Supplementation of Rhodotorula paludigena CM33 in Feed as Probiotic Enhances Growth, Immunity, Gene Expression, and Disease Resistance to Aeromonas hydrophila in Red tilapia (Oreochromis niloticus × O. mossambicus)

Supplementation of Rhodotorula paludigena CM33 in Feed as Probiotic Enhances Growth, Immunity, Gene Expression, and Disease Resistance to Aeromonas hydrophila in Red tilapia (Oreochromis niloticus × O. mossambicus) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Supplementation of Rhodotorula paludigena CM33 in Feed as Probiotic Enhances Growth, Immunity, Gene Expression, and Disease Resistance to Aeromonas hydrophila in Red tilapia ( Oreochromis niloticus × O. mossambicus ) Nguyen Vu Linh, Luu Tang Phuc Khang, Nguyen Dinh-Hung, Suwanna Wisetkaew, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6568606/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Dietary supplementation with red yeast (RY) has been proposed to enhance immunity and disease resistance in fish; however, its effects in red tilapia remain underexplored. This study evaluated the impact of Rhodotorula paludigena CM33 on growth performance, immune responses, liver and intestinal histology, gene expression, and resistance to Aeromonas hydrophila in red tilapia. A total of 300 fish were assigned to five dietary groups: RY-0 (control), RY-5 (5 g/kg), RY-10 (10 g/kg), RY-20 (20 g/kg), and RY-40 (40 g/kg). Growth performance was assessed at weeks 4 and 8. At week 8, blood serum, liver, and intestinal samples were collected for histological and gene expression analyses. Fish were then challenged with A. hydrophila at an LD₅₀ dose of 10⁵ CFU/fish via intraperitoneal injection. Results showed that R. paludigena CM33 significantly improved growth performance, with polynomial regression identifying ~ 24 g/kg as optimal, and experimental fish fed 20 g/kg achieved the highest weight, gain, and feed efficiency. Antioxidant and immune responses were enhanced, as evidenced by increased ABTS radical scavenging activity, superoxide dismutase activity, and upregulation of immune-related and antioxidant genes ( IL1, MHC, LBP, GSR, GPX, IGF, HSP70 , and TNF ). Histological analysis revealed enhanced intestinal structure and hepatocyte integrity, with RY-20 fish exhibiting elongated villi and reduced hepatic vacuolation compared to the control. Kaplan-Meier survival analysis confirmed greater resistance to A. hydrophila at the 20 g/kg inclusion level. These findings highlight R. paludigena CM33 as a promising dietary supplement for enhancing growth, immune function, and disease resistance in red tilapia. Aquaculture and Mariculture Aeromonas hydrophila dietary supplement immune enhancement Rhodotorula paludigena CM33 red tilapia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Tilapia farming is a cornerstone of global aquaculture, with production spanning more than 75% of countries [ 1 ]. Among tilapia species, red tilapia, a hybrid of Oreochromis niloticus and O. mossambicus , is particularly valued for its superior market price, salinity tolerance, and resilience during handling and transportation [ 2 ]. These attributes, combined with its rapid growth and adaptability to diverse environmental conditions, underscore its significance as a major aquaculture commodity. The shift from semi-intensive to high-input intensive systems, which rely on high-quality, processed feeds, however, has increased species’ susceptibility to stress and disease, presenting new challenges for sustainable production [ 3 , 4 ]. The intensification of aquaculture, along with suboptimal management practices, has contributed to a rise in infectious disease outbreaks, particularly among juvenile fish, which are highly vulnerable to pathogenic infections [ 5 – 7 ]. Among these pathogens, Aeromonas hydrophila is a ubiquitous freshwater bacterium frequently associated with severe disease outbreaks, leading to considerable economic losses and threatening the sustainability of aquaculture operations [ 8 , 9 ]. Traditionally, antibiotics have been the primary strategy for disease control due to their rapid efficacy and accessibility [ 10 ]. The indiscriminate use of antibiotics, however, has raised serious concerns regarding antimicrobial resistance, environmental contamination, and the accumulation of drug residues in fish intended for human consumption [ 10 , 11 ]. In response to these challenges, there is growing interest in alternative strategies that enhance the innate immune responses of fish. Nutritional interventions, particularly the incorporation of probiotics and functional food additives, have emerged as promising approaches to improve disease resistance while mitigating the adverse effects of antibiotic use [ 12 – 15 ]. Yeast-based supplements, rich in proteins, vitamins, minerals, and immunomodulatory compounds such as β-glucan, nucleotides, and mannan oligosaccharides, have demonstrated efficacy in promoting growth performance, enhancing immune responses, and improving disease resistance in a variety of aquatic species [ 16 – 20 ]. Among them, red yeasts of the genus Rhodotorula , characterized by their distinctive pigmentation due to carotenoid production, have gained attention not only for their biotechnological applications in biofuel production [ 21 ] but also for their potential as probiotic dietary supplements in aquaculture. Notably, Rhodotorula paludigena CM33, isolated from castor beans, has demonstrated promising effects in previous studies involving aquatic species such as flowerhorn fish and shrimp [ 22 , 23 ], where its supplementation resulted in improved growth, enhanced immune responses, and increased disease resistance. However, its application in tilapia remains largely unexplored. To address this knowledge gap, the present study investigated the effects of R. paludigena CM33 supplementation in red tilapia (Fig. 1 ), specifically examining growth performance, immune parameters, gene expression, and resistance to A. hydrophila . 2. Materials and methods 2.1. Production of Rhodotorula paludigena CM33 and diet preparation Rhodotorula paludigena CM33 was obtained from the Institute of Agricultural Technology, Suranaree University of Technology, Nakhon Ratchasima, Thailand. The red yeast CM33 was cultured according to the protocol described by Kaewda et al [ 22 ]. Specifically, yeast peptone dextrose (YPD) medium, composed of 20 g/L glucose, 10 g/L yeast extract, and 10 g/L peptone, was used for cultivation [ 22 ]. Five experimental diets were formulated, consisting of a control diet without red yeast and four diets supplemented with R. paludigena CM33 at inclusion levels of 5, 10, 20, and 40 g/kg. All feed ingredients were finely ground and mixed with soybean oil and water to form a uniform dough, which was extruded into pellets, dried at 50°C and stored at 4°C until use. The proximate composition of the experimental diets was determined following standardized methods outlined by the Association of Official Analytical Chemists [ 24 ]. Additionally, crude fat was analyzed using a Soxtec™ 8000 extractor (Denmark), as shown in Table 1 . Table 1 Ingredient composition of experimental diets supplemented with different levels of red yeast (g/kg on dry matter basis) Ingredients RY levels (g/kg diet) 0 (control) 5 10 20 40 Fish meal 360 360 360 360 360 Soybean meal 400 395 390 380 390 Corn meal 70 70 70 70 70 Rice bran 40 40 40 40 40 Wheat flour 80 80 80 80 80 Lecithin 7 7 7 7 7 Methionine 5 5 5 5 5 Lysine 5 5 5 5 5 Soybean oil 5 5 5 5 5 Red yeast 0 5 10 20 40 Premix 10 10 10 10 10 Vitamin C 98% 8 8 8 8 8 Proximate (%) Dry matter 6.35 6.85 6.67 6.81 6.77 Ash 11.25 11.27 11.28 11.29 11.28 Fiber 3.49 3.81 3.53 3.76 3.88 Crude lipid 3.20 3.23 3.22 3.23 3.25 Crude protein 34.59 34.62 34.65 34.81 34.71 Nitrogen-free extract 47.47 47.07 47.32 46.24 46.88 2.2. Experimental fish and feeding management Healthy red tilapia was obtained from a commercial fish hatchery in Chiang Mai, Thailand, with no prior history of infection outbreaks. The fish were acclimated to experimental conditions by feeding them a commercial diet for four weeks before initiating the trial. Following this acclimation period, the fish were transitioned to a basal diet for an additional two weeks to standardize their nutritional status. A total of 300 fish, with an average weight of 27.71 ± 0.06 g, were randomly distributed among 15 tanks, each containing 180 L of water. The experiments consisted of five treatment groups (RY-0, RY-5, RY-10, RY-20, and RY-40), as detailed in Table 1 , each with three replicates. A biofloc system was established three weeks before the start of the experimental period by inoculating the water with 2 g of wheat flour, 400 g of salt, 5 g of dolomite, and 5 g of molasses [ 25 , 26 ]. Following the methodology described by Avnimelech [ 27 ], the carbon-to-nitrogen ratio was maintained at 15:1 by daily supplementation of molasses containing 40% carbon. The feeding trial lasted for eight weeks, during which the fish were fed twice daily (i.e., 8:30 a.m. and 4:30 p.m.) at approximately 3% of their body weight. Feed intake was accurately determined by collecting and freeze-drying any uneaten feed, then subtracting this from the total amount initially provided. Water quality parameters were monitored daily and maintained within optimal ranges: temperature between 24.5 and 32.6°C, dissolved oxygen at or above 5.0 mg/L, total ammonia nitrogen below 0.08 mg/L, and pH between 7.0 and 8.2 [ 28 ]. Regular monitoring ensured a stable biofloc environment conducive to the healthy growth of the fish. 2.3. Sample collection and evaluation of growth performance and histology Growth data were at two-week intervals throughout the experiment. Prior to each measurement, fish were fasted for 24 hours to standardize their metabolic state. Fish each replicate tank were batch-weighed and counted to determine final weight (FW), weight gain (WG), daily weight gain, specific growth rate (SGR), and feed conversion ratio (FCR). The equations were as follows: Weight gain (WG) = Final weight – Initial weight Daily weight gain (DWG, g/day) = (Final weight – Initial weight) / Days of culture Specific growth rate (SGR, %/day) = [(Loge Final body weight – Loge Initial body weight) / Culture days] × 100 Feed conversion ratio (FCR) = Dry feed fed / Live weight gain At the conclusion of the 60-day feeding trial, three fish from each replicate tank were randomly selected and anesthetized with 200 mg/L clove oil before for blood and tissue collection. Blood samples were collected from the caudal vein using a 1-mL syringe, allowed to clot at 4°C for 4 hours, and then centrifuged at 1000 x g for 10 minutes at 4°C for antioxidant analyses. Intestinal tissue samples (approximately 50 mg) were placed in sterile tubes containing 200 µL of TRIzol™ reagent (Invitrogen™) and stored at -80°C for subsequent gene expression analysis. Additionally, midgut and liver tissue samples were preserved in 10% neutral buffered formalin. After 24 hours, the samples were transferred to 70% ethanol and subsequently processed for routine histopathology analysis. Tissue samples were embedded in paraffin, sectioned into 5 µm slices, and stained with hematoxylin and eosin (H&E). The slides were examined and photographed using a digital light microscope. 2.4. Serum antioxidant activities Serum antioxidant capacity was quantified using the ABTS radical scavenging assay, following the protocol detailed by Boonkong et al [ 29 ], with measurements performed at a wavelength of 734 nm. Concurrently, serum superoxide dismutase (SOD) activity was assessed using a commercial assay kit (CS0009, Sigma-Aldrich) according to the manufacturer's instructions. Absorbance was measured at 450 nm using a Varioskan LUX microplate reader (Thermo Scientific, Vantaa, Finland). Additionally, lipid peroxidation was evaluated by determining malondialdehyde (MDA) utilizing a commercially available assay kit (KTB1050, Abbkine). In this assay, MDA reacts with thiobarbituric acid (TBA), forming a chromogenic complex measurable at 532 nm. To correct for potential interference, absorbance at 600 nm was also recorded. Final MDA concentrations (nM/mL) were calculated by subtracting the absorbance at 600 nm from that at 532 nm and interpolating the resultant values against a standard curve [ 30 ]. 2.5. Gene expression Tissue samples were homogenized using a Bullet Blender® Homogenizer (Missing Lid, USA), and subsequently incubated at room temperature for 2–3 minutes. Chloroform (100 µL) was then added to the homogenate, followed by a 2-minute incubation. The mixture was centrifuged at 12,000 rpm at 4°C for 15 minutes and RNA was extracted from the aqueous phase using a Total RNA extraction kit (Omega Bio-tek, USA), following the manufacturer's instructions. RNA concentration and purity were measured using a NanoDrop™ One/OneC (Thermo Fisher Scientific). Complementary DNA (cDNA) was synthesized from 1 µg of RNA using a cDNA synthesis kit (BIO-RAD, USA). Real-time PCR was performed in a 20 µL reaction volume containing 100 ng of cDNA (1 µL), 0.4 µL of each 10 µM primer, and 10 µL of 2× iTaq Universal SYBR Green supermix (BIO-RAD, USA). Amplifications were conducted using a CFX Connect™ real-time system (BIO-RAD, USA) under following cycling protocol: initial denaturation 95°C for 30 seconds, followed by 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds [ 31 ]. A melt curve analysis was performed with the following steps: 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds. Gene expression levels were quantified using the 2 −ΔΔCt method [ 32 ] and normalized to 18S rRNA as the reference gene. All primer sequences used in the study are provided in Table 2 . Table 2 Primers used for qPCR in this study Target gene Sequence (5′–3′) 18S rRNA F: ACCAGCTGGATTTGTCAGAAG R: ACATACTGAATTGAACTTTG IL-1 F: GTCTGTCAAGGATAAGCGCTG R: ACTCTGGAGCTGGATGTTGA TNFα F: CTTCCCATAGACTCTGAGTAGCG R: GAGGCCAACAAAATCATCATCCC MHC F: ATGTCCAAGCTGCTGAAGATT R: TGCCGTCTGACTTCTTCACC LBP F: ACCAGAAACTGCGAGAAGGA R: GATTGGTGGTCGGAGGTTTG HSP70 F: TGGAGTCCTACGCCTTCAACA R: CAGGTAGCACCAGTGGGCAT IGF F: AGTTTGTCTGTGGAGAGCGAG R: GTGTGCCGCTGTGAACG GPX F: GGTGGATGTGAATGGAAAGG R: CTTGTAAGGTTCCCCGTCAG GSR F: CTGCACCAAAGAACTGCAAA R: CCAGAGAAGGCAGTCCACTC 2.6. Aeromonas hydrophila challenge The A. hydrophila strain used in this study was obtained from Scientific Laboratory and Equipment Center (SLEC), Prince of Songkla University, Surat Thani campus, Thailand. The bacterial culture was grown in brain heart infusion (BHI) broth and incubated at 30°C for 24 hours with constant shaking at 250 rpm. Prior to the bacterial challenge, fish were anesthetized with clove oil at a concentration of 200 mg/L. They were then intraperitoneally injected with a bacterial suspension at a final concentration determined by the median lethal dose (LD₅₀) of 10⁵ CFU/mL, as reported by Azzam-Sayuti et al [ 33 ]. Fish in the control group were similarly injected intraperitoneally with sterile BHI broth. The pathogen challenge trial was conducted over 14 days, during which clinical signs and mortality were monitored and recorded daily. 2.7. Statistical analysis Data normality was assessed using the Shapiro-Wilk test, and differences between treatments were subsequently analyzed with ANOVA and Duncan's multiple range test in SPSS (Version 29.0.2.0, IBM Corp., Armonk, NY, USA). The optimal level of R. paludigena CM33 was determined through polynomial regression analysis [ 34 ]. In addition, fish survival during the 14-day post-observation period following A. hydrophila injection was evaluated using Kaplan–Meier survival curves and Log-rank tests. Pearson correlation analysis was employed to examine the relationships between growth performance, antioxidant activities, and gene expression. Results are presented as mean ± standard deviation, while graphs and data visualizations were generated using Origin Pro (Version 2021b). Statistical significance was set at p ≤ 0.05. 3. Results 3.1. Growth performance and polynomial regression analysis Growth indicators of red tilapia fed diets supplemented with R. paludigena CM33 showed consistent improvements over the eight-week trial (Table 3 ). FW, WG, PWG, SGR, and DWG increased significantly as supplementation increased from 0 to 20 g/kg, peaking at 20 g/kg. However, these parameters declined slightly at 40 g/kg, suggesting a threshold effect. Table 3 Growth performance and feed efficiency of red tilapia ( Oreochromis niloticus x O. mossambicus ) fed diets supplemented with Rhodotorula paludigena CM33 over an eight-week feeding trial Parameter RY-0 RY-5 RY-10 RY-20 RY-40 Initial weight (g) 21.67 ± 0.03 21.73 ± 0.03 21.77 ± 0.10 21.7 ± 0.05 21.7 ± 0.05 Week 4 Survival rate (%) 100.00 ± 0.00 98.33 ± 2.89 98.33 ± 2.89 100.00 ± 0.00 98.33 ± 2.89 Final weight (g) 43.12 ± 1.76 c 43.8 ± 1.85 bc 44.33 ± 1.46 ab 45.32 ± 0.63 a 43.39 ± 1.08 bc Weight gain (g) 21.45 ± 1.78 c 22.06 ± 1.86 bc 22.57 ± 1.40 ab 23.62 ± 0.67 a 21.69 ± 1.03 bc Percent weight gain (%) 99.01 ± 8.33 c 101.53 ± 8.54 bc 103.67 ± 6.16 ab 108.84 ± 3.33 a 99.94 ± 4.54 bc Percentage specific growth rate (%.day − 1 ) 2.29 ± 0.14 c 2.33 ± 0.14 bc 2.37 ± 0.10 b 2.45 ± 0.05 a 2.31 ± 0.08 bc Daily weight gain (g.day − 1 ) 0.50 ± 0.18 0.39 ± 0.03 0.40 ± 0.02 0.42 ± 0.01 0.39 ± 0.02 FCR 0.79 ± 0.01 0.80 ± 0.02 0.80 ± 0.02 0.79 ± 0.01 0.80 ± 0.02 Week 8 Survival rate (%) 100.00 ± 0.00 96.67 ± 2.89 100.00 ± 0.00 96.67 ± 2.89 98.33 ± 2.89 Final weight (g) 70.80 ± 6.02 c 79.75 ± 0.64 b 85.20 ± 0.45 b 92.37 ± 1.71 a 82.46 ± 1.81 b Weight gain (g) 49.13 ± 6.04 c 58.01 ± 0.67 b 63.43 ± 0.44 b 70.67 ± 1.71 a 60.76 ± 1.85 b Percent weight gain (%) 226.79 ± 28.07 c 266.93 ± 3.43 b 291.43 ± 2.44 b 325.65 ± 7.79 a 280.01 ± 9.06 b Percentage specific growth rate (%.day − 1 ) 3.94 ± 0.28 c 4.33 ± 0.03 b 4.55 ± 0.02 b 4.83 ± 0.06 a 4.45 ± 0.08 b Daily weight gain (g.day − 1 ) 0.88 ± 0.11 c 1.04 ± 0.01 b 1.13 ± 0.01 b 1.26 ± 0.03 a 1.08 ± 0.03 b FCR 1.19 ± 0.53 0.84 ± 0.04 0.72 ± 0.01 0.75 ± 0.01 0.81 ± 0.04 Data are mean ± SE, different letters in a row indicate significant differences between treatments (p < 0.05). The RY-20 treatment resulted in the highest growth performance, significantly outperforming all other groups (p < 0.05). Compared to the control, RY-20 showed increases of 1.3-fold in FW, 1.44-fold in WG and PWG, 1.22-fold in SGR, and 1.43-fold in DWG, identifying 20 g/kg as the optimal inclusion level. FCR was lowest in the RY-10 and RY-20 groups and highest in the control, though differences among groups were not statistically significant. Polynomial regression analysis determined the optimal dietary inclusion levels for key parameters: FW peaked at 23.14 g/kg (adjusted R² = 0.88, Fig. 2 A), SGR at 23.77 g/kg (adjusted R² = 0.85, Fig. 2 B), and WG at 23.69 g/kg (adjusted R² = 0.88, Fig. 2 D). Similarly, FCR decreased quadratically, achieving optimal feed efficiency at 23.61 g/kg (adjusted R² = 0.94, Fig. 2 C). These findings indicate that supplementation with R. paludigena CM33 at approximately 20–24 g/kg optimizes growth performance and feed utilization efficiency in red tilapia. 3.2. Antioxidant and oxidative stress parameters The antioxidant capacity and oxidative stress response of red tilapia fed diets supplemented with R. paludigena CM33 were evaluated using ABTS radical scavenging activity, SOD activity, and MDA content (Fig. 3 ). ABTS radical scavenging increased significantly with red yeast supplementation (p < 0.05). Notably, fish fed the RY-20 diet exhibited the highest ABTS activity (74.73 ± 2.78%), which was significantly higher than that of the control group (70.08 ± 2.32%) (p < 0.05). A similar trend was observed for SOD activity, with the highest activity recorded in fish receiving the RY-20 diet (19.78 ± 0.47 U/mL), a significant increase compared to the control group (16.51 ± 0.73 U/mL) (p 0.05), suggesting that red yeast supplementation did not substantially influence oxidative damage in the tested conditions. 3.3. Histological characteristics of liver and intestine Intestinal tissue structure differed markedly among treatments (Fig. 4 A). Fish in the RY-0 group exhibited shorter villi compared to those in other treatment groups. In contrast, villi in fish from the RY-5 to RY-40 groups were more elongated and extended further into the intestinal lumen, thereby providing greater surface area for nutrient absorption. Specifically, the RY-20 group demonstrated notably elongated villi characterized by narrower tips and a more uniform epithelial lining. Histological analysis of liver tissues (Fig. 4 B) revealed distinct differences among groups in hepatocyte cord organization, cellular boundary clarity, and the extent of vacuolation and lipid droplet accumulation. Liver tissue in the RY-0 group exhibited prominent vacuolation and lipid deposition, suggesting potential metabolic disruption. In contrast, liver tissues from fish in the RY-5, RY-10, RY-20, and RY-40 groups displayed more organized hepatocyte cords with mild to moderate vacuolation, indicative of an adaptive metabolic response to red yeast supplementation. 3.4. Immune-related and antioxidant gene expression Dietary supplementation with R. paludigena CM33 significantly influenced immune-related and antioxidant gene expression in red tilapia (Fig. 5 ). Among immune-related genes, IL-1 expression progressively increased with higher supplementation levels, peaking in the RY-20 group (2.36-fold compared to control; p < 0.05). Although slightly reduced in the RY-40 group, IL-1 expression remained statistically similar to RY-10. TNF expression was highest in the RY-20 group (2.73-fold; p < 0.05), significantly exceeding RY-0, RY-5, and RY-40, with a notable reduction observed in the RY-40 group, yet still above control levels. Similarly, MHC expression peaked significantly in the RY-20 group (2.48-fold; p < 0.05), declining moderately in RY-40 but remaining higher than the control and statistically similar to RY-10. LBP expression exhibited a comparable pattern, peaking significantly in RY-20 (2.74-fold; p < 0.05) but declining sharply in RY-40, indicating a threshold beyond which supplementation no longer enhances expression. IGF , a regulator of growth and immune showed maximal expression in RY-20 (2.69-fold; p < 0.05), significantly higher than control and RY-5 groups. Expression decreased notably in RY-40, showing no significant difference from RY-10. Likewise, HSP70 expression was highest in RY-20 (2.47-fold; p < 0.05), significantly exceeding RY-0, RY-5, and RY-40. Antioxidant gene expression also differed significantly across treatments. Expression of oxidative stress regulators GSR and GPX increased substantially with supplementation, peaking in RY-20. GSR expression (2.06-fold; p < 0.05) significantly surpassed control, RY-5, and RY-10 groups, whereas RY-40 expression declined to levels similar to RY-10. GPX expression reached its highest level in RY-20 (3.43-fold; p < 0.05), significantly exceeding all other groups, followed by a pronounced reduction in RY-40, significantly lower than RY-20 and RY-10 (p < 0.05). 3.5. Pearson correlation between growth performance, antioxidant and oxidative stress parameters, and immune-related and antioxidant gene expression The correlation matrix (Fig. 6 ) highlights significant positive and negative relationships among growth performance indicators, oxidative stress markers, and immune-related gene expression in red tilapia fed diets supplemented with R. paludigena CM33. Red yeast supplementation exhibited a strong positive correlation with key growth parameters, including final weight (FW, r = 0.46, p < 0.05), weight gain (WG, r = 0.45, p < 0.05), percent weight gain (PWG, r = 0.46, p < 0.05), and specific growth rate (SGR, r = 0.45, p < 0.05). In contrast, FCR displayed a significant negative correlation with these growth metrics (r = -0.70 to -0.73, p < 0.05), indicating that higher red yeast inclusion enhances feed efficiency and growth performance. For antioxidant responses, SOD activity was positively correlated with red yeast supplementation (r = 0.27, p 0.05) and growth performance, suggesting a moderate reduction in oxidative stress. Additionally, ABTS radical scavenging activity showed a significant positive correlation with growth parameters, reinforcing the antioxidant benefits of dietary red yeast. Expression of immune-related genes, including IL-1, MHC, LBP, GSR, GPX , and IGF , was significantly associated with growth performance and antioxidant responses. MHC (r = 0.68, p < 0.05), LBP (r = 0.63, p < 0.05), and GSR (r = 0.67, p < 0.05) exhibited strong positive correlations with FW, SGR, and PWG, suggesting that enhanced immune function may contribute to improved growth performance. 3.6. The survival rate in Aeromonas hydrophila challenge The Kaplan-Meier survival curve (Fig. 7 ) depicts the cumulative survival rates of Oreochromis niloticus fed diets supplemented with different concentrations of R. paludigena CM33 following a pathogenic challenge with A. hydrophila . Significant differences were observed among certain treatments (p < 0.05). Dietary supplementation with R. paludigena CM33 enhanced disease resistance, as fish in the RY-5, RY-10, RY-20, and RY-40 groups exhibited markedly higher survival rates than the negative control RY-0 (-) group. Among these, RY-20 had the highest survival, followed closely by RY-40, RY-10, and RY-5, all exceeding 60%. Pairwise comparisons indicated that survival in the RY-20 group was significantly higher than in negative control RY-0 (-) group (p 0.05), indicating a plateau effect at higher inclusion levels. 4. Discussion This study demonstrates that dietary supplementation with R. paludigena CM33 significantly enhances the growth performance of red tilapia. Specifically, increases in FW, WG, PWG, SGR, and DWG were observed at inclusion levels up to 20 g/kg. Pearson correlation analysis revealed significant positive correlations between red yeast supplementation and key growth performance parameters (r = 0.45–0.46, p < 0.05), while FCR exhibited a strong negative correlation with these parameters (r = -0.70 to -0.73, p < 0.05), suggesting that higher red yeast inclusion enhances both growth and feed efficiency, consistent with previous research. Kaewda et al [ 22 ] reported that increasing doses of R. paludigena CM33 significantly enhanced growth performance in flowerhorn cichlid ( Amphilophus labiatus × Cichlasoma trimaculatum ), highlighting its potential as a functional feed additive. In shrimp ( Litopenaeus vannamei ) both dried and live Rhodosporidium paludigenum supplementation improved WG, SGR, and survival rates [ 35 ]. Additionally, Wang et al [ 36 ] observed significant increases in final body weight and SGR in sea cucumber ( Apostichopus japonicus ) supplemented with marine red yeast, reinforcing the general growth-promoting effects of yeast additives. Likewise, Linh et al [ 28 ] reported that koi carp fed 40 g/kg of red yeast exhibited significant improvements in WG, FW, and SGR compared to control groups. The beneficial effects of yeast supplementation may be attributed to several underlying mechanisms. Modulation of intestinal microflora and enhancement of gut morphology, such as increased villus integrity, likely contribute to more efficient nutrient digestion and absorption [ 37 , 38 ]. Consistent with this study, red tilapia fed the RY-20 diet exhibited elongated villi with narrower tips and a more uniform epithelial lining, indicative of improved intestinal functionality. Additionally, liver tissue analysis showed decreased lipid accumulation, suggesting an adaptive metabolic response to red yeast supplementation. The presence of bioactive compounds, including β-glucans, nucleic acids, MOS, and carotenoids (notably astaxanthin), further supports fish growth enhancement [ 28 , 39 , 40 ]. However, Brunel et al [ 41 ] found no significant improvements in weight gain, length gain, FCR, SGR, condition factor, or hepatosomatic index in Arctic char ( Salvelinus alpinus ) when oleaginous yeast ( Lipomyces starkeyi ) was used as a substitute for vegetable oil. Reactive oxygen species (ROS), natural byproducts of cellular metabolism, contribute to oxygen toxicity in living organisms [ 42 ]. Excessive ROS accumulation induces oxidative stress leading to cellular and biomolecular damage through lipid peroxidation and protein oxidation [ 43 ]. In this context, MDA is widely recognized oxidative stress maker associated with protein oxidation [ 44 ]. To counteract ROS-induced damage, organisms rely on an antioxidant defense system comprising enzymatic antioxidants, such as SOD and non-enzymatic mechanisms, including ABTS radical scavenging activity [ 45 , 46 ]. In this study, fish fed the RY-20 diet exhibited the highest ABTS and SOD activities, whereas MDA levels did not differ significantly among treatments. Antioxidant responses played a key role in the beneficial effects of R. paludigena CM33 supplementation. Specifically, SOD activity showed a significant positive correlation with both red yeast supplementation (r = 0.27, p < 0.05) and growth parameters (FW, r = 0.41; SGR, r = 0.39; p 0.05), the strong positive correlation between ABTS radical scavenging activity and growth parameters supports the role of dietary R. paludigena CM33 in enhancing the antioxidant defense system and mitigating oxidative stress [ 22 ]. These findings align with previous studies demonstrating the antioxidant benefits of yeast supplementation in various aquatic species. Kaewda et al [ 22 ] reported improved antioxidant activity in flowerhorn cichlid, while Zheng et al [ 47 ] observed similar benefits in Pacific white shrimp. Likewise, studies on rainbow trout ( Oncorhynchus mykiss ) [ 48 ], Nile tilapia ( Oreochromis niloticus ) [ 49 , 50 ], and turbot ( Scophthalmus maximus ) [ 51 ] consistently demonstrate that yeast supplementation enhances antioxidant capacity, reinforcing our findings. Probiotics enhance immune responses by stimulating cytokine production, strengthening host defense, and facilitating pathogen elimination [ 52 ]. Key inflammatory mediators such as IL-1 , and TNF-α regulate immune function and serve as indicators of inflammatory status [ 53 ]. Class II MHC molecules mediate antigen recognition in immune cells, playing a crucial role in pathogen defense [ 54 , 55 ]. Similarly, LBP is essential for acute-phase immune responses against gram-negative bacteria, enhancing both innate and adaptive immunity in fish [ 56 , 57 ]. Additionally, heat shock protein 70 (HSP70) supports immune protection, cell viability, and stress tolerance by regulating protein metabolism [ 58 – 60 ]. In this study, dietary supplementation with RY significantly upregulated the expression of several key inflammatory response genes, including IL-1, MHC, LBP, HSP70 , and TNF-α in red tilapia. The expression of immune-related genes ( IL-1, MHC, LBP, GSR, GPx , and IGF ) correlated with growth performance and antioxidant responses. Notably, MHC (r = 0.68, p < 0.05), LBP (r = 0.63, p < 0.05), and GSR (r = 0.67, p < 0.05) were strongly associated with FW, SGR, and PWG, suggesting that enhanced immune function contributed to improved growth performance. This immune enhancement may be attributed to the probiotic properties of red yeast, which produces bactericidal compounds such as bacteriocins and lysozymes that inhibit pathogenic bacteria and stimulate cytokine production [ 61 – 63 ]. Additionally, β-glucan in red yeast enhances the immune system by increasing lysozyme activity, elevating phagocytic cell counts, and activating the complement pathway. It also stimulates cytokine expression, further amplifying the overall immune response [ 64 , 65 ]. IGF plays a critical role in promoting growth and development in fish [ 66 ]. fish fed the RY-20 diet exhibited the highest IGF expression levels, which strongly correlated with improved growth performance after an eight-week feeding trial. This finding highlights IGF as the primary mediator of growth hormone effects, facilitating growth through cell proliferation and differentiation [ 67 , 68 ]. IGF regulates protein and lipid metabolism, which is crucial for maintaining growth and overall health, and has been linked to enhanced feed conversion efficiency and muscle growth [ 69 , 70 ]. Additionally, ROS scavenging is closely linked to both enzymatic and non-enzymatic antioxidant systems [ 71 ]. GPx and GSR play complementary roles in eliminating hydrogen peroxide (H₂O₂), with GPx catalyzing its reduction into water by converting glutathione (GSH) into glutathione disulfide (GSSG), while GSR regenerates GSH from GSSG through NADPH oxidation-reduction [ 72 ]. Our findings indicate that dietary RY supplementation significantly upregulated GPx and GSR transcription in the intestine of red tilapia, suggesting enhanced antioxidant defense capacity and greater resilience against oxidative stress. The Kaplan-Meier survival analysis following A. hydrophila challenge further substantiated the benefits of RY supplementation. Fish fed R. paludigena CM33 diets demonstrated significantly higher survival rates than the negative control, with the RY-20 group exhibiting the highest survival (p < 0.05). These results align with previous studies showing that yeast-based supplements enhance both growth and immune competence in aquatic species [ 22 , 73 , 74 ]. Optimized yeast supplementation has been shown to improve growth metrics while bolstering resistance against pathogens. Moreover, the observed correlations between antioxidant enzyme activities and growth parameters reinforce the role of oxidative stress mitigation in improving fish health, performance, and disease resistance. 5. Conclusion This study demonstrates that R. paludigena CM33 supplementation enhances growth, feed efficiency, and immune responses in red tilapia. Polynomial regression identified 24 g/kg as the optimal inclusion level, and the experiment confirmed that fish fed 20 g/kg exhibited the highest weight gain, specific growth rate, antioxidant capacity (ABTS, SOD), and immune-related gene expression. Histological analysis revealed improved intestinal morphology, characterized by elongated villi and a uniform epithelial lining, along with enhanced hepatocyte integrity. Additionally, survival against A. hydrophila significantly increased, highlighting the protective effects of red yeast. These findings suggest that R. paludigena CM33 supplementation at 20–24 g/kg is a promising strategy for improving aquaculture productivity and health, warranting further research for commercial application. Declarations CRediT authorship contribution statement Nguyen Vu Linh : Roles/Writing - Original draft, Methodology, Investigation, Conceptualization, Data curation, Funding acquisition, and Project administration. Luu Tang Phuc Khang: Roles/Writing - Original draft, Formal analysis, Data curation. Nguyen Dinh-Hung : Roles/Writing - Original draft, Writing-Review & Editing. Suwanna Wisetkaew : Methodology, Investigation. Phan Do Trong Nghia : Writing-Review & Editing. Papungkorn Sangsawad : Methodology, Writing-Review & Editing. Satid Chatchaiphan : Formal analysis, Writing-Review & Editing. Patima Permpoonpatana : Supervision, Validation, Writing-Review & Editing. Mintra Seel-audom : Roles/Writing - Original draft, Methodology, Investigation, Conceptualization, Data curation, Supervision, Validation. Declaration of Competing Interest The authors declare no conflict of interest. Data availability The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Acknowledgments The research was partially supported by Faculty of Agriculture, Chiang Mai University, Chiang Mai, Thailand. Animal ethics All experiments in this study were conducted in accordance with the relevant guidelines and regulations. The experimental protocols were approved by the Institutional Animal Care and Use Committee, Prince of Songkla University (Approval Ref. AG21/2025). All the procedure followed the ARRIVE guidelines. References M. Amin, L. Musdalifah, M. Ali, Growth performances of Nile Tilapia, Oreochromis niloticus, reared in recirculating aquaculture and active suspension systems, IOP Conference Series: Earth and Environmental Science, IOP Publishing, 2020, p. 012135. M.A. Naiel, E.-S.H. Eissa, Y.M. Abd El-Aziz, S. Saadony, H.E. Abd Elnabi, S.E.-S. Sakr, The assessment of different dietary selenium resources on reproductive performance, spawning indicators, and larval production of red tilapia (Oreochromis mossambicus× O. niloticus) broodfish, Aquaculture Nutrition 2023(1) (2023) 5596619. R. Pomeroy, M.M. Dey, N. Plesha, The social and economic impacts of semi-intensive aquaculture on biodiversity, Aquaculture Economics & Management 18(3) (2014) 303-324. M.L. Rahman, M. Shahjahan, N. Ahmed, Tilapia farming in Bangladesh: Adaptation to climate change, Sustainability 13(14) (2021) 7657. S.A. El Gamal, R.S. Adawy, V.H. Zaki, E. Zahran, Host–pathogen interaction unveiled by immune, oxidative stress, and cytokine expression analysis to experimental Saprolegnia parasitica infection in Nile tilapia, Scientific Reports 13(1) (2023) 9888. K.F. Tang, M.G. Bondad-Reantaso, W. Surachetpong, H.T. Dong, N. Fejzic, Q. Wang, N. Wajsbrot, B. Hao, Tilapia lake virus disease strategy manual, Food & Agriculture Org.2021. P. Kayansamruaj, N. Dinh-Hung, P. Srisapoome, U. Na-Nakorn, S. Chatchaiphan, Genomics-driven prophylactic measures to increase streptococcosis resistance in tilapia, Journal of Fish Diseases 46(6) (2023) 597-610. P. Nicholson, N. Mon-On, P. Jaemwimol, P. Tattiyapong, W. Surachetpong, Coinfection of tilapia lake virus and Aeromonas hydrophila synergistically increased mortality and worsened the disease severity in tilapia (Oreochromis spp.), Aquaculture 520 (2020) 734746. I.H. Igbinosa, A. Beshiru, E.E. Odjadjare, C.N. Ateba, E.O. Igbinosa, Pathogenic potentials of Aeromonas species isolated from aquaculture and abattoir environments, Microbial pathogenesis 107 (2017) 185-192. M.G. Bondad‐Reantaso, B. MacKinnon, I. Karunasagar, S. Fridman, V. Alday‐Sanz, E. Brun, M. Le Groumellec, A. Li, W. Surachetpong, I. Karunasagar, Review of alternatives to antibiotic use in aquaculture, Reviews in aquaculture 15(4) (2023) 1421-1451. E.S. Okeke, K.I. Chukwudozie, R. Nyaruaba, R.E. Ita, A. Oladipo, O. Ejeromedoghene, E.O. Atakpa, C.V. Agu, C.O. Okoye, Antibiotic resistance in aquaculture and aquatic organisms: a review of current nanotechnology applications for sustainable management, Environmental Science and Pollution Research 29(46) (2022) 69241-69274. F.M. Elshaghabee, N. Rokana, Dietary management by probiotics, prebiotics and synbiotics for the prevention of antimicrobial resistance, Sustainable Agriculture Reviews 49: Mitigation of Antimicrobial Resistance Vol 2. Natural and Synthetic Approaches (2021) 33-56. A.J. Onomu, G.E. Okuthe, The role of functional feed additives in enhancing aquaculture sustainability, Fishes 9(5) (2024) 167. E. Amenyogbe, Application of probiotics for sustainable and environment-friendly aquaculture management-A review, Cogent Food & Agriculture 9(1) (2023) 2226425. A.R. Lubis, M.A.A. Sumon, N. Dinh-Hung, A.K. Dhar, J. Delamare-Deboutteville, D.-H. Kim, A.P. Shinn, D. Kanjanasopa, P. Permpoonpattana, H.V. Doan, N.V. Linh, C.L. Brown, Review of quorum-quenching probiotics: A promising non-antibiotic-based strategy for sustainable aquaculture, Journal of Fish Diseases 47(7) (2024) e13941. N. Richard, B. Costas, M. Machado, S. Fernández-Boo, A. Girons, J. Dias, G. Corraze, F. Terrier, Y. Marchand, S. Skiba-Cassy, Inclusion of a protein-rich yeast fraction in rainbow trout plant-based diet: Consequences on growth performances, flesh fatty acid profile and health-related parameters, Aquaculture 544 (2021) 737132. S.S. Hashemi, K. Karimi, M.J. Taherzadeh, Integrated process for protein, pigments, and biogas production from baker's yeast wastewater using filamentous fungi, Bioresource technology 337 (2021) 125356. M.A. Siddik, M.J. Foysal, R. Fotedar, D.S. Francis, S.K. Gupta, Probiotic yeast Saccharomyces cerevisiae coupled with Lactobacillus casei modulates physiological performance and promotes gut microbiota in juvenile barramundi, Lates calcarifer, Aquaculture 546 (2022) 737346. P. Zhang, F. Yang, J. Hu, D. Han, H. Liu, J. Jin, Y. Yang, J. Yi, X. Zhu, S. Xie, Optimal form of yeast cell wall promotes growth, immunity and disease resistance in gibel carp (Carassius auratus gibelio), Aquaculture Reports 18 (2020) 100465. N.V. Linh, S. Wannavijit, M.A.A. Sumon, K. Tayyamath, N. Dinh-Hung, C.L. Brown, T. Nititanarapee, P. Permpoonpattana, W. Tapingkae, O. Srinual, H. Van Doan, Immunomodulatory and growth-promoting effects of supplementing red yeast (Sporidiobolus pararoseus) in fish meal-based diets for koi carp (Cyprinus carpio var. koi) cultured in a biofloc system, Aquaculture International 33(1) (2024) 17. C. Gosalawit, S. Imsoonthornruksa, N. Udomsil, M. Ketudat-Cairns, Genome sequence of the Oleaginous yeast Rhodotorula paludigena strain CM33, a potential strain for biofuel production, Microbiology Resource Announcements 9(19) (2020) 10.1128/mra. 00286-20. J. Kaewda, P. Sangsawad, S. Boonanuntanasarn, P. Manassila, A. Boontawan, M. Ketudat‑Cairns, C. Sriphuttha, C. Nakharuthai, Effects of Probiotics Red Yeast Rhodotorula paludigena CM33 on enhancing color pigmentation, antioxidant activity, immune response, intestinal microbiota, and growth in a commercial ornamental fish: Flowerhorn fish, Aquaculture Reports 40 (2025) 102609. C. Sriphuttha, S. Limkul, J. Pongsetkul, T. Phiwthong, A. Massu, N. Sumniangyen, P. Boontawan, M. Ketudat-Cairns, A. Boontawan, P. Boonchuen, Effect of fed dietary yeast (Rhodotorula paludigena CM33) on shrimp growth, gene expression, intestinal microbial, disease resistance, and meat composition of Litopenaeus vannamei, Developmental & Comparative Immunology 147 (2023) 104896. G. AOAC, Official methods of analysis of AOAC International. Rockville, MD: AOAC International, ISBN: 978-0-935584-87-5, 2016. N.V. Linh, A.R. Lubis, N. Dinh-Hung, S. Wannavijit, N. Montha, C.M. Fontana, P. Lengkidworraphiphat, O. Srinual, W.-K. Jung, M. Paolucci, H.V. Doan, Effects of Shrimp Shell-Derived Chitosan on Growth, Immunity, Intestinal Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus) Reared in a Biofloc System, Marine Drugs 22(4) (2024) 150. N.V. Linh, S. Wannavijit, K. Tayyamath, N. Dinh-Hung, T. Nititanarapee, M.A.A. Sumon, O. Srinual, P. Permpoonpattana, H.V. Doan, C.L. Brown, Black Soldier Fly (Hermetia illucens) Larvae Meal: A Sustainable Alternative to Fish Meal Proven to Promote Growth and Immunity in Koi Carp (Cyprinus carpio var. koi), Fishes 9(2) (2024) 53. Y. Avnimelech, Carbon/nitrogen ratio as a control element in aquaculture systems, Aquaculture 176(3) (1999) 227-235. N.V. Linh, S. Wannavijit, M.A.A. Sumon, K. Tayyamath, N. Dinh-Hung, C.L. Brown, T. Nititanarapee, P. Permpoonpattana, W. Tapingkae, O. Srinual, Immunomodulatory and growth-promoting effects of supplementing red yeast (Sporidiobolus pararoseus) in fish meal-based diets for koi carp (Cyprinus carpio var. koi) cultured in a biofloc system, Aquaculture International 33(1) (2025) 1-19. S. Boonkong, P. Luasiri, J. Pongsetkul, S. Suwanandgul, S. Chaipayang, W. Molee, P. Sangsawad, Exploring the utilization of bovine blood as a source of antioxidant peptide: Production, concentration, identification, and in silico gastrointestinal digestion, Food Science of Animal Resources 44(6) (2024) 1283. T. Karatas, K. EM, Comparison of Paraoxonase activity, malondialdehyde and high-density lipoprotein levels in cultuvated normal and albino rainbow trout reared in the same conditions, Kafkas Üniversitesi Veteriner Fakültesi Dergisi 18(1) (2012). N.V. Linh, N. Khongcharoen, D.-H. Nguyen, L.T. Dien, N. Rungrueng, C. Jhunkeaw, P. Sangpo, S. Senapin, T. Uttarotai, W. Panphut, S. St-Hilaire, H. Van Doan, H.T. Dong, Effects of hyperoxia during oxygen nanobubble treatment on innate immunity, growth performance, gill histology, and gut microbiome in Nile tilapia, Oreochromis niloticus, Fish & Shellfish Immunology 143 (2023) 109191. K.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method, Methods 25(4) (2001) 402-408. M. Azzam-Sayuti, M.Y. Ina-Salwany, M. Zamri-Saad, S. Annas, M.T. Yusof, M.S. Monir, A. Mohamad, M.H.N. Muhamad-Sofie, J.Y. Lee, Y.K. Chin, Comparative pathogenicity of Aeromonas spp. in cultured red hybrid tilapia (Oreochromis niloticus× O. mossambicus), Biology 10(11) (2021) 1192. R. Yossa, M. Verdegem, Misuse of multiple comparison tests and underuse of contrast procedures in aquaculture publications, Aquaculture 437 (2015) 344-350. S.-P. Yang, Z.-H. Wu, J.-C. Jian, X.-Z. Zhang, Effect of marine red yeast Rhodosporidium paludigenum on growth and antioxidant competence of Litopenaeus vannamei, Aquaculture 309(1-4) (2010) 62-65. J.-h. Wang, L.-q. Zhao, J.-f. Liu, H. Wang, S. Xiao, Effect of potential probiotic Rhodotorula benthica D30 on the growth performance, digestive enzyme activity and immunity in juvenile sea cucumber Apostichopus japonicus, Fish & shellfish immunology 43(2) (2015) 330-336. Q. Wang, S. Ayiku, H. Liu, B. Tan, X. Dong, S. Chi, Q. Yang, S. Zhang, W. Zhou, Dietary yeast culture facilitates the growth, immune response, digestive enzyme activity, intestinal microbiota and disease resistance against Vibrio harveyi of hybrid grouper (Epinephelus fuscoguttatus♀× Epinephelus lanceolatus♂), Aquaculture Research 53(6) (2022) 2484-2500. N. Jahan, S.M. Islam, M.F. Rohani, M.T. Hossain, M. Shahjahan, Probiotic yeast enhances growth performance of rohu (Labeo rohita) through upgrading hematology, and intestinal microbiota and morphology, Aquaculture 545 (2021) 737243. B.D. Glencross, D. Huyben, J.W. Schrama, The application of single-cell ingredients in aquaculture feeds—a review, Fishes 5(3) (2020) 22. K. Ghosh, R. Harikrishnan, A. Mukhopadhyay, E. Ringø, Fungi and actinobacteria: alternative probiotics for sustainable aquaculture, Fishes 8(12) (2023) 575. M. Brunel, V. Burkina, S. Sampels, A.-K. Dahlberg, V. Passoth, J. Pickova, Biomass of the oleaginous yeast Rhodotorula toruloides as feed ingredient in the diet of Arctic char (Salvelinus alpinus): impact on quality; safety and sensory outcome, Acta Agriculturae Scandinavica, Section A—Animal Science 73(3-4) (2024) 130-142. R.T. Di Giulio, J.N. Meyer, Reactive oxygen species and oxidative stress, The toxicology of fishes (2008) 273-324. Z. Xu, J. Cao, X. Qin, W. Qiu, J. Mei, J. Xie, Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: a review, Animals 11(11) (2021) 3304. Q. Gao, B. Liu, F. Shan, Z. Gu, C. Song, C. Sun, Q. Zhou, Effects of oxidized fish oil on digestive enzyme activity and antioxidant system in Macrobrachium rosenbergii post-larvae, Aquaculture Reports 23 (2022) 101062. S. Jeong, J.-H. Jung, K.-W. Jung, S. Ryu, S. Lim, From microbes to molecules: a review of microbial-driven antioxidant peptide generation, World Journal of Microbiology and Biotechnology 40(1) (2024) 29. X. Hu, W. Ma, D. Zhang, Z. Tian, Y. Yang, Y. Huang, Y. Hong, Application of Natural Antioxidants as Feed Additives in Aquaculture: A Review, Biology 14(1) (2025) 87. L. Zheng, S. Xie, Z. Zhuang, Y. Liu, L. Tian, J. Niu, Effects of yeast and yeast extract on growth performance, antioxidant ability and intestinal microbiota of juvenile Pacific white shrimp (Litopenaeus vannamei), Aquaculture 530 (2021) 735941. E.P. Kheirabadi, P.H. Shekarabi, F. Yadollahi, M. Soltani, E. Najafi, J. von Hellens, C.L. Flores, K. Salehi, C. Faggio, Red yeast (Phaffia rhodozyma) and its effect on growth, antioxidant activity and color pigmentation of rainbow trout (Oncorhynchus mykiss), Aquaculture Reports 23 (2022) 101082. N. Mashhadizadeh, S. Khezri, D.E. Esfahani, S. Mohammadzadeh, E. Ahmadifar, M. Ahmadifar, M.S. Moghadam, E. El-Haroun, Enhancing growth performance, antioxidant defense, immunity response, and resistance against heat stress in Nile Tilapia (Oreochromis niloticus) fed Saccharomyces boulardii and/or Bifidobacterium bifidum, Aquaculture Reports 39 (2024) 102462. M. Abdel-Tawwab, I. Adeshina, Z.A. Issa, Antioxidants and immune responses, resistance to Aspergilus flavus infection, and growth performance of Nile tilapia, Oreochromis niloticus, fed diets supplemented with yeast, Saccharomyces serevisiae, Animal Feed Science and Technology 263 (2020) 114484. J. Sun, Y. Li, T. Ren, Q. Gao, L. Yin, Y. Liang, H. Liu, Effects of yeast extract supplemented in diet on growth performance, digestibility, intestinal histology, and the antioxidant capacity of the juvenile turbot (Scophthalmus maximus), Frontiers in Physiology 15 (2024) 1329721. S.K. Nayak, Probiotics and immunity: a fish perspective, Fish & shellfish immunology 29(1) (2010) 2-14. S. Roy, V. Kumar, V. Kumar, B. Behera, Acute phase proteins and their potential role as an indicator for fish health and in diagnosis of fish diseases, Protein and peptide letters 24(1) (2017) 78-89. X. Li, H. Du, L. Liu, X. You, M. Wu, Z. Liao, MHC class II alpha, beta and MHC class II-associated invariant chains from Chinese sturgeon (Acipenser sinensis) and their response to immune stimulation, Fish & Shellfish Immunology 70 (2017) 1-12. A. Cuesta, M.Á. Esteban, J. Meseguer, Cloning, distribution and up-regulation of the teleost fish MHC class II alpha suggests a role for granulocytes as antigen-presenting cells, Molecular immunology 43(8) (2006) 1275-1285. N. Nithikulworawong, W. Jiwyam, The Immunostimulatory Potential and Resistance Aeromonas hydrophila of Pineapple Peel Extract in Nile Tilapia (Oreochromis niloticus), Aquaculture Studies 24(5) (2024). M.G. Scott, R.E. Hancock, Cationic antimicrobial peptides and their multifunctional role in the immune system, Critical Reviews™ in Immunology 20(5) (2000). S. Jeyachandran, H. Chellapandian, K. Park, I.-S. Kwak, A review on the involvement of heat shock proteins (extrinsic chaperones) in response to stress conditions in aquatic organisms, Antioxidants 12(7) (2023) 1444. L.L. Wong, D.T. Do, The role of heat shock proteins in response to extracellular stress in aquatic organisms, Heat shock proteins in veterinary medicine and sciences, Springer2018, pp. 247-274. S. Elbahnaswy, G.E. Elshopakey, A.A. Abdelwarith, E.M. Younis, S.J. Davies, M.A. El-Son, Immune protective, stress indicators, antioxidant, histopathological status, and heat shock protein gene expression impacts of dietary Bacillus spp. against heat shock in Nile tilapia, Oreochromis niloticus, BMC Veterinary Research 20(1) (2024) 469. G. Moonsamy, Y. Roets-Dlamini, C.N. Langa, S.O. Ramchuran, Advances in Yeast Probiotic Production and Formulation for Preventative Health, Microorganisms 12(11) (2024) 2233. N. Akhter, B. Wu, A.M. Memon, M. Mohsin, Probiotics and prebiotics associated with aquaculture: a review, Fish & shellfish immunology 45(2) (2015) 733-741. M.D. Ibrahem, Evolution of probiotics in aquatic world: Potential effects, the current status in Egypt and recent prospectives, Journal of advanced research 6(6) (2015) 765-791. S. Reyes-Cerpa, E. Vallejos-Vidal, M.J. Gonzalez-Bown, J. Morales-Reyes, D. Pérez-Stuardo, D. Vargas, M. Imarai, V. Cifuentes, E. Spencer, A.M. Sandino, Effect of yeast (Xanthophyllomyces dendrorhous) and plant (Saint John's wort, lemon balm, and rosemary) extract based functional diets on antioxidant and immune status of Atlantic salmon (Salmo salar) subjected to crowding stress, Fish & shellfish immunology 74 (2018) 250-259. J.J. Ching, A.S. Shuib, N. Abdul Majid, N. Mohd Taufek, Immunomodulatory activity of β‐glucans in fish: Relationship between β‐glucan administration parameters and immune response induced, Aquaculture Research 52(5) (2021) 1824-1845. S. Chandhini, B. Trumboo, S. Jose, T. Varghese, M. Rajesh, V.R. Kumar, Insulin-like growth factor signalling and its significance as a biomarker in fish and shellfish research, Fish Physiology and Biochemistry 47(4) (2021) 1011-1031. L. Xue, Y. Gao, S. Zhang, M. Weng, G. Zeng, J. Chen, M. Liao, S.M.H. Alavi, Y. Guiguen, Expression pattern of the fused in sarcoma gene and its contextual influence on the density-specific response of the growth hormone/insulin-like growth factor 1 axis in zig-zag eels (Mastacembelus armatus), Frontiers in Marine Science 11 (2024) 1461451. C.B. Ndandala, M. Dai, U.F. Mustapha, X. Li, J. Liu, H. Huang, G. Li, H. Chen, Current research and future perspectives of GH and IGFs family genes in somatic growth and reproduction of teleost fish, Aquaculture Reports 26 (2022) 101289. R.E. Ibrahim, S.A. Tolba, E.M. Younis, A.-W.A. Abdel-Warith, S.I. Shalaby, A. Osman, T. Khamis, M.A. Eissa, S.J. Davies, S.A. Amer, Kidney bean protein hydrolysate as a fish meal replacer: Effects on growth, digestive enzymes, metabolic functions, immune-antioxidant parameters and their related gene expression, intestinal and muscular gene expression, Aquaculture 575 (2023) 739803. S. Yang, Z. Liu, Z. Yan, Z. Zhao, C. Zhang, Q. Gong, X. Du, J. Wu, Y. Feng, J. Du, Improvement of skeletal muscle growth by GH/IGF growth-axis contributes to growth performance in commercial fleshy sturgeon, Aquaculture 543 (2021) 736929. E. Amenyogbe, E.K. Droepenu, C.L. Ayisi, G.A. Boamah, R.Q. Duker, E.D. Abarike, J.-s. Huang, Impact of probiotics, prebiotics, and synbiotics on digestive enzymes, oxidative stress, and antioxidant defense in fish farming: current insights and future perspectives, Frontiers in Marine Science 11 (2024) 1368436. H. Imai, Y. Nakagawa, Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells, Free Radical Biology and Medicine 34(2) (2003) 145-169. A. Perdichizzi, M. Meola, L. Caccamo, G. Caruso, F. Gai, G. Maricchiolo, Live yeast (Saccharomyces cerevisiae var. boulardii) supplementation in a European Sea Bass (Dicentrarchus labrax) diet: effects on the growth and immune response parameters, Animals 13(21) (2023) 3383. M. Gokulakrishnan, R. Kumar, B.R. Pillai, S. Nanda, S. Bhuyan, R. Kumari, J. Debbarma, S. Ferosekhan, G. Siddaiah, J.K. Sundaray, Dietary brewer’s spent yeast enhances growth, hematological parameters, and innate immune responses at reducing fishmeal concentration in the diet of climbing perch, Anabas testudineus fingerlings, Frontiers in Nutrition 9 (2022) 982572. Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6568606","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":450466213,"identity":"aafabc94-4f81-4339-86e3-d791dee8bc82","order_by":0,"name":"Nguyen Vu Linh","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Nguyen","middleName":"Vu","lastName":"Linh","suffix":""},{"id":450466214,"identity":"3fed7fa6-0644-4984-9b89-5ffcc63bcc96","order_by":1,"name":"Luu Tang Phuc Khang","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Luu","middleName":"Tang Phuc","lastName":"Khang","suffix":""},{"id":450466215,"identity":"a8a398cc-1288-4302-acbb-a46fb141f647","order_by":2,"name":"Nguyen Dinh-Hung","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIie3NMQuCQBTA8QtBl0vXk4a+woUgLelXSQRbWiKQxoPgVuc+RgTOJw90sVobWiJwamlrTMFoO24Muj8cdzzej0NIp/vFAJlGdzvtEf2MqhGXKRPREyq+Mzmxq2F5X/FrcKiOt+K1uY6Rtc2JjLhgL7wdb+K8XlBB6mbCcJlKCQXsj4YcYl8kSEw4DBhZ+mrEyxokIg4hGz/USEBJ+0vBIWIEy4nbEXyCObk0qGA1xBwn66mM2Oe6JSmETpYYz9cGZpkF+4uMfIrY52WqrHeFqos6nU73h70BXm1LliCpswAAAAAASUVORK5CYII=","orcid":"","institution":"The University of Arizona","correspondingAuthor":true,"prefix":"","firstName":"Nguyen","middleName":"","lastName":"Dinh-Hung","suffix":""},{"id":450466216,"identity":"b0ac03ac-a92c-44f6-b131-23d86948bccb","order_by":3,"name":"Suwanna Wisetkaew","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Suwanna","middleName":"","lastName":"Wisetkaew","suffix":""},{"id":450466217,"identity":"2278e041-3185-4ade-9840-31f8f2ccfe36","order_by":4,"name":"Do Trong Nghia","email":"","orcid":"","institution":"University of Stirling","correspondingAuthor":false,"prefix":"","firstName":"Do","middleName":"Trong","lastName":"Nghia","suffix":""},{"id":450466218,"identity":"35c9acb7-77e2-4f1e-9c9d-c3f1bb112388","order_by":5,"name":"Papungkorn Sangsawad","email":"","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Papungkorn","middleName":"","lastName":"Sangsawad","suffix":""},{"id":450466219,"identity":"5891bc59-a668-42e5-9eae-6d43d2469d66","order_by":6,"name":"Satid Chatchaiphan","email":"","orcid":"","institution":"Kasetsart University","correspondingAuthor":false,"prefix":"","firstName":"Satid","middleName":"","lastName":"Chatchaiphan","suffix":""},{"id":450466220,"identity":"e4ece5bc-d764-4dca-b631-32717f430cfa","order_by":7,"name":"Patima Permpoonpatana","email":"","orcid":"","institution":"Prince of Songkla University","correspondingAuthor":false,"prefix":"","firstName":"Patima","middleName":"","lastName":"Permpoonpatana","suffix":""},{"id":450466221,"identity":"bc435d37-1bdc-4036-a4ff-53a719724147","order_by":8,"name":"Mintra Seel-audom","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Mintra","middleName":"","lastName":"Seel-audom","suffix":""}],"badges":[],"createdAt":"2025-05-01 02:27:50","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-6568606/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6568606/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":81809606,"identity":"d0872be1-b018-40a7-b076-c916f0c05c2d","added_by":"auto","created_at":"2025-05-02 08:24:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":365587,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the experimental design, dietary treatments, and data analysis for red tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e × \u003cem\u003eO. mossambicus\u003c/em\u003e) fed \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/e1924cf6c5717bfe16eb344d.png"},{"id":81809601,"identity":"9caeeb9e-d23b-4a22-b4d4-95869b982f43","added_by":"auto","created_at":"2025-05-02 08:24:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":293128,"visible":true,"origin":"","legend":"\u003cp\u003eQuadratic regression models of dietary \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 supplementation on growth performance parameters of red tilapia (\u003cem\u003eOreochromis niloticus \u003c/em\u003ex\u003cem\u003e O. mossambicus\u003c/em\u003e) including (A) final weight (FW), (B) specific growth rate (SGR), (C) feed conversion ratio (FCR), and (D) weight gain (WG).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/e26d04a11b03af49a3e6c7bb.png"},{"id":81809892,"identity":"58572a62-629e-4b3b-b0fd-93907039ef97","added_by":"auto","created_at":"2025-05-02 08:32:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":162870,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of dietary \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 supplementation on (A) ABTS radical scavenging inhibition (%), (B) SOD activity, and (C) MDA content in red tilapia (\u003cem\u003eOreochromis niloticus \u003c/em\u003ex\u003cem\u003eO. mossambicus\u003c/em\u003e). Bars represent mean values ± standard error, with different letters above bars indicate significant differences (p \u0026lt; 0.05) among treatments.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/a66b0c9d2e4f9e08b261b915.png"},{"id":81809890,"identity":"ba737356-c765-434b-a0c4-b844cfdbe9cd","added_by":"auto","created_at":"2025-05-02 08:32:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":399723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhodotorula paludigena\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e CM33 supplementation on intestinal and liver histology in red tilapia (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eOreochromis niloticus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e × \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eO. mossambicus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e). \u003c/strong\u003e(A) The RY-0 group exhibited shorter intestinal villi, while the RY-5 to RY-40 groups showed villus elongation, with the RY-20 group displaying the longest villi, narrower tips, and a uniform epithelial lining. (B) Liver histology differed among treatments, with the RY-0 group exhibiting prominent vacuolation and lipid deposition, whereas fish in the RY-5 to RY-40 groups displayed well-organized hepatocyte cords with reduced vacuolation. H\u0026amp;E staining; the same scale bars were used for all figures and included in the figure.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/f927809e29c15de8feba9e20.png"},{"id":81809610,"identity":"1ea1f50b-f265-48a0-ab31-c02ac0d6c523","added_by":"auto","created_at":"2025-05-02 08:24:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":497835,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of dietary \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 supplementation on immune-related, antioxidant, and growth-related gene expression in red tilapia (\u003cem\u003eOreochromis niloticus \u003c/em\u003ex\u003cem\u003e O. mossambicus\u003c/em\u003e). Bars represent mean values ± standard error, with different letters above bars indicate significant differences (p \u0026lt; 0.05) among treatments.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/4f08f0324c44bee6fba18846.png"},{"id":81809613,"identity":"e865f0fd-33ef-4ebb-ae9d-3cd01c8469db","added_by":"auto","created_at":"2025-05-02 08:24:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":544805,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation matrix depicting the relationships among growth performance parameters, oxidative stress markers, and immune-related gene expression in red tilapia (\u003cem\u003eOreochromis niloticus \u003c/em\u003ex\u003cem\u003e O. mossambicus\u003c/em\u003e) fed different concentrations of \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33. Asterisks indicate significant differences (p \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/862b107e766b678f4694e970.png"},{"id":81809893,"identity":"98a15c04-0e93-44b5-a1f3-6490a958ca16","added_by":"auto","created_at":"2025-05-02 08:32:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":174242,"visible":true,"origin":"","legend":"\u003cp\u003eKaplan-Meier survival curve of red tilapia (\u003cem\u003eOreochromis niloticus \u003c/em\u003ex\u003cem\u003e O. mossambicus\u003c/em\u003e) fed diets supplemented with \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 following \u0026nbsp;\u003cem\u003eAeromonas hydrophila\u003c/em\u003e challenge. RY-0 (+) represents the unchallenged positive control, while RY-0 (-) is the challenged negative control. Asterisks indicate significant differences (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/9473190262f1226fb1524f7f.png"},{"id":81810703,"identity":"1d3ae36d-d20e-4425-9aef-92534367e9f6","added_by":"auto","created_at":"2025-05-02 08:48:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3774911,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6568606/v1/2ec8df6c-736a-4314-baa4-4e17a0005a4d.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eSupplementation of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhodotorula paludigena\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e CM33 in Feed as Probiotic Enhances Growth, Immunity, Gene Expression, and Disease Resistance to \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAeromonas hydrophila\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in Red tilapia (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eOreochromis niloticus × O. mossambicus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eTilapia farming is a cornerstone of global aquaculture, with production spanning more than 75% of countries [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Among tilapia species, red tilapia, a hybrid of \u003cem\u003eOreochromis niloticus\u003c/em\u003e and \u003cem\u003eO. mossambicus\u003c/em\u003e, is particularly valued for its superior market price, salinity tolerance, and resilience during handling and transportation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These attributes, combined with its rapid growth and adaptability to diverse environmental conditions, underscore its significance as a major aquaculture commodity. The shift from semi-intensive to high-input intensive systems, which rely on high-quality, processed feeds, however, has increased species\u0026rsquo; susceptibility to stress and disease, presenting new challenges for sustainable production [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe intensification of aquaculture, along with suboptimal management practices, has contributed to a rise in infectious disease outbreaks, particularly among juvenile fish, which are highly vulnerable to pathogenic infections [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Among these pathogens, \u003cem\u003eAeromonas hydrophila\u003c/em\u003e is a ubiquitous freshwater bacterium frequently associated with severe disease outbreaks, leading to considerable economic losses and threatening the sustainability of aquaculture operations [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Traditionally, antibiotics have been the primary strategy for disease control due to their rapid efficacy and accessibility [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The indiscriminate use of antibiotics, however, has raised serious concerns regarding antimicrobial resistance, environmental contamination, and the accumulation of drug residues in fish intended for human consumption [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In response to these challenges, there is growing interest in alternative strategies that enhance the innate immune responses of fish. Nutritional interventions, particularly the incorporation of probiotics and functional food additives, have emerged as promising approaches to improve disease resistance while mitigating the adverse effects of antibiotic use [\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Yeast-based supplements, rich in proteins, vitamins, minerals, and immunomodulatory compounds such as β-glucan, nucleotides, and mannan oligosaccharides, have demonstrated efficacy in promoting growth performance, enhancing immune responses, and improving disease resistance in a variety of aquatic species [\u003cspan additionalcitationids=\"CR17 CR18 CR19\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Among them, red yeasts of the genus \u003cem\u003eRhodotorula\u003c/em\u003e, characterized by their distinctive pigmentation due to carotenoid production, have gained attention not only for their biotechnological applications in biofuel production [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] but also for their potential as probiotic dietary supplements in aquaculture. Notably, \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33, isolated from castor beans, has demonstrated promising effects in previous studies involving aquatic species such as flowerhorn fish and shrimp [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], where its supplementation resulted in improved growth, enhanced immune responses, and increased disease resistance. However, its application in tilapia remains largely unexplored. To address this knowledge gap, the present study investigated the effects of \u003cem\u003eR. paludigena\u003c/em\u003e CM33 supplementation in red tilapia (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), specifically examining growth performance, immune parameters, gene expression, and resistance to \u003cem\u003eA. hydrophila\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Production of \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 and diet preparation\u003c/h2\u003e \u003cp\u003e \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 was obtained from the Institute of Agricultural Technology, Suranaree University of Technology, Nakhon Ratchasima, Thailand. The red yeast CM33 was cultured according to the protocol described by Kaewda et al [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Specifically, yeast peptone dextrose (YPD) medium, composed of 20 g/L glucose, 10 g/L yeast extract, and 10 g/L peptone, was used for cultivation [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Five experimental diets were formulated, consisting of a control diet without red yeast and four diets supplemented with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 at inclusion levels of 5, 10, 20, and 40 g/kg. All feed ingredients were finely ground and mixed with soybean oil and water to form a uniform dough, which was extruded into pellets, dried at 50\u0026deg;C and stored at 4\u0026deg;C until use. The proximate composition of the experimental diets was determined following standardized methods outlined by the Association of Official Analytical Chemists [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Additionally, crude fat was analyzed using a Soxtec\u0026trade; 8000 extractor (Denmark), as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIngredient composition of experimental diets supplemented with different levels of red yeast (g/kg on dry matter basis)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIngredients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eRY levels (g/kg diet)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0 (control)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e395\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRice bran\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat flour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLecithin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRed yeast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePremix\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin C 98%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eProximate (%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDry matter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.77\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e11.28\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFiber\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.88\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude lipid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e34.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e34.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNitrogen-free extract\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e47.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e47.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e46.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e46.88\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Experimental fish and feeding management\u003c/h2\u003e \u003cp\u003eHealthy red tilapia was obtained from a commercial fish hatchery in Chiang Mai, Thailand, with no prior history of infection outbreaks. The fish were acclimated to experimental conditions by feeding them a commercial diet for four weeks before initiating the trial. Following this acclimation period, the fish were transitioned to a basal diet for an additional two weeks to standardize their nutritional status. A total of 300 fish, with an average weight of 27.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 g, were randomly distributed among 15 tanks, each containing 180 L of water. The experiments consisted of five treatment groups (RY-0, RY-5, RY-10, RY-20, and RY-40), as detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, each with three replicates. A biofloc system was established three weeks before the start of the experimental period by inoculating the water with 2 g of wheat flour, 400 g of salt, 5 g of dolomite, and 5 g of molasses [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Following the methodology described by Avnimelech [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], the carbon-to-nitrogen ratio was maintained at 15:1 by daily supplementation of molasses containing 40% carbon. The feeding trial lasted for eight weeks, during which the fish were fed twice daily (i.e., 8:30 a.m. and 4:30 p.m.) at approximately 3% of their body weight. Feed intake was accurately determined by collecting and freeze-drying any uneaten feed, then subtracting this from the total amount initially provided. Water quality parameters were monitored daily and maintained within optimal ranges: temperature between 24.5 and 32.6\u0026deg;C, dissolved oxygen at or above 5.0 mg/L, total ammonia nitrogen below 0.08 mg/L, and pH between 7.0 and 8.2 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Regular monitoring ensured a stable biofloc environment conducive to the healthy growth of the fish.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Sample collection and evaluation of growth performance and histology\u003c/h2\u003e \u003cp\u003eGrowth data were at two-week intervals throughout the experiment. Prior to each measurement, fish were fasted for 24 hours to standardize their metabolic state. Fish each replicate tank were batch-weighed and counted to determine final weight (FW), weight gain (WG), daily weight gain, specific growth rate (SGR), and feed conversion ratio (FCR). The equations were as follows:\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eWeight gain (WG)\u0026thinsp;=\u0026thinsp;Final weight \u0026ndash; Initial weight\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eDaily weight gain (DWG, g/day) = (Final weight \u0026ndash; Initial weight) / Days of culture\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eSpecific growth rate (SGR, %/day) = [(Loge Final body weight \u0026ndash; Loge Initial body weight) / Culture days] \u0026times; 100\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eFeed conversion ratio (FCR)\u0026thinsp;=\u0026thinsp;Dry feed fed / Live weight gain\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cp\u003eAt the conclusion of the 60-day feeding trial, three fish from each replicate tank were randomly selected and anesthetized with 200 mg/L clove oil before for blood and tissue collection. Blood samples were collected from the caudal vein using a 1-mL syringe, allowed to clot at 4\u0026deg;C for 4 hours, and then centrifuged at 1000 x g for 10 minutes at 4\u0026deg;C for antioxidant analyses. Intestinal tissue samples (approximately 50 mg) were placed in sterile tubes containing 200 \u0026micro;L of TRIzol\u0026trade; reagent (Invitrogen\u0026trade;) and stored at -80\u0026deg;C for subsequent gene expression analysis. Additionally, midgut and liver tissue samples were preserved in 10% neutral buffered formalin. After 24 hours, the samples were transferred to 70% ethanol and subsequently processed for routine histopathology analysis. Tissue samples were embedded in paraffin, sectioned into 5 \u0026micro;m slices, and stained with hematoxylin and eosin (H\u0026amp;E). The slides were examined and photographed using a digital light microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Serum antioxidant activities\u003c/h2\u003e \u003cp\u003eSerum antioxidant capacity was quantified using the ABTS radical scavenging assay, following the protocol detailed by Boonkong et al [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], with measurements performed at a wavelength of 734 nm. Concurrently, serum superoxide dismutase (SOD) activity was assessed using a commercial assay kit (CS0009, Sigma-Aldrich) according to the manufacturer's instructions. Absorbance was measured at 450 nm using a Varioskan LUX microplate reader (Thermo Scientific, Vantaa, Finland). Additionally, lipid peroxidation was evaluated by determining malondialdehyde (MDA) utilizing a commercially available assay kit (KTB1050, Abbkine). In this assay, MDA reacts with thiobarbituric acid (TBA), forming a chromogenic complex measurable at 532 nm. To correct for potential interference, absorbance at 600 nm was also recorded. Final MDA concentrations (nM/mL) were calculated by subtracting the absorbance at 600 nm from that at 532 nm and interpolating the resultant values against a standard curve [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Gene expression\u003c/h2\u003e \u003cp\u003eTissue samples were homogenized using a Bullet Blender\u0026reg; Homogenizer (Missing Lid, USA), and subsequently incubated at room temperature for 2\u0026ndash;3 minutes. Chloroform (100 \u0026micro;L) was then added to the homogenate, followed by a 2-minute incubation. The mixture was centrifuged at 12,000 rpm at 4\u0026deg;C for 15 minutes and RNA was extracted from the aqueous phase using a Total RNA extraction kit (Omega Bio-tek, USA), following the manufacturer's instructions. RNA concentration and purity were measured using a NanoDrop\u0026trade; One/OneC (Thermo Fisher Scientific). Complementary DNA (cDNA) was synthesized from 1 \u0026micro;g of RNA using a cDNA synthesis kit (BIO-RAD, USA). Real-time PCR was performed in a 20 \u0026micro;L reaction volume containing 100 ng of cDNA (1 \u0026micro;L), 0.4 \u0026micro;L of each 10 \u0026micro;M primer, and 10 \u0026micro;L of 2\u0026times; iTaq Universal SYBR Green supermix (BIO-RAD, USA). Amplifications were conducted using a CFX Connect\u0026trade; real-time system (BIO-RAD, USA) under following cycling protocol: initial denaturation 95\u0026deg;C for 30 seconds, followed by 40 cycles of 95\u0026deg;C for 15 seconds and 60\u0026deg;C for 30 seconds [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. A melt curve analysis was performed with the following steps: 95\u0026deg;C for 15 seconds, 60\u0026deg;C for 60 seconds, and 95\u0026deg;C for 15 seconds. Gene expression levels were quantified using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and normalized to \u003cem\u003e18S rRNA\u003c/em\u003e as the reference gene. All primer sequences used in the study are provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for qPCR in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e18S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACCAGCTGGATTTGTCAGAAG\u003c/p\u003e \u003cp\u003eR: ACATACTGAATTGAACTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTCTGTCAAGGATAAGCGCTG\u003c/p\u003e \u003cp\u003eR: ACTCTGGAGCTGGATGTTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTNFα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTTCCCATAGACTCTGAGTAGCG\u003c/p\u003e \u003cp\u003eR: GAGGCCAACAAAATCATCATCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMHC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGTCCAAGCTGCTGAAGATT\u003c/p\u003e \u003cp\u003eR: TGCCGTCTGACTTCTTCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLBP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACCAGAAACTGCGAGAAGGA\u003c/p\u003e \u003cp\u003eR: GATTGGTGGTCGGAGGTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHSP70\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGGAGTCCTACGCCTTCAACA\u003c/p\u003e \u003cp\u003eR: CAGGTAGCACCAGTGGGCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIGF\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGTTTGTCTGTGGAGAGCGAG\u003c/p\u003e \u003cp\u003eR: GTGTGCCGCTGTGAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGPX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGGATGTGAATGGAAAGG\u003c/p\u003e \u003cp\u003eR: CTTGTAAGGTTCCCCGTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGSR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTGCACCAAAGAACTGCAAA\u003c/p\u003e \u003cp\u003eR: CCAGAGAAGGCAGTCCACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. \u003cem\u003eAeromonas hydrophila\u003c/em\u003e challenge\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eA. hydrophila\u003c/em\u003e strain used in this study was obtained from Scientific Laboratory and Equipment Center (SLEC), Prince of Songkla University, Surat Thani campus, Thailand. The bacterial culture was grown in brain heart infusion (BHI) broth and incubated at 30\u0026deg;C for 24 hours with constant shaking at 250 rpm. Prior to the bacterial challenge, fish were anesthetized with clove oil at a concentration of 200 mg/L. They were then intraperitoneally injected with a bacterial suspension at a final concentration determined by the median lethal dose (LD₅₀) of 10⁵ CFU/mL, as reported by Azzam-Sayuti et al [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Fish in the control group were similarly injected intraperitoneally with sterile BHI broth. The pathogen challenge trial was conducted over 14 days, during which clinical signs and mortality were monitored and recorded daily.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Statistical analysis\u003c/h2\u003e \u003cp\u003eData normality was assessed using the Shapiro-Wilk test, and differences between treatments were subsequently analyzed with ANOVA and Duncan's multiple range test in SPSS (Version 29.0.2.0, IBM Corp., Armonk, NY, USA). The optimal level of \u003cem\u003eR. paludigena\u003c/em\u003e CM33 was determined through polynomial regression analysis [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In addition, fish survival during the 14-day post-observation period following \u003cem\u003eA. hydrophila\u003c/em\u003e injection was evaluated using Kaplan\u0026ndash;Meier survival curves and Log-rank tests. Pearson correlation analysis was employed to examine the relationships between growth performance, antioxidant activities, and gene expression. Results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation, while graphs and data visualizations were generated using Origin Pro (Version 2021b). Statistical significance was set at p\u0026thinsp;\u0026le;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Growth performance and polynomial regression analysis\u003c/h2\u003e \u003cp\u003eGrowth indicators of red tilapia fed diets supplemented with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 showed consistent improvements over the eight-week trial (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). FW, WG, PWG, SGR, and DWG increased significantly as supplementation increased from 0 to 20 g/kg, peaking at 20 g/kg. However, these parameters declined slightly at 40 g/kg, suggesting a threshold effect.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGrowth performance and feed efficiency of red tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e x \u003cem\u003eO. mossambicus\u003c/em\u003e) fed diets supplemented with \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 over an eight-week feeding trial\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameter\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRY-0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRY-5\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRY-10\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRY-20\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRY-40\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInitial weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e21.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWeek 4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSurvival rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e98.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e98.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFinal weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43.12\u0026thinsp;\u0026plusmn;\u0026thinsp;1.76\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e43.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.85\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.46\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e43.39\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWeight gain (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21.45\u0026thinsp;\u0026plusmn;\u0026thinsp;1.78\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.06\u0026thinsp;\u0026plusmn;\u0026thinsp;1.86\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.57\u0026thinsp;\u0026plusmn;\u0026thinsp;1.40\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e21.69\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePercent weight gain (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e99.01\u0026thinsp;\u0026plusmn;\u0026thinsp;8.33\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e101.53\u0026thinsp;\u0026plusmn;\u0026thinsp;8.54\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e103.67\u0026thinsp;\u0026plusmn;\u0026thinsp;6.16\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e108.84\u0026thinsp;\u0026plusmn;\u0026thinsp;3.33\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e99.94\u0026thinsp;\u0026plusmn;\u0026thinsp;4.54\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePercentage specific growth rate (%.day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDaily weight gain (g.day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWeek 8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSurvival rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e96.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e98.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFinal weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70.80\u0026thinsp;\u0026plusmn;\u0026thinsp;6.02\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e79.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e85.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e92.37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e82.46\u0026thinsp;\u0026plusmn;\u0026thinsp;1.81\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWeight gain (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e49.13\u0026thinsp;\u0026plusmn;\u0026thinsp;6.04\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e63.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e70.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e60.76\u0026thinsp;\u0026plusmn;\u0026thinsp;1.85\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePercent weight gain (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e226.79\u0026thinsp;\u0026plusmn;\u0026thinsp;28.07\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e266.93\u0026thinsp;\u0026plusmn;\u0026thinsp;3.43\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e291.43\u0026thinsp;\u0026plusmn;\u0026thinsp;2.44\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e325.65\u0026thinsp;\u0026plusmn;\u0026thinsp;7.79\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e280.01\u0026thinsp;\u0026plusmn;\u0026thinsp;9.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePercentage specific growth rate (%.day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDaily weight gain (g.day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003cem\u003eData are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, different letters in a row indicate significant differences between treatments (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe RY-20 treatment resulted in the highest growth performance, significantly outperforming all other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared to the control, RY-20 showed increases of 1.3-fold in FW, 1.44-fold in WG and PWG, 1.22-fold in SGR, and 1.43-fold in DWG, identifying 20 g/kg as the optimal inclusion level. FCR was lowest in the RY-10 and RY-20 groups and highest in the control, though differences among groups were not statistically significant.\u003c/p\u003e \u003cp\u003ePolynomial regression analysis determined the optimal dietary inclusion levels for key parameters: FW peaked at 23.14 g/kg (adjusted R\u0026sup2; = 0.88, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), SGR at 23.77 g/kg (adjusted R\u0026sup2; = 0.85, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), and WG at 23.69 g/kg (adjusted R\u0026sup2; = 0.88, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Similarly, FCR decreased quadratically, achieving optimal feed efficiency at 23.61 g/kg (adjusted R\u0026sup2; = 0.94, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). These findings indicate that supplementation with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 at approximately 20\u0026ndash;24 g/kg optimizes growth performance and feed utilization efficiency in red tilapia.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Antioxidant and oxidative stress parameters\u003c/h2\u003e \u003cp\u003eThe antioxidant capacity and oxidative stress response of red tilapia fed diets supplemented with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 were evaluated using ABTS radical scavenging activity, SOD activity, and MDA content (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). ABTS radical scavenging increased significantly with red yeast supplementation (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Notably, fish fed the RY-20 diet exhibited the highest ABTS activity (74.73\u0026thinsp;\u0026plusmn;\u0026thinsp;2.78%), which was significantly higher than that of the control group (70.08\u0026thinsp;\u0026plusmn;\u0026thinsp;2.32%) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). A similar trend was observed for SOD activity, with the highest activity recorded in fish receiving the RY-20 diet (19.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47 U/mL), a significant increase compared to the control group (16.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.73 U/mL) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In contrast, MDA levels, an indicator of lipid peroxidation and oxidative stress, did not differ significantly among treatments (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), suggesting that red yeast supplementation did not substantially influence oxidative damage in the tested conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Histological characteristics of liver and intestine\u003c/h2\u003e \u003cp\u003eIntestinal tissue structure differed markedly among treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Fish in the RY-0 group exhibited shorter villi compared to those in other treatment groups. In contrast, villi in fish from the RY-5 to RY-40 groups were more elongated and extended further into the intestinal lumen, thereby providing greater surface area for nutrient absorption. Specifically, the RY-20 group demonstrated notably elongated villi characterized by narrower tips and a more uniform epithelial lining.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistological analysis of liver tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) revealed distinct differences among groups in hepatocyte cord organization, cellular boundary clarity, and the extent of vacuolation and lipid droplet accumulation. Liver tissue in the RY-0 group exhibited prominent vacuolation and lipid deposition, suggesting potential metabolic disruption. In contrast, liver tissues from fish in the RY-5, RY-10, RY-20, and RY-40 groups displayed more organized hepatocyte cords with mild to moderate vacuolation, indicative of an adaptive metabolic response to red yeast supplementation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Immune-related and antioxidant gene expression\u003c/h2\u003e \u003cp\u003eDietary supplementation with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 significantly influenced immune-related and antioxidant gene expression in red tilapia (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Among immune-related genes, \u003cem\u003eIL-1\u003c/em\u003e expression progressively increased with higher supplementation levels, peaking in the RY-20 group (2.36-fold compared to control; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Although slightly reduced in the RY-40 group, IL-1 expression remained statistically similar to RY-10. TNF expression was highest in the RY-20 group (2.73-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), significantly exceeding RY-0, RY-5, and RY-40, with a notable reduction observed in the RY-40 group, yet still above control levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilarly, \u003cem\u003eMHC\u003c/em\u003e expression peaked significantly in the RY-20 group (2.48-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), declining moderately in RY-40 but remaining higher than the control and statistically similar to RY-10. \u003cem\u003eLBP\u003c/em\u003e expression exhibited a comparable pattern, peaking significantly in RY-20 (2.74-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) but declining sharply in RY-40, indicating a threshold beyond which supplementation no longer enhances expression.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIGF\u003c/em\u003e, a regulator of growth and immune showed maximal expression in RY-20 (2.69-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), significantly higher than control and RY-5 groups. Expression decreased notably in RY-40, showing no significant difference from RY-10. Likewise, \u003cem\u003eHSP70\u003c/em\u003e expression was highest in RY-20 (2.47-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), significantly exceeding RY-0, RY-5, and RY-40.\u003c/p\u003e \u003cp\u003eAntioxidant gene expression also differed significantly across treatments. Expression of oxidative stress regulators \u003cem\u003eGSR\u003c/em\u003e and \u003cem\u003eGPX\u003c/em\u003e increased substantially with supplementation, peaking in RY-20. GSR expression (2.06-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) significantly surpassed control, RY-5, and RY-10 groups, whereas RY-40 expression declined to levels similar to RY-10. \u003cem\u003eGPX\u003c/em\u003e expression reached its highest level in RY-20 (3.43-fold; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), significantly exceeding all other groups, followed by a pronounced reduction in RY-40, significantly lower than RY-20 and RY-10 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.5. Pearson correlation between growth performance, antioxidant and oxidative stress parameters, and immune-related and antioxidant gene expression\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe correlation matrix (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) highlights significant positive and negative relationships among growth performance indicators, oxidative stress markers, and immune-related gene expression in red tilapia fed diets supplemented with \u003cem\u003eR. paludigena\u003c/em\u003e CM33. Red yeast supplementation exhibited a strong positive correlation with key growth parameters, including final weight (FW, r\u0026thinsp;=\u0026thinsp;0.46, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), weight gain (WG, r\u0026thinsp;=\u0026thinsp;0.45, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), percent weight gain (PWG, r\u0026thinsp;=\u0026thinsp;0.46, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and specific growth rate (SGR, r\u0026thinsp;=\u0026thinsp;0.45, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In contrast, FCR displayed a significant negative correlation with these growth metrics (r = -0.70 to -0.73, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that higher red yeast inclusion enhances feed efficiency and growth performance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor antioxidant responses, SOD activity was positively correlated with red yeast supplementation (r\u0026thinsp;=\u0026thinsp;0.27, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and growth parameters such as FW (r\u0026thinsp;=\u0026thinsp;0.41) and SGR (r\u0026thinsp;=\u0026thinsp;0.39). Conversely, MDA exhibited a weak negative correlation with red yeast supplementation (r = -0.16, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) and growth performance, suggesting a moderate reduction in oxidative stress. Additionally, ABTS radical scavenging activity showed a significant positive correlation with growth parameters, reinforcing the antioxidant benefits of dietary red yeast.\u003c/p\u003e \u003cp\u003eExpression of immune-related genes, including \u003cem\u003eIL-1, MHC, LBP, GSR, GPX\u003c/em\u003e, and \u003cem\u003eIGF\u003c/em\u003e, was significantly associated with growth performance and antioxidant responses. \u003cem\u003eMHC\u003c/em\u003e (r\u0026thinsp;=\u0026thinsp;0.68, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), \u003cem\u003eLBP\u003c/em\u003e (r\u0026thinsp;=\u0026thinsp;0.63, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and \u003cem\u003eGSR\u003c/em\u003e (r\u0026thinsp;=\u0026thinsp;0.67, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) exhibited strong positive correlations with FW, SGR, and PWG, suggesting that enhanced immune function may contribute to improved growth performance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.6. The survival rate in \u003cem\u003eAeromonas hydrophila\u003c/em\u003e challenge\u003c/h2\u003e \u003cp\u003eThe Kaplan-Meier survival curve (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) depicts the cumulative survival rates of \u003cem\u003eOreochromis niloticus\u003c/em\u003e fed diets supplemented with different concentrations of \u003cem\u003eR. paludigena\u003c/em\u003e CM33 following a pathogenic challenge with \u003cem\u003eA. hydrophila\u003c/em\u003e. Significant differences were observed among certain treatments (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Dietary supplementation with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 enhanced disease resistance, as fish in the RY-5, RY-10, RY-20, and RY-40 groups exhibited markedly higher survival rates than the negative control RY-0 (-) group. Among these, RY-20 had the highest survival, followed closely by RY-40, RY-10, and RY-5, all exceeding 60%. Pairwise comparisons indicated that survival in the RY-20 group was significantly higher than in negative control RY-0 (-) group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting an optimal protective effect at 20 g/kg inclusion level. However, no significant differences were detected between RY-20 and RY-40 (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), indicating a plateau effect at higher inclusion levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study demonstrates that dietary supplementation with \u003cem\u003eR. paludigena\u003c/em\u003e CM33 significantly enhances the growth performance of red tilapia. Specifically, increases in FW, WG, PWG, SGR, and DWG were observed at inclusion levels up to 20 g/kg. Pearson correlation analysis revealed significant positive correlations between red yeast supplementation and key growth performance parameters (r\u0026thinsp;=\u0026thinsp;0.45\u0026ndash;0.46, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while FCR exhibited a strong negative correlation with these parameters (r = -0.70 to -0.73, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting that higher red yeast inclusion enhances both growth and feed efficiency, consistent with previous research. Kaewda et al [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] reported that increasing doses of \u003cem\u003eR. paludigena\u003c/em\u003e CM33 significantly enhanced growth performance in flowerhorn cichlid (\u003cem\u003eAmphilophus labiatus\u003c/em\u003e \u003cb\u003e\u0026times;\u003c/b\u003e \u003cem\u003eCichlasoma trimaculatum\u003c/em\u003e), highlighting its potential as a functional feed additive. In shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e) both dried and live \u003cem\u003eRhodosporidium paludigenum\u003c/em\u003e supplementation improved WG, SGR, and survival rates [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Additionally, Wang et al [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] observed significant increases in final body weight and SGR in sea cucumber (\u003cem\u003eApostichopus japonicus\u003c/em\u003e) supplemented with marine red yeast, reinforcing the general growth-promoting effects of yeast additives. Likewise, Linh et al [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] reported that koi carp fed 40 g/kg of red yeast exhibited significant improvements in WG, FW, and SGR compared to control groups.\u003c/p\u003e \u003cp\u003eThe beneficial effects of yeast supplementation may be attributed to several underlying mechanisms. Modulation of intestinal microflora and enhancement of gut morphology, such as increased villus integrity, likely contribute to more efficient nutrient digestion and absorption [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Consistent with this study, red tilapia fed the RY-20 diet exhibited elongated villi with narrower tips and a more uniform epithelial lining, indicative of improved intestinal functionality. Additionally, liver tissue analysis showed decreased lipid accumulation, suggesting an adaptive metabolic response to red yeast supplementation. The presence of bioactive compounds, including β-glucans, nucleic acids, MOS, and carotenoids (notably astaxanthin), further supports fish growth enhancement [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. However, Brunel et al [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] found no significant improvements in weight gain, length gain, FCR, SGR, condition factor, or hepatosomatic index in Arctic char (\u003cem\u003eSalvelinus alpinus\u003c/em\u003e) when oleaginous yeast (\u003cem\u003eLipomyces starkeyi\u003c/em\u003e) was used as a substitute for vegetable oil.\u003c/p\u003e \u003cp\u003eReactive oxygen species (ROS), natural byproducts of cellular metabolism, contribute to oxygen toxicity in living organisms [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Excessive ROS accumulation induces oxidative stress leading to cellular and biomolecular damage through lipid peroxidation and protein oxidation [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this context, MDA is widely recognized oxidative stress maker associated with protein oxidation [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. To counteract ROS-induced damage, organisms rely on an antioxidant defense system comprising enzymatic antioxidants, such as SOD and non-enzymatic mechanisms, including ABTS radical scavenging activity [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In this study, fish fed the RY-20 diet exhibited the highest ABTS and SOD activities, whereas MDA levels did not differ significantly among treatments. Antioxidant responses played a key role in the beneficial effects of \u003cem\u003eR. paludigena\u003c/em\u003e CM33 supplementation. Specifically, SOD activity showed a significant positive correlation with both red yeast supplementation (r\u0026thinsp;=\u0026thinsp;0.27, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and growth parameters (FW, r\u0026thinsp;=\u0026thinsp;0.41; SGR, r\u0026thinsp;=\u0026thinsp;0.39; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Although MDA content displayed a weak negative correlation with red yeast supplementation (r = -0.16, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), the strong positive correlation between ABTS radical scavenging activity and growth parameters supports the role of dietary \u003cem\u003eR. paludigena\u003c/em\u003e CM33 in enhancing the antioxidant defense system and mitigating oxidative stress [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. These findings align with previous studies demonstrating the antioxidant benefits of yeast supplementation in various aquatic species. Kaewda et al [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] reported improved antioxidant activity in flowerhorn cichlid, while Zheng et al [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] observed similar benefits in Pacific white shrimp. Likewise, studies on rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], and turbot (\u003cem\u003eScophthalmus maximus\u003c/em\u003e) [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] consistently demonstrate that yeast supplementation enhances antioxidant capacity, reinforcing our findings.\u003c/p\u003e \u003cp\u003eProbiotics enhance immune responses by stimulating cytokine production, strengthening host defense, and facilitating pathogen elimination [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Key inflammatory mediators such as \u003cem\u003eIL-1\u003c/em\u003e, and \u003cem\u003eTNF-α\u003c/em\u003e regulate immune function and serve as indicators of inflammatory status [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Class II MHC molecules mediate antigen recognition in immune cells, playing a crucial role in pathogen defense [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Similarly, LBP is essential for acute-phase immune responses against gram-negative bacteria, enhancing both innate and adaptive immunity in fish [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Additionally, heat shock protein 70 (HSP70) supports immune protection, cell viability, and stress tolerance by regulating protein metabolism [\u003cspan additionalcitationids=\"CR59\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. In this study, dietary supplementation with RY significantly upregulated the expression of several key inflammatory response genes, including \u003cem\u003eIL-1, MHC, LBP, HSP70\u003c/em\u003e, and \u003cem\u003eTNF-α\u003c/em\u003e in red tilapia. The expression of immune-related genes (\u003cem\u003eIL-1, MHC, LBP, GSR, GPx\u003c/em\u003e, and \u003cem\u003eIGF\u003c/em\u003e) correlated with growth performance and antioxidant responses. Notably, \u003cem\u003eMHC\u003c/em\u003e (r\u0026thinsp;=\u0026thinsp;0.68, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), \u003cem\u003eLBP\u003c/em\u003e (r\u0026thinsp;=\u0026thinsp;0.63, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and \u003cem\u003eGSR\u003c/em\u003e (r\u0026thinsp;=\u0026thinsp;0.67, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were strongly associated with FW, SGR, and PWG, suggesting that enhanced immune function contributed to improved growth performance. This immune enhancement may be attributed to the probiotic properties of red yeast, which produces bactericidal compounds such as bacteriocins and lysozymes that inhibit pathogenic bacteria and stimulate cytokine production [\u003cspan additionalcitationids=\"CR62\" citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Additionally, β-glucan in red yeast enhances the immune system by increasing lysozyme activity, elevating phagocytic cell counts, and activating the complement pathway. It also stimulates cytokine expression, further amplifying the overall immune response [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. \u003cem\u003eIGF\u003c/em\u003e plays a critical role in promoting growth and development in fish [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. fish fed the RY-20 diet exhibited the highest \u003cem\u003eIGF\u003c/em\u003e expression levels, which strongly correlated with improved growth performance after an eight-week feeding trial. This finding highlights \u003cem\u003eIGF\u003c/em\u003e as the primary mediator of growth hormone effects, facilitating growth through cell proliferation and differentiation [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. \u003cem\u003eIGF\u003c/em\u003e regulates protein and lipid metabolism, which is crucial for maintaining growth and overall health, and has been linked to enhanced feed conversion efficiency and muscle growth [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. Additionally, ROS scavenging is closely linked to both enzymatic and non-enzymatic antioxidant systems [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. \u003cem\u003eGPx\u003c/em\u003e and \u003cem\u003eGSR\u003c/em\u003e play complementary roles in eliminating hydrogen peroxide (H₂O₂), with \u003cem\u003eGPx\u003c/em\u003e catalyzing its reduction into water by converting glutathione (GSH) into glutathione disulfide (GSSG), while GSR regenerates GSH from GSSG through NADPH oxidation-reduction [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. Our findings indicate that dietary RY supplementation significantly upregulated \u003cem\u003eGPx\u003c/em\u003e and \u003cem\u003eGSR\u003c/em\u003e transcription in the intestine of red tilapia, suggesting enhanced antioxidant defense capacity and greater resilience against oxidative stress.\u003c/p\u003e \u003cp\u003eThe Kaplan-Meier survival analysis following \u003cem\u003eA. hydrophila\u003c/em\u003e challenge further substantiated the benefits of RY supplementation. Fish fed \u003cem\u003eR. paludigena\u003c/em\u003e CM33 diets demonstrated significantly higher survival rates than the negative control, with the RY-20 group exhibiting the highest survival (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results align with previous studies showing that yeast-based supplements enhance both growth and immune competence in aquatic species [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e, \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. Optimized yeast supplementation has been shown to improve growth metrics while bolstering resistance against pathogens. Moreover, the observed correlations between antioxidant enzyme activities and growth parameters reinforce the role of oxidative stress mitigation in improving fish health, performance, and disease resistance.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study demonstrates that \u003cem\u003eR. paludigena\u003c/em\u003e CM33 supplementation enhances growth, feed efficiency, and immune responses in red tilapia. Polynomial regression identified 24 g/kg as the optimal inclusion level, and the experiment confirmed that fish fed 20 g/kg exhibited the highest weight gain, specific growth rate, antioxidant capacity (ABTS, SOD), and immune-related gene expression. Histological analysis revealed improved intestinal morphology, characterized by elongated villi and a uniform epithelial lining, along with enhanced hepatocyte integrity. Additionally, survival against \u003cem\u003eA. hydrophila\u003c/em\u003e significantly increased, highlighting the protective effects of red yeast. These findings suggest that \u003cem\u003eR. paludigena\u003c/em\u003e CM33 supplementation at 20\u0026ndash;24 g/kg is a promising strategy for improving aquaculture productivity and health, warranting further research for commercial application.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNguyen Vu Linh\u003c/strong\u003e: Roles/Writing - Original draft, Methodology, Investigation, Conceptualization, Data curation, Funding acquisition, and Project administration. \u003cstrong\u003eLuu Tang Phuc Khang:\u003c/strong\u003e Roles/Writing - Original draft, Formal analysis, Data curation. \u003cstrong\u003eNguyen Dinh-Hung\u003c/strong\u003e: Roles/Writing - Original draft, Writing-Review \u0026amp; Editing. \u003cstrong\u003eSuwanna Wisetkaew\u003c/strong\u003e: Methodology, Investigation. \u003cstrong\u003ePhan Do Trong Nghia\u003c/strong\u003e: Writing-Review \u0026amp; Editing. \u003cstrong\u003ePapungkorn Sangsawad\u003c/strong\u003e:\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eMethodology, Writing-Review \u0026amp; Editing.\u0026nbsp;\u003cstrong\u003eSatid Chatchaiphan\u003c/strong\u003e: Formal analysis, Writing-Review \u0026amp; Editing.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePatima Permpoonpatana\u003cstrong\u003e:\u003c/strong\u003e\u003c/strong\u003e Supervision, Validation, Writing-Review \u0026amp; Editing. \u003cstrong\u003eMintra Seel-audom\u003c/strong\u003e: Roles/Writing - Original draft, Methodology, Investigation, Conceptualization, Data curation, Supervision, Validation.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe research was partially supported by Faculty of Agriculture, Chiang Mai University, Chiang Mai, Thailand.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal ethics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments in this study were conducted in accordance with the relevant guidelines and regulations. The experimental protocols were approved by the Institutional Animal Care and Use Committee, Prince of Songkla University (Approval Ref. AG21/2025). All the procedure followed the ARRIVE guidelines.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eM. Amin, L. Musdalifah, M. Ali, Growth performances of Nile Tilapia, Oreochromis niloticus, reared in recirculating aquaculture and active suspension systems, IOP Conference Series: Earth and Environmental Science, IOP Publishing, 2020, p. 012135.\u003c/li\u003e\n\u003cli\u003eM.A. Naiel, E.-S.H. Eissa, Y.M. Abd El-Aziz, S. Saadony, H.E. Abd Elnabi, S.E.-S. Sakr, The assessment of different dietary selenium resources on reproductive performance, spawning indicators, and larval production of red tilapia (Oreochromis mossambicus\u0026times; O. niloticus) broodfish, Aquaculture Nutrition 2023(1) (2023) 5596619.\u003c/li\u003e\n\u003cli\u003eR. Pomeroy, M.M. Dey, N. Plesha, The social and economic impacts of semi-intensive aquaculture on biodiversity, Aquaculture Economics \u0026amp; Management 18(3) (2014) 303-324.\u003c/li\u003e\n\u003cli\u003eM.L. Rahman, M. Shahjahan, N. Ahmed, Tilapia farming in Bangladesh: Adaptation to climate change, Sustainability 13(14) (2021) 7657.\u003c/li\u003e\n\u003cli\u003eS.A. El Gamal, R.S. Adawy, V.H. Zaki, E. Zahran, Host\u0026ndash;pathogen interaction unveiled by immune, oxidative stress, and cytokine expression analysis to experimental Saprolegnia parasitica infection in Nile tilapia, Scientific Reports 13(1) (2023) 9888.\u003c/li\u003e\n\u003cli\u003eK.F. Tang, M.G. Bondad-Reantaso, W. Surachetpong, H.T. Dong, N. Fejzic, Q. Wang, N. Wajsbrot, B. Hao, Tilapia lake virus disease strategy manual, Food \u0026amp; Agriculture Org.2021.\u003c/li\u003e\n\u003cli\u003eP. Kayansamruaj, N. Dinh-Hung, P. Srisapoome, U. Na-Nakorn, S. Chatchaiphan, Genomics-driven prophylactic measures to increase streptococcosis resistance in tilapia, Journal of Fish Diseases 46(6) (2023) 597-610.\u003c/li\u003e\n\u003cli\u003eP. Nicholson, N. Mon-On, P. Jaemwimol, P. Tattiyapong, W. Surachetpong, Coinfection of tilapia lake virus and Aeromonas hydrophila synergistically increased mortality and worsened the disease severity in tilapia (Oreochromis spp.), Aquaculture 520 (2020) 734746.\u003c/li\u003e\n\u003cli\u003eI.H. Igbinosa, A. Beshiru, E.E. Odjadjare, C.N. Ateba, E.O. Igbinosa, Pathogenic potentials of Aeromonas species isolated from aquaculture and abattoir environments, Microbial pathogenesis 107 (2017) 185-192.\u003c/li\u003e\n\u003cli\u003eM.G. Bondad‐Reantaso, B. MacKinnon, I. Karunasagar, S. Fridman, V. Alday‐Sanz, E. Brun, M. Le Groumellec, A. Li, W. Surachetpong, I. Karunasagar, Review of alternatives to antibiotic use in aquaculture, Reviews in aquaculture 15(4) (2023) 1421-1451.\u003c/li\u003e\n\u003cli\u003eE.S. Okeke, K.I. Chukwudozie, R. Nyaruaba, R.E. Ita, A. Oladipo, O. Ejeromedoghene, E.O. Atakpa, C.V. Agu, C.O. Okoye, Antibiotic resistance in aquaculture and aquatic organisms: a review of current nanotechnology applications for sustainable management, Environmental Science and Pollution Research 29(46) (2022) 69241-69274.\u003c/li\u003e\n\u003cli\u003eF.M. Elshaghabee, N. Rokana, Dietary management by probiotics, prebiotics and synbiotics for the prevention of antimicrobial resistance, Sustainable Agriculture Reviews 49: Mitigation of Antimicrobial Resistance Vol 2. Natural and Synthetic Approaches (2021) 33-56.\u003c/li\u003e\n\u003cli\u003eA.J. Onomu, G.E. Okuthe, The role of functional feed additives in enhancing aquaculture sustainability, Fishes 9(5) (2024) 167.\u003c/li\u003e\n\u003cli\u003eE. Amenyogbe, Application of probiotics for sustainable and environment-friendly aquaculture management-A review, Cogent Food \u0026amp; Agriculture 9(1) (2023) 2226425.\u003c/li\u003e\n\u003cli\u003eA.R. Lubis, M.A.A. Sumon, N. Dinh-Hung, A.K. Dhar, J. Delamare-Deboutteville, D.-H. Kim, A.P. Shinn, D. Kanjanasopa, P. Permpoonpattana, H.V. Doan, N.V. Linh, C.L. Brown, Review of quorum-quenching probiotics: A promising non-antibiotic-based strategy for sustainable aquaculture, Journal of Fish Diseases 47(7) (2024) e13941.\u003c/li\u003e\n\u003cli\u003eN. Richard, B. Costas, M. Machado, S. Fern\u0026aacute;ndez-Boo, A. Girons, J. Dias, G. Corraze, F. Terrier, Y. Marchand, S. Skiba-Cassy, Inclusion of a protein-rich yeast fraction in rainbow trout plant-based diet: Consequences on growth performances, flesh fatty acid profile and health-related parameters, Aquaculture 544 (2021) 737132.\u003c/li\u003e\n\u003cli\u003eS.S. Hashemi, K. Karimi, M.J. Taherzadeh, Integrated process for protein, pigments, and biogas production from baker\u0026apos;s yeast wastewater using filamentous fungi, Bioresource technology 337 (2021) 125356.\u003c/li\u003e\n\u003cli\u003eM.A. Siddik, M.J. Foysal, R. Fotedar, D.S. Francis, S.K. Gupta, Probiotic yeast Saccharomyces cerevisiae coupled with Lactobacillus casei modulates physiological performance and promotes gut microbiota in juvenile barramundi, Lates calcarifer, Aquaculture 546 (2022) 737346.\u003c/li\u003e\n\u003cli\u003eP. Zhang, F. Yang, J. Hu, D. Han, H. Liu, J. Jin, Y. Yang, J. Yi, X. Zhu, S. Xie, Optimal form of yeast cell wall promotes growth, immunity and disease resistance in gibel carp (Carassius auratus gibelio), Aquaculture Reports 18 (2020) 100465.\u003c/li\u003e\n\u003cli\u003eN.V. Linh, S. Wannavijit, M.A.A. Sumon, K. Tayyamath, N. Dinh-Hung, C.L. Brown, T. Nititanarapee, P. Permpoonpattana, W. Tapingkae, O. Srinual, H. Van Doan, Immunomodulatory and growth-promoting effects of supplementing red yeast (Sporidiobolus pararoseus) in fish meal-based diets for koi carp (Cyprinus carpio var. koi) cultured in a biofloc system, Aquaculture International 33(1) (2024) 17.\u003c/li\u003e\n\u003cli\u003eC. Gosalawit, S. Imsoonthornruksa, N. Udomsil, M. Ketudat-Cairns, Genome sequence of the Oleaginous yeast Rhodotorula paludigena strain CM33, a potential strain for biofuel production, Microbiology Resource Announcements 9(19) (2020) 10.1128/mra. 00286-20.\u003c/li\u003e\n\u003cli\u003eJ. Kaewda, P. Sangsawad, S. Boonanuntanasarn, P. Manassila, A. Boontawan, M. Ketudat‑Cairns, C. Sriphuttha, C. Nakharuthai, Effects of Probiotics Red Yeast Rhodotorula paludigena CM33 on enhancing color pigmentation, antioxidant activity, immune response, intestinal microbiota, and growth in a commercial ornamental fish: Flowerhorn fish, Aquaculture Reports 40 (2025) 102609.\u003c/li\u003e\n\u003cli\u003eC. Sriphuttha, S. Limkul, J. Pongsetkul, T. Phiwthong, A. Massu, N. Sumniangyen, P. Boontawan, M. Ketudat-Cairns, A. Boontawan, P. Boonchuen, Effect of fed dietary yeast (Rhodotorula paludigena CM33) on shrimp growth, gene expression, intestinal microbial, disease resistance, and meat composition of Litopenaeus vannamei, Developmental \u0026amp; Comparative Immunology 147 (2023) 104896.\u003c/li\u003e\n\u003cli\u003eG. AOAC, Official methods of analysis of AOAC International. Rockville, MD: AOAC International, ISBN: 978-0-935584-87-5, 2016.\u003c/li\u003e\n\u003cli\u003eN.V. Linh, A.R. Lubis, N. Dinh-Hung, S. Wannavijit, N. Montha, C.M. Fontana, P. Lengkidworraphiphat, O. Srinual, W.-K. Jung, M. Paolucci, H.V. Doan, Effects of Shrimp Shell-Derived Chitosan on Growth, Immunity, Intestinal Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus) Reared in a Biofloc System, Marine Drugs 22(4) (2024) 150.\u003c/li\u003e\n\u003cli\u003eN.V. Linh, S. Wannavijit, K. Tayyamath, N. Dinh-Hung, T. Nititanarapee, M.A.A. Sumon, O. Srinual, P. Permpoonpattana, H.V. Doan, C.L. Brown, Black Soldier Fly (Hermetia illucens) Larvae Meal: A Sustainable Alternative to Fish Meal Proven to Promote Growth and Immunity in Koi Carp (Cyprinus carpio var. koi), Fishes 9(2) (2024) 53.\u003c/li\u003e\n\u003cli\u003eY. Avnimelech, Carbon/nitrogen ratio as a control element in aquaculture systems, Aquaculture 176(3) (1999) 227-235.\u003c/li\u003e\n\u003cli\u003eN.V. Linh, S. Wannavijit, M.A.A. Sumon, K. Tayyamath, N. Dinh-Hung, C.L. Brown, T. Nititanarapee, P. Permpoonpattana, W. Tapingkae, O. Srinual, Immunomodulatory and growth-promoting effects of supplementing red yeast (Sporidiobolus pararoseus) in fish meal-based diets for koi carp (Cyprinus carpio var. koi) cultured in a biofloc system, Aquaculture International 33(1) (2025) 1-19.\u003c/li\u003e\n\u003cli\u003eS. Boonkong, P. Luasiri, J. Pongsetkul, S. Suwanandgul, S. Chaipayang, W. Molee, P. Sangsawad, Exploring the utilization of bovine blood as a source of antioxidant peptide: Production, concentration, identification, and in silico gastrointestinal digestion, Food Science of Animal Resources 44(6) (2024) 1283.\u003c/li\u003e\n\u003cli\u003eT. Karatas, K. EM, Comparison of Paraoxonase activity, malondialdehyde and high-density lipoprotein levels in cultuvated normal and albino rainbow trout reared in the same conditions, Kafkas \u0026Uuml;niversitesi Veteriner Fak\u0026uuml;ltesi Dergisi 18(1) (2012).\u003c/li\u003e\n\u003cli\u003eN.V. Linh, N. Khongcharoen, D.-H. Nguyen, L.T. Dien, N. Rungrueng, C. Jhunkeaw, P. Sangpo, S. Senapin, T. Uttarotai, W. Panphut, S. St-Hilaire, H. Van Doan, H.T. Dong, Effects of hyperoxia during oxygen nanobubble treatment on innate immunity, growth performance, gill histology, and gut microbiome in Nile tilapia, Oreochromis niloticus, Fish \u0026amp; Shellfish Immunology 143 (2023) 109191.\u003c/li\u003e\n\u003cli\u003eK.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026minus;\u0026Delta;\u0026Delta;CT Method, Methods 25(4) (2001) 402-408.\u003c/li\u003e\n\u003cli\u003eM. Azzam-Sayuti, M.Y. Ina-Salwany, M. Zamri-Saad, S. Annas, M.T. Yusof, M.S. Monir, A. Mohamad, M.H.N. Muhamad-Sofie, J.Y. Lee, Y.K. Chin, Comparative pathogenicity of Aeromonas spp. in cultured red hybrid tilapia (Oreochromis niloticus\u0026times; O. mossambicus), Biology 10(11) (2021) 1192.\u003c/li\u003e\n\u003cli\u003eR. Yossa, M. Verdegem, Misuse of multiple comparison tests and underuse of contrast procedures in aquaculture publications, Aquaculture 437 (2015) 344-350.\u003c/li\u003e\n\u003cli\u003eS.-P. Yang, Z.-H. Wu, J.-C. Jian, X.-Z. Zhang, Effect of marine red yeast Rhodosporidium paludigenum on growth and antioxidant competence of Litopenaeus vannamei, Aquaculture 309(1-4) (2010) 62-65.\u003c/li\u003e\n\u003cli\u003eJ.-h. Wang, L.-q. Zhao, J.-f. Liu, H. Wang, S. Xiao, Effect of potential probiotic Rhodotorula benthica D30 on the growth performance, digestive enzyme activity and immunity in juvenile sea cucumber Apostichopus japonicus, Fish \u0026amp; shellfish immunology 43(2) (2015) 330-336.\u003c/li\u003e\n\u003cli\u003eQ. Wang, S. Ayiku, H. Liu, B. Tan, X. Dong, S. Chi, Q. Yang, S. Zhang, W. Zhou, Dietary yeast culture facilitates the growth, immune response, digestive enzyme activity, intestinal microbiota and disease resistance against Vibrio harveyi of hybrid grouper (Epinephelus fuscoguttatus♀\u0026times; Epinephelus lanceolatus♂), Aquaculture Research 53(6) (2022) 2484-2500.\u003c/li\u003e\n\u003cli\u003eN. Jahan, S.M. Islam, M.F. Rohani, M.T. Hossain, M. Shahjahan, Probiotic yeast enhances growth performance of rohu (Labeo rohita) through upgrading hematology, and intestinal microbiota and morphology, Aquaculture 545 (2021) 737243.\u003c/li\u003e\n\u003cli\u003eB.D. Glencross, D. Huyben, J.W. Schrama, The application of single-cell ingredients in aquaculture feeds\u0026mdash;a review, Fishes 5(3) (2020) 22.\u003c/li\u003e\n\u003cli\u003eK. Ghosh, R. Harikrishnan, A. Mukhopadhyay, E. Ring\u0026oslash;, Fungi and actinobacteria: alternative probiotics for sustainable aquaculture, Fishes 8(12) (2023) 575.\u003c/li\u003e\n\u003cli\u003eM. Brunel, V. Burkina, S. Sampels, A.-K. Dahlberg, V. Passoth, J. Pickova, Biomass of the oleaginous yeast Rhodotorula toruloides as feed ingredient in the diet of Arctic char (Salvelinus alpinus): impact on quality; safety and sensory outcome, Acta Agriculturae Scandinavica, Section A\u0026mdash;Animal Science 73(3-4) (2024) 130-142.\u003c/li\u003e\n\u003cli\u003eR.T. Di Giulio, J.N. Meyer, Reactive oxygen species and oxidative stress, The toxicology of fishes (2008) 273-324.\u003c/li\u003e\n\u003cli\u003eZ. Xu, J. Cao, X. Qin, W. Qiu, J. Mei, J. Xie, Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: a review, Animals 11(11) (2021) 3304.\u003c/li\u003e\n\u003cli\u003eQ. Gao, B. Liu, F. Shan, Z. Gu, C. Song, C. Sun, Q. Zhou, Effects of oxidized fish oil on digestive enzyme activity and antioxidant system in Macrobrachium rosenbergii post-larvae, Aquaculture Reports 23 (2022) 101062.\u003c/li\u003e\n\u003cli\u003eS. Jeong, J.-H. Jung, K.-W. Jung, S. Ryu, S. Lim, From microbes to molecules: a review of microbial-driven antioxidant peptide generation, World Journal of Microbiology and Biotechnology 40(1) (2024) 29.\u003c/li\u003e\n\u003cli\u003eX. Hu, W. Ma, D. Zhang, Z. Tian, Y. Yang, Y. Huang, Y. Hong, Application of Natural Antioxidants as Feed Additives in Aquaculture: A Review, Biology 14(1) (2025) 87.\u003c/li\u003e\n\u003cli\u003eL. Zheng, S. Xie, Z. Zhuang, Y. Liu, L. Tian, J. Niu, Effects of yeast and yeast extract on growth performance, antioxidant ability and intestinal microbiota of juvenile Pacific white shrimp (Litopenaeus vannamei), Aquaculture 530 (2021) 735941.\u003c/li\u003e\n\u003cli\u003eE.P. Kheirabadi, P.H. Shekarabi, F. Yadollahi, M. Soltani, E. Najafi, J. von Hellens, C.L. Flores, K. Salehi, C. Faggio, Red yeast (Phaffia rhodozyma) and its effect on growth, antioxidant activity and color pigmentation of rainbow trout (Oncorhynchus mykiss), Aquaculture Reports 23 (2022) 101082.\u003c/li\u003e\n\u003cli\u003eN. Mashhadizadeh, S. Khezri, D.E. Esfahani, S. Mohammadzadeh, E. Ahmadifar, M. Ahmadifar, M.S. Moghadam, E. El-Haroun, Enhancing growth performance, antioxidant defense, immunity response, and resistance against heat stress in Nile Tilapia (Oreochromis niloticus) fed Saccharomyces boulardii and/or Bifidobacterium bifidum, Aquaculture Reports 39 (2024) 102462.\u003c/li\u003e\n\u003cli\u003eM. Abdel-Tawwab, I. Adeshina, Z.A. Issa, Antioxidants and immune responses, resistance to Aspergilus flavus infection, and growth performance of Nile tilapia, Oreochromis niloticus, fed diets supplemented with yeast, Saccharomyces serevisiae, Animal Feed Science and Technology 263 (2020) 114484.\u003c/li\u003e\n\u003cli\u003eJ. Sun, Y. Li, T. Ren, Q. Gao, L. Yin, Y. Liang, H. Liu, Effects of yeast extract supplemented in diet on growth performance, digestibility, intestinal histology, and the antioxidant capacity of the juvenile turbot (Scophthalmus maximus), Frontiers in Physiology 15 (2024) 1329721.\u003c/li\u003e\n\u003cli\u003eS.K. Nayak, Probiotics and immunity: a fish perspective, Fish \u0026amp; shellfish immunology 29(1) (2010) 2-14.\u003c/li\u003e\n\u003cli\u003eS. Roy, V. Kumar, V. Kumar, B. Behera, Acute phase proteins and their potential role as an indicator for fish health and in diagnosis of fish diseases, Protein and peptide letters 24(1) (2017) 78-89.\u003c/li\u003e\n\u003cli\u003eX. Li, H. Du, L. Liu, X. You, M. Wu, Z. Liao, MHC class II alpha, beta and MHC class II-associated invariant chains from Chinese sturgeon (Acipenser sinensis) and their response to immune stimulation, Fish \u0026amp; Shellfish Immunology 70 (2017) 1-12.\u003c/li\u003e\n\u003cli\u003eA. Cuesta, M.\u0026Aacute;. Esteban, J. Meseguer, Cloning, distribution and up-regulation of the teleost fish MHC class II alpha suggests a role for granulocytes as antigen-presenting cells, Molecular immunology 43(8) (2006) 1275-1285.\u003c/li\u003e\n\u003cli\u003eN. Nithikulworawong, W. Jiwyam, The Immunostimulatory Potential and Resistance Aeromonas hydrophila of Pineapple Peel Extract in Nile Tilapia (Oreochromis niloticus), Aquaculture Studies 24(5) (2024).\u003c/li\u003e\n\u003cli\u003eM.G. Scott, R.E. Hancock, Cationic antimicrobial peptides and their multifunctional role in the immune system, Critical Reviews\u0026trade; in Immunology 20(5) (2000).\u003c/li\u003e\n\u003cli\u003eS. Jeyachandran, H. Chellapandian, K. Park, I.-S. Kwak, A review on the involvement of heat shock proteins (extrinsic chaperones) in response to stress conditions in aquatic organisms, Antioxidants 12(7) (2023) 1444.\u003c/li\u003e\n\u003cli\u003eL.L. Wong, D.T. Do, The role of heat shock proteins in response to extracellular stress in aquatic organisms, Heat shock proteins in veterinary medicine and sciences, Springer2018, pp. 247-274.\u003c/li\u003e\n\u003cli\u003eS. Elbahnaswy, G.E. Elshopakey, A.A. Abdelwarith, E.M. Younis, S.J. Davies, M.A. El-Son, Immune protective, stress indicators, antioxidant, histopathological status, and heat shock protein gene expression impacts of dietary Bacillus spp. against heat shock in Nile tilapia, Oreochromis niloticus, BMC Veterinary Research 20(1) (2024) 469.\u003c/li\u003e\n\u003cli\u003eG. Moonsamy, Y. Roets-Dlamini, C.N. Langa, S.O. Ramchuran, Advances in Yeast Probiotic Production and Formulation for Preventative Health, Microorganisms 12(11) (2024) 2233.\u003c/li\u003e\n\u003cli\u003eN. Akhter, B. Wu, A.M. Memon, M. Mohsin, Probiotics and prebiotics associated with aquaculture: a review, Fish \u0026amp; shellfish immunology 45(2) (2015) 733-741.\u003c/li\u003e\n\u003cli\u003eM.D. Ibrahem, Evolution of probiotics in aquatic world: Potential effects, the current status in Egypt and recent prospectives, Journal of advanced research 6(6) (2015) 765-791.\u003c/li\u003e\n\u003cli\u003eS. Reyes-Cerpa, E. Vallejos-Vidal, M.J. Gonzalez-Bown, J. Morales-Reyes, D. P\u0026eacute;rez-Stuardo, D. Vargas, M. Imarai, V. Cifuentes, E. Spencer, A.M. Sandino, Effect of yeast (Xanthophyllomyces dendrorhous) and plant (Saint John\u0026apos;s wort, lemon balm, and rosemary) extract based functional diets on antioxidant and immune status of Atlantic salmon (Salmo salar) subjected to crowding stress, Fish \u0026amp; shellfish immunology 74 (2018) 250-259.\u003c/li\u003e\n\u003cli\u003eJ.J. Ching, A.S. Shuib, N. Abdul Majid, N. Mohd Taufek, Immunomodulatory activity of \u0026beta;‐glucans in fish: Relationship between \u0026beta;‐glucan administration parameters and immune response induced, Aquaculture Research 52(5) (2021) 1824-1845.\u003c/li\u003e\n\u003cli\u003eS. Chandhini, B. Trumboo, S. Jose, T. Varghese, M. Rajesh, V.R. Kumar, Insulin-like growth factor signalling and its significance as a biomarker in fish and shellfish research, Fish Physiology and Biochemistry 47(4) (2021) 1011-1031.\u003c/li\u003e\n\u003cli\u003eL. Xue, Y. Gao, S. Zhang, M. Weng, G. Zeng, J. Chen, M. Liao, S.M.H. Alavi, Y. Guiguen, Expression pattern of the fused in sarcoma gene and its contextual influence on the density-specific response of the growth hormone/insulin-like growth factor 1 axis in zig-zag eels (Mastacembelus armatus), Frontiers in Marine Science 11 (2024) 1461451.\u003c/li\u003e\n\u003cli\u003eC.B. Ndandala, M. Dai, U.F. Mustapha, X. Li, J. Liu, H. Huang, G. Li, H. Chen, Current research and future perspectives of GH and IGFs family genes in somatic growth and reproduction of teleost fish, Aquaculture Reports 26 (2022) 101289.\u003c/li\u003e\n\u003cli\u003eR.E. Ibrahim, S.A. Tolba, E.M. Younis, A.-W.A. Abdel-Warith, S.I. Shalaby, A. Osman, T. Khamis, M.A. Eissa, S.J. Davies, S.A. Amer, Kidney bean protein hydrolysate as a fish meal replacer: Effects on growth, digestive enzymes, metabolic functions, immune-antioxidant parameters and their related gene expression, intestinal and muscular gene expression, Aquaculture 575 (2023) 739803.\u003c/li\u003e\n\u003cli\u003eS. Yang, Z. Liu, Z. Yan, Z. Zhao, C. Zhang, Q. Gong, X. Du, J. Wu, Y. Feng, J. Du, Improvement of skeletal muscle growth by GH/IGF growth-axis contributes to growth performance in commercial fleshy sturgeon, Aquaculture 543 (2021) 736929.\u003c/li\u003e\n\u003cli\u003eE. Amenyogbe, E.K. Droepenu, C.L. Ayisi, G.A. Boamah, R.Q. Duker, E.D. Abarike, J.-s. Huang, Impact of probiotics, prebiotics, and synbiotics on digestive enzymes, oxidative stress, and antioxidant defense in fish farming: current insights and future perspectives, Frontiers in Marine Science 11 (2024) 1368436.\u003c/li\u003e\n\u003cli\u003eH. Imai, Y. Nakagawa, Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells, Free Radical Biology and Medicine 34(2) (2003) 145-169.\u003c/li\u003e\n\u003cli\u003eA. Perdichizzi, M. Meola, L. Caccamo, G. Caruso, F. Gai, G. Maricchiolo, Live yeast (Saccharomyces cerevisiae var. boulardii) supplementation in a European Sea Bass (Dicentrarchus labrax) diet: effects on the growth and immune response parameters, Animals 13(21) (2023) 3383.\u003c/li\u003e\n\u003cli\u003eM. Gokulakrishnan, R. Kumar, B.R. Pillai, S. Nanda, S. Bhuyan, R. Kumari, J. Debbarma, S. Ferosekhan, G. Siddaiah, J.K. Sundaray, Dietary brewer\u0026rsquo;s spent yeast enhances growth, hematological parameters, and innate immune responses at reducing fishmeal concentration in the diet of climbing perch, Anabas testudineus fingerlings, Frontiers in Nutrition 9 (2022) 982572.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Chiang Mai University","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Aeromonas hydrophila, dietary supplement, immune enhancement, Rhodotorula paludigena CM33, red tilapia","lastPublishedDoi":"10.21203/rs.3.rs-6568606/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6568606/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDietary supplementation with red yeast (RY) has been proposed to enhance immunity and disease resistance in fish; however, its effects in red tilapia remain underexplored. This study evaluated the impact of \u003cem\u003eRhodotorula paludigena\u003c/em\u003e CM33 on growth performance, immune responses, liver and intestinal histology, gene expression, and resistance to \u003cem\u003eAeromonas hydrophila\u003c/em\u003e in red tilapia. A total of 300 fish were assigned to five dietary groups: RY-0 (control), RY-5 (5 g/kg), RY-10 (10 g/kg), RY-20 (20 g/kg), and RY-40 (40 g/kg). Growth performance was assessed at weeks 4 and 8. At week 8, blood serum, liver, and intestinal samples were collected for histological and gene expression analyses. Fish were then challenged with \u003cem\u003eA. hydrophila\u003c/em\u003e at an LD₅₀ dose of 10⁵ CFU/fish via intraperitoneal injection. Results showed that \u003cem\u003eR. paludigena\u003c/em\u003e CM33 significantly improved growth performance, with polynomial regression identifying\u0026thinsp;~\u0026thinsp;24 g/kg as optimal, and experimental fish fed 20 g/kg achieved the highest weight, gain, and feed efficiency. Antioxidant and immune responses were enhanced, as evidenced by increased ABTS radical scavenging activity, superoxide dismutase activity, and upregulation of immune-related and antioxidant genes (\u003cem\u003eIL1, MHC, LBP, GSR, GPX, IGF, HSP70\u003c/em\u003e, and \u003cem\u003eTNF\u003c/em\u003e). Histological analysis revealed enhanced intestinal structure and hepatocyte integrity, with RY-20 fish exhibiting elongated villi and reduced hepatic vacuolation compared to the control. Kaplan-Meier survival analysis confirmed greater resistance to \u003cem\u003eA. hydrophila\u003c/em\u003e at the 20 g/kg inclusion level. These findings highlight \u003cem\u003eR. paludigena\u003c/em\u003e CM33 as a promising dietary supplement for enhancing growth, immune function, and disease resistance in red tilapia.\u003c/p\u003e","manuscriptTitle":"Supplementation of Rhodotorula paludigena CM33 in Feed as Probiotic Enhances Growth, Immunity, Gene Expression, and Disease Resistance to Aeromonas hydrophila in Red tilapia (Oreochromis niloticus × O. mossambicus)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-02 08:24:48","doi":"10.21203/rs.3.rs-6568606/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"08463b1d-36ea-477f-afff-12579d30b9f1","owner":[],"postedDate":"May 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":47934285,"name":"Aquaculture and Mariculture"}],"tags":[],"updatedAt":"2025-05-02T08:24:48+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-02 08:24:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6568606","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6568606","identity":"rs-6568606","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}