiagen). cDNA was synthesized using Random Primer (Thermo Fisher Scientific Inc.) and ReverTra Ace (Toyobo Co., Ltd.). Quantitative PCR was performed using the QuantStudio 6 Flex Real-Time PCR System with Fast SYBR Green Master Mix Reagent. The primer sequences are presented in (Supplemental Table 1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNA-seq experiments were performed by Novogene (Beijing, China) using RNA extracted from BAT. Sequencing libraries were built using the NEBNext UltraTM RNA Library Prep Kit (Illumina, USA). The library preparations were sequenced on an Illumina Novaseq 6000 platform, and 150-bp paired-end reads were generated. Differentially expressed genes were determined by fold change (\u0026gt;1.5), and gene ontology analysis was conducted using Metasape 3.5.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMetabolomics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBAT samples for metabolomics were obtained from mice 30 min after NE administration at 33\u0026deg;C to evaluate the metabolic dynamics of BAT exhibiting maximal oxygen consumption. Approximately 25\u0026ndash;30 mg of frozen BAT tissue was placed in a homogenization tube along with zirconia beads (5mm\u0026phi; and 3mm\u0026phi;). Next, 1,500 \u0026micro;L of 50% acetonitrile/Milli-Q water containing internal standards (H3304-1002, Human Metabolome Technologies, Inc. (HMT), Tsuruoka, Yamagata, Japan) was added to the tube, after which the tissue was completely homogenized at 1,500 rpm, 4\u0026deg;C for 60 s using a bead shaker (Shake Master NEO, Bio Medical Science, Tokyo, Japan). The homogenate was then centrifuged at 2,300 \u0026times; g, 4\u0026deg;C for 5 min. Subsequently, 800 \u0026micro;L of upper aqueous layer was centrifugally filtered through a Millipore 5-kDa cutoff filter (UltrafreeMC-PLHCC, HMT) at 9,100 \u0026times;g, 4\u0026deg;C for 180 min to remove macromolecules. The filtrate was evaporated to dryness under vacuum and reconstituted in 50 \u0026micro;L of Milli-Q water for metabolome analysis at HMT.\u003c/p\u003e\n\u003cp\u003eMetabolome analysis was conducted according to HMT\u0026rsquo;s C-SCOPE package, using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS) for cation analysis and CE-tandem mass spectrometry (CE-MS/MS) for anion analysis based on the methods described previously (1, 2). Briefly, CE-TOFMS and CE-MS/MS analyses were performed using an Agilent CE capillary electrophoresis system equipped with an Agilent 6210 time-of-flight mass spectrometer (Agilent Technologies, Inc., Santa Clara, CA, USA) and Agilent 6460 Triple Quadrupole LC/MS (Agilent Technologies), respectively. The systems were controlled using Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 \u0026mu;m i. d. \u0026times; 80 cm total length) with commercial electrophoresis buffer (H3301-1001 and I3302-1023 for cation and anion analyses, respectively, HMT) as the electrolyte. The time-of-flight mass spectrometer was scanned from m/z 50 to 1,000 (1), and the triple quadrupole mass spectrometer was used to detect compounds in dynamic MRM mode. Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (3) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) to obtain peak information, including m/z, peak area, and migration time (MT). Signal peaks were annotated according to the HMT metabolite database based on their m/z values and MTs. The peak area of each metabolite was normalized to internal standards, and the metabolite concentration was evaluated by standard curves with three-point calibrations using each standard compound. Hierarchical cluster analysis and principal component analysis (PCA) (4) were performed using HMT\u0026rsquo;s proprietary MATLAB and R programs, respectively. Detected metabolites were plotted on metabolic pathway maps using the VANTED software (5).\u003c/p\u003e\n\u003cp\u003eReferences\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e1. Ohashi, Y. \u003cem\u003eet al\u003c/em\u003e. Depiction of metabolome changes in histidine-starved \u003cem\u003eEscherichia coli\u003c/em\u003e by CE-TOFMS. \u003cem\u003eMol. Biosyst\u003c/em\u003e. 4, 135\u0026ndash;147, 2008.\u003c/p\u003e\n\u003cp\u003e2. Ooga, T. \u003cem\u003eet al\u003c/em\u003e. Metabolomic anatomy of an animal model revealing homeostatic imbalances in dyslipidaemia. \u003cem\u003eMol. Biosyst\u003c/em\u003e. 7, 1217\u0026ndash;1223 (2011).\u003c/p\u003e\n\u003cp\u003e3. Sugimoto, M., Wong, D. T., Hirayama, A., Soga, T. \u0026amp; Tomita, M. Capillary electrophoresis mass spectrometry-based saliva metabolomics identified oral, breast and pancreatic cancer\u0026ndash;specific profiles. \u003cem\u003eMetabolomics\u003c/em\u003e 6, 78\u0026ndash;95 (2009).\u003c/p\u003e\n\u003cp\u003e4. Yamamoto, H., Fujimori, T., Sato, H., Ishikawa, G., Kami, K. \u0026amp; Ohashi, Y: Statistical hypothesis testing of factor loading in principal component analysis and its application to metabolite set enrichment analysis. \u003cem\u003eBMC Bioinform\u003c/em\u003e. 15, 51 (2014).\u003c/p\u003e\n\u003cp\u003e5. Junker, B. H., Klukas, C. \u0026amp; Schreiber F. VANTED: a system for advanced data analysis and visualization in the context of biological networks. \u003cem\u003eBMC Bioinform\u003c/em\u003e. 7, 109 (2006).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePartial least squares (PLS) discriminant analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMetabolomics data were normalized and analyzed by partial least squares (PLS) (1) using R programs (2) developed by Human Metabolome Technologies, Inc.\u003c/p\u003e\n\u003cp\u003eReferences\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e1. Yamamoto, H. PLS-ROG: partial least squares with rank order of groups. \u003cem\u003eJ. Chemom\u003c/em\u003e. 33, e2883 (2017).\u003c/p\u003e\n\u003cp\u003e2. R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ (2021).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLipidomics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBAT samples for lipidomics were obtained from mice 30 minutes after NE administration at 33\u0026deg;C to evaluate the lipid profile of BAT exhibiting maximal oxygen consumption. Lipidome analysis was conducted according to lipidome lab Non-targeted lipidome Scan package (lipidome lab, Akita, Japan), using liquid chromatograph orbitrap mass spectrometry (LC-OrbitrapMS) based on the methods described previously\u003csup\u003e1,2\u003c/sup\u003e. Briefly, total lipids were extracted from\u0026nbsp;10 \u0026micro;L brown adipose tissue samples\u0026nbsp;with the modified Bligh-Dyer method. An aliquot of the lower/organic phase was evaporated to dryness under N2, and the residue was dissolved in methanol for LC-MS/MS measurements.\u003c/p\u003e\n\u003cp\u003eLiquid chromatography (LC)-electrospray ionization-MS/MS analysis was performed by using Q-Exactive Plus mass spectrometer with an UltiMate 3000 LC system (Thermo Fisher Scientific). Samples were separated on L-column3 C18 metal-free column (2.0 \u0026micro;m, 2.0 mm \u0026times; 100 mm i.d.) at 40\u0026deg;C using a gradient solvent system: mobile phase A (isopropanol/methanol/water (5/1/4 v/v/v) supplemented with 5 mM ammonium formate and 0.05% ammonium hydroxide (28% in water))/mobile phase B (isopropanol supplemented with 5 mM ammonium formate and 0.05% ammonium hydroxide (28% in water)) ratios of 60%/40% (0 min), 40%/60% (0\u0026ndash;1 min), 20%/80% (1\u0026ndash;9 min), 5%/95% (9\u0026ndash;11 min), 5%/95% (11\u0026ndash;22 min), 95%/5% (22\u0026ndash;22.1 min), 95%/5% (22.1\u0026ndash;25 min), 60%/40% (25\u0026ndash;25.1 min) and 60%/40% (25.1\u0026ndash;30 min). The injection volume was 10 \u0026micro;l and the flow rate was 0.1 mL/min. A heated electrospray ionization (HESI-II) source conditions were as follows: ionization mode, positive or negative; sheath gas, 60 arbitrary units; auxiliary gas, 10 arbitrary units; sweep gas, 0 arbitrary units; spray voltage, 3.2 kV in positive and \u0026minus;3.0 kV in negative mode; heater temperature, 325\u0026deg;C; ion transfer capillary temperature, 300\u0026deg;C in positive and \u0026minus;320\u0026deg;C in negative mode; and S-lens RF level, 50. The orbitrap mass analyzer was operated at a resolving power of 70,000 in full-scan mode (scan range 200\u0026ndash;1,800\u0026thinsp;\u003cem\u003em/z\u003c/em\u003e in positive and 190\u0026ndash;1,800\u0026thinsp;\u003cem\u003em/z\u003c/em\u003e in negative mode; automatic gain control (AGC) target 1e6 in positive and 3e6 in negative mode) and resolving power of 17,500 in positive and 35,000 in negative mode in the top 20 data-dependent MS2 mode (stepped normalized collision energy 20, 30 and 40; isolation window 4.0\u0026thinsp;m/z; AGC target 1e5) with dynamic exclusion setting of 10.0 s. Post-processing of the raw data files for diacylglycerol and ceramide were done using the lipid molecular identification software, Lipid Search 5.1 (Mitsui Knowledge Industries co., ltd., JAPAN) which is identifies individual intact lipid molecules on the basis of their molecular weight and fragmentation patterns from headgroup and fatty acid composition. In this method, biological matrix effects cannot be normalized in all detected peaks, because it is not possible to prepare appropriate internal standards corresponding to all the detected peaks. The relative values were calculated using the ratio of the chromatographic peak area of each analyte to that of the total analyte. The annotation method used in this study corresponds to equivalent to \u0026quot;Fatty Acyl/Alkyl Level or Hydroxyl Group Level\u0026quot; defined by the lipidomics Standard Initiative\u003csup\u003e3\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eReferences\u003c/p\u003e\n\u003cp\u003e1. Nishiumi, S. \u003cem\u003eet al\u003c/em\u003e. Comparative evaluation of plasma metabolomic data from multiple laboratories. \u003cem\u003eMetabolites\u003c/em\u003e 2, 135 (2022).\u003c/p\u003e\n\u003cp\u003e2. Takumi, H.\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e. Comprehensive analysis of lipid composition in human foremilk and hindmilk. \u003cem\u003eJ Oleo Sci\u003c/em\u003e. 7, 947\u0026ndash;957 (2022).\u003c/p\u003e\n\u003cp\u003e3. Lipidomics Standards Initiative Consortium. Lipidomics needs more standardization. \u003cem\u003eNat. Metab\u003c/em\u003e. 1, 745\u0026ndash;747 (2019).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBAT-specific ChREBP knock down by AAV injection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT)\u0026nbsp;and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively). Wild-type female mice were anesthetized and the interscapular skin was incised to expose the BAT.\u0026nbsp;2.4*10\u003csup\u003e10\u003c/sup\u003eGC vectors were injected into the BAT using 10\u0026mu;L syringe (HAMILTON, 80330), the skin was sutured, and the anesthesia was antagonized. These mice were used for experiments of measurement of VO2, gene expression analyses and histological analyses after 1 week of injection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOvariectomy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e12-week-old wild-type mice were bilaterally ovariectomized (OVX) or sham operated under a combination of medetomidine, midazolam, and butorphanol anesthesia (subcutaneously administered). They were sacrificed and analyzed one week after ovariectomy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBAT ex vivo assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBAT was collected, surface washed with PBS and kept in PBS at 37C. BAT explants were cut into 1\u0026ndash;2 mm pieces with scissors in PBS at 37\u0026deg;C and transferred to serum and phenol red free high glucose DMEM supplemented with 100 nM 17\u0026beta;-Estradiol (Sigma) or vehicle (ethanol). After incubation in a CO\u003csub\u003e2\u003c/sub\u003e incubator for 24 hours, BAT was collected and used for RNA extraction.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Ms. K. Katakura and T. Haba for technical assistance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis work was supported by a Grant-in-Aid for Scientific Research to T.Y. (22H03126) and K.T. (21K16350) from the Japan Society for the Promotion of Science (JSPS). This research was also supported by Moonshot R\u0026amp;D [Grant Number JPMJPS2023] to T.Y. from the Japan Science and Technology Agency (JST).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWorld Health Organization. Obesity and Overweight. Key Facts. (2021). Available online at: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed February 15, 2024).\u003c/li\u003e\n\u003cli\u003eTsao, C. W.\u003cem\u003e et al.\u003c/em\u003e Heart Disease and Stroke Statistics-2023 Update: A Report From the American Heart Association. \u003cem\u003eCirculation\u003c/em\u003e \u003cstrong\u003e147\u003c/strong\u003e, e93-e621 (2023). https://doi.org/10.1161/CIR.0000000000001123\u003c/li\u003e\n\u003cli\u003eSun, H.\u003cem\u003e et al.\u003c/em\u003e IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. \u003cem\u003eDiabetes Res Clin Pract\u003c/em\u003e \u003cstrong\u003e183\u003c/strong\u003e, 109119 (2022). https://doi.org/10.1016/j.diabres.2021.109119\u003c/li\u003e\n\u003cli\u003eKaikaew, K., Grefhorst, A. \u0026amp; Visser, J. A. Sex Differences in Brown Adipose Tissue Function: Sex Hormones, Glucocorticoids, and Their Crosstalk. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 652444 (2021). https://doi.org/10.3389/fendo.2021.652444\u003c/li\u003e\n\u003cli\u003eCarpentier, A. C., Blondin, D. P., Haman, F. \u0026amp; Richard, D. Brown Adipose Tissue-A Translational Perspective. \u003cem\u003eEndocr Rev\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 143-192 (2023). https://doi.org/10.1210/endrev/bnac015\u003c/li\u003e\n\u003cli\u003eBecher, T.\u003cem\u003e et al.\u003c/em\u003e Brown adipose tissue is associated with cardiometabolic health. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 58-65 (2021). https://doi.org/10.1038/s41591-020-1126-7\u003c/li\u003e\n\u003cli\u003eGaspar, R. C., Pauli, J. R., Shulman, G. I. \u0026amp; Munoz, V. R. An update on brown adipose tissue biology: a discussion of recent findings. \u003cem\u003eAm J Physiol Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e320\u003c/strong\u003e, E488-E495 (2021). https://doi.org/10.1152/ajpendo.00310.2020\u003c/li\u003e\n\u003cli\u003eRodriguez-Cuenca, S.\u003cem\u003e et al.\u003c/em\u003e Sex-dependent thermogenesis, differences in mitochondrial morphology and function, and adrenergic response in brown adipose tissue. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e277\u003c/strong\u003e, 42958-42963 (2002). https://doi.org/10.1074/jbc.M207229200\u003c/li\u003e\n\u003cli\u003eQuevedo, S., Roca, P., Pico, C. \u0026amp; Palou, A. Sex-associated differences in cold-induced UCP1 synthesis in rodent brown adipose tissue. \u003cem\u003ePflugers Arch\u003c/em\u003e \u003cstrong\u003e436\u003c/strong\u003e, 689-695 (1998). https://doi.org/10.1007/s004240050690\u003c/li\u003e\n\u003cli\u003eVillena, J. A. New insights into PGC-1 coactivators: redefining their role in the regulation of mitochondrial function and beyond. \u003cem\u003eFEBS J\u003c/em\u003e \u003cstrong\u003e282\u003c/strong\u003e, 647-672 (2015). https://doi.org/10.1111/febs.13175\u003c/li\u003e\n\u003cli\u003eKleiner, S.\u003cem\u003e et al.\u003c/em\u003e Development of insulin resistance in mice lacking PGC-1alpha in adipose tissues. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e109\u003c/strong\u003e, 9635-9640 (2012). https://doi.org/10.1073/pnas.1207287109\u003c/li\u003e\n\u003cli\u003ePerdikari, A.\u003cem\u003e et al.\u003c/em\u003e BATLAS: Deconvoluting Brown Adipose Tissue. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 784-797 e784 (2018). https://doi.org/10.1016/j.celrep.2018.09.044\u003c/li\u003e\n\u003cli\u003eSaeed, S.\u003cem\u003e et al.\u003c/em\u003e Loss-of-function mutations in ADCY3 cause monogenic severe obesity. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e50\u003c/strong\u003e, 175-179 (2018). https://doi.org/10.1038/s41588-017-0023-6\u003c/li\u003e\n\u003cli\u003eGrarup, N.\u003cem\u003e et al.\u003c/em\u003e Loss-of-function variants in ADCY3 increase risk of obesity and type 2 diabetes. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e50\u003c/strong\u003e, 172-174 (2018). https://doi.org/10.1038/s41588-017-0022-7\u003c/li\u003e\n\u003cli\u003eVentura-Clapier, R.\u003cem\u003e et al.\u003c/em\u003e Mitochondria: a central target for sex differences in pathologies. \u003cem\u003eClin Sci (Lond)\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, 803-822 (2017). https://doi.org/10.1042/CS20160485\u003c/li\u003e\n\u003cli\u003eKlinge, C. M. Estrogenic control of mitochondrial function. \u003cem\u003eRedox Biol\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 101435 (2020). https://doi.org/10.1016/j.redox.2020.101435\u003c/li\u003e\n\u003cli\u003eSanchez-Gurmaches, J.\u003cem\u003e et al.\u003c/em\u003e Brown Fat AKT2 Is a Cold-Induced Kinase that Stimulates ChREBP-Mediated De Novo Lipogenesis to Optimize Fuel Storage and Thermogenesis. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 195-209 e196 (2018). https://doi.org/10.1016/j.cmet.2017.10.008\u003c/li\u003e\n\u003cli\u003eSchlein, C.\u003cem\u003e et al.\u003c/em\u003e Endogenous Fatty Acid Synthesis Drives Brown Adipose Tissue Involution. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 108624 (2021). https://doi.org/10.1016/j.celrep.2020.108624\u003c/li\u003e\n\u003cli\u003eHoene, M.\u003cem\u003e et al.\u003c/em\u003e The lipid profile of brown adipose tissue is sex-specific in mice. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1842\u003c/strong\u003e, 1563-1570 (2014). https://doi.org/10.1016/j.bbalip.2014.08.003\u003c/li\u003e\n\u003cli\u003eDudek, J. Role of Cardiolipin in Mitochondrial Signaling Pathways. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 90 (2017). https://doi.org/10.3389/fcell.2017.00090\u003c/li\u003e\n\u003cli\u003eYamaoka, S., Urade, R. \u0026amp; Kito, M. Cardiolipin molecular species in rat heart mitochondria are sensitive to essential fatty acid-deficient dietary lipids. \u003cem\u003eJ Nutr\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 415-421 (1990). https://doi.org/10.1093/jn/120.5.415\u003c/li\u003e\n\u003cli\u003eSparagna, G. C.\u003cem\u003e et al.\u003c/em\u003e Loss of cardiac tetralinoleoyl cardiolipin in human and experimental heart failure. \u003cem\u003eJ Lipid Res\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 1559-1570 (2007). https://doi.org/10.1194/jlr.M600551-JLR200\u003c/li\u003e\n\u003cli\u003eFrank, A. P., Palmer, B. F. \u0026amp; Clegg, D. J. Do estrogens enhance activation of brown and beiging of adipose tissues? \u003cem\u003ePhysiol Behav\u003c/em\u003e \u003cstrong\u003e187\u003c/strong\u003e, 24-31 (2018). https://doi.org/10.1016/j.physbeh.2017.09.026\u003c/li\u003e\n\u003cli\u003ePuigserver, P.\u003cem\u003e et al.\u003c/em\u003e A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e92\u003c/strong\u003e, 829-839 (1998). https://doi.org/10.1016/s0092-8674(00)81410-5\u003c/li\u003e\n\u003cli\u003eTiraby, C.\u003cem\u003e et al.\u003c/em\u003e Acquirement of brown fat cell features by human white adipocytes. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e278\u003c/strong\u003e, 33370-33376 (2003). https://doi.org/10.1074/jbc.M305235200\u003c/li\u003e\n\u003cli\u003eBesse-Patin, A.\u003cem\u003e et al.\u003c/em\u003e Estrogen Signals Through Peroxisome Proliferator-Activated Receptor-gamma Coactivator 1alpha to Reduce Oxidative Damage Associated With Diet-Induced Fatty Liver Disease. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cstrong\u003e152\u003c/strong\u003e, 243-256 (2017). https://doi.org/10.1053/j.gastro.2016.09.017\u003c/li\u003e\n\u003cli\u003eNaumenko, N.\u003cem\u003e et al.\u003c/em\u003e PGC-1alpha deficiency reveals sex-specific links between cardiac energy metabolism and EC-coupling during development of heart failure in mice. \u003cem\u003eCardiovasc Res\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, 1520-1534 (2022). https://doi.org/10.1093/cvr/cvab188\u003c/li\u003e\n\u003cli\u003ePanic, V.\u003cem\u003e et al.\u003c/em\u003e Mitochondrial pyruvate carrier is required for optimal brown fat thermogenesis. \u003cem\u003eElife\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e (2020). https://doi.org/10.7554/eLife.52558\u003c/li\u003e\n\u003cli\u003eMills, E. L.\u003cem\u003e et al.\u003c/em\u003e Accumulation of succinate controls activation of adipose tissue thermogenesis. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e560\u003c/strong\u003e, 102-106 (2018). https://doi.org/10.1038/s41586-018-0353-2\u003c/li\u003e\n\u003cli\u003eBan, T.\u003cem\u003e et al.\u003c/em\u003e Molecular basis of selective mitochondrial fusion by heterotypic action between OPA1 and cardiolipin. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 856-863 (2017). https://doi.org/10.1038/ncb3560\u003c/li\u003e\n\u003cli\u003eKlingenberg, M. Cardiolipin and mitochondrial carriers. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1788\u003c/strong\u003e, 2048-2058 (2009). https://doi.org/10.1016/j.bbamem.2009.06.007\u003c/li\u003e\n\u003cli\u003eLi, Y.\u003cem\u003e et al.\u003c/em\u003e Cardiolipin-induced activation of pyruvate dehydrogenase links mitochondrial lipid biosynthesis to TCA cycle function. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e294\u003c/strong\u003e, 11568-11578 (2019). https://doi.org/10.1074/jbc.RA119.009037\u003c/li\u003e\n\u003cli\u003eSustarsic, E. G.\u003cem\u003e et al.\u003c/em\u003e Cardiolipin Synthesis in Brown and Beige Fat Mitochondria Is Essential for Systemic Energy Homeostasis. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 159-174 e111 (2018). https://doi.org/10.1016/j.cmet.2018.05.003\u003c/li\u003e\n\u003cli\u003eLai, L.\u003cem\u003e et al.\u003c/em\u003e A role for peroxisome proliferator-activated receptor gamma coactivator 1 (PGC-1) in the regulation of cardiac mitochondrial phospholipid biosynthesis. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e289\u003c/strong\u003e, 2250-2259 (2014). https://doi.org/10.1074/jbc.M113.523654\u003c/li\u003e\n\u003cli\u003eHarish, G.\u003cem\u003e et al.\u003c/em\u003e Mitochondrial function in human brains is affected by pre- and post mortem factors. \u003cem\u003eNeuropathol Appl Neurobiol\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 298-315 (2013). https://doi.org/10.1111/j.1365-2990.2012.01285.x\u003c/li\u003e\n\u003cli\u003eJusto, R.\u003cem\u003e et al.\u003c/em\u003e Gender dimorphism in rat liver mitochondrial oxidative metabolism and biogenesis. \u003cem\u003eAm J Physiol Cell Physiol\u003c/em\u003e \u003cstrong\u003e289\u003c/strong\u003e, C372-378 (2005). https://doi.org/10.1152/ajpcell.00035.2005\u003c/li\u003e\n\u003cli\u003eMoulin, M.\u003cem\u003e et al.\u003c/em\u003e Sexual dimorphism of doxorubicin-mediated cardiotoxicity: potential role of energy metabolism remodeling. \u003cem\u003eCirc Heart Fail\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 98-108 (2015). https://doi.org/10.1161/CIRCHEARTFAILURE.114.001180\u003c/li\u003e\n\u003cli\u003eBhalla, K.\u003cem\u003e et al.\u003c/em\u003e PGC1alpha promotes tumor growth by inducing gene expression programs supporting lipogenesis. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e71\u003c/strong\u003e, 6888-6898 (2011). https://doi.org/10.1158/0008-5472.CAN-11-1011\u003c/li\u003e\n\u003cli\u003eSantolla, M. F.\u003cem\u003e et al.\u003c/em\u003e G protein-coupled estrogen receptor mediates the up-regulation of fatty acid synthase induced by 17beta-estradiol in cancer cells and cancer-associated fibroblasts. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e287\u003c/strong\u003e, 43234-43245 (2012). https://doi.org/10.1074/jbc.M112.417303\u003c/li\u003e\n\u003cli\u003ePizer, E. S., Lax, S. F., Kuhajda, F. P., Pasternack, G. R. \u0026amp; Kurman, R. J. Fatty acid synthase expression in endometrial carcinoma: correlation with cell proliferation and hormone receptors. \u003cem\u003eCancer\u003c/em\u003e \u003cstrong\u003e83\u003c/strong\u003e, 528-537 (1998).\u003c/li\u003e\n\u003cli\u003eMartinez de Morentin, P. B.\u003cem\u003e et al.\u003c/em\u003e Estradiol regulates brown adipose tissue thermogenesis via hypothalamic AMPK. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 41-53 (2014). https://doi.org/10.1016/j.cmet.2014.03.031\u003c/li\u003e\n\u003cli\u003eNilsson, M. E.\u003cem\u003e et al.\u003c/em\u003e Measurement of a Comprehensive Sex Steroid Profile in Rodent Serum by High-Sensitive Gas Chromatography-Tandem Mass Spectrometry. \u003cem\u003eEndocrinology\u003c/em\u003e \u003cstrong\u003e156\u003c/strong\u003e, 2492-2502 (2015). https://doi.org/10.1210/en.2014-1890\u003c/li\u003e\n\u003cli\u003eSievers, W.\u003cem\u003e et al.\u003c/em\u003e The effect of estrogen on brown adipose tissue activity in male rats. \u003cem\u003eBMC Res Notes\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 28 (2022). https://doi.org/10.1186/s13104-022-05910-x\u003c/li\u003e\n\u003cli\u003eAnderson, L. A., McTernan, P. G., Barnett, A. H. \u0026amp; Kumar, S. The effects of androgens and estrogens on preadipocyte proliferation in human adipose tissue: influence of gender and site. \u003cem\u003eJ Clin Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e, 5045-5051 (2001). https://doi.org/10.1210/jcem.86.10.7955\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3968646/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3968646/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBrown adipose tissue (BAT), a thermogenic tissue that plays an important role in systemic energy expenditure, has histological and functional sex differences. BAT thermogenic activity is higher in female mice than in male mice. However, the molecular mechanism underlying this functional sex difference has not been fully elucidated. Herein, we demonstrate the role and mechanism of PGC-1α in this sex difference. Inducible adipocyte-specific PGC-1α knockout (KO) mice displayed decreased BAT thermogenesis only in females. Expression of carbohydrate response-element binding protein beta (Chrebpβ) and downstream de novo lipogenesis (DNL) related genes were both reduced only in female KO mice. BAT-specific knockdown of Chrebpβ reduced the DNL-related gene expression and BAT thermogenesis in female wild-type mice. Furthermore, PGC-1α enhanced the sensitivity of female BAT estrogen signaling, thereby increasing Chrebpβ and its downstream DNL-related gene expression. These findings demonstrate that PGC-1α-ChREBPβ mediated DNL plays a pivotal role in BAT thermogenesis in a sex-dependent manner.\u003c/p\u003e","manuscriptTitle":"Sex difference in BAT thermogenesis depends on PGC-1α-ChREBPβ mediated de novo lipogenesis in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-13 08:08:34","doi":"10.21203/rs.3.rs-3968646/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"079891d5-1e84-42eb-a41c-aafe817abacb","owner":[],"postedDate":"March 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":28981186,"name":"Biological sciences/Molecular biology"},{"id":28981187,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases/Metabolic syndrome"}],"tags":[],"updatedAt":"2025-07-15T07:06:02+00:00","versionOfRecord":{"articleIdentity":"rs-3968646","link":"https://doi.org/10.1038/s41467-025-61219-w","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2025-07-14 04:00:00","publishedOnDateReadable":"July 14th, 2025"},"versionCreatedAt":"2024-03-13 08:08:34","video":"","vorDoi":"10.1038/s41467-025-61219-w","vorDoiUrl":"https://doi.org/10.1038/s41467-025-61219-w","workflowStages":[]},"version":"v1","identity":"rs-3968646","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3968646","identity":"rs-3968646","version":["v1"]},"buildId":"cTy_lsJlmDsVRNrSptgXS","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}