Genetic Relationship Analysis of Pastor roseus Based on COI and Cytb Gene Sequences

Genetic Relationship Analysis of Pastor roseus Based on COI and Cytb Gene Sequences | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL Ecology and Evolution This is a preprint and has not been peer reviewed. Data may be preliminary. 16 September 2025 V1 Latest version Share on Genetic Relationship Analysis of Pastor roseus Based on COI and Cytb Gene Sequences Authors : Xiaofang Ye 0000-0002-7531-3162 [email protected] , Xixiu Sun 0009-0004-8992-3625 , Xiaojie Wang , Ran Li , Huixia Liu , Ye Xu , Rong Ji , Jun Lin , and Kun Yang Authors Info & Affiliations https://doi.org/10.22541/au.175804262.29546115/v1 259 views 176 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Abstract: This study aimed to elucidate the intra- and inter-population genetic variation of Pastor roseus in Xinjiang, China. Sequences of the mitochondrial genes COI and Cytb of 108 individuals from 10 distinct geographical populations across four regions of Xinjiang Uyghur Autonomous Region were analyzed. The mitochondrial genes were 1551 bp and 1143 bp in full length, respectively, and the AT content of bases was greater than the GC content. Based on the molecular variation in COI and Cytb , 62 and 69 haplotypes were detected, respectively; the average haplotype diversity (Hd) values were 0.976±0.006 and 0.944±0.018, respectively, and the nucleotide diversity (π) values were 0.00316±0.00016 and 0.00292±0.00021, respectively, indicating that there was high genetic diversity among the 10 population. Analysis of molecular variance (AMOVA) indicated that the major source of genetic variation was within the populations. Analysis of molecular signatures of neutrality indicated that Tajima’s D value was not significant, but Fu’s FS was significant, suggesting that P. roseus populations have recently experienced a large population expansion, but that the populations are currently relatively stable and the selection pressure is low. The results of the study not only provide a theoretical basis for the conservation of P. roseus , but also help to utilize this species in the comprehensive management of grassland locusts. Genetic Relationship Analysis of Pastor roseus Based on COI and Cytb Gene Sequences Xixiu Sun 1 , Xiaojie Wang 1 , Ran Li 1 , Huixia Liu 1 , Ye Xu 1 , Rong Ji 2,3 , Jun Lin 4 , Kun Yang 4 and Xiaofang Ye 1,2, * 1 International Research Center of Cross-Border Pest Management in Central Asia, Xinjiang Key Laboratory of Special Species Conservation and Regulatory Biology, College of Life Sciences, Xinjiang Normal University, Urumqi, Xinjiang Uygur Autonomous Region, 830017, P.R. China; Xixiu Sun( [email protected] ); Xiaojie Wang( [email protected] ); Ran Li( [email protected] ); Huixia Liu( [email protected] ); Ye Xu( [email protected] ); 2 Research Field (Migratory Biology), Observation and Research Station of Xinjiang, Tacheng, Xinjiang Xinjiang Uygur Autonomous Region, 834700, P.R. China; 3 Changji University, Changji, Xinjiang Uygur Autonomous Region, 831100, P.R. China; Rong Ji ( [email protected] ) 4 Center for Grassland Biological Disaster Prevention and Control of Xinjiang Uygur Autonomous Region, Urumqi 830000, Xinjiang Uygur Autonomous Region, China; Jun Lin( [email protected] ); Kun Yang( [email protected] ) Xixiu Sun and Xiaojie Wang should be considered the joint first author. * Correspondence: [email protected] (Xiaofang Ye). Abstract: This study aimed to elucidate the intra- and inter-population genetic variation of Pastor roseus in Xinjiang, China. Sequences of the mitochondrial genes COI and Cytb of 108 individuals from 10 distinct geographical populations across four regions of Xinjiang Uyghur Autonomous Region were analyzed. The mitochondrial genes were 1551 bp and 1143 bp in full length, respectively, and the AT content of bases was greater than the GC content. Based on the molecular variation in COI and Cytb , 62 and 69 haplotypes were detected, respectively; the average haplotype diversity ( H d ) values were 0.976±0.006 and 0.944±0.018, respectively, and the nucleotide diversity (π) values were 0.00316±0.00016 and 0.00292±0.00021, respectively, indicating that there was high genetic diversity among the 10 population. Analysis of molecular variance (AMOVA) indicated that the major source of genetic variation was within the populations. Analysis of molecular signatures of neutrality indicated that Tajima’s D value was not significant, but Fu’s F S was significant, suggesting that P. roseus populations have recently experienced a large population expansion, but that the populations are currently relatively stable and the selection pressure is low. The results of the study not only provide a theoretical basis for the conservation of P. roseus , but also help to utilize this species in the comprehensive management of grassland locusts. Keywords: Pastor roseus ; mitochondrial DNA; genetic diversity; genetic structure Introduction Pastor roseus , a long-distance migratory passerine of the family Sturnidae (Hobson and Yohannes 2007; Quader and Raza 2018), breeds annually with a population of 2−4 million individuals in locust-prone grasslands of Xinjiang, at elevations ranging from 300 to 2,500 m. Its reproductive cycle is highly synchronized with locust outbreak periods (Yu 2012). As an efficient natural predator of locusts, adults consume 120−180 locusts/day (Li et al. 2010), thereby protecting millions of hectares of grassland. Its biological control efficacy significantly surpasses that of chemical control methods. Research demonstrates that genetic diversity directly influences avian migration phenology and predation efficiency. Maintaining intraspecific genetic variation is critical for sustaining ecological pest-control functions. Populations that experience a loss of genetic variation may suffer reduced biocontrol capacity, while those with high genetic diversity exhibit enhanced predation efficiency, thus reducing pesticide residues from chemical interventions (Ranner et al. 1994; Frankham et al. 2002). Early studies in avian genetics primarily relied on morphological characteristics and behavioral traits to establish phylogenetic relationships (Li et al. 2015; Xia et al. 2015), but such approaches often yielded conflicting conclusions due to discrepancies in research methodologies. Additionally, many avian traits are functional rather than phylogenetically informative (Zhang 2007). With modern advances in biotechnology, DNA-based molecular techniques are being increasingly recognized and utilized, enabling numerous valuable research outcomes in avian phylogenetics based on mitochondrial genome studies. Mitochondrial DNA (mtDNA) is characterized by its rapid evolution, maternal inheritance, minimal recombination, and absence of introns. It has provided vast molecular data for use in molecular phylogenetics (Helm-Bychowski and Cracraft 1993). Specifically, COI and Cytb genes are frequently employed for species identification, species relationship analysis, and determination of genetic differentiation. The research on P. roseus in China has focused on technology to attract this species and understanding their locust control effect (Guo 2015), while research elsewhere has focused on changes in important physiological characters like water and energy metabolism during their migration (Milchev and Dimitrov 2005), as well as recording changes in its distribution (Kumar 2015; Diniarsih et al. 2016; Oo et al. 2020). To the best of our knowledge, no reports have been published on the population genetics of P. roseus . Accordingly, the present study analyzed the COI and Cytb gene sequences of P. roseus from various geographically separated populations in Xinjiang, determined their base compositions, and calculated various population genetic statistics. Ultimately, the phylogeographic relationships were elucidated among multiple P. roseus populations and individuals across different regions of Xinjiang, providing a preliminary assessment of the uniformity of rosy starling populations within this region. This study offers a scientific foundation for devising effective measures to conserve and utilize P. roseus germplasm resources. Preserving genetic diversity enhances biocontrol efficacy, potentially reducing pesticide usage in grassland ecosystems, and aiding in judicious application of their use in controlling locusts to mitigate the losses incurred by locust infestation in Xinjiang. Material and Methods 2.1 Sampling and treatment Blood samples of P. roseus chicks from Hami City, Tacheng City, Manas County, and Yining County in Xinjiang, China were collected from May to July of both 2024 and 2025 (Fig. 1 and Table 1). Multiple nests were randomly selected in the aforementioned areas, and the nests and chicks in them were labeled. Venous blood (0.5 mL) from the wing of one chick in each nest was collected and quickly transferred to a centrifuge tube with 1% heparin sodium solution. The mixture in the tube was thoroughly mixed by slowly pipetting it and then stored at −80°C. Figure 1. Distribution map of sampling sites. Group Nest No. Collection year Corresponding to the collection site (Abbreviation) Longitude and latitude 2025TC-1 2025TC-A1-A12 2025 Tacheng City - Timber Mill (Tacheng 1) 46°38′38″ N，83°6′33″ E 2025TC-2 2025TC-B1-B7 2025 Nest 1, Innovation Road, Tacheng City (Tacheng 2) 46°40′40″ N，82°54′43″ E 2025TC-3 2025TC-C1-C10 2025 Nest 2, Innovation Road, Tacheng City (Tacheng 2) 46°40′40″ N，82°54′43″ E 2025HM-1 2025HM-D1-D15 2025 Hami City - Songshutang Community (Hami 2) 43°22′22″ N，93°38′7″ E 2025HM-2 2025HM-E1-E6 2025 Beside the Sheepfold, Third Company, Horse Ranch, Hami City (Hami 3) 43°25′25″ N，93°33′3″ E 2025MNS 2025MNS-F1-F11 2025 Manas County - Provincial Highway 101 43°52′52″ N，86°13′9″ E 2025YN-1 2025YN-G1-G8 2025 Nest 1 at the Entrance of Tuohulasu Scenic Area, Yining County (Yining 1) 44°15′15″ N，81°44′34″ E 2025YN-2 2025YN-H1-H13 2025 Nest 2 at the Entrance of Tuohulasu Scenic Area, Yining County (Yining 1) 44°15′15″ N，81°44′34″ E 2025YN-3 2025YN-I1-I14 2025 Yining County - Artificial Stone Nests in Tuohulasu Scenic Area (Yining 2) 44°16′16″ N，81°46′18″ E 2024HM 2024HM-J1-J12 2024 Hami City - Horse Ranch Company 3 Nurbai (Hami 1) 43°24′24″ N，93°31′51″ E Table 1. Sample information. Note: In the column of Nest No., A1-A12, B1-B7, C1-C10, D1-D15, E1-E6, F1-F11, G1-G8, H1-H13, I1-I14, and J1-J12 represent the number of P. roseus collected at each sampling point. 2.2 DNA extraction, amplification, and sequencing Total DNA was extracted from the blood samples using the Ezup Column Blood Genomic DNA Extraction Kit (B518253, Shanghai Biotechnology, Shanghai, China). Based on the mitochondrial COI and Cytb sequences of P. roseus , respective primers were designed using Primer Premier 5.0 software (Premier Biosoft, San Francisco, CA, USA) and synthesized by Shanghai Sangon Bioengineering Co., Ltd. (Shanghai, China) (Table 2). Table 2. Primer information. Primers Primer sequences Amplified fragment length COI -F COI -R AAAGGACTACAGCCTAACGC ACTAACACCTCTATGAGAAAGAAGC 1672 Cytb-F Cytb-R ACCTCCACCACTCTCCACTC AAATGCCAGCTTTGGGAGTTG 1374 The PCR reaction volume (25 μL) contained 1 μL each of upstream and downstream primers, 9.5 μL of ddH 2 O, 12.5 μL of 2× Taq PCR Premix II, and 1 μL of total DNA template. The thermal cycling conditions for COⅠ were as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min 40 s; 72°C for 10 min; and held at 4°C thereafter. The thermal cycling conditions for Cytb were as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 68°C for 30 s, 72°C for 1 min 22 s; 72°C for 10 min; and held at 4°C thereafter. The PCR products were detected using agarose gel electrophoresis and sent to Shanghai Sangon Bioengineering Co., Ltd. (China) for Sanger sequencing. 2.3 Bioinformatic analysis Sequencing results were assembled using (DNASTAR Inc., Madison, WI, USA), and assembled sequences were manually proofread for possible errors by referring to the sequencing chromatograms. Each sequence was compared to the publicly available complete mitochondrial COI and Cytb sequences of P. roseus (GenBank accession number PP792558). If any base mutations were present, they were manually corrected as necessary by referring to the peak patterns in the ABI files. After validation, the sequences were aligned using MEGA 11 (Tamura et al. 2021) to analyze their nucleotide composition, conserved sites (C), variable sites (V), parsimony-informative sites (Pi), singleton mutation sites (S), and the frequency of base usage at each codon position. DnaSP 6 (Rozas et al. 2017) software was used to distinguish haplotypes and calculate classical population genetic parameters such as haplotype diversity ( H d ), nucleotide diversity (π), and the average number of nucleotide differences in the population ( K ). Arlequin v3.5.2.2 (Excoffier and Lischer 2010) software was used to perform molecular variance analysis (AMOVA), calculate the genetic differentiation index ( F ST ), and conduct neutrality tests for the ten populations. Haplotype network relationship maps for 10 geographic populations of P. roseus were constructed using PopART 1.7 (Leigh and David 2015) software. Results 3.1 DNA extraction and COI and Cytb amplification and sequences Genomic DNA was extracted from 108 blood samples of P. roseus from 10 geographic populations, and COI and Cytb mtDNA genes were amplified and sequenced. As shown in Fig. 2, the extracted total DNA from each P. roseus sample had a single bright band without degradation. OD 260/280 values of the sample were all between 1.8 and 2.0, indicating that the DNA was of good quality and could be used for subsequent experiments. Figure 2. Gel diagram of total DNA extraction from Pastor roseus . 3.2 Base composition This study acquired 108 COI and Cytb sequences from P. roseus individuals , with sequence lengths of 1551 and 1143 bp, respectively. In the COI sequences, the average contents of the four bases A, T, C, and G were 27.96%, 23.38%, 31.49%, and 17.17%, respectively, with a slightly higher A+T content (51.34%) than C+G content (48.66%). Similarly, in the Cytb sequence, the average contents of A, T, C, and G were 28.80%, 24.11%, 33.98%, and 13.11%, respectively, with slightly higher A+T content (52.91%) than C+G content (47.09%; Table 3). Within the COI and Cytb sequences, G consistently exhibited the lowest content, indicating a pronounced anti-G bias. The COI sequence contained 1477 conserved sites (C; representing 95.23% of the total sites) and 74 variable sites (V; constituting 4.77% of all sites). All Cytb sequences contained 1062 conserved sites (C; representing 92.91% of the total sites) and 81 variable sites (V; accounting for 7.09% of all sites). Among the COI and Cytb gene sequence codons, the first codon position exhibited the highest frequency of G and C, respectively (Table 3); the second codon position exhibited a considerably higher frequency of T than other bases, with G having the lowest frequency; the third codon position exhibited the highest frequency of C and the lowest frequency of G. The frequency of the four bases in the codons considerably differed, with G exhibiting the lowest frequency in the third codon position. In the COI and Cytb sequences of P. roseus , no insertions or deletions of abnormal fragments were observed, with most base substitutions being transitions and primarily occurring at the third codon position. Table 3. Base composition of COI and Cytb gene sequences in Pastor roseus . Codon site COI Base composition % Cytb Base composition % A T C G A T C G The first 24.37 20.74 23.94 30.95 24.95 21.27 29.91 23.87 The Second 18.19 39.85 26.88 15.09 20.48 40.67 26.26 12.59 The third 41.33 9.54 43.66 5.48 40.97 10.38 45.78 2.87 Average 27.96 23.38 31.49 17.17 28.80 24.11 33.98 13.11 3.3 Population genetic diversity DnaSP 6 was used to analyze the haplotypes, haplotype diversity, and nucleotide diversity of COI and Cytb gene sequences. From the COI gene sequences of P. roseus , 62 haplotypes were defined. The overall haplotype diversity, nucleotide diversity, and average nucleotide differences were 0.976 ± 0.006, 0.00316 ± 0.00016, and 4.896, respectively. From the Cytb gene sequences, 69 haplotypes were defined; the overall haplotype diversity, nucleotide diversity, and average nucleotide differences were 0.944 ± 0.018, 0.00292 ± 0.00021, and 3.334, respectively. Both gene sequences exhibited low nucleotide diversity and high haplotype diversity. The genetic diversity analysis of P. roseus in each population based on COI sequences (Table 4) revealed that the haplotype diversity of population 2025MNS was the lowest and those of populations 2025TC-2, 2025TC-3, 2025HM-2, 2025YN-1, and 2024HM were high. The genetic diversity analysis of P. roseus in each population based on Cytb sequences (Table 4) revealed that the haplotype diversity of population 2025YN-2 was the lowest and those populations 2025TC-2, 2025TC-3, 2025HM-2, and 2025YN-1 were high. The ratio of haplotype number to sample number of the population was 100%; that is, no individuals shared identical haplotypes. Table 4. Genetic diversity index of 10 populations in Pastor roseus . Gene Populations n N H d π K COI 2025TC-1 12 10 0.970±0.044 0.00292±0.00056 4.530 2025TC-2 7 7 1.000±0.076 0.00461±0.00073 7.143 2025TC-3 10 10 1.000±0.045 0.00374±0.00045 5.800 2025HM-1 15 13 0.981±0.031 0.00321±0.00031 4.971 2025HM-2 6 6 1.000±0.096 0.00352±0.00080 5.467 2025MNS 11 7 0.909±0.066 0.00241±0.00032 3.745 2025YN-1 8 8 1.000±0.063 0.00256±0.00041 3.964 2025YN-2 13 9 0.910±0.068 0.00231±0.00058 3.590 2025YN-3 14 13 0.989±0.031 0.00266±0.00036 4.121 2024HM 12 12 1.000±0.034 0.00329±0.00039 5.106 Total 108 62 0.976±0.006 0.00316±0.00016 4.896 Cytb 2025TC-1 12 8 0.848±0.104 0.00199±0.00060 2.273 2025TC-2 7 7 1.000±0.076 0.00383±0.00076 4.381 2025TC-3 10 10 1.000±0.045 0.00387±0.00059 4.422 2025HM-1 15 11 0.933±0.054 0.00195±0.00035 2.229 2025HM-2 6 6 1.000±0.096 0.00292±0.00047 3.333 2025MNS 11 7 0.909±0.066 0.00347±0.00064 3.964 2025YN-1 8 8 1.000±0.063 0.00366±0.00063 4.179 2025YN-2 13 8 0.808±0.113 0.00227±0.00064 2.590 2025YN-3 14 13 0.989±0.031 0.00319±0.00041 3.648 2024HM 12 10 0.955±0.057 0.00241±0.00034 2.758 Total 108 69 0.944±0.018 0.00292±0.00021 3.334 Note: Here, n represents the number of P. roseus individuals samples at each sampling point; N represents the number of shared haplotypes; π represents nucleotide diversity. H d represents haplotype diversity. K represents the average number of nucleotide differences. Among the 62 haplotypes defined by COI gene sequences, 15 shared haplotypes (Hap2–Hap5, Hap15, Hap16, Hap20, Hap22, Hap27, Hap39–Hap41, Hap44, Hap49, and Hap50) and 47 unique haplotypes were observed. Among the shared haplotypes, Hap41 was endemic to Manas County; Hap44 and Hap49 were only found in Yining County; and Hap39 was common in the samples from Manas County and Yining County. Hap2 and Hap4 were observed in the samples from Tacheng City and Hami City in 2025. Hap15 and Hap20 were shared by samples from Tacheng City, Hami City, and Yining County in 2025. Hap22 was shared by the samples from Tacheng City, Manas County, and Yining County in 2025. Hap3 and Hap5 were common to all four locations in 2025 and were observed in the samples from Hami City in 2024. The samples from Tacheng City, Manas County, and Yining County in 2025 exhibited shared haplotypes (Hap16, Hap40, and Hap50, respectively) with the samples from Hami City in 2024. In 2024 and 2025, three shared haplotypes (Hap3, Hap5, and Hap27) were observed among the samples from Hami City. Among the 69 haplotypes defined by the Cytb gene sequences, 11 shared haplotypes (Hap1, Hap5, Hap16, Hap19, Hap25, Hap27, Hap37, Hap38, and Hap50–Hap52) and 58 unique haplotypes were observed. Among the shared haplotypes, Hap25 was endemic to Hami City in both 2024–2025. Hap37 and Hap38 were only observed in Manas County, whereas Hap51 and Hap52 were endemic to Yining County. Hap1 was shared among the samples from all four locations in 2025 and was observed in the largest number of samples from Hami City in 2024. Among the samples from 2025, Hap5 was shared by Tacheng City, Hami City, and Yining County; Hap16 was shared by Tacheng City and Hami City; Hap19 was shared by Tacheng City and Yining County, and Hap27 was shared by Hami City and Yining County. Hap50 was shared by the samples from Yining County in 2025 and those from Hami City in 2024. In 2024–2025, only two shared haplotypes (Hap1 and Hap25) were observed in the samples from Hami City. 3.4 Population genetic structure of P. roseus Based on the gene sequences of COI and Cytb in P. roseus , the genetic differentiation index ( F ST ) and gene flow ( N m ) of 10 populations were calculated. For COI , F ST values among populations ranged from -0.07907 to 0.19085, with the smallest genetic differentiation between populations 2025YN-1 and 2025TC-2 and the greatest differentiation between populations 2025TC-1 and 2025YN-3. N m values of the 10 populations ranged from 2.09741 to 2756.15, with the most frequent exchanges occurring between populations 2025HM-1 and 2025TC-1 (Table 5). For Cytb , F ST values among populations ranged from -0.03198 to 0.12009, with the smallest genetic differentiation between populations 2025TC-3 and HM2024 and the greatest genetic differentiation between populations 2025TC-1 and 2025YN-3. N m values of the 10 populations ranged from 3.66348 to 396.2651, with the most frequent exchanges occurring between the 2025HM-1 and 2025YN-2 populations (Table 6). Molecular ANOVA of COI and Cytb gene sequences revealed that the intra-population variation was absolutely dominant. Among them, intra-population variation and inter-population variation in COI sequences accounted for 95.4% and 4.6% of the total variation, respectively. Intra-population variation and inter-population variation in Cytb sequences accounted for 96.61% and 3.39% of the total variation, respectively (Table 7). Table 5. F ST (lower diagonal) and N m (upper diagonal) values between different geographical populations of Pastor roseus based on COI gene sequences. TC_1 TC_2 TC_3 HM_1 HM_2 YN_1 YN_2 YN_3 HM2024 TC_1 3.97274 4.53381 2756.154 Undetermined 2.68461 11.20226 2.11985 3.36211 TC_2 0.11179 Undetermined 57.65625 8.22807 Undetermined 16.81522 Undetermined Undetermined TC_3 0.09933 -0.03949 Undetermined 4.57088 Undetermined 7.73218 Undetermined Undetermined HM_1 0.00018 0.0086 -0.01365 21.59406 87.90068 42.89344 11.44108 106.8839 HM_2 -0.02632 0.05729 0.0986 0.02263 3.12222 43.00964 2.09741 3.20982 MNS 0.08105 0.04925 0.09278 0.04701 0.04869 5.25436 Undetermined 3.32305 3.97151 YN_1 0.15701 -0.07907 -0.0597 0.00566 0.13804 7.69945 Undetermined Undetermined YN_2 0.04273 0.02888 0.06074 0.01152 0.01149 0.06098 4.44995 4.44995 YN_3 0.19085 -0.01384 -0.02272 0.04187 0.1925 -0.06867 0.10101 Undetermined HM2024 0.12946 -0.021 -0.04775 0.00466 0.13478 -0.05117 0.06852 -0.02678 Note: TC_1 through YN_3 are all samples from 2025; HM2024 is a sample from 2024; Table 6. F ST (lower diagonal) and gene flow N m (upper diagonal) values between different geographical populations of Pastor roseus based on Cytb gene sequences. TC_1 TC_2 TC_3 HM_1 HM_2 MNS YN_1 YN_2 YN_3 HM2024 TC_1 4.20586 6.80672 22.60054 60 10.53333 3.77118 Undetermined 3.66348 6.07317 TC_2 0.10625 Undetermined 11.57209 15.10526 14.93626 82.93333 9.35152 58.25806 Undetermined TC_3 0.06843 -0.01707 121.0227 9.30769 19.13177 Undetermined 21.71695 Undetermined Undetermined HM_1 0.02164 0.04142 0.00411 12.67059 7.91675 5.44472 396.2651 12.92423 Undetermined HM_2 0.00826 0.03204 0.05098 0.03796 10.75307 4.02802 62.3866 3.79206 6.38491 MNS 0.04532 0.03239 0.02547 0.05941 0.04443 164.4439 17.85734 11.96033 10.45585 YN_1 0.11706 0.00599 -0.01258 0.08411 0.11042 0.00303 7.77744 Undetermined 39.08884 YN_2 -0.01995 0.05075 0.02251 0.00126 0.00795 0.02724 0.06041 6.52676 23.1487 YN_3 0.12009 0.00851 -0.01708 0.03725 0.11649 0.04013 -0.00149 0.07116 Undetermined HM2024 0.07607 -0.00547 -0.03198 -0.00437 0.07262 0.04564 0.01263 0.02114 -0.01308 Note: TC_1 through YN_3 are all samples from 2025; HM2024 is a sample from 2024; Table 7. Analysis of molecular variation (AMOVA) of the two mitochondrial genes COI and Cytb between the ten samples of Pastor roseus . Marker Source of variation d.f. Sum of squares Variance components Percentage of variation COI Among populations 9 32.023 0.1131 Va 4.6 Within populations 98 229.922 2.34614 Vb 95.4 Total 107 261.944 2.45924 Cytb Among populations 9 20.004 0.05664 Va 3.39 Within populations 98 158.339 1.61570 Vb 96.61 Total 107 178.343 1.67234 Haplotype network maps of P. roseus from 10 geographic populations based on COI and Cytb sequences were constructed. As shown in Fig 3, the haplotypes of both genes were relatively dispersed, and there were many haplotypes, indicating high genetic diversity among populations. Figure 3. Haplotype network of Pastor roseus from ten populations. (A) The network of COI sequences. (B) The network of Cytb sequences. Note: Each circle represents a unique haplotype. Different colors represent the different ten populations of P. roseus . The size of each circle is proportional to the number of haplotypes contained. The lines (shaded markers) on the branches indicate the mutations differentiating haplotypes, with each mutation represented as a line. 3.5 Population genetic analysis Based on the mitochondrial COI and Cytb gene sequences, tests of molecular signatures of neutrality and base mismatch analysis were performed on 10 geographic populations of P. roseus . For COI , Tajima’s D test values of each population were negative and deviated from the neutral expectation, reaching P > 0.05 for most populations. A similar trend was found in Fu’s F S , with significance reaching P < 0.05, however, for most populations (Table 8). For Cytb , Tajima’s D values were negative and deviated from neutrality for every population, with P < 0.05 for most populations, while Fu’s F S values were significant ( P < 0.05) for most populations (Table 9). The results of base mismatch analysis differed from the observed values, and the curve showed an unimodal mismatch distribution (Fig. 4), suggesting that populations may have undergone population expansion or positive selection. Figure 4. The mismatch analysis of ten Pastor roseus populations based on COI and Cytb gene sequences. Note: The x-axis shows the number of pairwise differences, while the y-axis shows the frequency of mismatches. Freq. Exp, frequency expected (green dashed line); Freq. Obs, frequency observed (red solid line). Table 8. The neutrality tests of ten Pastor roseus populations based on COI gene sequences. Statistics TC-1 TC-2 TC-3 HM-1 HM-2 MNS YN-1 YN-2 YN-3 HM2024 Mean s.d. Tajima’s D -0.85 -1.35 -1.03 -0.95 -1.03 -0.01 -1.06 -1.46 -1.29 -1.01 -1.00 0.40 Tajima’s D p-value 0.19 0.07 0.16 0.18 0.20 0.54 0.17 0.07 0.10 0.16 0.18 0.13 FS -4.02 -2.21 -5.32 -6.65 -1.99 -1.08 -4.64 -2.86 -8.94 -8.07 -4.58 2.66 FS p-value 0.01 0.05 0.00 0.00 0.05 0.25 0.00 0.05 0.00 0.00 0.04 0.08 Note: TC_1 through YN_3 are all samples from 2025; HM2024 is a sample from 2024. Table 9. The neutrality tests of ten Pastor roseus populations based on Cytb gene sequences. Statistics TC-1 TC-2 TC-3 HM-1 HM-2 MNS YN-1 YN-2 YN-3 HM2024 Mean s.d. Tajima’s D -1.80 -1.28 -1.76 -1.54 -1.43 -0.47 -1.15 -1.77 -1.62 -1.52 -1.44 0.40 Tajima’s D p-value 0.02 0.10 0.03 0.05 0.02 0.39 0.15 0.03 0.04 0.07 0.09 0.11 FS -3.53 -3.34 -6.44 -7.44 -3.03 -0.93 -4.47 -2.71 -9.76 -6.26 -4.79 2.64 FS p-value 0.01 0.01 0.00 0.00 0.01 0.25 0.01 0.03 0.00 0.00 0.03 0.08 Note: TC_1 through YN_3 are all samples from 2025; HM2024 is a sample from 2024. Discussion In this study, mitochondrial COI and Cytb genes were sequenced from 108 P. roseus across 10 populations in Xinjiang. Both genes showed consistent base composition: C > A > T > G, with A+T content exceeding C+G. This aligns with vertebrate mtDNA characteristics (37-50% C+G) (Nei and Koehn 1983; Stanton et al. 1993) and closely matches related migratory birds ( Phylloscopus spp, Grus nigricollis ) (Wang 2020; Wang et al. 2018; Johns and Avise 1998; Hochachka and Mommsen 2005; Zhuang et al. 2013; Xie et al. 2024; Zhang et al. 2018). Notably, high A+T content may facilitate energy metabolism during migration: Reduced hydrogen bonding in A-T-rich regions promotes efficient gene unwinding for transcription, potentially enhancing expression of energy-related proteins (Kocher et al. 1989). Genetic diversity is the basis for the survival and evolution of populations; the richer the genetic diversity, the greater the potential for survival, reproduction, and expansion of a population and the greater the ability of that population to resist and adapt to environmental changes. Haplotype diversity ( H d ) and nucleotide diversity (π) are important indicators for evaluating the genetic diversity of populations, and the larger their values are the higher the genetic diversity of the population is (Li et al. 2018). Haplotype diversity of each population was categorized into a low category (0–0.5) and a high category (0.5–1.0) according to a threshold value of 0.5 (Li et al. 2022); populations were also classified into one of three categories of nucleotide diversity (Xiao et al. 2024), which considers the proportion of haplotypes in the population and is a more precise indicator of genetic diversity (Neigel and Avise 1993; Ma et al. 2019). The average number of nucleotide differences ( K ) indicates the number of different nucleotides at the same position in the same locus from two different individuals. When comparing two gene sequences, the nucleotide difference number reflects the similarities and differences between them. A higher nucleotide difference number indicates more differences between two sequences, while a lower number indicates greater similarity between them (Starikov 2023). In this study, based on the sequences of two mitochondrial genes ( COI and Cytb ) of P. roseus in 10 geographic groups, the haplotype diversity values were 0.976±0.006 and 0.944±0.018, respectively. The nucleotide diversity values were 0.00316±0.00016 and 0.00292±0.00021, respectively. The mean nucleotide difference number values were 4.896 and 3.334, respectively. Both genes demonstrated high haplotype diversity and moderate nucleotide diversity in P. roseus . Xiao Renzhi et al (Xiao et al. 2024) found that eight genes in 11 geographic populations of chestnut-backed short-footed bulbuls ( Hemixos castanonotus ) had high haplotype diversity and moderately high nucleotide diversity, indicating that this population had experienced long-term cumulative genetic differentiation, has a long evolutionary history, and is rich in genetic variation. Zhang (2007) analyzed the mitochondrial DNA gene ( D-loop ) of Eurasian tree sparrow ( Passer montanus) and found that the π and H d values were 0.0021±0.0004, and 0.755±0.057, respectively; this species had high haplotypic diversity but low nucleotide diversity, indicating that its population may have experienced a historical expansion but with a limited level of genetic diversity. In comparison, both haplotype diversity and nucleotide diversity of P. roseus were higher than those of tree sparrows, suggesting that P. roseus have higher genetic diversity, which helps them to adapt to different environmental conditions and resist external pressures, thus increasing the possibility of long-term population survival. The number of haplotypes (i.e., haplotype richness) reflects the genetic diversity of a population and is an important measure of genetic diversity, which can be used to assess genetic differences within and among populations (Aktaş 2024). In addition, diversity in haplotype number can reveal species migration patterns, evolutionary history, and genetic structure (Klyosov 2018). Analysis of nucleotide variation among different geographic populations in P. roseus showed that there was indeed genetic variation among 10 geographic groups of rosy starlings, with a total of 62 haplotypes detected in the COI gene, of which 15 were shared haplotypes; a total of 69 haplotypes were detected in the Cytb gene, of which 11 were shared haplotypes. However, that differentiation among the 10 populations did not meet subspecies differentiation criteria, indicating the populations belong to the same species, with closer affinities among populations, frequent gene exchange, and no geographic isolation. Through analysis of blood samples of Hami P. roseus in 2024 and 2025, we identified Hap3 (2025HM-D15 and 2024HM-9), Hap5 (2025HM-E1 and 2024HM-12), and Hap27 (2025HM-D2, D7 and 2024HM-10) haplotypes in the COⅠ gene sequences, as well as Hap1 (2025HM-D2, D7 and 2024HM-10) and Hap27 (2025HM-D2, D7, and 2024HM-10) haplotypes in Cytb gene sequences. Hap1 (2025HM-D5, 2025HM-D8, 2025HM-D9, 2025HM-D15, 2024HM-4, 2024HM-9, and 2024HM-12) and Hap25 (2025HM-D4 and 2024HM-7) were haplotypes shared between 2024 and 2025 in Hami. These findings indicated shared haplotypes between individuals 2025HM-D15 and 2024HM-9, 2025HM-E1 and 2024HM-12, 2025HM-D2, D7 and 2024HM-10, 2025HM-D5, 2025HM-D8, 2025HM-D9, 2025HM-D15, 2024HM-4, 2024HM-9 and 2024HM-12, and 2025HM-D4 and 2024HM-7. It is hypothesized that haplotype-sharing P. roseus populations are likely to come from the same wintering roosts and that P. roseus from the same wintering roost may migrate to the same breeding each year. This information is important for understanding the kinship, population differentiation, and historical evolution among different geographic groups of P. roseus (Zou 2020) . The genetic differentiation index ( F ST ) and gene flow ( N m ) are important indicators for evaluating the genetic structure of populations (Wang et al. 2017). The value of F ST can be utilized to evaluate the degree of genetic differentiation among populations; F ST ≤ 0.05 indicates that there is a weak genetic differentiation among populations; 0.05 0.15 indicates that there is a high level of genetic differentiation among populations (Wright 1978; Gao et al. 2020). In this study, most of the genetic differentiation among different populations of rosy starling samples was not significant, which was consistent with the inferred haplotype network. The AMOVA results indicated that most of the genetic variation in P. roseus occurred within the populations. Genetic variation among populations was low in P. roseus , which explains why their genetic differentiation was not significant. Populations 2025TC-1 and 2025YN-3 had the greatest F ST values ( COI, 0.19085; Cytb , 0.12009) among populations, suggesting that genetic differentiation was greatest between these two populations and was significantly higher than that of other populations. It is hypothesized that this may be owing to the fact that Tacheng and Yining are separated by the Tian Shan Mountain range (Wang 2006) and further suggests that the degree of genetic differentiation among populations may be influenced by both distance and environmental isolation. In addition, the N m values of all pairs of populations were all greater than 1.0, and their haplotype network relationship maps also showed a mixed haplotype distribution pattern, indicating that although the genetic exchange among populations was restricted, this restriction may have occurred recently. The isolation of the existing populations thus began too recently to lead to significant differentiation among groups. Multimodal mismatch distributions indicate that the shape of the gene tree is highly random, suggesting stable and balanced population dynamics, whereas unimodal mismatch distributions would indicate a high level of migration as populations have recently expanded or neighboring populations have expanded in their distribution areas (Zhan et al. 2023). In the present study, the distribution curves of nucleotide mismatch were relatively smooth, conforming to the expectation of unimodal curves associated with population expansion. Tajima’s D values were not significant in both genes analyzed, while Fu’s F S values were significant, which indicated that there was a deviation from the neutral expectation of the P. roseus genes across the 10 geographic groups. These findings indicated that P. roseus Xinjiang experienced a large population expansion in the recent past, but with a more stable population size since then and no significant selective pressure. Xinjiang is one of the regions in China with the most severe locust infestations (Gong 2001). There are many locust species and large numbers of locusts distributed in this province, which seriously endanger the grasslands of Xinjiang and affect the regional agricultural and animal husbandry economy (Yang et al. 2007). Each year, P. roseus migrate to Xinjiang in early May and return to their wintering grounds in late August (Du et al. 2018), which is highly consistent with the occurrence period of grassland locusts in Xinjiang. The peak period of locust numbers occurs after the P . roseus chicks hatch. The parent birds can thus quickly obtain food to complete the brooding process and increase their success rate of reproduction (Wang et al. 2025). This phenomenon is the result of the combined effect of biological characteristics (high reproductive capacity, specialized diet) (Wang 2007), the special ecological conditions in Xinjiang (periodic locust outbreaks, warm and humid climate) (Yao et al. 2022), and human conservation management practices (artificial recruitment, engineering avoidance) (Tang et al. 2008). To some extent, these factors may explain why P. roseus populations expand during the breeding season. Genetic diversity improves the adaptability and survival capacity of species, which is essential for their long-term survival and reproduction (Ran et al. 2023). Pastor roseus not only provides a low cost means of controlling locust damage, but also can overcome the problem of resistance of locusts to pesticides and still reduce their damage to crops (Shi and Tan 2019). Therefore, protecting the genetic diversity of P. roseus is of great importance for maintaining local biodiversity and ecological balance. In the actual conservation of P. roseus starlings, it is necessary to consider the genetic diversity and genetic differentiation among populations, which helps in formulating effective conservation measures. This study analyzed the genetic diversity and genetic structure of P. roseus from different geographical populations in Xinjiang at the molecular level. The research results provide empirical guidance and support for the rational utilization of rosy starlings to control grassland locusts. Conclusion P. roseus exhibits exceptionally high mitochondrial diversity (haplotype diversity H d > 0.94). The AT-rich nucleotide composition in its COI and Cytb genes enhances energy metabolism efficiency during flight, while high haplotype diversity contributes to population resilience against environmental fluctuations. Therefore, conservation efforts must prioritize maintaining migratory connectivity to sustain this species’ role in locust biocontrol and ecosystem homeostasis. Although this study only examined mitochondrial genes COI and Cytb , future work should incorporate nuclear genomic markers (e.g., microsatellites) to provide a more comprehensive understanding of population genetic structure. Quantifying gene flow intensity ( N m ) among key breeding colonies will further support its sustainable service capacity in locust biological control. Acknowledgements We would like to express our gratitude to the Xinjiang Uygur Autonomous Region Grassland Biological Disaster Prevention and Control Center for their support and permission in conducting this study; we also extend our appreciation to the Hami City Locust and Rodent Pest Prediction and Prevention Station for their support and permission, as well as their assistance during field sampling. We also thank all the authors for their contributions to this article. This work was supported by the Tianshan Innovative Research Team of Xinjiang Uygur Autonomous Region (2024D14006); Tianshan Talent Leading Talent Project of Xinjiang Uygur Autonomous Region (TSYCLJ0016); Tianshan Young Talent Project for Outstanding Young Scholars of Xinjiang Uygur Autonomous Region, China(2024TSYCCX0063). Author contributions Xixiu Sun: Data Curation (equal), Formal Analysis (equal), Investigation(equal), Methodology (equal), Validation (equal), Software (equal), Writing – Original Draft Preparation (lead). Xiaojie Wang: Data Curation (equal), Formal Analysis (equal), Investigation (equal), Methodology (equal), Writing – Original Draft Preparation (lead). Ran Li: Investigation (equal), Validation (equal). Huixia Liu: Software (equal). Ye Xu: Software (equal). Rong Ji: Project Administration (equal). Jun Lin: Investigation (equal). Kun Yang: Investigation (equal). Xiaofang Ye: Funding Acquisition (lead), Writing – Review & Editing (lead). Data availability The original data is included in the supplementary materials Conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Ethics approval This study was conducted in accordance with the ethical guidelines of the Academic Morality and Ethics Committee of Xinjiang Normal University , and received approval with the review num ber [XJNU2024LLSC002]. All sampling and experimental procedures are strictly carried out in accordance with relevant guidelines and regulations. References 1. Hobson KA, Yohannes E (2007) Establishing elemental turnover in exercising birds using a wind tunnel: implications for stable isotope tracking of migrants. Canadian Journal of Zoology 85: 703-708. 2. Quader S, Raza RH (2018) ”MigrantWatch: A citizen science programme for the study of bird migration”. Indian Birds 3: 202-209. 3. Yu YW (2012) The distribution and biological characteristics of sturnus roseus in Tacheng. Grass-feeding livestock 77-80. 4. Li H, Wang W, Lou SQ, Guo JM, Ban SP, Yin BL, Kong QG (2010) Discussion on the Development and Prospects of the Technologies for Controlling Locusts with Pastor roseus and Locust-eating Chickens in Yili Grassland. Xin jiang xu mu ye 57-59. 5. Ranner A, Davygora AV, Hallman B (1994) Birds in Europe. Their conservation status. 6. Frankham R, Briscoe DA, Ballou JD (2002) Introduction to conservation genetics. Cambridge University Press. 7. Li QS, Li X, Luo X (2015) Skeleton comparison of seven babblers from Mt. Gaoligong, Yunnan. Journal of biology 32: 43-47. 8. Xia J, Wu F, Hu WZ, Fang JL, Yang XJ (2015) The coexistence of seven sympatric fulvettas in Ailao Mountains, Ejia Town, Yunnan Province. Zoologlcal Research 36: 18-28. 9. Zhang W (2007) Comparison of Cytb and CoI gene sequences from 15 species in Passeriformes and Phylogeny of some Shrike species. Dissertation, ShaanXi Normal University. 10. Helm-Bychowski K, Cracraft J (1993) Recovering phylogenetic signal from DNA sequences: Relationships within the corvine assemblage (class Aves) as inferred from complete sequences of the mitochondrial DNA cytochrome-b gene. Molecular biology and Evolution 10: 1196-1214. 11. Guo H (2015) Artificial recruitment of pink starlings in Sazi District, Xinjiang Achievements of biological locust control. Heilongjiang Animal Science and Veterinary Medicine 7: 159-161. 12. Milchev B, Dimitrov D (2005) Structure, dimensions and building materials of the nests of the rose-coloured starling Stumus roseus (Linnaeus, 1758) (Aves: Passeriformes) from Southeast Bulgaria. Acta zoologica bulgarica 57: 55-64. 13. Kumar R (2015) Rosy starling Pastor roseus : A first record from Uttarakhand, India. Indian Birds 10: 135-136. 14. Diniarsih S, Jones S, Setiyono J, Noske R (2016) Rosy Starling Pastor roseus : a new species for Indonesia. Kukila 19: 60-64. 15. Oo SSL, Kyaw M, Hlaing NM, Renner SC(2020) New to Myanmar: the Rosy Starling Pastor roseus (Aves: Passeriformes: Sturnidae) in the Hkakabo Razi Landscape. Journal of Threatened Taxa 12: 15493-15494. 16. Tamura, Koichiro, Glen S, Sudhir K (2021) ”MEGA11: molecular evolutionary genetics analysis version 11.” Mol Biol Evol 38: 3022-3027. 17. Rozas J, Ferrer-Mata A, Sánchez-DelBarrio J C, Guirao-Rico S, Librado P, Ramos-Onsins S E, Sánchez-Gracia A (2017) DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular biology and evolution 34: 3299-3302. 18. Excoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular ecology resources 10: 564-567. 19. Leigh Jessica W, David B, Shinichi N (2015) ”POPART: full-feature software for haplotype network construction. ” Methods in Ecology & Evolution 6. 20. Nei M, Koehn RK (1983) Evolution of genes and proteins. Sunderland, America. 21. Stanton DJ, Crease TJ, Hebert PDN (1991) Cloning and characterization of Daphnia mitochondrial DNA. Journal of molecular evolution 33: 152-155. 22. Wang ZL (2020) Characteristics of locust plague outbreaks and green prevention and control techniques. Scientific Cultivation and Breeding 39-41. 23. Wang YY, Bai ZZ, Xiong Y, Zhang MM, Li HJ (2018) The analysis of genetic variation between black-necked crane and common crane based on mitochondrial genes. Journal of Biology 35: 27-30. 24. Johns GC, Avise JC (1998) A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Molecular biology and evolution 15: 1481-1490. 25. Hochachka PW, Mommsen TP (2005) Biochemistry and molecular biology of fishes (USA). Environ Ecology Biochem 1995: 1-455. 26. Zhuang X, Qu M, Zhang X, Ding S (2013) A comprehensive description and evolutionary analysis of 22 grouper (Perciformes, Epinephelidae) mitochondrial genomes with emphasis on two novel genome organizations. PLoS One 8: e73561. 27. Xie JY, Chen Y, Sun HY (2024) Codon bias in the mitochondrial genomes of two invasive Gambusia species. Journal of South Agriculture 55: 2514-2522. 28. Zhang HB, Bai YZ, Shi XJ, Sun LX, Wang ZF, Wu XB (2018) The complete mitochondrial genomes of Tarsiger cyanurus and Phoenicurus auroreus: a phylogenetic analysis of Passeriformes. Genes Genom 40: 151-165. 29. Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX, Wilson AC (1989) Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences 86: 6196-6200. 30. Li WJ, Wang HS, Liu HZ, Cao WX, Wang XM, Yu J, Zhu X (2018) Genetic diversity and population demographic history of Hemiculterella sauvagei in the chishui river. Acta hydrobiologica sinica 42: 106-113. 31. Li BQ, Zhan HF, He XT, Lv XY, Yang ZC, Wang YY (2022) Genetic Diversity of Gorsachius magnificus Leigongshan Small Population in Guizhou. Chinese Journal of wildlife 43: 403-411. 32. Xiao RZ, Zou FS, Liu XY, Wang ZZ (2024) Population Differentiation and Genetic Diversity of Hemixos castanonotus . Chinese Journal of Zoology 59: 49-66. 33. Neigel JE, Avise JC (1993) Application of a random walk model to geographic distributions of animal mitochondrial DNA variation. Genetics 135: 1209-1220. 34. Ma Y, Li HL, H J, Zhao YM, Yang HQ, Lu L, Liu QY (2019) Genetic diversity and phylogenetic relationships based on mtDNA control region sequences of Marmota himalayana . Acta Theriologica Sinica 39: 285-294. 35. Starikov I (2023) Molecular phylogeny and systematics of selected taxa of diurnal raptors and owls. Dissertation, Ruprecht-Karls–University. 36. Zhang MM (2007) The genetic diversity analysis and the primary study of subspecies differentiation of Tree Sparrows . Dissertation, Hebei Normal University. 37. Aktaş C (2024) Development of a Bioinformatic Analysis Package to Test Global Phylogeographic Relationships of Species by Using Geotagged DNA Sequences from Genbank. Dissertation, Middle East Technical University. 38. Klyosov A (2018) DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. Nature Precedings 1-1. 39. Zou R, Liang C, Dai M, Wang X, Zhang X, Song Z (2020) DNA barcoding and phylogenetic analysis of bagrid catfish in China based on mitochondrial COI gene. Mitochondrial DNA Part A 31: 73-80. 40. Wang T, Du YY, Yang ZY, Zhang YP, Lou ZY, Jiao WL (2017) Population genetic structure of Schizopygopsis kialingensis inferred from mitochondrial D-loop sequences. Acta Ecologica Sinica 37: 7741-7749. 41. Wright S (1978) Evolution and the Genetics of Populations, volume 4: Variability Within and Among Natural Populations. Chicago: University of Chicago Press 1978: 84-86. 42. Gao H, Qiao FJ, Teng LW, Li JL, Yu MQ, Liu ZS (2020) Genetic diversity and structure of the Alashan red deer ( Cervus elaphus alashanicus ) in Helan Mountains, China. Acta Theriologica Sinica 40: 458-466. 43. Wang B (2006) Paleozoic geodynamic evolution of Yili Block in West Chinese Tianshan. Dissertation, Université d’Orléans. 44. Zhan Y, Qi S, Liu L, Bao Q, Wu T, Liu W, Chen (2023) G. Genetic Diversity Analysis and Breeding of Geese Based on the Mitochondrial ND6 Gene. Genes 14: 1605. 45. Gong JN (2001) Grasshoppers and pest rat hazard in grassland of Xinjiang and their controlling strategy. Journal of Catastrophology 16: 65-9. 46. Yang HS, Ji R, Xiong L, Yuan H (2007) Effect of meteorological factors on locust occurrence in the North of Mt Tianshan in Xinjiang. Chinese Bulletin Entomology 44: 517-520. 47. Du GL, Zhao HL, Ma CY, Tu XB, Zhang ZH (2018) Effect of PinkStarlings Nest Struction and MigratingTimeon Grasshoppers Management. Chinense Journal of Biological Control 34: 923-926. 48. Wang XJ, Wu B, Sun XX, Remila Apaer, Nuerlan Hasimuer, Song YW, Ji R, Ye XF(2025) Breeding Ecology of Pastor roseus in Hami Grassland, Xinjiang, China. Chinese Journal of Zoology 60:1125-1135. 49. Wang T (2007) Studies on the choice of seven primary grasshoppers for host plant and system evolution relationships of them in xinjiang. Dissertation, Xinjiang Normal University. 50. Yao JQ, Li MY, Dilinuer Tuoliewubieke, Chen J, Mao WY (2022) The assessment on “warming-wetting” trend in Xinjiang at multi-scale during 1961-2019. Arid Zone Research 39:333-346. 51. Tang HP, Yan LJ, Zhang XS (2008) Biodiversity conservation and a conception for a national desert park in Dzungaria Basin, Xinjiang. Biodiversity Science 16: 618–626. 52. Ran B, Zhu W, Zhao X, Li L, Yi Z, Li M, Wang T, Li D (2023) Studying Genetic Diversity and Relationships between Mountainous Meihua Chickens Using Mitochondrial DNA Control Region. Genes 14: 998. 53. Shi WP, Tan SQ (2019) Current Status and Trend on Grasshopper and Locust Biological Control. Chinese Journal Biology Control 5: 307-324. Information & Authors Information Version history V1 Version 1 16 September 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Collection Ecology and Evolution Keywords ecosystem experimental evolution genetics laboratory molecular genetics statistical theoretical vertebrate Authors Affiliations Xiaofang Ye 0000-0002-7531-3162 [email protected] Xinjiang Normal University View all articles by this author Xixiu Sun 0009-0004-8992-3625 Xinjiang Normal University View all articles by this author Xiaojie Wang Xinjiang Normal University View all articles by this author Ran Li Xinjiang Normal University View all articles by this author Huixia Liu Xinjiang Normal University View all articles by this author Ye Xu Xinjiang Normal University View all articles by this author Rong Ji Xinjiang Normal University View all articles by this author Jun Lin Locust and Rodent Pest Prediction and Control Station of Xinjiang View all articles by this author Kun Yang Locust and Rodent Pest Prediction and Control Station of Xinjiang View all articles by this author Metrics & Citations Metrics Article Usage 259 views 176 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Xiaofang Ye, Xixiu Sun, Xiaojie Wang, et al. Genetic Relationship Analysis of Pastor roseus Based on COI and Cytb Gene Sequences. Authorea . 16 September 2025. DOI: https://doi.org/10.22541/au.175804262.29546115/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.175804262.29546115/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fef5a27bb8e593a',t:'MTc3OTMyMjE2NA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();