Genome-wide identification of ATG genes and their expression profiles under biotic and abiotic stresses in Fenneropenaeus chinensis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genome-wide identification of ATG genes and their expression profiles under biotic and abiotic stresses in Fenneropenaeus chinensis Chenhui Guan, Yalun Li, Qiong Wang, Jiajia Wang, Caijuan Tian, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3871880/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Jun, 2024 Read the published version in BMC Genomics → Version 1 posted 10 You are reading this latest preprint version Abstract Background Autophagy is a conserved catabolic process in eukaryotes that contributes to cell survival in response to multiple stresses and is important for organism fitness. Extensive research has shown that autophagy plays a pivotal role in both viral infection and replication processes. Despite the increasing research dedicated to autophagy, investigations into shrimp autophagy are relatively scarce. Results Based on three different methods, a total of 20 members of the ATGs were identified from F. chinensis , all of which contained an autophagy domain. These genes were divided into 18 subfamilies based on their different C-terminal domains, and were found to be located on 16 chromosomes. Quantitative real-time PCR (qRT-PCR) results showed that ATG genes were extensively distributed in all the tested tissues, with the highest expression levels were detected in muscle and eyestalk. To clarify the comprehensive roles of ATG genes upon biotic and abiotic stresses, we examined their expression patterns. The expression levels of multiple ATGs showed an initial increase followed by a decrease, with the highest expression levels observed at 6 h and/or 24 h after WSSV injection. The expression levels of three genes (ATG1, ATG3, and ATG4B) gradually increased until 60 h after injection. Under low-salt conditions, 12 ATG genes were significantly induced, and their transcription abundance peaked at 96 h after treatment. Conclusions These results suggested that ATG genes may have significant roles in responding to various environmental stressors. Overall, this study provides a thorough characterization and expression analysis of ATG genes in F. chinensis , laying a strong foundation for further functional studies and promising potential in innate immunity. Fenneropenaeus chinensis autophagy WSSV low-salt stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Autophagy is a conserved intracellular degradation system found in eukaryotes. In autophagy, an isolation membrane emerges suddenly in the cytoplasm, which then expands and transforms into double membrane-bound structure called an autophagosome [ 1 – 3 ]. During this process, a portion of cytoplasm, including proteins and organelles, is sequestered into the autophagosome. The autophagosome then fuses with a lysosome (or a vacuole, in yeast and plants). The inner membrane, referred to as an autophagic body in yeast, is exposed to lysosomal hydrolases and degraded along with its contents [ 1 – 3 ]. The primary function of autophagy is to maintain cellular homeostasis by recycling intracellular materials, which promotes stress resistance and longevity [ 3 ]. Autophagy has emerged as a crucial cellular process with implications for health and immunity in all eukaryotic organisms. Research has shown that a range of autophagy-related genes play important roles in both biotic and abiotic stresses in plants and animals. In yeast, there are over 36 autophagy-related genes (ATG) have been identified. Most of these genes have corresponding homologous genes in mammals [ 4 , 5 ]. Drought and salt stress cause ion stress which induces oxidative damage in plant cells. Autophagy repairs this damage under the activation of various biological factors [ 6 ]. Silencing OsATG2 and OsATG7 inhibits autophagy and reduces wheat salt tolerance [ 7 ]. Overexpression o f MdATG18a enhances the adaptability of apples to drought stress [ 8 ]. In animal studies, it has been found that the ATG5-ATG12 conjugate functions in the mouse innate antiviral immune system, enhancing their bactericidal activity [ 9 ]. For the banana shrimp, interference with either ATG3 or ATG6 during WSSV challenge resulted in a decrease in autophagic levels[ 10 ]. Therefore, autophagy-related research has recently gained increasing attention from the scientific community. Fenneropenaeus chinensis , commonly known as Chinese shrimp, is a highly valued species in China’s aquaculture industry. Its distribution is mainly concentrated in the Yellow Sea and Bohai Sea of China, as well as the western and southern coast of the Korean Peninsula [ 11 ]. Due to the advancement of aquaculture techniques, F. chinensis emerged as the most important shrimp species for cultivation in China during the 1990s [ 12 ]. F. chinensis and other crustaceans often encounter changes in environmental factors, such as extreme temperatures, salinity, hypoxia and abnormal acid-base levels. Environmental factors can disrupt homeostatic equilibrium and cause the fluctuations in the neuroendocrine, physiological, and behavioral status of aquatic animals, negatively impacting their health [ 13 ]. Saline-alkaline water aquaculture is becoming a promising solution to accommodate the growing needs of the aquaculture industry. Therefore, it is important to investigate the physiological changes and molecular responses in aquatic animals adapting to this environment. F. chinensis is highly sensitive to changes in salinity levels, particularly in low-salt environments, which is considered a major stressor. It is essential to understand the effects of low salinity on F. chinensis to develop effective mitigation strategies in F. chinensis aquaculture. The sensitivity to low salinity is rooted in the osmoregulatory mechanisms employed by these organisms to maintain internal salt and water balance. The balance is crucial for their metabolic processes and impacts the reproductive and developmental processes of shrimps. In addition to abiotic stress, the significant environmental variations were accompanied by severe bacterial and viral infections, resulting in an epizootic breakout that caused great losses to the aquaculture industry [ 14 ]. White spot syndrome virus (WSSV) is a major pathogen in shrimp aquaculture. It is a double-stranded DNA virus that causes white spot disease [ 15 – 17 ]. The mortality rate of F. chinensis infected with WSSV can reach 100% within a week. WSSV first emerged in the late 20th century, causing huge economic losses. Despite extensive research, no effective solution to the WSSV problem has been conducted, and it remains one of the most fatal pathogens in F. chinensis aquaculture[ 18 ]. Autophagy has been extensively studied endlessly in animals and plants, but it is relatively uncommon in crustaceans. Existing research suggests that autophagy participates in sugar metabolism, antimicrobial peptide regulation, and other pathways when animals and plants respond to abiotic stress or bacterial infection[ 19 , 20 ]. Given the growing importance of shrimp aquaculture and the risks posed by viral infections and environmental stress, it is crucial to comprehend the autophagy-related mechanisms in this economically vital species. However, the precise details of the F. chinensis autophagy-related gene family, its structure, and its specific roles in the response to WSSV infection and low-salt stress have not been comprehensively elucidated. The objective of this study is to identify and characterize the ATG gene family in F. chinensis and investigate their expression patterns in response to biotic and abiotic stresses. The study aims to contribute to the advancement of shrimp aquaculture and the management of viral diseases and environmental factors that pose a threat to this industry. Results Identification and characterization of ATG genes in F. chinensis In the F. chinensis , a total of 20 ATG genes were identified and named according to the rules for ATG gene nomenclature (Table 1 ). These ATG genes (designated as FcATGs ) were classified into18 subfamilies, including F c ATG 1-3, F c ATG 4B, F c ATG 4D, F c ATG 5-8, F c ATG 8B, F c ATG 9-10, F c ATG 12-14, FcVPS 15, F c ATG 16 -18, and F c ATG 101. The predicted molecular weight of F. chinensis ATG proteins were in the range of 13.63 kDa to 241.9 kDa and the deduced isoelectric points ranged from 4.57 to 9.69. The F c ATG 12 gene had the smallest molecular weight of 13.63 kDa, while the F c ATG 2 gene had the largest molecular weight of 241.9 kDa. The instability index of three ATG proteins, namely F c ATG 12, F c ATG 14, and F c ATG 101, was less than 40, indicating their stability. On the other hand, the remaining 17 proteins were predicted to be unstable. All ATG proteins had GRAVY values less than 0, indicating their hydrophilic nature. The open reading Table 1 The characteristics of ATG proteins in F. chinensis Protein Name ID ORF length(bp) Amino Acids Molecular Weight PI Instability Index Aliphatic index GRAVY Subcellular localization ATG1 LOC125025612 2517 838 89941.75 9.26 67.13 70.62 -0.442 Nucleus ATG2 LOC125043934 6546 2181 241858.27 5.29 48.19 82.14 -0.339 Nucleus ATG3 LOC125036151 951 316 35726.78 4.57 46.46 71.27 -0.614 Nucleus ATG4B LOC125047743 1233 410 47538.38 4.98 53.27 81.54 -0.288 Cytoplasm ATG4D LOC125033004 2259 752 83824.62 7.57 59.27 66.22 -0.560 Nucleus ATG5 LOC125047653 810 269 31103.47 5.59 43.43 84.05 -0.407 Nucleus ATG6 LOC125039134 1275 424 47999.00 5.08 41.28 81.91 -0.435 Nucleus ATG7 LOC125046156 2091 696 76306.06 5.53 44.12 88.74 -0.112 Nucleus ATG8 LOC125042574 360 119 14087.20 8.59 41.55 76.13 -0.584 Golgi apparatus ATG8B LOC125046396 369 122 14523.69 9.69 51.40 88.61 -0.577 Cytoplasm ATG9A LOC125045477 2466 821 93190.68 6.14 54.50 84.12 -0.137 Cytoplasm, Mitochondrion ATG10 LOC125041822 675 224 26022.52 5.06 51.1 82.63 -0.485 Nucleus ATG12 LOC125041823 363 120 13637.43 6.14 38.97 68.33 -0.718 Cytoplasm ATG13 LOC125031250 1422 473 52171.50 5.40 49.86 73.21 -0.547 Cytoplasm, Nucleus ATG14 LOC125035822 1467 488 54777.77 5.72 39.91 80.14 -0.510 Nucleus VPS15 LOC125046127 3987 1328 148803.93 6.29 45.38 92.68 -0.176 Cytoplasm, Nucleus ATG16 LOC125044282 1695 564 63011.29 6.93 44.3 85.5 -0.458 Nucleus ATG17 LOC125042474 4143 1380 156986.09 5.14 51.27 79.86 -0.697 Nucleus ATG18 LOC125034319 1035 344 36468.30 6.39 44.12 75.44 -0.190 Nucleus ATG101 LOC125034760 660 219 25158.20 5.15 36.07 84.57 -0.415 Golgi apparatus, Nucleus frames (ORFs) of ATG genes ranged from 360 to 6,546 bp, with predicted protein lengths ranging from 119 to 2181 amino acids (aa). Subcellular location prediction revealed that 12 ATG proteins are located in the nucleus, while the remaining proteins are mainly present in the Golgi apparatus, cytoplasm, and mitochondrion. The cDNA sequences of these ATG genes have been submitted to the GenBank database, and their characteristics are summarized in Table 1 . Phylogenetic Tree Construction To explore the evolutionary relationships of F c ATG genes, we constructed a phylogenetic tree was using ATG protein sequences from fifteen species, including F. chinensis , Mus musculus , Penaeus monodon , Litopenaeus vannamei , Macrobrachium nipponense , Bombyx mori , and Drosophila melanogaster et al. The phylogenetic analysis (Fig. 1 ) revealed that the ML tree for ATGs split into 18 subfamilies, with the subfamilies in F. chinensis clustering with their respective counterparts from other species as expected. The F c ATG 1, F c ATG 7, F c ATG 13, F c ATG 14, F c ATG 16, F c ATG 18 and F c ATG 101 subfamilies clustered first, followed by the F c ATG 2, F c ATG 3, F c ATG 4, F c ATG 6, F c ATG 10, F c ATG 12, and F c ATG 15 subfamilies, as well as the F c ATG 5, F c ATG 8, F c ATG 9, and F c ATG 12 subfamily. These results are consistent with the classification described in previous research and provide insights into the evolution of F c ATG s orthologous genes in different species. Chromosomal distribution of ATG gene Chromosomal distribution analysis revealed that 20 ATG genes are distributed across 16 shrimp chromosomes, from NC-061821.1 to NC-061859.1. However, the distribution of ATG genes was uneven on each chromosome. For instance, FcATG 3 and FcATG 14, FcATG 8 and FcATG 17, as well as FcATG 5 and FcATG 4B are all located on the same chromosome, while the remaining chromosomes each hosted only a single ATG gene (Fig. 2 ). The non-random distribution of ATG genes in the shrimp genome highlights the importance of their genomic arrangement in autophagy-related processes. Structure and domain analysis of F. chinensis ATG genes Based on the structural analysis of the F. chinensis ATG genes, the number of exons among ATG members varies from 1 to 29. Each ATG member comprises both UTR and CDS regions, with coding regions of similar lengths for members within the same subfamily, such as FcATG 4B, FcATG 4D, FcATG 8, and FcATG 8B (Fig. 3-3a). Protein domain analysis reveals that FcATG 6, FcVPS 15, and FcATG 16 each possess two domains: APG6_N and APG6 for FcATG 6, VPS15 and WD40 for FcVPS 15, and Fc ATG16 and WD40 for FcATG 16. In contrast, other proteins have only one domain. Different subfamilies exhibit distinct domain compositions. However, within the same subfamily, the domain structure is generally conserved. For example, both FcATG 4B and FcATG 4D contain the Peptidase_C54 domain, while FcATG 8 and FcATG 8B contain the Ubl_ATG8 domain (see Fig. 3-3b). This structural analysis offers insight into the diversity and conservation of gene architecture within the FcATG family and sheds light on potential functional implications. Expression profiles of ATG genes in F. chinensis The relative expression levels of FcATG were measured in various tissues, including the eyestalk, gill, heart, hepatopancreas, intestine, muscle, and stomach, using qRT-PCR with 18S rDNA as the internal control in nine untreated shrimps. As shown in Fig. 4 , FcATG 1, FcATG 4B, FcATG 7, and FcATG 12 genes exhibited higher expression levels in the eyestalk compared to the gills, heart, intestine, hepatopancreas, and stomach. The other 14 FcATG genes had the highest level of expression in muscles. Expression profiles of ATG genes after WSSV infection This experiment utilized qRT-PCR analysis to study the expression levels of the 20 identified members of the FcATG gene family. The cDNA samples from the hepatopancreas were collected at 3h, 6h, 12h, 24h, 36h, 48h, and 60h after WSSV injection to investigate the expression levels of each member during WSSV infection. Figure 5 shows that FcATG 1, FcATG 3, and FcATG 4B had a significant upregulation trend, with the highest expression at 60 hours. FcATG 7 and FcATG 10 exhibited a noticeable downregulation trend. Most ATG genes showed an up-regulation followed by a down-regulation trend, with FcATG 2, FcATG 8, and FcATG 8B peaked at 3 hours. FcATG 5, FcATG 6, FcATG 9A, FcATG 13, FcATG 14, FcVPS 15, FcATG 17, and FcATG 101 reached their peak expression at 6 hours. FcATG 4D, FcATG 12, FcATG 16, and FcATG 18 reached their highest expression at 24 hours. Expression profiles of ATG genes after low-salt stress The expression of FcATG genes in hepatopancreas tissues after low-salt stress was analyzed using qRT-PCR (Fig. 6). The results showed an up-regulation trend for FcATG 1-3, FcATG 4B, FcATG 4D, FcATG 5, FcATG 9, FcATG 12-13 FcVPS 15, FcATG 16, and FcATG 8, peaking at 72 h or 96 h. FcATG 10 exhibited a notable upregulation, reaching peak expression at 24 h. Meanwhile, FcATG 6- FcATG 8, FcATG 8B, FcATG 14, FcATG 17, FcATG 101 initially showed a downregulation followed by an upregulation trend. FcATG 17, and FcATG 101 peaked at 72 h, while the rest reached their highest expression at 96 h. Discussion Autophagy is a highly conserved catabolic pathway that is involved in the cellular degradation of long-lived proteins or dysfunctional cellular components through lysosomes action. It is considered a pro-survival mechanism and for maintaining homeostasis[ 21 ]. Meanwhile, autophagy is a sensitive process that underlies cell response to almost every stressful condition affecting cellular homeostasis. Its role is complex and likely depends on the cell’s genetic background and environmental cues [ 22 , 23 ]. Recent research has shown that autophagy is crucial for maintaining homeostasis at both the cellular and organismal levels [ 24 – 26 ]. While the study of ATG genes has been characterized in yeasts and mammals for decades, there has been a lack of systematic identification and analysis of the ATG gene family in F. chinensis . Additionally, research on ATGs under biotic and abiotic stresses of F. chinensis has not been conducted. This study identified and characterized the ATG genes of F. chinensis , including their phylogenetic analysis, protein structures, and physicochemical properties of ATGs. In addition, the expression profiles of ATG genes were analyzed after WSSV infection, low salt stress, and in healthy tissues. These analyses provide insights into the involvement of ATGs in response to toxicological and environmental stresses. This study reports the identification of 20 ATG family members in the F. chinensis genome, three of which have instability coefficients below 40, indicating relative stability of the gene family. This finding is consistent with the results reported by Liu et al. [ 27 ] in their investigation of the physical and chemical properties of the ATG gene in Punica granatum . Meanwhile, the 20 ATG gene family members of F. chinensis are distributed unevenly across 16 chromosomes. This distribution pattern is similar to that found in Arabidopsis [ 28 ], suggesting that even within the same family, members can have different chromosomal positions. The ATG genes are relatively conserved from yeast to humans, but the detailed evolutionary history remains unclear. Analyzing phylogenetic relationships can provide insight into the evolution of the ATG genes. A phylogenetic tree was constructed based on the amino acid sequences of ATG homologous genes from 15 different species. The resulting tree revealed that 20 shrimp ATG genes were grouped into 18 subfamilies. Moreover, the evolutionary relationship between L.vannamei and the ATG genes of the Chinese shrimp ATG family was found to be similar, suggesting a close association. As per Zhu’s findings, the ATG gene of Procambarus clarkii and Homarus americanus are closely related [ 26 ]. In general, proteins within the same subfamily on a branch exhibit similar structures and functional domains, thereby indicating a tendency towards functional conservation. Previous studies have profiled the expression patterns of ATG family members in crustacean [ 10 , 29 – 31 ]. However, such research has not been conducted in F. chinensis . To better understand the characteristics and functions of ATG genes in F. chinensis , we used qRT-PCR to profile the expression patterns of ATG genes in different tissues. ATGs are expressed ubiquitously in various F. chinensis tissues with varying levels, indicating their divergent functions in the organism. Sixteen ATG genes have the highest expression levels in muscles, while four ATG genes have the highest expression levels in the eye stalk, suggesting that ATG genes may be involved in the growth and development process. These finding are consistent with the research results in P. monodon , L. vannamei and Ctenopharyngodon idellus [ 10 , 31 , 32 ]. Intriguingly, the expression level of FcATG 16 was notably higher in the gill compared to other ATG family members. The gill is a multipurpose organ that provides gas exchange and osmotic regulation. This suggests that FcATG 16 may play an important role in the physiological function of the gill [ 10 , 30 ]. Besides, ATG3 is highly expressed in hepatopancreas, which is an important immune organ, suggesting ATG3 may be involved in immune responses, lipid metabolism, and detoxification in F. chinensis , as previous studies have demonstrated in other species such as Pelteobagrus fulvidraco , Macrobrachium rosenbergii , and some mammals [ 33 – 36 ]. Taken together, ATG genes may participate in various biological processes, with some members specifically related to the immune system of F. chinensis . Studies have shown that the expression of ATGs can be affected by various stimuli, such as environmental stress and pathogen invasion, and these genes play important roles in mediating autophagy, participating in embryonic development, host resistance to viral and bacterial infection, and immunity process [ 37 , 38 ]. Recently, there have been several efforts to study the role of the ATG gene family in pathogen invasion. The results have shown that different ATG members are stimulated after virus infection in various species. For instance, in olive flounder Paralichthys olivaceus , the mRNA level of ATG6 significantly increased after viral hemorrhagic septicemia virus (VHSV) infection [ 39 ]. In Procambarus clarkii , ATG14 expression was initially upregulated upon WSSV infection and then stabilized[ 26 ]. Similarly, in WSSV-infected L. vannamei , the expression level of ATG6 was first upregulated and then downregulated [ 10 ]. Due to the limited information on ATG in crustaceans, only the expression patterns of individual members in response to virus invasion were detected. Therefore, we conducted WSSV infection experiments and measured the expression levels of all FcATG members in F. chinensis . The results showed that in the hepatopancreas, 12 FcATG genes exhibited an up-regulation followed by a down-regulation trend, with the highest expression levels observed at 6 h and/or 24 h after treatment. Unlike other ATG family members, the expression levels of three genes ( FcATG 1, FcATG 3, and FcATG 4B) gradually increased until 60 h after injection. This indicated that these genes can be significantly induced by WSSV infection. It is believed that autophagy-related genes may be regulated thus cellular autophagy be affected in the early stage of viral infection. In the late stage of infection, host cells downregulate the expression of ATG to resist the virus and prevent its proliferation [ 40 ]. In contrast, the expression trend of FcATG 7 and FcATG 10 was continuously down-regulated after WSSV infection. This suggests that these genes may have species-specific or environment-dependent effects on the response of F. chinensis to WSSV infection. On the other hand, the expression trends of FcATG 8 and FcATG 101 did not change significantly. It is speculated that they may not be the main genes involved in coping with WSSV in F. chinensis , and further research is need to confirm this hypothesis. In summary, the results of F. chinensis suggest that ATGs play a crucial rule in the immune response against WSSV, emphasizing their significance in immunity. Further, autophagy is essential for maintaining the intracellular stability under normal and stress conditions and it ensures quality control within cells. However, autophagy induced by ion concentrations, pH, and other stressors, particularly when the stress level is not fatal, constitutes a strategy to adapt and cope with stress. This can promote cell survival by maintaining a sufficient amino acid pool and cell energy level [ 41 , 42 ]. For example, L. vannamei can regulate autophagy in respond to low temperature stress [ 43 ]. Hypoxic stress significantly upregulated the expression levels of ATG13 and ATG101 in Macrobrachium japonicum [ 29 ]. Similarly, in F. chinensis , the expression levels of ATG5, ATG6, and ATG12 were significantly upregulated under pH or carbonate alkalinity stress [ 44 ]. In this study, 12 FcATG genes were significantly induced, and their transcription abundance peaked at 96 hours after treatment under low-salt conditions. This suggests that FcATG genes are activated to promote cell survival by regulating autophagy when challenged by low-salt. Previous studies have shown that F. chinensis increases body energy consumption and enhances sugar metabolism activity in response to abiotic stress, including the acute changes in salinity [ 45 ]. Autophagy is proposed to participate in the process of sugar metabolism by regulating of glucose uptake, key enzymes of glycolysis, and mitochondria[ 46 ]. Taken together, these results demonstrate that abiotic stress alters the expression of ATG genes in organisms and plays an important role in their response to such stress. This study will advance our understanding of the molecular mechanisms by which FcATGs respond to low-salt stress. Conclusions In summary, we identified 20 ATG genes in F. chinensis , and characterized their structure, domains, phylogenetic tree, chromosomal distribution, and bioinformatics information. The qPCR examination results indicated that ATG genes played an essential role in WSSV infection. Furthermore, we analyzed their expression profiles based on generated from low-salt stress, providing potential functional information on the response of ATG genes to abiotic stressors in F. chinensis . This study enhances our comprehension of the molecular basis of the ATG gene family’s response to toxicological and environmental stresses in F. chinensis. It provides important clues for future research on their functions. Materials and methods Experimental Shrimp In the present study, F. chinensis (weight 15.4 ± 2.1 g, length 11.1 ± 0.87 cm) were obtained from the Changyi Haifeng Aquaculture Co., Ltd., Shandong, China. The shrimps were cultured in cement breeding ponds, with continuous aeration, at a temperature of 25 ℃, salinity of 30, and a pH of 8.4. During the acclimation period, the shrimps were fed thrice daily at 00:00, 09:00, and17:00 for two weeks. After acclimation, nine healthy and energetic F. chinensis were randomly selected for the study. Seven tissues, including eye stalks, gills, heart, hepatopancreas, muscles, stomach, and intestines, were collected and stored in liquid nitrogen for later use. Identification of ATG gene family in F. chinensis The ATG gene sequences of humans, mouse, zebrafish and arthropods were obtained from the UniProt ( https://www.uniprot.org/ ) and NCBI ( http://www.ncbi.nlm.nih.gov/ ) databases, and were used as the query sequences to search against the whole genome databases of F. chinensis using the TBLASTN alignment tool (E-value = 1e − 5 ). The amino acid sequences were predicted and translated from the open reading frame (ORF) using ORF Finder ( https://www.ncbi.nlm.nih.gov/orffinder/ ). The results were validated by BLASTP against the NCBI non-redundant protein (NR) database. The domain architectures of the ATG in F. chinensis were examined using SMART to confirm all of the family genes. Phylogenetic analysis The amino acid sequences of ATG subunits from F. chinensis and several representative animals were obtained from NCBI and aligned using the ClustalW program. Phylogenetic trees were constructed using the Maximum Likelihood (ML) method with a bootstrap value of 1000 in MEGA 11. The resulting tree was annotated using iTOL ( https://itol.embl.de/login.cgi ). Bioinformatics analysis To analyse the characteristics of ATG, we predicted the amino acids, molecular weight (MW), theoretical isoelectric points (pI), instability index, and grand average of hydropathicity (GRAVY) of the ATG genes using ExPASy ProtParam ( https://web.expasy.org/protparam/ ). We used SignalP 5.0 [ 47 ] to predict signal peptides and WOLF PSORT [ 48 ] to predict subcellular localization. NCBI-CDD ( https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi ) was used to predict the conserved domain of ATG genes. The structures of ATG genes were visualized using TBtools. The WSSV infection experiment Preparation of WSSV stock solution: the carapace and hepatopancreas were removed from WSSV - infected shrimp before shearing in an ice - bath environment, and 1 g tissue was collected and mixed with 10 ml phosphate - buffered saline (PBS). The mixture was homogenized at 10000 rpm for 5 s and then centrifuged at 8000 rpm for 5 min at 4°C. The supernatant fluid was filtered through a 0.45 µm microporous membrane as a virus stock solution [ 49 ]. 10 3 -diluted-stock-solution (using pre-chilled PBS) was used in this experiment to infect healthy shrimps. After acclimation, a total of 180 healthy F. chinensis were selected for the WSSV infection experiment. The shrimps were randomly divided into two groups, with three replicates in each group and 30 shrimps in each replicate. The second abdominal segment muscle of the shrimps was injected with PBS or WSSV suspensions. The experimental group received 10 µL of WSSV virus suspension, while the control group was injected with 10 µL sterile phosphate (PBS). The injected shrimps were raised separately in aquariums. We randomly selected hepatopancreas tissues from three healthy and complete shrimps were randomly selected at 0, 3, 6, 12, 24, 36, 48, and 60 h after injection and frozen immediately in liquid nitrogen and then stored at − 80 ℃. The low salinity stress experiment Ninety healthy and energetic shrimps were randomly selected and divided into three groups, each containing 30 shrimps. The stress treatment group was subjected to low-salt stress conditions with a salinity of 15. Salinity was corrected every 6 h using with light brine during the experiment. The hepatopancreas tissues were collected after exposure to low-salinity stress at 0, 3, 6, 12, 24, 48, 72, and 96 h. Three parallel samples were taken at each time point, frozen in liquid nitrogen and then stored at − 80 ℃ for later use. Total RNA extraction, and cDNA synthesis The total RNA of tissues was extracted using TransZol Up (TransGen Biotech, China) following the manufacturer’s instructions. RNA concentration and integrity were measured using an Ultra-trace UV spectrophotometer (Thermo, USA) and 1.5% agarose gel electrophoresis (AGE). According to the manufacturer’s instructions, the first-strand cDNA synthesis was performed with HiScript III RT SuperMix for qPCR (+ gDNA wiper) (Vazyme, China). Quantitative Real-time PCR (qRT-PCR) analysis The expressions of ATGs in different tissues of healthy F. chinensis , as well as their temporal expression patterns in the hepatopancreas after WSSV infection and low-salt stress were detected by qRT - PCR. Primers were designed for each gene using Primer5 software, avoiding regions with hairpin structures as identified by Mfold at 60°C [ 50 ]. The 18S rRNA was selected as the reference gene. Primer specificity and efficiency were checked for all qPCR conditions. The primer sequences are listed in Table 2. The qRT-PCR assay was conducted using ChamQ SYBR Color qPCR master mix (Vazyme, China) in a final volume of 10 µl on the FAST 7500 Real-time system (FAST, USA). The reaction mixture contained ChamQ SYBR Color qPCR Master Mix (Low ROX Premixed) (Vazyme, China), forward and reverse primers (final concentration 100 nM) and 4 µl of diluted cDNA. The PCR reactions were initiated with a denaturation step at 95°C for 30 s, followed by 40 cycles of two-step amplification as follows: denaturation at 95°C for 10 s, annealing at 60°C for 30 s. Fluorescence data were acquired during the final step. Gene-specific amplification was confirmed by a single peak in the melting curve analysis. Three technical repeats were performed for each biological repeat. The data was analysed using FAST 7500 software, and the relative expression ratio was calculated using 2 −ΔΔCT method [ 51 ]. Statistical analysis was performed using SPSS 19.0. A One-Way ANOVA was exerted to compare the differences between groups. Finally, GraphPad Prism was used for scientific graphing. Table 2 The primers used in this research Primer Sequence (5’-3’) Purpose FcATG1-F CTTATGGAGCGAGAGCACAATGAG PCR FcATG1-R GAGAGCGAGCCAATTCAAGGATAC PCR FcATG2-F AGCAAGTTGGTAGGAGGTGTCAG PCR FcATG2-R TGAGCCGATGAAGTTGTGAATGC PCR FcATG3-F CGCCGAGTATCTTACGCCAATTC PCR FcATG3-R GGACAGTGATGAACCAAGTGATCTC PCR FcATG4B-F CAGCCTTGCGGAGTGATGTG PCR FcATG4B-R CAGCCCTTGTCAGATGTAAAGTTTG PCR FcATG4D-F TGGAGGCATGAGCGTGTCTG PCR FcATG4D-R GGCACTGGGTCTACTGGGATG PCR FcATG5-F ATGATGCTGAGATGTGGTTGGAATC PCR FcATG5-R GTGGGAGAAGTGGGCTGTGAG PCR FcATG6-F CACCATCAACAACCTCCGCTTAG PCR FcATG6-R CGGTGCTTGGAGAACTTCAGTC PCR FcATG7-F AGCAACCAGCCAGTACCTCAC PCR FcATG7-R AGACGCTCCAGCAGACTTCAG PCR FcATG8-F GGGCAGAGGGAGAGAAGATTAGG PCR FcATG8-R TTGTCAAGATCGCCGATTCGTG PCR FcATG8B-F AGGAGTTTCGCCCAGAGACAG PCR FcATG8B-R ATACCGCTCAATAATCACAGGAACC PCR FcATG9A-F CACGCCGCTCATTCTCATCTTC PCR FcATG9A-R CCCACGCCTACAACCTCTACG PCR FcATG10-F CTGACGCAGCAAGAGCATCC PCR FcATG10-R AACCAGCTTATCATGTACCTTAGGC PCR FcATG12-F AGAATAAACACACAGCCGCCAAG PCR FcATG12-R GTACCTGCGTATGAATTCTGCTACC PCR FcATG13-F CAGCAACAGCAACAGCAACAAC PCR FcATG13-R AGGGAATATCGGGCAGGAAGAAG PCR FcATG14-F AGACACAGTATCGCATTGTTCACC PCR FcATG14-R TTCTCCATCACTCTCCTCACACTC PCR FcVPS15-F CGGCAGTGGTGGCGAGAG PCR FcVPS15-R GCAGGCATGAGAGGATACATACTTC PCR FcATG16-F TTAACTTAGCCTTCACTGCCTTGG PCR FcATG16-R TGTGTCATTCTCCAGGTTCAACTTC PCR FcATG17-F CATTGACTATGGCTCCGACACTG PCR FcATG17-R GCTGCTGGCATATTCTCGTCTG PCR FcATG18-F TTCCTCATCGCCTCCTCCAATAC PCR FcATG18-R GGCTGCTCCTCTACCACTACTC PCR FcATG101-F AAGGCAGGCAGGTGGATGAG PCR FcATG101-R CTATGGTTCCAACGGCGTATGTG PCR Fc18S-F TATACGCTAGTGGAGCTGGAA PCR Fc18S-R GGGGAGGTAGTGACGAAAAAT PCR Declarations Author contributions GCH conducted analysis and wrote the draft of manuscript. GCH, LYL, WJJ, WQ and TCJ performed data analysis. LZX and HYY conceived and designed the experiments, reviewed, and edited the writing of the manuscript. All authors read and approved the final manuscript. Funding This work was supported by grants from the National Natural Science Foundation of China [Grant No. 42376111], National Key R & D Program of China [No. 2022YFD2400104-03], China Agriculture Research System of MOF and MARA [No. CARS-48], Central Public-interest Scientific Institution Basal Research Fund, CAFS [No. 2023TD50] and ‘First Class Fishery Discipline’ program in Shandong Province, China. Availability of data and materials The sequence information of Fenneropenaeus chinensis ATG family genes were collected from Fenneropenaeus chinensis genome to Breeding Database (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_019202785.1/), and the ATG protein sequences of Mus musculus , Penaeus monodon, Litopenaeus vannamei , Macrobrachium nipponense , Bombyx mori , and Drosophila melanogaster et al. were downloaded from the NCBI website (https://www.ncbi.nlm.nih.gov/). All data used during the current study are included in this published article and its supplementary information files or available from the corresponding author on reasonable request. Ethics approval and consent to participate The Guidelines for the Care and Use of Laboratory Animals in China were followed when carrying out all the experiments. The Institutional Animal Care and Use Committee (IACUC) of the Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (Qingdao, China), approved the study, the study is reported in accordance with ARRlVE guidelines. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Klionsky DJ, Ohsumi Y. Vacuolar import of proteins and organelles from the cytoplasm. Annual Rev Cell Dev Biology. 1999;15(1):1–32. Mizushima N, Yoshimori T, Ohsumi Y. The role of ATG proteins in autophagosome formation. Annu Rev Cell Dev Biol. 2011;27:107–32. Noda NN, Fujioka Y. Atg1 family kinases in autophagy initiation. Cell Mol Life Sci. 2015;72(16):3083–96. Garcia Maurino S, Alcaide A, Dominguez C. Pharmacological control of autophagy: therapeutic perspectives in inflammatory bowel disease and colorectal cancer. Curr Pharm Design. 2012;18(26):3853–73. Qiang L, Sample A, Shea CR, Soltani K, Macleod KF, He Y. Autophagy gene ATG7 regulates ultraviolet radiation-induced inflammation and skin tumorigenesis. Autophagy. 2017;13(12):2086–103. Chen H, Dong JL, Wang T. Autophagy in plant abiotic stress management. Int J Mol Sci. 2021;22(8):954–63. Yu JY, Wang YJ, Jiao JL, Wang HZ. Silencing of ATG2 and ATG7 promotes programmed cell death in wheat via inhibition of autophagy under salt stress. Ecotoxicol Environ Saf. 2021;225:112761. Sun X, Wang P, Jia X, Huo L, Che RM, Ma F. Improvement of drought tolerance by overexpressing MdATG18a is mediated by modified antioxidant system and activated autophagy in transgenic apple. Plant Biotechnol. 2018;16(2):545–57. Fumihiko T, Kouji K, Atsushi M, Nao J, Kenji O. The non-canonical role of Atg family members as suppressors of innate antiviral immune signaling. Autophagy. 2008;4(1):67–9. Chu JX, Meng FJ, Zhang GC. Cloning of ATG6 in Litopenaeus vannamei and research on its expression under WSSV infection. J Anhui Agricultural Sci. 2018;46(12):107–11. Wang MZ, Kong J, Meng XH, Luan S, Luo K, Sui J, Chen BL, Cao JW, Shi XL, Zhang Q. Evaluation of genetic parameters for growth and cold tolerance traits in Fenneropenaeus chinensis juveniles. PLoS ONE. 2017;12(8):e0183801. Wang Q, Ren XY, Liu P, Li JT, Lv JJ, Wang JJ, Zhang HE, Wei W, Zhou YX, He YY. Improved genome assembly of Chinese shrimp ( Fenneropenaeus chinensis ) suggests adaptation to the environment during evolution and domestication. Mol Ecol Resour. 2021;22(1):334–44. He YY, Wang Q, Li J, Li ZX. Comparative proteomic profiling in Chinese shrimp Fenneropenaeus chinensis under low pH stress. Fish Shellfish Immunol. 2021;120:526–35. Le Moullac G, Haffner P. Environmental factors affecting immune responses in Crustacea. Aquaculture. 2000;191(1):121–31. Huang J, Cai SL, Song XL, Wang CM, Yu J, Yang CH. Study on artificial infection for penaeus chinensis by the pathogen of the explosive epidemic disease of shrimp. Mar Fisheries Reseach. 1995;16(1):51–8. Lo CF, HO CH, peng SE, Chen CH, Chen H, Lin Y, Chang CF, Fu K, Su MS, Wang CH, et al. White spot syndrome baculovirus (WSBV) detected in cultured and captured shrimp, crabs and other arthropods. Dis Aquat Organ. 1996;27(3):215–25. Van Hulten MCW, Witteveldt J, Peters S, Kloosterboer N, Tarchini R, Fiers M, Sandbrink H, Lankhorst RK, Vlak JM. The white spot syndrome Virus DNA genome sequence. Virology. 2001;286(1):7–22. Li XP, Luan S, Luo K, Cao BX, Chen BL, Kong J, Meng XH. Comparative transcriptomic analysis of Chinese shrimp Fenneropenaeus chinensis infected with white spot syndrome virus. Aquaculture Rep. 2022;22:100986. He YY, Li ZX, Zhang HE, Hu S, Wang QY, Li J. Genome-wide identification of Chinese shrimp ( Fenneropenaeus chinensis ) microRNA responsive to low pH stress by deep sequencing. Cell Stress & Chaperones. 2019;24(4):689–95. Yang W, Liu C, Xu QS, Qu C, Sun J, Huang S, Kong N, Lv XJ, Liu ZQ, Wang LL et al. Beclin-1 is involved in the regulation of antimicrobial peptides expression in Chinese mitten crab Eriocheir sinensis . Fish & Shellfish Immunology. 2019;89:207–216. J.Klionsky RPK. An overview of autophagy: morphology, mechanism, and regulation. Mary Ann Liebert. 2014;20(3):460–73. Lerner E, Kimchi. The paradox of autophagy and its implication in cancer etiology and therapy. Apoptosis. 2009;14(4):376–91. Galati S, Boni C, Gerra MC, Lazzaretti M, Buschini A. Autophagy: a player in response to oxidative stress and DNA damage. Oxidative Med Cell Longev. 2019;2019:5692958. Brittany E, Nimrod M, Chao M. Impaired autophagy and defective mitochondrial function:converging paths on the road to motor neuron degeneration. Front Cell Neurosci. 2016;10(44):00044. Jacob JA, Mohammad JM, Salmani, Jiang Z, Feng L, Song J, Jia X, Chen B. Autophagy: An overview and its roles in cancer and obesity. Clin Chim Acta. 2017;468:85–9. Zhu MR, Zhan M, Xi CJ, Gong J, Shen HS. Molecular characterization and expression of the autophagy-related gene Atg14 in WSSV-infected Procambarus clarkii . Fish Shellfish Immunol. 2022;125:200–11. Liu C, Zhao YJ, Zhao X, Dong J, Yuan Z. Identification of ATG gene family of Punica granatum and analysis on their expression pattern under abiotic stress. J Plant Resour Environ. 2022;31(5):37–49. Zhang HZ, Zhu L, Zuo ZY, Liu WH, Xu J. Prediction of the function of autophagy-related genes (ATGs) in development and abiotic stress based on expression profiling in Arabidopsi . Genomics And Applied Biology. 2020;39(6):2671–82. Sun SM, Chen YX, Zheng C, Zhao QQ, Xue C. Cloning and expression analysis of autophagy genes ATG13 and ATG101 in Macrobrachium nipponense under hypoxic stress. J Fisheries China. 2021;45(6):846–61. Yin WJ, Liu F, Meng FJ, Zhang GC, Wang LY, Sun JS. Cloning of ATG3 in Litopenaeus vannamei and research on its expression under WSSV infection. J Tianjin Normal University(Natural Sci Edition). 2021;41(2):51–5. Liu W. Mechanism of miR-7562 mediated ATG5-ATG12 conjugation system in response to Vibrio harveyi stress in Penaeus monodon . Shanghai, China: Shanghai Ocean University; 2018. He L, Ruan JM, Liu Y, Fu JP, Liu L, Wei LL. Cloning of beclin1 , an autophagy gene, and it's expression under microcystinlr stress in grass carp ( Ctenopharygodon idella ). Acta Hydrobiol Sin. 2019;43(3):479–85. Wei CC, Luo Z, Song YF, Pan YX, Wu K, You WJ. Identification of autophagy related genes LC3 and ATG4 from yellow catfish Pelteobagrus fulvidraco and their transcriptional responses to waterborne and dietborne zinc exposure. Chemosphere. 2018;175:228–38. Suwansa Ard S, Kankuan W, Thongbuakaew T, Saetan J, Kornthong N, Kruangkum T, Khornchatri K, Cummins SF, Isidoro C, Sobhon P. Transcriptomic analysis of the autophagy machinery in crustaceans. BMC Genomics. 2016;17:1–14. He H, Dang YJ, Dai FY, Guo ZK, Wu JX, She XY, Pei Y, Chen YJ, Ling WH, Wu CQ, et al. Post-translational modifications of three members of the human MAP1LC3 family and detection of a novel type of modification for MAP1LC3B . J Biol Chem. 2003;278(31):29278–87. Wu JX, Dang YJ, Su W, Liu C, Ma HJ, Shan YX, Pei Y, Wan B, Guo JH, Yu L. Molecular cloning and characterization of rat LC3A and LC3B–t wo novel markers of autophagosome. Biochem Biophys Res Commun. 2006;339(1):437–42. Wang JR. Beclin 1 bridges autophagy, apoptosis and differentiation. Autophagy. 2008;4(7):947–8. Tang H, Da L, Mao Y, Li Y, Li D, Xu ZH, Li F, Wang YF, Tiollais P, Li T, et al. Hepatitis B virus X protein sensitizes cells to starvation-induced autophagy via up‐regulation of beclin 1 expression. Hepatology. 2009;49(1):60–71. Kong HJ, Moon J, Nam B, Kim Y, Kim W, Lee J, Kim K, Kim B, Yeo S, Lee CH, et al. Molecular characterization of the autophagy-related gene Beclin-1 from the olive flounder ( Paralichthys olivaceus ). Fish Shellfish Immunol. 2011;31(2):189–95. Liu W, Li FF, Sun HJ, Wang YF, Yu GH, Wang FL, Qian YM. Tobacco mosaic virus infection on tobacco plants induces autophagy. Acta Phytopathologica Sinica. 2016;46(6):42–9. Kroemer G, Mariño G, Levine B. Autophagy and the integrated stress response. Mol Cell. 2010;40(2):280–93. Mariño G, Santano MN, Baehrecke EH, Kroemer G. Self-consumption: the interplay of autophagy and apoptosis. Nat Rev Mol Cell Biol. 2014;15(2):81–94. Dong WN, Liao MQ, Zhuang XQ, Huang L, Liu C, Wang FF, Yin XL, Liu Y, Liang QJ, Wang WN. MYC drives autophagy to adapt to stress in Penaeus vannamei . Fish Shellfish Immunol. 2022;126:187–96. Wei W, He YY, Li ZX, Zhou YX, Li J. Cloning of ATG5 gene of Fenneropenaeus chinensis and expression analysis under pH and carbonate alkalinity stress. Progress In Fishery Sciences. 2022;43(3):84–94. He YY, Li ZX, Zhang HE, Hu S, Wang QY, Li J. Genome-wide identification of Chinese shrimp ( Fenneropenaeus chinensis ) microRNA responsive to low pH stress by deep sequencing. Cell Stress and Caperones. 2019;24(4):689–95. Yang ZG, Zhang XD, Tang SL, Li HY. Research progress of autophagy on regulation of energy metabolism in tumor cells. Chin J Bases Clin Gen Surg. 2015;22(12):1525–9. Armenteros JJA, Tsirigos KD, Sønderby CK, Petersen TN, Winther O, Brunak S, Heijne Gv, Nielsen H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol. 2019;37(4):420–3. Horton P, Keun Joon Park, Obayashi T, Naoya Fujita, Harada H, Collier CJA, Nakai K. Wolf Psort protein localization predictor. Nucleic Acids Res. 2007;35(Web Server Issue):585–7. Huang J, Song XL, Zhang YJ. The components of an inorganic physiological buffer for Penaeus chinensis . Methods Cell Sci. 1999;21(4):225–30. Michael Z. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003;31(13):3406–15. Schmittgen TD, Livak KJ, Schmittgen TD. Livak KJAnalyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–8. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 20 Jun, 2024 Read the published version in BMC Genomics → Version 1 posted Editorial decision: Revision requested 17 May, 2024 Reviews received at journal 08 May, 2024 Reviewers agreed at journal 28 Apr, 2024 Reviews received at journal 19 Feb, 2024 Reviewers agreed at journal 01 Feb, 2024 Reviewers invited by journal 27 Jan, 2024 Editor assigned by journal 27 Jan, 2024 Editor invited by journal 24 Jan, 2024 Submission checks completed at journal 24 Jan, 2024 First submitted to journal 16 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3871880","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268960517,"identity":"7803898f-e84f-4c00-9d8c-bcb10f9e151b","order_by":0,"name":"Chenhui Guan","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chenhui","middleName":"","lastName":"Guan","suffix":""},{"id":268960518,"identity":"cf132dd5-f493-45d3-8fd9-5d3be40049e9","order_by":1,"name":"Yalun Li","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yalun","middleName":"","lastName":"Li","suffix":""},{"id":268960519,"identity":"737a5dcf-14d6-44ee-9078-db0f62ac5a4b","order_by":2,"name":"Qiong Wang","email":"","orcid":"","institution":"Chinese Academy of Fishery Sciences","correspondingAuthor":false,"prefix":"","firstName":"Qiong","middleName":"","lastName":"Wang","suffix":""},{"id":268960520,"identity":"165f222b-401f-46e1-8c6d-60f7ae450947","order_by":3,"name":"Jiajia Wang","email":"","orcid":"","institution":"Chinese Academy of Fishery Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jiajia","middleName":"","lastName":"Wang","suffix":""},{"id":268960522,"identity":"95fd34bb-35f5-4b3e-a16b-148c76343d43","order_by":4,"name":"Caijuan Tian","email":"","orcid":"","institution":"Chinese Academy of Fishery Sciences","correspondingAuthor":false,"prefix":"","firstName":"Caijuan","middleName":"","lastName":"Tian","suffix":""},{"id":268960524,"identity":"29ffe085-8ea4-4c04-985c-6392a8fae431","order_by":5,"name":"Yuying He","email":"","orcid":"","institution":"Chinese Academy of Fishery Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yuying","middleName":"","lastName":"He","suffix":""},{"id":268960526,"identity":"3f41e7a4-3db4-4348-8fd3-bf96ce856f38","order_by":6,"name":"Zhaoxia Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYBACPmYGNhDNw8DeABZgbCCkhQ2uhecAsVoYIFoYGCQSiNXCzv7swY+KwzL8Mx9v/MzDYCO74QDzswcEHJZu2HMmjUfidlqxNA9DmvGGA2zmBgS0HJPgbbPhYbidYwDUcjhxwwEeNgn8WhjbJP+2SfDI3zxj/JuH4T8xWpjZpEG2GNzgMQPacoAYLWxs0jJAvxieSSuznGOQbDzzMJsZXi38/MefSb6pOGwvd/zw5htvKuxk+443P8OrBRkYgBEDM7HqIVpGwSgYBaNgFGABAPVAPFCr17Z4AAAAAElFTkSuQmCC","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Zhaoxia","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-01-17 05:00:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3871880/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3871880/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12864-024-10529-2","type":"published","date":"2024-06-20T15:48:47+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50156020,"identity":"e00c3337-4373-4fbc-896b-71b42f9f8c32","added_by":"auto","created_at":"2024-01-25 11:42:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1941753,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic relationships of the ATG genes \u003cem\u003eF. chinensis\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/0871016291bc27b7cbbe2393.png"},{"id":50156018,"identity":"85688e38-35f1-44ee-89d8-59e6c4141657","added_by":"auto","created_at":"2024-01-25 11:42:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2858985,"visible":true,"origin":"","legend":"\u003cp\u003eThe chromosome location of ATG gene family members of \u003cem\u003eF. chinensis\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/4301d1abb4b1d7b3ea8700f2.png"},{"id":50156292,"identity":"2b810096-6473-4c80-a093-21e8a44336f4","added_by":"auto","created_at":"2024-01-25 11:50:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":503362,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of the gene structure(a) and protein domain(b) of ATG in \u003cem\u003eF. chinensis.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/89aadad8ff19ad571582dfec.png"},{"id":50156019,"identity":"c3e1daa2-cd90-42b6-b65a-a619755d2a2a","added_by":"auto","created_at":"2024-01-25 11:42:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2699249,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of ATG in various tissues of healthy \u003cem\u003eF. chinensis\u003c/em\u003e, including eyestalk (E), gill (G), heart (H), hepatopancreas (HE), intestine (I), muscle (M), and stomach (S).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/a06eeb5461e0760d763f2fa5.png"},{"id":50156293,"identity":"3c06c7df-712a-444d-9bc1-bb4ff7ba361e","added_by":"auto","created_at":"2024-01-25 11:50:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2355039,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of 20 ATG genes in the hepatopancreas tissue of \u003cem\u003eF. chinensis\u003c/em\u003e after WSSV infection Error bars indicate the mean ± standard deviation (n = 3). * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001, and **** means P \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/8278a0794e784ba394f3b63e.png"},{"id":50156016,"identity":"e607dbd2-1b51-42a8-a4d2-1adec8d6087d","added_by":"auto","created_at":"2024-01-25 11:42:47","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":236507,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of ATG genes expression in F. chinensis following experimental with low-salt stress from hepatopancreas tissues.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/2804f8eb457c8e28f3e689fe.png"},{"id":58823632,"identity":"c67ff181-c4fe-4501-88ae-d7f9b8585340","added_by":"auto","created_at":"2024-06-21 17:04:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11178171,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3871880/v1/25db69c1-cee6-44c3-b3dd-ab021cbc0794.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genome-wide identification of ATG genes and their expression profiles under biotic and abiotic stresses in Fenneropenaeus chinensis","fulltext":[{"header":"Background","content":"\u003cp\u003eAutophagy is a conserved intracellular degradation system found in eukaryotes. In autophagy, an isolation membrane emerges suddenly in the cytoplasm, which then expands and transforms into double membrane-bound structure called an autophagosome [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. During this process, a portion of cytoplasm, including proteins and organelles, is sequestered into the autophagosome. The autophagosome then fuses with a lysosome (or a vacuole, in yeast and plants). The inner membrane, referred to as an autophagic body in yeast, is exposed to lysosomal hydrolases and degraded along with its contents [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The primary function of autophagy is to maintain cellular homeostasis by recycling intracellular materials, which promotes stress resistance and longevity [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Autophagy has emerged as a crucial cellular process with implications for health and immunity in all eukaryotic organisms. Research has shown that a range of autophagy-related genes play important roles in both biotic and abiotic stresses in plants and animals. In yeast, there are over 36 autophagy-related genes (ATG) have been identified. Most of these genes have corresponding homologous genes in mammals [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Drought and salt stress cause ion stress which induces oxidative damage in plant cells. Autophagy repairs this damage under the activation of various biological factors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Silencing \u003cem\u003eOsATG2\u003c/em\u003e and \u003cem\u003eOsATG7\u003c/em\u003e inhibits autophagy and reduces wheat salt tolerance [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Overexpression o\u003cem\u003ef MdATG18a\u003c/em\u003e enhances the adaptability of apples to drought stress [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In animal studies, it has been found that the ATG5-ATG12 conjugate functions in the mouse innate antiviral immune system, enhancing their bactericidal activity [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. For the banana shrimp, interference with either ATG3 or ATG6 during WSSV challenge resulted in a decrease in autophagic levels[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, autophagy-related research has recently gained increasing attention from the scientific community.\u003c/p\u003e \u003cp\u003e \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e, commonly known as Chinese shrimp, is a highly valued species in China\u0026rsquo;s aquaculture industry. Its distribution is mainly concentrated in the Yellow Sea and Bohai Sea of China, as well as the western and southern coast of the Korean Peninsula [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Due to the advancement of aquaculture techniques, \u003cem\u003eF. chinensis\u003c/em\u003e emerged as the most important shrimp species for cultivation in China during the 1990s [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. \u003cem\u003eF. chinensis\u003c/em\u003e and other crustaceans often encounter changes in environmental factors, such as extreme temperatures, salinity, hypoxia and abnormal acid-base levels. Environmental factors can disrupt homeostatic equilibrium and cause the fluctuations in the neuroendocrine, physiological, and behavioral status of aquatic animals, negatively impacting their health [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Saline-alkaline water aquaculture is becoming a promising solution to accommodate the growing needs of the aquaculture industry. Therefore, it is important to investigate the physiological changes and molecular responses in aquatic animals adapting to this environment. \u003cem\u003eF. chinensis\u003c/em\u003e is highly sensitive to changes in salinity levels, particularly in low-salt environments, which is considered a major stressor. It is essential to understand the effects of low salinity on \u003cem\u003eF. chinensis\u003c/em\u003e to develop effective mitigation strategies in \u003cem\u003eF. chinensis\u003c/em\u003e aquaculture. The sensitivity to low salinity is rooted in the osmoregulatory mechanisms employed by these organisms to maintain internal salt and water balance. The balance is crucial for their metabolic processes and impacts the reproductive and developmental processes of shrimps. In addition to abiotic stress, the significant environmental variations were accompanied by severe bacterial and viral infections, resulting in an epizootic breakout that caused great losses to the aquaculture industry [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. White spot syndrome virus (WSSV) is a major pathogen in shrimp aquaculture. It is a double-stranded DNA virus that causes white spot disease [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The mortality rate of \u003cem\u003eF. chinensis\u003c/em\u003e infected with WSSV can reach 100% within a week. WSSV first emerged in the late 20th century, causing huge economic losses. Despite extensive research, no effective solution to the WSSV problem has been conducted, and it remains one of the most fatal pathogens in \u003cem\u003eF. chinensis\u003c/em\u003e aquaculture[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Autophagy has been extensively studied endlessly in animals and plants, but it is relatively uncommon in crustaceans. Existing research suggests that autophagy participates in sugar metabolism, antimicrobial peptide regulation, and other pathways when animals and plants respond to abiotic stress or bacterial infection[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Given the growing importance of shrimp aquaculture and the risks posed by viral infections and environmental stress, it is crucial to comprehend the autophagy-related mechanisms in this economically vital species. However, the precise details of the \u003cem\u003eF. chinensis\u003c/em\u003e autophagy-related gene family, its structure, and its specific roles in the response to WSSV infection and low-salt stress have not been comprehensively elucidated.\u003c/p\u003e \u003cp\u003eThe objective of this study is to identify and characterize the ATG gene family in \u003cem\u003eF. chinensis\u003c/em\u003e and investigate their expression patterns in response to biotic and abiotic stresses. The study aims to contribute to the advancement of shrimp aquaculture and the management of viral diseases and environmental factors that pose a threat to this industry.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eIdentification and characterization of ATG genes in \u003cem\u003eF. chinensis\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn the \u003cem\u003eF. chinensis\u003c/em\u003e, a total of 20 ATG genes were identified and named according to the rules for ATG gene nomenclature (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These ATG genes (designated as \u003cem\u003eFcATGs\u003c/em\u003e) were classified into18 subfamilies, including \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e1-3, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e4B, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e4D, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e5-8, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e8B, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e9-10, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e12-14, \u003cem\u003eFcVPS\u003c/em\u003e15, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e16 -18, and \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e101. The predicted molecular weight of \u003cem\u003eF. chinensis\u003c/em\u003e ATG proteins were in the range of 13.63 kDa to 241.9 kDa and the deduced isoelectric points ranged from 4.57 to 9.69. The \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e12 gene had the smallest molecular weight of 13.63 kDa, while the \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e2 gene had the largest molecular weight of 241.9 kDa. The instability index of three ATG proteins, namely \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e12, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e14, and \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e 101, was less than 40, indicating their stability. On the other hand, the remaining 17 proteins were predicted to be unstable. All ATG proteins had GRAVY values less than 0, indicating their hydrophilic nature. The open reading\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe characteristics of ATG proteins in \u003cem\u003eF. chinensis\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eORF length(bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmino Acids\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMolecular Weight\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eInstability Index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eAliphatic index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eGRAVY\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eSubcellular localization\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125025612\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2517\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e838\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e89941.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e9.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e67.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e70.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125043934\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6546\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2181\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e241858.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e48.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e82.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.339\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125036151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e951\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e316\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e35726.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e46.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e71.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.614\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG4B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125047743\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1233\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e410\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47538.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e53.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e81.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.288\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCytoplasm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG4D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125033004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2259\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e752\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e83824.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e7.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e59.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e66.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.560\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125047653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e810\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e269\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e31103.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e43.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e84.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.407\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125039134\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1275\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e424\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47999.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e41.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e81.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.435\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125046156\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e696\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e76306.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e88.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125042574\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e119\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e14087.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e41.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e76.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.584\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eGolgi apparatus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG8B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125046396\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e369\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e122\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e14523.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e9.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e51.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e88.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.577\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCytoplasm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG9A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125045477\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2466\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e93190.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e54.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e84.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.137\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCytoplasm, Mitochondrion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125041822\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e675\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e224\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e26022.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e51.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e82.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.485\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125041823\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e363\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e13637.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e38.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e68.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.718\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCytoplasm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125031250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1422\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e52171.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e49.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e73.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCytoplasm, Nucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125035822\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1467\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e54777.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e39.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e80.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVPS15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125046127\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3987\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1328\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e148803.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e45.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e92.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCytoplasm, Nucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125044282\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1695\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e564\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63011.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e85.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.458\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125042474\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e156986.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e51.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e79.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125034319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e344\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e36468.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e75.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.190\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC125034760\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e660\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e219\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e25158.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e36.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e84.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.415\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eGolgi apparatus, Nucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eframes (ORFs) of ATG genes ranged from 360 to 6,546 bp, with predicted protein lengths ranging from 119 to 2181 amino acids (aa). Subcellular location prediction revealed that 12 ATG proteins are located in the nucleus, while the remaining proteins are mainly present in the Golgi apparatus, cytoplasm, and mitochondrion. The cDNA sequences of these ATG genes have been submitted to the GenBank database, and their characteristics are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003ePhylogenetic Tree Construction\u003c/p\u003e \u003cp\u003eTo explore the evolutionary relationships of \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e genes, we constructed a phylogenetic tree was using ATG protein sequences from fifteen species, including \u003cem\u003eF. chinensis\u003c/em\u003e, \u003cem\u003eMus musculus\u003c/em\u003e, \u003cem\u003ePenaeus monodon\u003c/em\u003e, \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e, \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e, \u003cem\u003eBombyx mori\u003c/em\u003e, and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e et al. The phylogenetic analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) revealed that the ML tree for ATGs split into 18 subfamilies, with the subfamilies in \u003cem\u003eF. chinensis\u003c/em\u003e clustering with their respective counterparts from other species as expected. The \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e1, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e7, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e13, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e14, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e16, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e18 and \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e101 subfamilies clustered first, followed by the \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e2, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e3, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e4, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e6, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e10, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e12, and \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e15 subfamilies, as well as the \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e5, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e8, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e9, and \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003e12 subfamily. These results are consistent with the classification described in previous research and provide insights into the evolution of \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eF\u003c/span\u003e\u003cem\u003ec\u003c/em\u003e\u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eATG\u003c/span\u003es orthologous genes in different species.\u003c/p\u003e \u003cp\u003eChromosomal distribution of ATG gene\u003c/p\u003e \u003cp\u003eChromosomal distribution analysis revealed that 20 ATG genes are distributed across 16 shrimp chromosomes, from NC-061821.1 to NC-061859.1. However, the distribution of ATG genes was uneven on each chromosome. For instance, \u003cem\u003eFcATG\u003c/em\u003e3 and \u003cem\u003eFcATG\u003c/em\u003e14, \u003cem\u003eFcATG\u003c/em\u003e8 and \u003cem\u003eFcATG\u003c/em\u003e17, as well as \u003cem\u003eFcATG\u003c/em\u003e5 and \u003cem\u003eFcATG\u003c/em\u003e4B are all located on the same chromosome, while the remaining chromosomes each hosted only a single ATG gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The non-random distribution of ATG genes in the shrimp genome highlights the importance of their genomic arrangement in autophagy-related processes.\u003c/p\u003e \u003cp\u003eStructure and domain analysis of \u003cem\u003eF. chinensis\u003c/em\u003e ATG genes\u003c/p\u003e \u003cp\u003eBased on the structural analysis of the \u003cem\u003eF. chinensis\u003c/em\u003e ATG genes, the number of exons among ATG members varies from 1 to 29. Each ATG member comprises both UTR and CDS regions, with coding regions of similar lengths for members within the same subfamily, such as \u003cem\u003eFcATG\u003c/em\u003e4B, \u003cem\u003eFcATG\u003c/em\u003e4D, \u003cem\u003eFcATG\u003c/em\u003e8, and \u003cem\u003eFcATG\u003c/em\u003e8B (Fig.\u0026nbsp;3-3a). Protein domain analysis reveals that \u003cem\u003eFcATG\u003c/em\u003e6, \u003cem\u003eFcVPS\u003c/em\u003e15, and \u003cem\u003eFcATG\u003c/em\u003e16 each possess two domains: APG6_N and APG6 for \u003cem\u003eFcATG\u003c/em\u003e6, VPS15 and WD40 for \u003cem\u003eFcVPS\u003c/em\u003e15, and \u003cem\u003eFc\u003c/em\u003eATG16 and WD40 for \u003cem\u003eFcATG\u003c/em\u003e16. In contrast, other proteins have only one domain. Different subfamilies exhibit distinct domain compositions. However, within the same subfamily, the domain structure is generally conserved. For example, both \u003cem\u003eFcATG\u003c/em\u003e4B and \u003cem\u003eFcATG\u003c/em\u003e4D contain the Peptidase_C54 domain, while \u003cem\u003eFcATG\u003c/em\u003e8 and \u003cem\u003eFcATG\u003c/em\u003e8B contain the Ubl_ATG8 domain (see Fig.\u0026nbsp;3-3b). This structural analysis offers insight into the diversity and conservation of gene architecture within the \u003cem\u003eFcATG\u003c/em\u003e family and sheds light on potential functional implications.\u003c/p\u003e \u003cp\u003eExpression profiles of ATG genes in \u003cem\u003eF. chinensis\u003c/em\u003e\u003c/p\u003e \u003cp\u003eThe relative expression levels of \u003cem\u003eFcATG\u003c/em\u003e were measured in various tissues, including the eyestalk, gill, heart, hepatopancreas, intestine, muscle, and stomach, using qRT-PCR with 18S rDNA as the internal control in nine untreated shrimps. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cem\u003eFcATG\u003c/em\u003e1, \u003cem\u003eFcATG\u003c/em\u003e4B, \u003cem\u003eFcATG\u003c/em\u003e7, and \u003cem\u003eFcATG\u003c/em\u003e12 genes exhibited higher expression levels in the eyestalk compared to the gills, heart, intestine, hepatopancreas, and stomach. The other 14 \u003cem\u003eFcATG\u003c/em\u003e genes had the highest level of expression in muscles.\u003c/p\u003e \u003cp\u003eExpression profiles of ATG genes after WSSV infection\u003c/p\u003e \u003cp\u003eThis experiment utilized qRT-PCR analysis to study the expression levels of the 20 identified members of the \u003cem\u003eFcATG\u003c/em\u003e gene family. The cDNA samples from the hepatopancreas were collected at 3h, 6h, 12h, 24h, 36h, 48h, and 60h after WSSV injection to investigate the expression levels of each member during WSSV infection. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e shows that \u003cem\u003eFcATG\u003c/em\u003e1, \u003cem\u003eFcATG\u003c/em\u003e3, and \u003cem\u003eFcATG\u003c/em\u003e4B had a significant upregulation trend, with the highest expression at 60 hours. \u003cem\u003eFcATG\u003c/em\u003e7 and \u003cem\u003eFcATG\u003c/em\u003e10 exhibited a noticeable downregulation trend. Most ATG genes showed an up-regulation followed by a down-regulation trend, with \u003cem\u003eFcATG\u003c/em\u003e2, \u003cem\u003eFcATG\u003c/em\u003e8, and \u003cem\u003eFcATG\u003c/em\u003e8B peaked at 3 hours. \u003cem\u003eFcATG\u003c/em\u003e5, \u003cem\u003eFcATG\u003c/em\u003e6, \u003cem\u003eFcATG\u003c/em\u003e9A, \u003cem\u003eFcATG\u003c/em\u003e13, \u003cem\u003eFcATG\u003c/em\u003e14, \u003cem\u003eFcVPS\u003c/em\u003e15, \u003cem\u003eFcATG\u003c/em\u003e17, and \u003cem\u003eFcATG\u003c/em\u003e101 reached their peak expression at 6 hours. \u003cem\u003eFcATG\u003c/em\u003e4D, \u003cem\u003eFcATG\u003c/em\u003e12, \u003cem\u003eFcATG\u003c/em\u003e16, and \u003cem\u003eFcATG\u003c/em\u003e18 reached their highest expression at 24 hours.\u003c/p\u003e \u003cp\u003eExpression profiles of ATG genes after low-salt stress\u003c/p\u003e \u003cp\u003eThe expression of \u003cem\u003eFcATG\u003c/em\u003e genes in hepatopancreas tissues after low-salt stress was analyzed using qRT-PCR (Fig.\u0026nbsp;6). The results showed an up-regulation trend for \u003cem\u003eFcATG\u003c/em\u003e1-3, \u003cem\u003eFcATG\u003c/em\u003e4B, \u003cem\u003eFcATG\u003c/em\u003e4D, \u003cem\u003eFcATG\u003c/em\u003e5, \u003cem\u003eFcATG\u003c/em\u003e9, \u003cem\u003eFcATG\u003c/em\u003e12-13 \u003cem\u003eFcVPS\u003c/em\u003e15, \u003cem\u003eFcATG\u003c/em\u003e16, and \u003cem\u003eFcATG\u003c/em\u003e8, peaking at 72 h or 96 h. \u003cem\u003eFcATG\u003c/em\u003e10 exhibited a notable upregulation, reaching peak expression at 24 h. Meanwhile, \u003cem\u003eFcATG\u003c/em\u003e6- \u003cem\u003eFcATG\u003c/em\u003e8, \u003cem\u003eFcATG\u003c/em\u003e8B, \u003cem\u003eFcATG\u003c/em\u003e14, \u003cem\u003eFcATG\u003c/em\u003e17, \u003cem\u003eFcATG\u003c/em\u003e101 initially showed a downregulation followed by an upregulation trend. \u003cem\u003eFcATG\u003c/em\u003e17, and \u003cem\u003eFcATG\u003c/em\u003e101 peaked at 72 h, while the rest reached their highest expression at 96 h.\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003eAutophagy is a highly conserved catabolic pathway that is involved in the cellular degradation of long-lived proteins or dysfunctional cellular components through lysosomes action. It is considered a pro-survival mechanism and for maintaining homeostasis[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Meanwhile, autophagy is a sensitive process that underlies cell response to almost every stressful condition affecting cellular homeostasis. Its role is complex and likely depends on the cell\u0026rsquo;s genetic background and environmental cues [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Recent research has shown that autophagy is crucial for maintaining homeostasis at both the cellular and organismal levels [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. While the study of ATG genes has been characterized in yeasts and mammals for decades, there has been a lack of systematic identification and analysis of the ATG gene family in \u003cem\u003eF. chinensis\u003c/em\u003e. Additionally, research on ATGs under biotic and abiotic stresses of \u003cem\u003eF. chinensis\u003c/em\u003e has not been conducted. This study identified and characterized the ATG genes of \u003cem\u003eF. chinensis\u003c/em\u003e, including their phylogenetic analysis, protein structures, and physicochemical properties of ATGs. In addition, the expression profiles of ATG genes were analyzed after WSSV infection, low salt stress, and in healthy tissues. These analyses provide insights into the involvement of ATGs in response to toxicological and environmental stresses.\u003c/p\u003e \u003cp\u003eThis study reports the identification of 20 ATG family members in the \u003cem\u003eF. chinensis\u003c/em\u003e genome, three of which have instability coefficients below 40, indicating relative stability of the gene family. This finding is consistent with the results reported by Liu et al. [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] in their investigation of the physical and chemical properties of the ATG gene in \u003cem\u003ePunica granatum\u003c/em\u003e. Meanwhile, the 20 ATG gene family members of \u003cem\u003eF. chinensis\u003c/em\u003e are distributed unevenly across 16 chromosomes. This distribution pattern is similar to that found in \u003cem\u003eArabidopsis\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], suggesting that even within the same family, members can have different chromosomal positions. The ATG genes are relatively conserved from yeast to humans, but the detailed evolutionary history remains unclear. Analyzing phylogenetic relationships can provide insight into the evolution of the ATG genes. A phylogenetic tree was constructed based on the amino acid sequences of ATG homologous genes from 15 different species. The resulting tree revealed that 20 shrimp ATG genes were grouped into 18 subfamilies. Moreover, the evolutionary relationship between \u003cem\u003eL.vannamei\u003c/em\u003e and the ATG genes of the Chinese shrimp ATG family was found to be similar, suggesting a close association. As per Zhu\u0026rsquo;s findings, the ATG gene of \u003cem\u003eProcambarus clarkii\u003c/em\u003e and \u003cem\u003eHomarus americanus\u003c/em\u003e are closely related [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In general, proteins within the same subfamily on a branch exhibit similar structures and functional domains, thereby indicating a tendency towards functional conservation.\u003c/p\u003e \u003cp\u003ePrevious studies have profiled the expression patterns of ATG family members in crustacean [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, such research has not been conducted in \u003cem\u003eF. chinensis\u003c/em\u003e. To better understand the characteristics and functions of ATG genes in \u003cem\u003eF. chinensis\u003c/em\u003e, we used qRT-PCR to profile the expression patterns of ATG genes in different tissues. ATGs are expressed ubiquitously in various \u003cem\u003eF. chinensis\u003c/em\u003e tissues with varying levels, indicating their divergent functions in the organism. Sixteen ATG genes have the highest expression levels in muscles, while four ATG genes have the highest expression levels in the eye stalk, suggesting that ATG genes may be involved in the growth and development process. These finding are consistent with the research results in \u003cem\u003eP. monodon\u003c/em\u003e, \u003cem\u003eL. vannamei\u003c/em\u003e and \u003cem\u003eCtenopharyngodon idellus\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Intriguingly, the expression level of \u003cem\u003eFcATG\u003c/em\u003e16 was notably higher in the gill compared to other ATG family members. The gill is a multipurpose organ that provides gas exchange and osmotic regulation. This suggests that \u003cem\u003eFcATG\u003c/em\u003e16 may play an important role in the physiological function of the gill [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Besides, ATG3 is highly expressed in hepatopancreas, which is an important immune organ, suggesting ATG3 may be involved in immune responses, lipid metabolism, and detoxification in \u003cem\u003eF. chinensis\u003c/em\u003e, as previous studies have demonstrated in other species such as \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e, \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e, and some mammals [\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Taken together, ATG genes may participate in various biological processes, with some members specifically related to the immune system of \u003cem\u003eF. chinensis\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eStudies have shown that the expression of ATGs can be affected by various stimuli, such as environmental stress and pathogen invasion, and these genes play important roles in mediating autophagy, participating in embryonic development, host resistance to viral and bacterial infection, and immunity process [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Recently, there have been several efforts to study the role of the ATG gene family in pathogen invasion. The results have shown that different ATG members are stimulated after virus infection in various species. For instance, in olive flounder \u003cem\u003eParalichthys olivaceus\u003c/em\u003e, the mRNA level of ATG6 significantly increased after viral hemorrhagic septicemia virus (VHSV) infection [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. In \u003cem\u003eProcambarus clarkii\u003c/em\u003e, ATG14 expression was initially upregulated upon WSSV infection and then stabilized[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Similarly, in WSSV-infected \u003cem\u003eL. vannamei\u003c/em\u003e, the expression level of ATG6 was first upregulated and then downregulated [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Due to the limited information on ATG in crustaceans, only the expression patterns of individual members in response to virus invasion were detected. Therefore, we conducted WSSV infection experiments and measured the expression levels of all \u003cem\u003eFcATG\u003c/em\u003e members in \u003cem\u003eF. chinensis\u003c/em\u003e. The results showed that in the hepatopancreas, 12 \u003cem\u003eFcATG\u003c/em\u003e genes exhibited an up-regulation followed by a down-regulation trend, with the highest expression levels observed at 6 h and/or 24 h after treatment. Unlike other ATG family members, the expression levels of three genes (\u003cem\u003eFcATG\u003c/em\u003e1, \u003cem\u003eFcATG\u003c/em\u003e3, and \u003cem\u003eFcATG\u003c/em\u003e4B) gradually increased until 60 h after injection. This indicated that these genes can be significantly induced by WSSV infection. It is believed that autophagy-related genes may be regulated thus cellular autophagy be affected in the early stage of viral infection. In the late stage of infection, host cells downregulate the expression of ATG to resist the virus and prevent its proliferation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In contrast, the expression trend of \u003cem\u003eFcATG\u003c/em\u003e7 and \u003cem\u003eFcATG\u003c/em\u003e10 was continuously down-regulated after WSSV infection. This suggests that these genes may have species-specific or environment-dependent effects on the response of \u003cem\u003eF. chinensis\u003c/em\u003e to WSSV infection. On the other hand, the expression trends of \u003cem\u003eFcATG\u003c/em\u003e8 and \u003cem\u003eFcATG\u003c/em\u003e101 did not change significantly. It is speculated that they may not be the main genes involved in coping with WSSV in \u003cem\u003eF. chinensis\u003c/em\u003e, and further research is need to confirm this hypothesis. In summary, the results of \u003cem\u003eF. chinensis\u003c/em\u003e suggest that ATGs play a crucial rule in the immune response against WSSV, emphasizing their significance in immunity.\u003c/p\u003e \u003cp\u003eFurther, autophagy is essential for maintaining the intracellular stability under normal and stress conditions and it ensures quality control within cells. However, autophagy induced by ion concentrations, pH, and other stressors, particularly when the stress level is not fatal, constitutes a strategy to adapt and cope with stress. This can promote cell survival by maintaining a sufficient amino acid pool and cell energy level [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. For example, \u003cem\u003eL. vannamei\u003c/em\u003e can regulate autophagy in respond to low temperature stress [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Hypoxic stress significantly upregulated the expression levels of ATG13 and ATG101 in \u003cem\u003eMacrobrachium japonicum\u003c/em\u003e [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Similarly, in \u003cem\u003eF. chinensis\u003c/em\u003e, the expression levels of ATG5, ATG6, and ATG12 were significantly upregulated under pH or carbonate alkalinity stress [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In this study, 12 \u003cem\u003eFcATG\u003c/em\u003e genes were significantly induced, and their transcription abundance peaked at 96 hours after treatment under low-salt conditions. This suggests that \u003cem\u003eFcATG\u003c/em\u003e genes are activated to promote cell survival by regulating autophagy when challenged by low-salt. Previous studies have shown that \u003cem\u003eF. chinensis\u003c/em\u003e increases body energy consumption and enhances sugar metabolism activity in response to abiotic stress, including the acute changes in salinity [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Autophagy is proposed to participate in the process of sugar metabolism by regulating of glucose uptake, key enzymes of glycolysis, and mitochondria[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Taken together, these results demonstrate that abiotic stress alters the expression of ATG genes in organisms and plays an important role in their response to such stress. This study will advance our understanding of the molecular mechanisms by which \u003cem\u003eFcATGs\u003c/em\u003e respond to low-salt stress.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, we identified 20 ATG genes in \u003cem\u003eF. chinensis\u003c/em\u003e, and characterized their structure, domains, phylogenetic tree, chromosomal distribution, and bioinformatics information. The qPCR examination results indicated that ATG genes played an essential role in WSSV infection. Furthermore, we analyzed their expression profiles based on generated from low-salt stress, providing potential functional information on the response of ATG genes to abiotic stressors in \u003cem\u003eF. chinensis\u003c/em\u003e. This study enhances our comprehension of the molecular basis of the ATG gene family\u0026rsquo;s response to toxicological and environmental stresses in \u003cem\u003eF. chinensis.\u003c/em\u003e It provides important clues for future research on their functions.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eExperimental Shrimp\u003c/p\u003e \u003cp\u003eIn the present study, \u003cem\u003eF. chinensis\u003c/em\u003e (weight 15.4\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1 g, length 11.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87 cm) were obtained from the Changyi Haifeng Aquaculture Co., Ltd., Shandong, China. The shrimps were cultured in cement breeding ponds, with continuous aeration, at a temperature of 25 ℃, salinity of 30, and a pH of 8.4. During the acclimation period, the shrimps were fed thrice daily at 00:00, 09:00, and17:00 for two weeks. After acclimation, nine healthy and energetic \u003cem\u003eF. chinensis\u003c/em\u003e were randomly selected for the study. Seven tissues, including eye stalks, gills, heart, hepatopancreas, muscles, stomach, and intestines, were collected and stored in liquid nitrogen for later use.\u003c/p\u003e \u003cp\u003eIdentification of ATG gene family in \u003cem\u003eF. chinensis\u003c/em\u003e\u003c/p\u003e \u003cp\u003eThe ATG gene sequences of humans, mouse, zebrafish and arthropods were obtained from the UniProt (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.uniprot.org/\u003c/span\u003e\u003cspan address=\"https://www.uniprot.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases, and were used as the query sequences to search against the whole genome databases of \u003cem\u003eF. chinensis\u003c/em\u003e using the TBLASTN alignment tool (E-value\u0026thinsp;=\u0026thinsp;1e\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e). The amino acid sequences were predicted and translated from the open reading frame (ORF) using ORF Finder (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/orffinder/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/orffinder/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The results were validated by BLASTP against the NCBI non-redundant protein (NR) database. The domain architectures of the ATG in \u003cem\u003eF. chinensis\u003c/em\u003e were examined using SMART to confirm all of the family genes.\u003c/p\u003e \u003cp\u003ePhylogenetic analysis\u003c/p\u003e \u003cp\u003eThe amino acid sequences of ATG subunits from \u003cem\u003eF. chinensis\u003c/em\u003e and several representative animals were obtained from NCBI and aligned using the ClustalW program. Phylogenetic trees were constructed using the Maximum Likelihood (ML) method with a bootstrap value of 1000 in MEGA 11. The resulting tree was annotated using iTOL (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://itol.embl.de/login.cgi\u003c/span\u003e\u003cspan address=\"https://itol.embl.de/login.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBioinformatics analysis\u003c/p\u003e \u003cp\u003eTo analyse the characteristics of ATG, we predicted the amino acids, molecular weight (MW), theoretical isoelectric points (pI), instability index, and grand average of hydropathicity (GRAVY) of the ATG genes using ExPASy ProtParam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). We used SignalP 5.0 [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] to predict signal peptides and WOLF PSORT [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] to predict subcellular localization. NCBI-CDD (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to predict the conserved domain of ATG genes. The structures of ATG genes were visualized using TBtools.\u003c/p\u003e \u003cp\u003eThe WSSV infection experiment\u003c/p\u003e \u003cp\u003ePreparation of WSSV stock solution: the carapace and hepatopancreas were removed from WSSV - infected shrimp before shearing in an ice - bath environment, and 1 g tissue was collected and mixed with 10 ml phosphate - buffered saline (PBS). The mixture was homogenized at 10000 rpm for 5 s and then centrifuged at 8000 rpm for 5 min at 4\u0026deg;C. The supernatant fluid was filtered through a 0.45 \u0026micro;m microporous membrane as a virus stock solution [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. 10\u003csup\u003e3\u003c/sup\u003e-diluted-stock-solution (using pre-chilled PBS) was used in this experiment to infect healthy shrimps.\u003c/p\u003e \u003cp\u003eAfter acclimation, a total of 180 healthy \u003cem\u003eF. chinensis\u003c/em\u003e were selected for the WSSV infection experiment. The shrimps were randomly divided into two groups, with three replicates in each group and 30 shrimps in each replicate. The second abdominal segment muscle of the shrimps was injected with PBS or WSSV suspensions. The experimental group received 10 \u0026micro;L of WSSV virus suspension, while the control group was injected with 10 \u0026micro;L sterile phosphate (PBS). The injected shrimps were raised separately in aquariums. We randomly selected hepatopancreas tissues from three healthy and complete shrimps were randomly selected at 0, 3, 6, 12, 24, 36, 48, and 60 h after injection and frozen immediately in liquid nitrogen and then stored at \u0026minus;\u0026thinsp;80 ℃.\u003c/p\u003e \u003cp\u003eThe low salinity stress experiment\u003c/p\u003e \u003cp\u003eNinety healthy and energetic shrimps were randomly selected and divided into three groups, each containing 30 shrimps. The stress treatment group was subjected to low-salt stress conditions with a salinity of 15. Salinity was corrected every 6 h using with light brine during the experiment. The hepatopancreas tissues were collected after exposure to low-salinity stress at 0, 3, 6, 12, 24, 48, 72, and 96 h. Three parallel samples were taken at each time point, frozen in liquid nitrogen and then stored at \u0026minus;\u0026thinsp;80 ℃ for later use.\u003c/p\u003e \u003cp\u003eTotal RNA extraction, and cDNA synthesis\u003c/p\u003e \u003cp\u003eThe total RNA of tissues was extracted using TransZol Up (TransGen Biotech, China) following the manufacturer\u0026rsquo;s instructions. RNA concentration and integrity were measured using an Ultra-trace UV spectrophotometer (Thermo, USA) and 1.5% agarose gel electrophoresis (AGE). According to the manufacturer\u0026rsquo;s instructions, the first-strand cDNA synthesis was performed with HiScript III RT SuperMix for qPCR (+\u0026thinsp;gDNA wiper) (Vazyme, China).\u003c/p\u003e \u003cp\u003eQuantitative Real-time PCR (qRT-PCR) analysis\u003c/p\u003e \u003cp\u003eThe expressions of ATGs in different tissues of healthy \u003cem\u003eF. chinensis\u003c/em\u003e, as well as their temporal expression patterns in the hepatopancreas after WSSV infection and low-salt stress were detected by qRT - PCR. Primers were designed for each gene using Primer5 software, avoiding regions with hairpin structures as identified by Mfold at 60\u0026deg;C [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The 18S rRNA was selected as the reference gene. Primer specificity and efficiency were checked for all qPCR conditions. The primer sequences are listed in Table\u0026nbsp;2. The qRT-PCR assay was conducted using ChamQ SYBR Color qPCR master mix (Vazyme, China) in a final volume of 10 \u0026micro;l on the FAST 7500 Real-time system (FAST, USA). The reaction mixture contained ChamQ SYBR Color qPCR Master Mix (Low ROX Premixed) (Vazyme, China), forward and reverse primers (final concentration 100 nM) and 4 \u0026micro;l of diluted cDNA. The PCR reactions were initiated with a denaturation step at 95\u0026deg;C for 30 s, followed by 40 cycles of two-step amplification as follows: denaturation at 95\u0026deg;C for 10 s, annealing at 60\u0026deg;C for 30 s. Fluorescence data were acquired during the final step. Gene-specific amplification was confirmed by a single peak in the melting curve analysis. Three technical repeats were performed for each biological repeat. The data was analysed using FAST 7500 software, and the relative expression ratio was calculated using 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Statistical analysis was performed using SPSS 19.0. A One-Way ANOVA was exerted to compare the differences between groups. Finally, GraphPad Prism was used for scientific graphing.\u003c/p\u003e \u003cp\u003eTable 2 The primers used in this research\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePurpose\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG1-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCTTATGGAGCGAGAGCACAATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG1-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGAGAGCGAGCCAATTCAAGGATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG2-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGCAAGTTGGTAGGAGGTGTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG2-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTGAGCCGATGAAGTTGTGAATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG3-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCGCCGAGTATCTTACGCCAATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG3-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGGACAGTGATGAACCAAGTGATCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG4B-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCAGCCTTGCGGAGTGATGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG4B-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCAGCCCTTGTCAGATGTAAAGTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG4D-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTGGAGGCATGAGCGTGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG4D-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGGCACTGGGTCTACTGGGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG5-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eATGATGCTGAGATGTGGTTGGAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG5-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGTGGGAGAAGTGGGCTGTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG6-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCACCATCAACAACCTCCGCTTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG6-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;CGGTGCTTGGAGAACTTCAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG7-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGCAACCAGCCAGTACCTCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG7-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGACGCTCCAGCAGACTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG8-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGGGCAGAGGGAGAGAAGATTAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG8-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTTGTCAAGATCGCCGATTCGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG8B-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGGAGTTTCGCCCAGAGACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG8B-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eATACCGCTCAATAATCACAGGAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG9A-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCACGCCGCTCATTCTCATCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG9A-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCCCACGCCTACAACCTCTACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG10-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCTGACGCAGCAAGAGCATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG10-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAACCAGCTTATCATGTACCTTAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG12-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGAATAAACACACAGCCGCCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG12-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGTACCTGCGTATGAATTCTGCTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG13-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCAGCAACAGCAACAGCAACAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG13-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGGGAATATCGGGCAGGAAGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG14-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAGACACAGTATCGCATTGTTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG14-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTTCTCCATCACTCTCCTCACACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcVPS15-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCGGCAGTGGTGGCGAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcVPS15-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGCAGGCATGAGAGGATACATACTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG16-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTTAACTTAGCCTTCACTGCCTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG16-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTGTGTCATTCTCCAGGTTCAACTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG17-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCATTGACTATGGCTCCGACACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG17-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGCTGCTGGCATATTCTCGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG18-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTTCCTCATCGCCTCCTCCAATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG18-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGGCTGCTCCTCTACCACTACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG101-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eAAGGCAGGCAGGTGGATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFcATG101-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eCTATGGTTCCAACGGCGTATGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFc18S-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eTATACGCTAGTGGAGCTGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eFc18S-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"61.371841155234655%\" valign=\"top\"\u003e\n \u003cp\u003eGGGGAGGTAGTGACGAAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.425992779783392%\" valign=\"top\"\u003e\n \u003cp\u003ePCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGCH conducted analysis and wrote the draft of manuscript. GCH, LYL, WJJ, WQ and TCJ performed data analysis. LZX and HYY conceived and designed the experiments, reviewed, and edited the writing of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China [Grant No. 42376111], National Key R \u0026amp; D Program of China [No. 2022YFD2400104-03], China Agriculture Research System of MOF and MARA [No. CARS-48], Central Public-interest Scientific Institution Basal Research Fund, CAFS [No. 2023TD50] and \u0026lsquo;First Class Fishery Discipline\u0026rsquo; program in Shandong Province, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence information of \u003cem\u003eFenneropenaeus chinensis\u0026nbsp;\u003c/em\u003eATG family genes were collected from \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e genome to Breeding Database (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_019202785.1/), and the ATG protein sequences of \u003cem\u003eMus musculus\u003c/em\u003e, \u003cem\u003ePenaeus monodon,\u003c/em\u003e \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e, \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e, \u003cem\u003eBombyx mori\u003c/em\u003e, and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e et al. were downloaded from the NCBI website (https://www.ncbi.nlm.nih.gov/). All data used during the current study are included in this published article and its supplementary information files or available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Guidelines for the Care and Use of Laboratory Animals in China were followed when carrying out all the experiments. The Institutional Animal Care and Use Committee (IACUC) of the Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (Qingdao, China), approved the study, the study is reported in accordance with ARRlVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKlionsky DJ, Ohsumi Y. Vacuolar import of proteins and organelles from the cytoplasm. Annual Rev Cell Dev Biology. 1999;15(1):1\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMizushima N, Yoshimori T, Ohsumi Y. The role of ATG proteins in autophagosome formation. Annu Rev Cell Dev Biol. 2011;27:107\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoda NN, Fujioka Y. \u003cem\u003eAtg1\u003c/em\u003e family kinases in autophagy initiation. Cell Mol Life Sci. 2015;72(16):3083\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia Maurino S, Alcaide A, Dominguez C. Pharmacological control of autophagy: therapeutic perspectives in inflammatory bowel disease and colorectal cancer. Curr Pharm Design. 2012;18(26):3853\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiang L, Sample A, Shea CR, Soltani K, Macleod KF, He Y. Autophagy gene \u003cem\u003eATG7\u003c/em\u003e regulates ultraviolet radiation-induced inflammation and skin tumorigenesis. Autophagy. 2017;13(12):2086\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Dong JL, Wang T. Autophagy in plant abiotic stress management. Int J Mol Sci. 2021;22(8):954\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu JY, Wang YJ, Jiao JL, Wang HZ. Silencing of \u003cem\u003eATG2\u003c/em\u003e and \u003cem\u003eATG7\u003c/em\u003e promotes programmed cell death in wheat via inhibition of autophagy under salt stress. Ecotoxicol Environ Saf. 2021;225:112761.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun X, Wang P, Jia X, Huo L, Che RM, Ma F. Improvement of drought tolerance by overexpressing \u003cem\u003eMdATG18a\u003c/em\u003e is mediated by modified antioxidant system and activated autophagy in transgenic apple. Plant Biotechnol. 2018;16(2):545\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFumihiko T, Kouji K, Atsushi M, Nao J, Kenji O. The non-canonical role of Atg family members as suppressors of innate antiviral immune signaling. Autophagy. 2008;4(1):67\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu JX, Meng FJ, Zhang GC. Cloning of \u003cem\u003eATG6\u003c/em\u003e in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e and research on its expression under WSSV infection. J Anhui Agricultural Sci. 2018;46(12):107\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang MZ, Kong J, Meng XH, Luan S, Luo K, Sui J, Chen BL, Cao JW, Shi XL, Zhang Q. Evaluation of genetic parameters for growth and cold tolerance traits in \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e juveniles. PLoS ONE. 2017;12(8):e0183801.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Ren XY, Liu P, Li JT, Lv JJ, Wang JJ, Zhang HE, Wei W, Zhou YX, He YY. Improved genome assembly of Chinese shrimp (\u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e) suggests adaptation to the environment during evolution and domestication. Mol Ecol Resour. 2021;22(1):334\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe YY, Wang Q, Li J, Li ZX. Comparative proteomic profiling in Chinese shrimp \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e under low pH stress. Fish Shellfish Immunol. 2021;120:526\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Moullac G, Haffner P. Environmental factors affecting immune responses in Crustacea. Aquaculture. 2000;191(1):121\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Cai SL, Song XL, Wang CM, Yu J, Yang CH. Study on artificial infection for \u003cem\u003epenaeus chinensis\u003c/em\u003e by the pathogen of the explosive epidemic disease of shrimp. Mar Fisheries Reseach. 1995;16(1):51\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo CF, HO CH, peng SE, Chen CH, Chen H, Lin Y, Chang CF, Fu K, Su MS, Wang CH, et al. White spot syndrome baculovirus (WSBV) detected in cultured and captured shrimp, crabs and other arthropods. Dis Aquat Organ. 1996;27(3):215\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Hulten MCW, Witteveldt J, Peters S, Kloosterboer N, Tarchini R, Fiers M, Sandbrink H, Lankhorst RK, Vlak JM. The white spot syndrome Virus DNA genome sequence. Virology. 2001;286(1):7\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi XP, Luan S, Luo K, Cao BX, Chen BL, Kong J, Meng XH. Comparative transcriptomic analysis of Chinese shrimp \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e infected with white spot syndrome virus. Aquaculture Rep. 2022;22:100986.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe YY, Li ZX, Zhang HE, Hu S, Wang QY, Li J. Genome-wide identification of Chinese shrimp (\u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e) microRNA responsive to low pH stress by deep sequencing. Cell Stress \u0026amp; Chaperones. 2019;24(4):689\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang W, Liu C, Xu QS, Qu C, Sun J, Huang S, Kong N, Lv XJ, Liu ZQ, Wang LL et al. \u003cem\u003eBeclin-1\u003c/em\u003e is involved in the regulation of antimicrobial peptides expression in Chinese mitten crab \u003cem\u003eEriocheir sinensis\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology. 2019;89:207\u0026ndash;216.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ.Klionsky RPK. An overview of autophagy: morphology, mechanism, and regulation. Mary Ann Liebert. 2014;20(3):460\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLerner E, Kimchi. The paradox of autophagy and its implication in cancer etiology and therapy. Apoptosis. 2009;14(4):376\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalati S, Boni C, Gerra MC, Lazzaretti M, Buschini A. Autophagy: a player in response to oxidative stress and DNA damage. Oxidative Med Cell Longev. 2019;2019:5692958.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrittany E, Nimrod M, Chao M. Impaired autophagy and defective mitochondrial function:converging paths on the road to motor neuron degeneration. Front Cell Neurosci. 2016;10(44):00044.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacob JA, Mohammad JM, Salmani, Jiang Z, Feng L, Song J, Jia X, Chen B. Autophagy: An overview and its roles in cancer and obesity. Clin Chim Acta. 2017;468:85\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu MR, Zhan M, Xi CJ, Gong J, Shen HS. Molecular characterization and expression of the autophagy-related gene \u003cem\u003eAtg14\u003c/em\u003e in WSSV-infected \u003cem\u003eProcambarus clarkii\u003c/em\u003e. Fish Shellfish Immunol. 2022;125:200\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Zhao YJ, Zhao X, Dong J, Yuan Z. Identification of ATG gene family of \u003cem\u003ePunica granatum\u003c/em\u003e and analysis on their expression pattern under abiotic stress. J Plant Resour Environ. 2022;31(5):37\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang HZ, Zhu L, Zuo ZY, Liu WH, Xu J. Prediction of the function of autophagy-related genes (ATGs) in development and abiotic stress based on expression profiling in \u003cem\u003eArabidopsi\u003c/em\u003e. Genomics And Applied Biology. 2020;39(6):2671\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun SM, Chen YX, Zheng C, Zhao QQ, Xue C. Cloning and expression analysis of autophagy genes \u003cem\u003eATG13\u003c/em\u003e and \u003cem\u003eATG101\u003c/em\u003e in \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e under hypoxic stress. J Fisheries China. 2021;45(6):846\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin WJ, Liu F, Meng FJ, Zhang GC, Wang LY, Sun JS. Cloning of \u003cem\u003eATG3\u003c/em\u003e in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e and research on its expression under WSSV infection. J Tianjin Normal University(Natural Sci Edition). 2021;41(2):51\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W. Mechanism of miR-7562 mediated \u003cem\u003eATG5-ATG12\u003c/em\u003e conjugation system in response to Vibrio harveyi stress in \u003cem\u003ePenaeus monodon\u003c/em\u003e. Shanghai, China: Shanghai Ocean University; 2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe L, Ruan JM, Liu Y, Fu JP, Liu L, Wei LL. Cloning of \u003cem\u003ebeclin1\u003c/em\u003e, an autophagy gene, and it's expression under microcystinlr stress in grass carp (\u003cem\u003eCtenopharygodon idella\u003c/em\u003e). Acta Hydrobiol Sin. 2019;43(3):479\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei CC, Luo Z, Song YF, Pan YX, Wu K, You WJ. Identification of autophagy related genes \u003cem\u003eLC3\u003c/em\u003e and \u003cem\u003eATG4\u003c/em\u003e from yellow catfish \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e and their transcriptional responses to waterborne and dietborne zinc exposure. Chemosphere. 2018;175:228\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuwansa Ard S, Kankuan W, Thongbuakaew T, Saetan J, Kornthong N, Kruangkum T, Khornchatri K, Cummins SF, Isidoro C, Sobhon P. Transcriptomic analysis of the autophagy machinery in crustaceans. BMC Genomics. 2016;17:1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe H, Dang YJ, Dai FY, Guo ZK, Wu JX, She XY, Pei Y, Chen YJ, Ling WH, Wu CQ, et al. Post-translational modifications of three members of the human \u003cem\u003eMAP1LC3\u003c/em\u003e family and detection of a novel type of modification for \u003cem\u003eMAP1LC3B\u003c/em\u003e. J Biol Chem. 2003;278(31):29278\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu JX, Dang YJ, Su W, Liu C, Ma HJ, Shan YX, Pei Y, Wan B, Guo JH, Yu L. Molecular cloning and characterization of rat \u003cem\u003eLC3A\u003c/em\u003e and \u003cem\u003eLC3B\u0026ndash;t\u003c/em\u003ewo novel markers of autophagosome. Biochem Biophys Res Commun. 2006;339(1):437\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang JR. \u003cem\u003eBeclin 1\u003c/em\u003e bridges autophagy, apoptosis and differentiation. Autophagy. 2008;4(7):947\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang H, Da L, Mao Y, Li Y, Li D, Xu ZH, Li F, Wang YF, Tiollais P, Li T, et al. Hepatitis B virus X protein sensitizes cells to starvation-induced autophagy via up‐regulation of \u003cem\u003ebeclin 1\u003c/em\u003e expression. Hepatology. 2009;49(1):60\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong HJ, Moon J, Nam B, Kim Y, Kim W, Lee J, Kim K, Kim B, Yeo S, Lee CH, et al. Molecular characterization of the autophagy-related gene \u003cem\u003eBeclin-1\u003c/em\u003e from the olive flounder (\u003cem\u003eParalichthys olivaceus\u003c/em\u003e). Fish Shellfish Immunol. 2011;31(2):189\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Li FF, Sun HJ, Wang YF, Yu GH, Wang FL, Qian YM. Tobacco mosaic virus infection on tobacco plants induces autophagy. Acta Phytopathologica Sinica. 2016;46(6):42\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKroemer G, Mari\u0026ntilde;o G, Levine B. Autophagy and the integrated stress response. Mol Cell. 2010;40(2):280\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMari\u0026ntilde;o G, Santano MN, Baehrecke EH, Kroemer G. Self-consumption: the interplay of autophagy and apoptosis. Nat Rev Mol Cell Biol. 2014;15(2):81\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong WN, Liao MQ, Zhuang XQ, Huang L, Liu C, Wang FF, Yin XL, Liu Y, Liang QJ, Wang WN. MYC drives autophagy to adapt to stress in \u003cem\u003ePenaeus vannamei\u003c/em\u003e. Fish Shellfish Immunol. 2022;126:187\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei W, He YY, Li ZX, Zhou YX, Li J. Cloning of \u003cem\u003eATG5\u003c/em\u003e gene of \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e and expression analysis under pH and carbonate alkalinity stress. Progress In Fishery Sciences. 2022;43(3):84\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe YY, Li ZX, Zhang HE, Hu S, Wang QY, Li J. Genome-wide identification of Chinese shrimp (\u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e) microRNA responsive to low pH stress by deep sequencing. Cell Stress and Caperones. 2019;24(4):689\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang ZG, Zhang XD, Tang SL, Li HY. Research progress of autophagy on regulation of energy metabolism in tumor cells. Chin J Bases Clin Gen Surg. 2015;22(12):1525\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArmenteros JJA, Tsirigos KD, S\u0026oslash;nderby CK, Petersen TN, Winther O, Brunak S, Heijne Gv, Nielsen H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol. 2019;37(4):420\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorton P, Keun Joon Park, Obayashi T, Naoya Fujita, Harada H, Collier CJA, Nakai K. Wolf Psort protein localization predictor. Nucleic Acids Res. 2007;35(Web Server Issue):585\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Song XL, Zhang YJ. The components of an inorganic physiological buffer for \u003cem\u003ePenaeus chinensis\u003c/em\u003e. Methods Cell Sci. 1999;21(4):225\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichael Z. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003;31(13):3406\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmittgen TD, Livak KJ, Schmittgen TD. Livak KJAnalyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Fenneropenaeus chinensis, autophagy, WSSV, low-salt stress","lastPublishedDoi":"10.21203/rs.3.rs-3871880/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3871880/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAutophagy is a conserved catabolic process in eukaryotes that contributes to cell survival in response to multiple stresses and is important for organism fitness. Extensive research has shown that autophagy plays a pivotal role in both viral infection and replication processes. Despite the increasing research dedicated to autophagy, investigations into shrimp autophagy are relatively scarce.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eBased on three different methods, a total of 20 members of the ATGs were identified from \u003cem\u003eF. chinensis\u003c/em\u003e, all of which contained an autophagy domain. These genes were divided into 18 subfamilies based on their different C-terminal domains, and were found to be located on 16 chromosomes. Quantitative real-time PCR (qRT-PCR) results showed that ATG genes were extensively distributed in all the tested tissues, with the highest expression levels were detected in muscle and eyestalk. To clarify the comprehensive roles of ATG genes upon biotic and abiotic stresses, we examined their expression patterns. The expression levels of multiple ATGs showed an initial increase followed by a decrease, with the highest expression levels observed at 6 h and/or 24 h after WSSV injection. The expression levels of three genes (ATG1, ATG3, and ATG4B) gradually increased until 60 h after injection. Under low-salt conditions, 12 ATG genes were significantly induced, and their transcription abundance peaked at 96 h after treatment.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThese results suggested that ATG genes may have significant roles in responding to various environmental stressors. Overall, this study provides a thorough characterization and expression analysis of ATG genes in \u003cem\u003eF. chinensis\u003c/em\u003e, laying a strong foundation for further functional studies and promising potential in innate immunity.\u003c/p\u003e","manuscriptTitle":"Genome-wide identification of ATG genes and their expression profiles under biotic and abiotic stresses in Fenneropenaeus chinensis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-25 11:42:42","doi":"10.21203/rs.3.rs-3871880/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-17T10:18:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-08T13:52:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"253687399006906493929055164262990772363","date":"2024-04-29T02:22:45+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-19T16:36:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"1b8060bd-c6be-4410-8808-ecc58228ad32","date":"2024-02-01T06:57:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-27T13:37:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-27T13:29:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-01-24T06:57:08+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-24T06:49:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2024-01-17T04:58:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2e6c9c6f-2f9a-4769-81ee-826337c28387","owner":[],"postedDate":"January 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-06-21T15:48:47+00:00","versionOfRecord":{"articleIdentity":"rs-3871880","link":"https://doi.org/10.1186/s12864-024-10529-2","journal":{"identity":"bmc-genomics","isVorOnly":false,"title":"BMC Genomics"},"publishedOn":"2024-06-20 15:48:47","publishedOnDateReadable":"June 20th, 2024"},"versionCreatedAt":"2024-01-25 11:42:42","video":"","vorDoi":"10.1186/s12864-024-10529-2","vorDoiUrl":"https://doi.org/10.1186/s12864-024-10529-2","workflowStages":[]},"version":"v1","identity":"rs-3871880","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3871880","identity":"rs-3871880","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.