Characterization of an unusual tobacco rattle virus isolate and a novel phenuivirid in the Jerusalem sage

Characterization of an unusual tobacco rattle virus isolate and a novel phenuivirid in the Jerusalem sage | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Characterization of an unusual tobacco rattle virus isolate and a novel phenuivirid in the Jerusalem sage Mathieu Mahillon, Nathalie Dubuis, Justine Brodard, Isabelle Kellenberger, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6578422/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Aug, 2025 Read the published version in Virology Journal → Version 1 posted 10 You are reading this latest preprint version Abstract Two RNA viruses were identified by high-throughput sequencing analysis of leaf samples of Jerusalem sages ( Phlomis fruticosa ) in Switzerland. The first virus, representing a novel isolate of tobacco rattle virus (TRV) named "Phlo", was identified in symptomatic plants but not in healthy ones. Phlo is distinguished by its exceptionally long RNA2 that harbours two ORFs preceding the CP ORF. This peculiar genetic make-up is shared by a set of closely-related European TRV RNA2s, and it could be associated with host-specific systemic infection ability. The second virus, detected both in symptomatic and asymptomatic sages, is a novel member of the family Phenuiviridae named "Phlomis phenuivirus 1" (PPV1). PPV1 exhibits a “cogu-like” architecture with a probable bi-segmented, ambisense RNA genome encoding a replicase, nucleocapsid, and putative movement protein (MP). PPV1 is related to Muscari virus A, a virus identified in an ornamental in Australia, and together they likely constitute a new genus for which the name "Maladivirus" is proposed. This taxon represents a sister clade of the genus Entovirus , whose members have been identified in a fungus and diverse environmental samples. Intriguingly, the putative MPs of maladiviruses and entoviruses cluster with those of lentinuviruses (i.e. cogu-like mycoviruses) and with putative endogenous viral elements from a mycorrhizal fungus, suggesting a role in fungal hosts. bunyaviricetes coguvirus entovirus phenuiviridae phlomis tobravirus TRV virgaviridae Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Advances in high-throughput sequencing (HTS) technologies have revolutionized plant virology. HTS allows for the unbiased analysis of nucleic acids, which is particularly relevant in the cases of untransmissible and/or latent phytoviruses that would be otherwise omitted by traditional diagnostics methods. HTS has therefore significantly expanded the known plant virome ( 1 ), and becomes increasingly popular in routine phytosanitary analyses as costs decrease ( 2 ). Here, we used HTS to investigate the etiology of diseased plants of the Jerusalem sage ( Phlomis fruticosa ), an ornamental in the family Lamiaceae . Native to the eastern Mediterranean regions, this evergreen shrub is widely grown across Europe for its attractive yellow flowers. This species can readily propagate over several years in temperate areas, which favors a potential role as pathogen reservoir. So far, the sole virus identified in Jerusalem sage is Phlomis mottle virus (PhMV), a trichovirus discovered in Italy ( 3 ). Our HTS analysis of symptomatic Jerusalem sages revealed the mixed infection of an atypical isolate of tobacco rattle virus (TRV, Tobravirus tabaci ) and a novel virus belonging to the family Phenuiviridae . TRV is a member of the genus Tobravirus (family Virgaviridae ; order Martellivirales ) which also accommodates pea early-browning virus (PEBV, Tobravirus pisi ) and pepper ringspot virus (PRV, Tobravirus capsica ) ( 4 ). The history of TRV dates back to the late 1890s in Germany, when the “Mauche” disease was first reported on tobacco ( 5 ). Nowadays, although TRV is best known as a versatile biotechnology tool ( 6 ), it still remains problematic on ornamentals and crops such as potato. TRV is ubiquitous in many agricultural soils worldwide, inducing latent to strongly symptomatic infections ( 7 ). Its host range is exceptionally high, encompassing over 400 plant species from 50 families ( 7 ). The virus is transmitted by nematodes from the genera Paratrichodorus and Trichodorus , and actively attracts these vectors through modulation of plant root volatiles ( 8 ). Transmission can also occur via seeds ( 9 ). TRV genome consists of two positive sense, single-stranded RNAs (RNA1 and 2) encapsidated in rod-shaped virions ( 10 ). Both RNAs are 5’-capped and end by a tRNA structure (11). RNA1 encodes the RNA-dependant RNA polymerase (RdRp) subunits, a movement protein (MP) and a cysteine-rich protein (CRP). Both the MP and CRP act as viral suppressors of RNA silencing ( 12 , 13 ), and a recent study has also highlighted a role in virion formation for the CRP ( 14 ). While TRV RNA1 is highly stable among isolates ( 6 ), RNA2 is prone to reassortment, recombination, insertion and deletion ( 15 ). Two main architectures have been described for this RNA. The most common architecture consists of the capsid protein (CP) ORF located in 5’ and followed by the ORFs encoding 2b and 2c, two proteins involved in nematode transmission ( 16 ). Some isolates exhibiting this architecture have shortened versions of 2b and/or 2c, and a few isolates have additional small ORFs in the 3’ region ( 17 ). The second RNA2 architecture, previously framed “rule-breaking” architecture, consists of the CP ORF preceded by one or several ORFs. It was first described for the “Spinach Yellow Mottle” (SYM) isolate in England in 1979, for which RNA2 harbours three CP-preceding ORFs encoding hypothetical proteins (HPs) ( 18 , 19 ). In 2014, the Polish isolate Mlo7 identified in potato was also predicted to encode a small CP-preceding HP closely related to one of SYM HPs ( 20 ). A similar architecture was found in 2015 for the German isolates Da and Db, both retrieved from strongly-symptomatic potato tubers, and encoding a CP-preceding HP of 35 kDa (35K) unrelated to SYM HPs ( 21 ). Last, the RNA2 of the isolate IFA65, first identified in Italy on pepper in the 1970s ( 22 ), has been recently sequenced, revealing a long CP-preceding ORF related to SYM HPs ( 22 ). The biological role of all these aforementioned CP-preceding ORFs remains unknown. The family Phenuiviridae (order Hareavirales ; class Bunyaviricetes ) accommodates viruses with negative and ambisense RNA infecting eukaryotes including humans ( 23 – 26 ). These viruses have segmented genomes encoding at least an RdRp and a nucleocapsid (N). While many phenuivirids produce glycoproteins (G) and are protected in an envelope, others are “naked” and appear as flexuous filaments consisting of genomic RNA associated with N proteins. This is the case for plant phenuivirids such as members of the genera Tenuivirus , Mechlorovirus , Coguvirus and Rubodvirus ( 27 – 31 ). In recent years, Phenuiviridae has greatly expanded through the accumulation of HTS data, which has led the International Committee on Taxonomy of Viruses (ICTV) to recognize several new “cogu-like” genera: Entovirus , Laulavirus , Lentinuvirus and Bocivirus . These viruses are presumably naked and encode an RdRp, N and putative MP that is structurally similar to proteins from the tobacco mosaic virus 30 kDa (30K) family ( 32 , 33 ). Cogu-like viruses have been retrieved from various eukaryotes (plants, fungi, arthropods) and environmental samples ( 34 – 39 ). Remarkably, a recent study has shown that the laulavirus “Valsa mali negative-strand RNA virus 1” (VmNSRV1) can be found in natural populations of fungi and plants, leading to its description as the first “phyto-mycovirus” ( 40 ). Material and method Plant material Leaves of healthy and symptomatic plants of Jerusalem sage were collected in a private garden in Lausanne (Switzerland), in proximity of the so-called “Maladière” area in August 2022. Symptomatic leaves were used for the mechanical inoculation of several indicator plant species. Briefly, a sap inoculum was produced by grinding leaves in cold phosphate buffer (1 mM diethyldithiocarbamate, 20 mM Na 2 HPO 4 , pH 7.6) in a mortar using a pestle. The resulting sap was rubbed on the first true leaves of indicator species using carborundum (400-mesh silicon carbide, Aldrich) as abrasive. Inoculated plants were maintained in greenhouses (24°C, 14/10 h photoperiod) for one month with daily inspections. Virion observation and inoculation For the visualisation of virions, a simplified protocol dedicated for the semi-purification of TRV particle was followed ( 41 ). Briefly, 10 g of symptomatic sage leaves were first ground in liquid nitrogen in a mortar using a pestle. The resulting powder was mixed with 20 ml of CP buffer (0.18 M McIlvaine buffer, pH 7) supplemented with 0.2% thioglycolic acid, and squeezed through a nylon filter cloth. One vol of diethylether: carbon tetrachloride was added, followed by slow mixing for 5 min. The phases were then separated by low-speed centrifugation (20 min, 4,000 rpm) and the upper phase was used for high-speed centrifugation (1 h, 40,000 rpm). The resulting pellet was suspended in 1 mL CP buffer. The low and high-speed centrifugation steps were repeated, and the final pellet was resuspended in 0.1 mL CP buffer. Particles were observed by transmission electron microscopy (TEM) using the Tecnai G2 Spirit electron microscope as previously described ( 42 ). Semi-purified particles were also used for plant inoculation as described in the previous section. RNA extraction and RT-PCR RNA extraction and RT-PCR Total RNA was extracted from 0.5 g of leaves using a 3% CTAB protocol, which was followed by DNase treatment as previously-described ( 43 ). RNA concentration was estimated with the Qubit 3 Fluorometer (Invitrogen). RT-PCR were conducted using the M-MLV reverse transcriptase and the Go Taq polymerase (Promega) as described before ( 43 ). The primer pair Katu/Katd was used to assess the presence of PhMV ( 44 ). TRV RNA1 was amplified using the primer pair TRV_F/R ( 45 ), while the new primer pair TRV2JS_F/R (TCGGGGTTTACTTGGTTCCG/CTCCTAACGCATTGTTGGCG) was designed to amplify RNA2. The segments L and S of the phenuivirid were amplified using the pairs PPV1_F2/R2 (GCTAGGGACGATGCAGAGGG/GCACCTGAGCTTTGTAGACGC) and PPV2_F1/R1 (CCGCCAGAGTGAGTGAGAGG/AGACAGAGCAAGGAGGCGAG). PCR amplicons were analysed by agarose gel electrophoresis. Genome sequencing The DNase-treated RNA extracted from the leaves of two symptomatic Jerusalem sages was sent to Macrogen (South Korea) for an Illumina sequencing as previously documented ( 46 ). A total of 95,985,190 reads were generated, of which 93.6% exhibited high quality scores (> Q30) and were further used for trimming using Trimmomatic ( 47 ) and de novo assembly with Spades ( 48 ). Contigs longer than 500 bp were then submitted to BlastX searches against a local virus database. Contigs with hits E-value < 0.001 were further examined by online BlastX and BlastN searches. Bioinformatics analyses Viral genomes were analysed on Jalview ( 49 ) and Ugene ( 50 ). Functional annotation was performed using the MOTIF webserver ( https://www.genome.jp/tools/motif/ ). Accession numbers for the proteins used in this study are available in Table S2 and S3. Protein alignments were obtained using Muscle ( 51 ). For phylogenetic analyses, alignments were first loaded into ModelFinder ( 52 ) in order to find the best aa substitution model. Maximum-likelihood (ML) phylogenetic trees were then built with IQ-Tree ( 53 ) in combination with ultrafast bootstrap ( 54 ). The ML trees were manually curated on ITol ( 55 ). RNA secondary structures were predicted using the RNAfold webserver ( 56 ). Homologs of viral proteins in fungal genomes were further screened on the MycoCosm portal ( 57 ). Results A new TRV isolate In the summer 2022, large chlorotic rings and irregular patches were noted on leaves of Jerusalem sages in a private garden in Lausanne (Fig. 1 A). Total RNA samples extracted from these plants tested negative for PhMV by RT-PCR. Sap inoculations of several indicator species were unsuccessful, and examination of crude extracts by TEM did not reveal viral particle. Furthermore, a cellulose-based extraction protocol failed to evidence any dsRNA element in the leaves (data not shown). Altogether, these results prompted an HTS analysis of total RNA. Following de novo assembly and Blast analyses, two viral contigs (6,752 and 4,590 nt) were identified, corresponding to the RNA1 and 2 of a new TRV isolate. Both contigs were assembled with high coverages (1,547x and 691x, respectively) and exhibited partial TRV termini (data not shown), indicating near-complete sequencing. This new TRV isolate is hereafter dubbed “Phlo”, and its RNA1 and RNA2 sequences are available in NCBI Genbank under accession numbers PV297904 and PV297905, respectively. RT-PCR analyses confirmed the presence of Phlo RNA1 and 2 in symptomatic Jerusalem sages, while there was no detection in samples from healthy sages collected at the same location (Fig. S1 ). Rod-shaped particles ca. 50–150 nm in length were observed in semi-purified extracts from sage leaves (Fig. 1 B). These particles exhibited a clear central canal, in line with previous characterization of TRV virions ( 10 ). Mechanical inoculation using semi-purified virions was successful on plants of sugar beet ( Beta vulgaris ), Chenopodium (C. quinoa and C. amaranticolor ), tobacco ( Nicotiana tabacum and N. benthamiana ) and periwinkle ( Catharanthus roseus ). Mild chlorosis appeared at 4 days post inoculation (dpi) on leaves of both Nicotiana species, but systemic symptoms were only noted on plants of N. tabacum , on which ringspots and severe mosaic developed locally at 7 dpi, and later spread on upper tissues as well (Fig. 1 C). Periwinkles did not exhibit local symptoms but showed chlorotic spots on upper leaves after one week. Conversely, plants of sugar beet developed local chlorotic spots at 7 dpi, but no systemic symptom was noted. Chlorotic and necrotic spots appeared 3 dpi on the inoculated leaves of the two Chenopodium species. Inoculated leaves of C. quinoa eventually became completely necrotic and collapsed. After one week, chlorosis, necrotic spots and deformations were noted on the upper leaves of these species. This last result is quite remarkable as long-distance movement in Chenopodium has only been reported for SYM among TRV isolates ( 18 ). Analysis of Phlo genome Phlo RNA1 is highly similar to other TRV RNA1s, showing a classic architecture, with the closest sequence being ppk20 RNA1 (AF406990.1, 100% cover, 99.5% nt id.). In contrast, Phlo RNA2 is rather unusual, as it is longer than other reported TRV RNA2 and harbours five long (> 200 nt) ORFs dubbed “ORF1-5” (Fig. 2 A). BlastP searches on these ORFs yielded intriguing results (Table 1 ). Both ORF1 and 2 show homology to the CP-preceding HP of IFA65, but also to the HPs of SYM and Mlo7. ORF3 corresponds to the CP, while ORF4 encodes a distant homolog of 2b from TRV 11r21, an isolate collected at the same location of Mlo7 ( 20 ). ORF5 hypothetically encodes a small protein of 9 kDa (9K) that is also present on IFA65 RNA2, but does not show homology to any other sequence in the NCBI databases. Consistent with these results, a BlastN search on Phlo RNA2 yielded IFA65 RNA2 as the closest sequence (ON156783.1, 77% cover, 98% nt id.). Both RNAs are almost identical except for the 2b-encoding region lacking in IFA65 (Fig. 2 A). Table 1 Description of the best BlastP hits for the ORFs of TRV Phlo RNA2. ORF Size (aa) Best hit Cover (%) ID (%) Size (aa) Acc. number 1 314 IFA65 RNA2 ORF1 100 98 527 WCJ12589.1 2 200 IFA65 RNA2 ORF1 100 97 527 WCJ12589.1 3 221 IFA65 RNA2 CP 100 99 221 WCJ12590.1 4 371 11r21 RNA2 2b 99 47 369 AHG52767.1 5 70 IFA65 RNA2 ORF3 100 99 70 WCJ12591.1 A phylogeny of the Tobravirus CPs, which is the only conserved gene in RNA2, reveals that most isolates fall in four main lineages: “alpha”, “beta”, “gamma”, and “delta” (Fig. 2 B), consistent with a previous study ( 21 ). The isolates harboring CP-preceding ORFs belong to two groups within the alpha lineage, with Da and Db forming the “alpha 1” subclade, while Phlo and the remaining isolates forming the “alpha 2” subclade (Fig. 2 C). A third group, the subclade “alpha 3” accommodates isolates with a classic architecture shared with other TRV RNA2s. Hypothetically, three gene acquisitions occurred among members of the alpha 1 and 2 subclades, and several deletion events also occurred. 2b is truncated in SYM and totally lost in Mlo7 and IFA65. The CP-preceding HPs also have experienced deletions, with total lost in 11r21. An alignment of these HPs shows that no isolate seem to harbor a full-length ancestral version (Fig. S2). A novel phenuivirid In addition to Phlo, a second RNA virus was identified in the HTS dataset. Indeed, two contigs (5,832 and 3,372 nt) were found harbouring ORFs related to proteins from phenuivirids (BlastX hits with E-value = 0). These contigs were thus assigned to the long (L) and short (S) segments of a novel virus tentatively named “Phlomis phenuivirus 1” (PPV1, accession numbers PV370485 and PV370486). The sequencing coverages of PPV1 segments (71x and 141x, respectively) were significantly lower than that of Phlo, indicative of a lower viral titre. Interestingly, RT-PCR analyses showed the presence of PPV1 not only in symptomatic but also in healthy Jerusalem sages (Fig. S1 ), suggesting that the virus might be latent on this species. While TRV was detected by RT-PCR in the mechanically-inoculated symptomatic plants, there was no signal for PPV1 RNAs (data not shown). A RACE protocol was followed to obtain the sequences of the RNA termini, without success. A representation of the genome of PPV1 is provided on Fig. 3 A. PPV1 segment L encodes a large (partial) protein of 1,919 aa with the Bunyavirus RdRp domain pfam04196 at positions 615–1286. PPV1 segment S is ambisense, harboring two ORFs in opposite frames. The 425 nt-long intergenic region separating these ORFs is highly rich in AT, and it is predicted to fold into a stable secondary structure (Fig. 3 B), which are features described in many phenuivirids. The first ORF of PPV1 segment S encodes a protein of 359 aa containing the Tenuivirus/Phlebovirus N domain pfam05733 (positions 47–307), and the second ORF encodes a HP of 448 aa with no known domain. BlastP search on this HP revealed distant homology (< 30% aa id.) with the putative MPs associated with several other cogu-like viruses. Phylogenetic analyses of PPV1 ML phylogenetic trees were built for PPV1 proteins and their homologs from representative phenuivirids (Table S2). In the RdRp tree (Fig. 3 C, left panel), PPV1 is placed in a strongly-supported clade with Muscari virus A (MvA), a virus identified by HTS in grape hyacinth ( Muscari neglectum ) in Western Australia ( 58 ). Both viruses arguably form a new genus of cogu-like viruses as their RdRp share very low level of aa identities (< 37%) with the closest sequences. We propose therefore the novel genus “Maladivirus” (from the location of the sampled sages in the “ Maladi ère” area) to accommodate PPV1 and MvA. Maladiviruses represent a sister clade of the genus Entovirus that consists of the mycovirus “Entoleuca phenui-like virus 1” (EnPLV1) and sequences retrieved from metaviromics studies of soils and sediments in China ( 59 , 60 ). The genera “Maladivirus” and Entovirus share a common bi-segmented genome architecture with other cogu-like viruses, with some exceptions found among laulaviruses and bociviruses for which the N and MP ORFs are located on distinct segments (Fig. 3 C, right panel). In the phylogenetic tree of N proteins (Fig. 4 A), which is not available for MvA, PPV1 appears again most closely related to entoviruses. In contrast to the RdRp and N that are shared with other phenuivirids, the MPs of cogu-like are unique in the family Phenuiviridae and show distant homology to the MPs of ophioviruses (family Aspiviridae ), which are negative-strand RNA viruses infecting a great diversity of plants ( 28 , 32 ). The MP tree was therefore built using ophioviruses’ MPs as outgroup (Fig. 4 B). In this tree, cogu-like viruses form two distinct clades, with maladiviruses again closely related to several members of the genus Entoviruses . The MPs of maladiviruses appear also related to the MPs of lentinuviruses, which have been exclusively associated with fungi ( 36 , 61 ). Interestingly, in both N and MP trees, a few phylogenetic incongruences appear among coguviruses and entoviruses, suggesting possible events of recombination/reassortment. Table 2 Endogenous viral elements homolog to PPV1 MP in G. morchelliformis GMNE.BST. EVE Scaffold CDS positions Strand CDS accessions Size (aa) G 401 67,301 − 68,401 + KAF8490304.1 366 G’ 158 206,30 1-206,667 and 206,884 − 207,395 + KAF8510981.1 292 G’’ 153 207,359 − 207,644 and 207,720 − 207,760 - KAF8511336.1 108 Curiously, an online BlastP search revealed a distant homolog of PPV1 MP (KAF8490304.1, 366 aa, 64% cover, 27% id.) in the genome of the mycorrhizal fungus Gautieria morchelliformis strain GMNE.BST (assembly “Gaumor1_1”, acc. number: GCA_015179125.1 ( 62 )). The associated ORF likely represents an “endogenous viral element” (dubbed “EVE-Gm”) which presumably results from the reverse-transcription and integration of a viral sequence into its host genome ( 63 ). A previous study already evidenced an EVE related to lentinuviral N in the genome of the powdery mildew pathogen Erysiphe cichoracearum ( 36 ). EVE-Gm is specifically related to the MPs of maladiviruses, entoviruses and lentinuviruses (Fig. 4 B). Additional BlastN searches revealed two other similar EVEs (EVE-Gm’ and EVE-Gm’’, Table 2 ) on other scaffolds of the same assembly. These sequences are truncated and likely correspond to pseudogenized EVEs. In terms of genomic neighbourhood, EVE-Gm and EVE-Gm’’ are preceded by an ORF harboring the domain COG3378 (Fig. 4 C), corresponding to a DNA primase/helicase associated with mobile genetic elements (MGE). BlastP search on this ORF yielded significant hits in other fungal genomes (data not shown), suggesting that it may represent a fungus-specific MGE. In the case of EVE-Gm’, the MP-related ORF is followed by a HP with no known domain. Discussion Our HTS analysis revealed the mixed infection of two RNA viruses in symptomatic samples of Jerusalem sages. Genome analysis for these viruses provides interesting evolutionary insights for distant taxa within the Riboviria realm. A near-complete genome was reconstructed for Phlo, which corresponds to a new TRV isolate most likely responsible for the chlorotic patches and ring patterns observed on the sages. These symptoms are indeed consistent with those previously described on other plant species upon TRV infection ( 7 ). Of particular interest, Phlo RNA2 is remarkably long, and is closely related to the RNA2s of the European isolates IFA65, SYM, Mlo7, and 11r21. All these RNA2s presumably derive from a common ancestor that acquired one (or multiple) CP-preceding ORF, and experienced various deletion events. Similar deletions have been previously reported for other TRV RNA2s upon repeated mechanical inoculations or extended in planta infection ( 21 , 64 ). As for the CP-preceding HPs, their function remain uncertain. Reverse genetics studies on SYM mutants lacking HPs have not revealed changes in viral titre or spread in N. benthamiana ( 19 ). Nevertheless, early studies on this isolate have linked its RNA2 with long-distance movement in C. quinoa , an ability that is shared by Phlo but absent in isolates with a common architecture ( 18 , 65 ). Hence, the CP-preceding HPs might be involved in systemic infection in a host-specific manner. This could be easily experimentally tested using infectious clones in future research. It is important to highlight that most TRV sequences available to date have been obtained from potato (Table S1 ). Consequently, further characterization of TRV isolates from alternative host species is warranted to improve our understanding of the genomic diversity of this virus. The second RNA virus identified in the sages is PPV1, which represents a novel phenuivirid likely latent on sages. Together with MvA, PPV1 belongs to the proposed genus “Maladivirus” within the large group of cogu-like viruses. A fascinating aspect of these viruses lies in their host diversity (Fig. 3 C). Some genera have been associated with one host kingdom. This is the case for coguviruses that infect plants and lentinuviruses that are mycoviruses. All members of Bocivirus have been described as mycoviruses, except Sanya phenuivirus 1 (SPV1) that has been detected in a horse fly. The recently-described laulavirus VmNSRV1 has been described both in plant and fungus, and other laulaviruses have been identified in plants, fungi and even arthropods. The case of Entovirus is unclear as the host status has only been clearly established for the mycovirus EnPLV1, whereas other members of this genus have been obtained from soil and sediment metaviromics studies. As far as maladiviruses are concerned, both MvA and PPV1 were detected in plant samples. However, clear demonstration of plant infection is still needed, as it is possible that these viruses actually infect plant-associated organisms (e.g. fungal endophytes) rather than plants themselves. Altogether, the host diversity of cogu-like viruses remind the case of members the family Partitiviridae , which are dsRNA viruses detected in multiple eukaryotic kingdoms. A recent study has demonstrated replication of several partitivirids in plants, fungi and animals ( 66 ), and this triple cross-kingdom infection capacity is worth testing for cogu-like viruses. Another intriguing aspect of cogu-like viruses concerns their putative MPs. These proteins are arguably involved in the intercellular movement of coguviruses and plant-infecting cogu-like viruses, which is supported by the localization of VmNSRV1 MP in plasmodesmata ( 40 ). However, the presence of such homologs in cogu-like viruses not associated with plants is puzzling. Either these proteins might be required during a hypothetical plant stage, or they could serve another function in non-plant hosts. Interestingly, the MPs of maladiviruses are particularly close to homologs found in mycoviruses as well as putative EVEs from the fungus G. morchelliformis . These findings further question the true host of PPV1 and suggest a function in fungal hosts for these putative MPs. Declarations Acknowledgements We would like to thank Sabine Bonnard, Stefan Kellenberger, Marc Passerat and Larissa Grosu for taking care of the plants. We are also thankful to Jacques Mahillon and Raphaël Groux for critical review of the manuscript. Funding This research received no external funding. Availability of data and materials Not applicable. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author Contribution MM performed the plant sampling. ND and MM performed virus Purification and TEM. JB, IK and MM produced the HTS and conducted subsequent bioinformatics and molecular analyses. JB and MM performed biological assays. MM wrote the initial draft. AB and OS critically reviewed the manuscript. All authors have read the manuscript and agree for publication. References Dolja VV, Krupovic M, Koonin EV. Deep Roots and Splendid Boughs of the Global Plant Virome. Annu Rev Phytopathol. 2020 Aug 25;58:23–53. Lebas B, Adams I, Al Rwahnih M, Baeyen S, Bilodeau GJ, Blouin AG, et al. Facilitating the adoption of high-throughput sequencing technologies as a plant pest diagnostic test in laboratories: A step-by-step description. EPPO Bulletin. 2022;52(2):394–418. Saldarelli P, Boscia D, De Stradis A, Vovlas C. A New Member of the Family Flexiviridae from Phlomis Fructicosa. Journal of Plant Pathology. 2008;90(2):281–6. Adams MJ, Adkins S, Bragard C, Gilmer D, Li D, MacFarlane SA, et al. ICTV Virus Taxonomy Profile: Virgaviridae. J Gen Virol. 2017 Aug;98(8):1999–2000. Harrison BD, Robinson DJ. Tobraviruses. In: Van Regenmortel MHV, Fraenkel-Conrat H, editors. The Plant Viruses: The Rod-Shaped Plant Viruses [Internet]. Boston, MA: Springer US; 1986 [cited 2023 Nov 23]. p. 339–69. (The Viruses). Available from: https://doi.org/10.1007/978-1-4684-7026-0_17 Macfarlane SA. Tobraviruses--plant pathogens and tools for biotechnology. Mol Plant Pathol. 2010 Jul;11(4):577–83. Adams MJ, Antoniw JF. DPVweb: a comprehensive database of plant and fungal virus genes and genomes. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D382-385. van Griethuysen PA, Redeker KR, MacFarlane SA, Neilson R, Hartley SE. Virus-induced changes in root volatiles attract soil nematode vectors to infected plants. New Phytologist. 2024;241(5):2275–86. Cooper JI, Harrison BD. The role of weed hosts and the distribution and activity of vector nematodes in the ecology of tobacco rattle virus. Annals of Applied Biology. 1973;73(1):53–66. Nixon HL, Harrison BD. Electron Microscopic Evidence on the Structure of the Particles of Tobacco Rattle Virus582. Microbiology. 1959;21(3):582–90. van Belkum A, Cornelissen B, Linthorst H, Bol J, Pley C, Bosch L. tRNA-like properties of tobacco rattle virus RNA. Nucleic Acids Res. 1987 Apr 10;15(7):2837–50. Martín-Hernández AM, Baulcombe DC. Tobacco Rattle Virus 16-Kilodalton Protein Encodes a Suppressor of RNA Silencing That Allows Transient Viral Entry in Meristems. Journal of Virology. 2008 Apr 15;82(8):4064–71. Deng X, Kelloniemi J, Haikonen T, Vuorinen AL, Elomaa P, Teeri TH, et al. Modification of Tobacco rattle virus RNA1 to serve as a VIGS vector reveals that the 29K movement protein is an RNA silencing suppressor of the virus. Mol Plant Microbe Interact. 2013 May;26(5):503–14. Yue N, Jiang Z, Pi Q, Yang M, Gao Z, Wang X, et al. Zn2+-dependent association of cysteine-rich protein with virion orchestrates morphogenesis of rod-shaped viruses. PLOS Pathogens. 2024 Jun 17;20(6):e1012311. Koenig R, Lesemann DE, Pleij CWA. Tobacco rattle virus genome alterations in the Hosta hybrid ‘Green Fountain’ and other plants: reassortments, recombinations and deletions. Arch Virol. 2012 Oct 1;157(10):2005–8. Macfarlane SA. Molecular determinants of the transmission of plant viruses by nematodes. Mol Plant Pathol. 2003 May 1;4(3):211–5. Heinze C, Von Bargen S, Sadowska-Rybak M, Willingmann P, Adam G. Sequences of Tobacco Rattle Viruses from Potato. Journal of Phytopathology. 2000;148(9–10):547–54. Kurppa A, Jones AT, Harrison BD, Bailiss KW. Properties of spinach yellow mottle, a distinctive strain of tobacco rattle virus. Annals of Applied Biology. 1981;98(2):243–54. Ashfaq M, McGavin W, Macfarlane SA. RNA2 of TRV SYM breaks the rules for tobravirus genome structure. Virus Res. 2011 Sep;160(1–2):435–8. Yin Z, Pawełkowicz M, Michalak K, Chrzanowska M, Zimnoch-Guzowska E. The genomic RNA1 and RNA2 sequences of the tobacco rattle virus isolates found in Polish potato fields. Virus Research. 2014 Jun 24;185:110–3. Lindner K, Hilbrich I, Koenig R. Molecular characterization of variants of a new ‘rule-breaking’ tobacco rattle virus RNA2 in potatoes. Virus Research. 2018 Jan 15;244:270–5. Conti M, Masenga V. Identification and Prevalence of Pepper Viruses in Northwest Italy. Journal of Phytopathology. 1977;90(3):212–22. Herath V, Romay G, Urrutia CD, Verchot J. Family Level Phylogenies Reveal Relationships of Plant Viruses within the Order Bunyavirales. Viruses. 2020 Sep;12(9):1010. Sun MH, Ji YF, Li GH, Shao JW, Chen RX, Gong HY, et al. Highly adaptive Phenuiviridae with biomedical importance in multiple fields. Journal of Medical Virology. 2022;94(6):2388–401. Sasaya T, Palacios G, Briese T, Di Serio F, Groschup MH, Neriya Y, et al. ICTV Virus Taxonomy Profile: Phenuiviridae 2023. Journal of General Virology. 2023;104(9):001893. Kuhn JH, Brown K, Adkins S, de la Torre JC, Digiaro M, Ergünay K, et al. Promotion of order Bunyavirales to class Bunyaviricetes to accommodate a rapidly increasing number of related polyploviricotine viruses. Journal of Virology. 2024 Sep 20;98(10):e01069-24. Falk BW, Tsai JH. BIOLOGY AND MOLECULAR BIOLOGY OF VIRUSES IN THE GENUS TENUIVIRUS. Annual Review of Phytopathology. 1998 Sep 1;36(Volume 36, 1998):139–63. Navarro B, Zicca S, Minutolo M, Saponari M, Alioto D, Di Serio F. A Negative-Stranded RNA Virus Infecting Citrus Trees: The Second Member of a New Genus Within the Order Bunyavirales. Frontiers in Microbiology [Internet]. 2018 [cited 2023 Jun 10];9. Available from: https://www.frontiersin.org/articles/10.3389/fmicb.2018.02340 Lecoq H, Wipf-Scheibel C, Verdin E, Desbiez C. Characterization of the first tenuivirus naturally infecting dicotyledonous plants. Arch Virol. 2019 Jan 1;164(1):297–301. Diaz-Lara A, Navarro B, Di Serio F, Stevens K, Hwang MS, Kohl J, et al. Two Novel Negative-Sense RNA Viruses Infecting Grapevine Are Members of a Newly Proposed Genus within the Family Phenuiviridae. Viruses. 2019 Jul 26;11(8):685. Gaafar YZA, Richert-Pöggeler KR, Sieg-Müller A, Lüddecke P, Herz K, Hartrick J, et al. A divergent strain of melon chlorotic spot virus isolated from black medic (Medicago lupulina) in Austria. Virology Journal. 2019 Jul 5;16(1):89. Navarro B, Minutolo M, De Stradis A, Palmisano F, Alioto D, Di Serio F. The first phlebo-like virus infecting plants: a case study on the adaptation of negative-stranded RNA viruses to new hosts. Mol Plant Pathol. 2018 May;19(5):1075–89. Butkovic A, Dolja VV, Koonin EV, Krupovic M. Plant virus movement proteins originated from jelly-roll capsid proteins. PLOS Biology. 2023 Jun 15;21(6):e3002157. Chen YM, Sadiq S, Tian JH, Chen X, Lin XD, Shen JJ, et al. RNA viromes from terrestrial sites across China expand environmental viral diversity. Nat Microbiol. 2022 Aug;7(8):1312–23. Tokarz R, Sameroff S, Tagliafierro T, Jain K, Williams SH, Cucura DM, et al. Identification of Novel Viruses in Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis Ticks. mSphere. 2018;3(2):e00614-17. Lin YH, Fujita M, Chiba S, Hyodo K, Andika IB, Suzuki N, et al. Two novel fungal negative-strand RNA viruses related to mymonaviruses and phenuiviruses in the shiitake mushroom (Lentinula edodes). Virology. 2019 Jul 1;533:125–36. Bertazzon N, Chitarra W, Angelini E, Nerva L. Two New Putative Plant Viruses from Wood Metagenomics Analysis of an Esca Diseased Vineyard. Plants. 2020 Jul;9(7):835. Kuhn JH, Adkins S, Alioto D, Alkhovsky SV, Amarasinghe GK, Anthony SJ, et al. 2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. Arch Virol. 2020 Dec 1;165(12):3023–72. Sadiq S, Harvey E, Mifsud JCO, Minasny B, McBratney AB, Pozza LE, et al. Australian terrestrial environments harbour extensive RNA virus diversity. Virology. 2024 May 1;593:110007. Dai R, Yang S, Pang T, Tian M, Wang H, Zhang D, et al. Identification of a negative-strand RNA virus with natural plant and fungal hosts. Proceedings of the National Academy of Sciences. 2024 Mar 19;121(12):e2319582121. Gugerli P. Different States of Aggregation of Tobacco Rattle Virus Coat Protein. Journal of General Virology. 1976;33(2):297–307. Mahillon M, Brodard J, Kellenberger I, Blouin AG, Schumpp O. A novel weevil-transmitted tymovirus found in mixed infection on hollyhock. Virology Journal. 2023 Jan 30;20(1):17. Mahillon M, Groux R, Bussereau F, Brodard J, Debonneville C, Demal S, et al. Virus Yellows and Syndrome “Basses Richesses” in Western Switzerland: A Dramatic 2020 Season Calls for Urgent Control Measures. Pathogens. 2022;11(8):885. Dovas CI, Katis NI. A spot nested RT-PCR method for the simultaneous detection of members of the Vitivirus and Foveavirus genera in grapevine. J Virol Methods. 2003 Jan;107(1):99–106. Boutsika K, Phillips MS, MacFarlane SA, Brown DJF, Holeva RC, Blok VC. Molecular diagnostics of some trichodorid nematodes and associated Tobacco rattle virus. Plant Pathology. 2004;53(1):110–6. Mahillon M, Kellenberger I, Dubuis N, Brodard J, Bunter M, Weibel J, et al. First report of Tomato brown rugose fruit virus in tomato in Switzerland. New Disease Reports. 2022;45(1):e12065. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014 Aug 1;30(15):2114–20. Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes De Novo Assembler. Current Protocols in Bioinformatics. 2020;70(1):e102. Waterhouse AM, Procter JB, Martin DMA, Clamp M, Barton GJ. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009 May 1;25(9):1189–91. Okonechnikov K, Golosova O, Fursov M, UGENE team. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics. 2012 Apr 15;28(8):1166–7. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792–7. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods. 2017 Jun;14(6):587–9. Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015 Jan;32(1):268–74. Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol. 2018 01;35(2):518–22. Letunic I, Bork P. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. 2019 Jul 2;47(W1):W256–9. Gruber AR, Lorenz R, Bernhart SH, Neuböck R, Hofacker IL. The Vienna RNA Websuite. Nucleic Acids Research. 2008 Jul 1;36(suppl_2):W70–4. Grigoriev IV, Nikitin R, Haridas S, Kuo A, Ohm R, Otillar R, et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucleic Acids Res. 2014 Jan 1;42(Database issue):D699–704. Wylie SJ, Tran TT, Nguyen DQ, Koh SH, Chakraborty A, Xu W, et al. A virome from ornamental flowers in an Australian rural town. Arch Virol. 2019 Sep;164(9):2255–63. Shi M, Lin XD, Tian JH, Chen LJ, Chen X, Li CX, et al. Redefining the invertebrate RNA virosphere. Nature. 2016 Dec;540(7634):539–43. Velasco L, Arjona-Girona I, Cretazzo E, López-Herrera C. Viromes in Xylariaceae fungi infecting avocado in Spain. Virology. 2019 Jun 1;532:11–21. Li W, Sun H, Cao S, Zhang A, Zhang H, Shu Y, et al. Extreme Diversity of Mycoviruses Present in Single Strains of Rhizoctonia cerealis, the Pathogen of Wheat Sharp Eyespot. Microbiol Spectr. 11(4):e00522-23. Miyauchi S, Kiss E, Kuo A, Drula E, Kohler A, Sánchez-García M, et al. Large-scale genome sequencing of mycorrhizal fungi provides insights into the early evolution of symbiotic traits. Nat Commun. 2020 Oct 12;11(1):5125. Holmes EC. The Evolution of Endogenous Viral Elements. Cell Host Microbe. 2011 Oct 20;10(4):368–77. Hernandez C, Carette JE, Brown DJ, Bol JF. Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2. Journal of Virology. 1996 Aug;70(8):4933–40. Lister RM, Bracker CE. Defectiveness and dependence in three related strains of tobacco rattle virus. Virology. 1969 Feb 1;37(2):262–75. Telengech P, Hyodo K, Ichikawa H, Kuwata R, Kondo H, Suzuki N. Replication of single viruses across the kingdoms, Fungi, Plantae, and Animalia. Proceedings of the National Academy of Sciences. 2024 Jun 18;121(25):e2318150121. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFinal.pdf Cite Share Download PDF Status: Published Journal Publication published 06 Aug, 2025 Read the published version in Virology Journal → Version 1 posted Editorial decision: Revision requested 08 Jul, 2025 Reviews received at journal 08 Jul, 2025 Reviewers agreed at journal 24 Jun, 2025 Reviews received at journal 19 Jun, 2025 Reviewers agreed at journal 24 May, 2025 Reviewers agreed at journal 23 May, 2025 Reviewers invited by journal 06 May, 2025 Editor assigned by journal 05 May, 2025 Submission checks completed at journal 05 May, 2025 First submitted to journal 02 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6578422","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":452457112,"identity":"69c7d574-fe0f-4730-beee-997d260e7d82","order_by":0,"name":"Mathieu Mahillon","email":"","orcid":"","institution":"University of Ghent","correspondingAuthor":false,"prefix":"","firstName":"Mathieu","middleName":"","lastName":"Mahillon","suffix":""},{"id":452457114,"identity":"cf09cd68-a607-4dd6-87c6-6a342a3f3d0d","order_by":1,"name":"Nathalie Dubuis","email":"","orcid":"","institution":"Agroscope","correspondingAuthor":false,"prefix":"","firstName":"Nathalie","middleName":"","lastName":"Dubuis","suffix":""},{"id":452457116,"identity":"9afc2244-f484-488b-a12e-6a83bba73b14","order_by":2,"name":"Justine Brodard","email":"","orcid":"","institution":"Agroscope","correspondingAuthor":false,"prefix":"","firstName":"Justine","middleName":"","lastName":"Brodard","suffix":""},{"id":452457117,"identity":"5061c191-ee99-4388-a41b-c39bcb749b2e","order_by":3,"name":"Isabelle Kellenberger","email":"","orcid":"","institution":"Agroscope","correspondingAuthor":false,"prefix":"","firstName":"Isabelle","middleName":"","lastName":"Kellenberger","suffix":""},{"id":452457118,"identity":"92de6d5b-1e6f-458f-bbcc-b7408babd624","order_by":4,"name":"Arnaud G. Blouin","email":"","orcid":"","institution":"Agroscope","correspondingAuthor":false,"prefix":"","firstName":"Arnaud","middleName":"G.","lastName":"Blouin","suffix":""},{"id":452457119,"identity":"fa122dff-1ca8-451f-b291-5d67cebf2908","order_by":5,"name":"Olivier Schumpp","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQUlEQVRIie2RMUvDQBSAXwgky0nWi4HkL1wJdKk/5rK0S1KELg4drhSSsWvA3yDYrZuRg0yRrtEGSZf6D6SCiGfSVk8rODrcNzyOe/fdu/cOQKH4j5gaA9qsUBNdKYuBNFFC/6b4f1AOq1YJmKx8xj2Wrse4vngEL7nLT+8X1WA2u1qvt+OzoQX6+qE8r8C6lK6xp1qMaTECUgz7TlRsorR88n2U90c2M/xeSDaAq+yrQrg2JUFMgWDUdaKYR6zMDUdjPLjOoOuEhIsU/am8UfDSVhl4QrFfhHKTmc+/KJM6YGKvbBVKlrGBTz6qADpaRfQyqWlOESlCvyd66cxLQ296wRyNRC8c4VJSLDOpb7dj6npJ0VlFi8pzl7nWTixJ5qvwlbtWKinyp2hMzGb3DLr/MnTs/IFGsbKdolAoFIqWd1ZceNWRDLpFAAAAAElFTkSuQmCC","orcid":"","institution":"Agroscope","correspondingAuthor":true,"prefix":"","firstName":"Olivier","middleName":"","lastName":"Schumpp","suffix":""}],"badges":[],"createdAt":"2025-05-02 12:38:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6578422/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6578422/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12985-025-02896-3","type":"published","date":"2025-08-06T15:57:58+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82343097,"identity":"cc97c27f-1ef6-4df2-bb02-37cefbe4bc7b","added_by":"auto","created_at":"2025-05-09 09:32:26","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":92322,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSymptoms and particles associated with TRV Phlo.\u003c/strong\u003e \u003cstrong\u003eA.\u003c/strong\u003e Leaves of Jerusalem sages with virus-like symptoms that were used for the HTS analysis. The white bar represents 1 cm. \u003cstrong\u003eB.\u003c/strong\u003e Electron micrograph of three TRV Phlo virions\u003cem\u003e.\u003c/em\u003e Particles were stained with phosphotungstic acid. The black bar represents 100 nm. The inner panel gives a closer look at the central canal. \u003cstrong\u003eC.\u003c/strong\u003e Mosaic and ringspot symptoms on upper leaves of \u003cem\u003eN. tabacum \u003c/em\u003ecv. Xanthii, 30 days post inoculation with semi-purified TRV Phlo particles.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6578422/v1/8e97cfb726fc900686839ef9.jpg"},{"id":82344056,"identity":"8a963121-cc7c-4e64-803c-ef49ea0259a3","added_by":"auto","created_at":"2025-05-09 09:40:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":46265,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenomic and phylogenetic analyses of TRV Phlo RNA2. A.\u003c/strong\u003e Comparison of Phlo and IFA65 RNA2. Colored arrows represent ORFs. The shaded areas indicate nt identities (in percent). \u003cstrong\u003eB. \u003c/strong\u003eUnrooted\u003cstrong\u003e \u003c/strong\u003eML phylogenetic tree of the \u003cem\u003eTobravirus\u003c/em\u003eCPs (see Table S1 for accession numbers). The tree was built using the model JTT+G4. Black circles on branch indicate \u0026gt; 80 % bootstrap support. “n” indicates the number of isolates in each clade. \u003cstrong\u003eC. \u003c/strong\u003eDetails on the CP lineage alpha.\u003cstrong\u003e \u003c/strong\u003eFor each isolate, the corresponding RNA2 architecture is represented when available. Description of the ORFs are given in the lower right panel.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6578422/v1/84cd1c0de366fc1b2eab84ae.png"},{"id":82343099,"identity":"1cdaca99-fd6a-4790-b557-468d8c987224","added_by":"auto","created_at":"2025-05-09 09:32:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":62071,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenomic and phylogenetic analyses of PPV1. \u003c/strong\u003eA. Schematical representation of PPV1 genomic segments L and S. Colored arrows represent ORFs. B. Predicted secondary structure for PPV1 segment S intergenic region. The percentage of AT and minimal energy are indicated. C. Left: ML phylogenetic tree for the RdRp of PPV1 and related phenuivirids. The tree was built using the substitution model rtREV + I + G4. Black circles on branch indicate \u0026gt; 80 % bootstrap support. The position of PPV1 is indicated by a black arrow. Right: Genome architectures. RdRp: RNA-dependant RNA replicase; G: glycoproteins; N: nucleocapsid; MP: movement protein.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6578422/v1/b7674541bbfc0434b47075a7.png"},{"id":82344405,"identity":"26c83099-657c-4470-ba0d-ff85c7d5fadb","added_by":"auto","created_at":"2025-05-09 09:48:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":46375,"visible":true,"origin":"","legend":"\u003cp\u003eML phylogenetic trees for the proteins N (A) and MP (B) of PPV1 and related phenuivirids. The trees were built using the substitution models LG+F+G4 and rtREV+F+I+G4, respectively. Black circles on branch indicate \u0026gt; 50 % bootstrap support. Colored boxes represent genera as indicated on Figure 3C. C. Schematical representation of the three endogenous viral elements (EVE) detected in the genome of \u003cem\u003eG. morchelliformis\u003c/em\u003e GMNE.BST.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6578422/v1/d33eb1a194e3dff3a118461d.png"},{"id":88814256,"identity":"df3c3f1d-bc22-42e2-9d94-5f571160d000","added_by":"auto","created_at":"2025-08-11 16:09:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1054481,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6578422/v1/881a6f77-1c8d-48ec-93cb-d1cd2987c0ef.pdf"},{"id":82343098,"identity":"7ca1f10b-44e1-4bf5-bcb6-aa2476e6d311","added_by":"auto","created_at":"2025-05-09 09:32:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":835480,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFinal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6578422/v1/20adb8427143c13660c9fd5b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Characterization of an unusual tobacco rattle virus isolate and a novel phenuivirid in the Jerusalem sage","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdvances in high-throughput sequencing (HTS) technologies have revolutionized plant virology. HTS allows for the unbiased analysis of nucleic acids, which is particularly relevant in the cases of untransmissible and/or latent phytoviruses that would be otherwise omitted by traditional diagnostics methods. HTS has therefore significantly expanded the known plant virome (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e), and becomes increasingly popular in routine phytosanitary analyses as costs decrease (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Here, we used HTS to investigate the etiology of diseased plants of the Jerusalem sage (\u003cem\u003ePhlomis fruticosa\u003c/em\u003e), an ornamental in the family \u003cem\u003eLamiaceae\u003c/em\u003e. Native to the eastern Mediterranean regions, this evergreen shrub is widely grown across Europe for its attractive yellow flowers. This species can readily propagate over several years in temperate areas, which favors a potential role as pathogen reservoir. So far, the sole virus identified in Jerusalem sage is Phlomis mottle virus (PhMV), a trichovirus discovered in Italy (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Our HTS analysis of symptomatic Jerusalem sages revealed the mixed infection of an atypical isolate of tobacco rattle virus (TRV, \u003cem\u003eTobravirus tabaci\u003c/em\u003e) and a novel virus belonging to the family \u003cem\u003ePhenuiviridae\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eTRV is a member of the genus \u003cem\u003eTobravirus\u003c/em\u003e (family \u003cem\u003eVirgaviridae\u003c/em\u003e; order \u003cem\u003eMartellivirales\u003c/em\u003e) which also accommodates pea early-browning virus (PEBV, \u003cem\u003eTobravirus pisi\u003c/em\u003e) and pepper ringspot virus (PRV, \u003cem\u003eTobravirus capsica\u003c/em\u003e) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). The history of TRV dates back to the late 1890s in Germany, when the \u0026ldquo;Mauche\u0026rdquo; disease was first reported on tobacco (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Nowadays, although TRV is best known as a versatile biotechnology tool (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e), it still remains problematic on ornamentals and crops such as potato. TRV is ubiquitous in many agricultural soils worldwide, inducing latent to strongly symptomatic infections (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Its host range is exceptionally high, encompassing over 400 plant species from 50 families (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). The virus is transmitted by nematodes from the genera \u003cem\u003eParatrichodorus\u003c/em\u003e and \u003cem\u003eTrichodorus\u003c/em\u003e, and actively attracts these vectors through modulation of plant root volatiles (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Transmission can also occur via seeds (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). TRV genome consists of two positive sense, single-stranded RNAs (RNA1 and 2) encapsidated in rod-shaped virions (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Both RNAs are 5\u0026rsquo;-capped and end by a tRNA structure (11). RNA1 encodes the RNA-dependant RNA polymerase (RdRp) subunits, a movement protein (MP) and a cysteine-rich protein (CRP). Both the MP and CRP act as viral suppressors of RNA silencing (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), and a recent study has also highlighted a role in virion formation for the CRP (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWhile TRV RNA1 is highly stable among isolates (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e), RNA2 is prone to reassortment, recombination, insertion and deletion (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Two main architectures have been described for this RNA. The most common architecture consists of the capsid protein (CP) ORF located in 5\u0026rsquo; and followed by the ORFs encoding 2b and 2c, two proteins involved in nematode transmission (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Some isolates exhibiting this architecture have shortened versions of 2b and/or 2c, and a few isolates have additional small ORFs in the 3\u0026rsquo; region (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). The second RNA2 architecture, previously framed \u0026ldquo;rule-breaking\u0026rdquo; architecture, consists of the CP ORF preceded by one or several ORFs. It was first described for the \u0026ldquo;Spinach Yellow Mottle\u0026rdquo; (SYM) isolate in England in 1979, for which RNA2 harbours three CP-preceding ORFs encoding hypothetical proteins (HPs) (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). In 2014, the Polish isolate Mlo7 identified in potato was also predicted to encode a small CP-preceding HP closely related to one of SYM HPs (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). A similar architecture was found in 2015 for the German isolates Da and Db, both retrieved from strongly-symptomatic potato tubers, and encoding a CP-preceding HP of 35 kDa (35K) unrelated to SYM HPs (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Last, the RNA2 of the isolate IFA65, first identified in Italy on pepper in the 1970s (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), has been recently sequenced, revealing a long CP-preceding ORF related to SYM HPs (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). The biological role of all these aforementioned CP-preceding ORFs remains unknown.\u003c/p\u003e \u003cp\u003eThe family \u003cem\u003ePhenuiviridae\u003c/em\u003e (order \u003cem\u003eHareavirales\u003c/em\u003e; class \u003cem\u003eBunyaviricetes\u003c/em\u003e) accommodates viruses with negative and ambisense RNA infecting eukaryotes including humans (\u003cspan additionalcitationids=\"CR24 CR25\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). These viruses have segmented genomes encoding at least an RdRp and a nucleocapsid (N). While many phenuivirids produce glycoproteins (G) and are protected in an envelope, others are \u0026ldquo;naked\u0026rdquo; and appear as flexuous filaments consisting of genomic RNA associated with N proteins. This is the case for plant phenuivirids such as members of the genera \u003cem\u003eTenuivirus\u003c/em\u003e, \u003cem\u003eMechlorovirus\u003c/em\u003e, \u003cem\u003eCoguvirus\u003c/em\u003e and \u003cem\u003eRubodvirus\u003c/em\u003e (\u003cspan additionalcitationids=\"CR28 CR29 CR30\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In recent years, \u003cem\u003ePhenuiviridae\u003c/em\u003e has greatly expanded through the accumulation of HTS data, which has led the International Committee on Taxonomy of Viruses (ICTV) to recognize several new \u0026ldquo;cogu-like\u0026rdquo; genera: \u003cem\u003eEntovirus\u003c/em\u003e, \u003cem\u003eLaulavirus\u003c/em\u003e, \u003cem\u003eLentinuvirus\u003c/em\u003e and \u003cem\u003eBocivirus\u003c/em\u003e. These viruses are presumably naked and encode an RdRp, N and putative MP that is structurally similar to proteins from the tobacco mosaic virus 30 kDa (30K) family (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Cogu-like viruses have been retrieved from various eukaryotes (plants, fungi, arthropods) and environmental samples (\u003cspan additionalcitationids=\"CR35 CR36 CR37 CR38\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Remarkably, a recent study has shown that the laulavirus \u0026ldquo;Valsa mali negative-strand RNA virus 1\u0026rdquo; (VmNSRV1) can be found in natural populations of fungi and plants, leading to its description as the first \u0026ldquo;phyto-mycovirus\u0026rdquo; (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e"},{"header":"Material and method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant material\u003c/h2\u003e \u003cp\u003eLeaves of healthy and symptomatic plants of Jerusalem sage were collected in a private garden in Lausanne (Switzerland), in proximity of the so-called \u0026ldquo;Maladi\u0026egrave;re\u0026rdquo; area in August 2022. Symptomatic leaves were used for the mechanical inoculation of several indicator plant species. Briefly, a sap inoculum was produced by grinding leaves in cold phosphate buffer (1 mM diethyldithiocarbamate, 20 mM Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, pH 7.6) in a mortar using a pestle. The resulting sap was rubbed on the first true leaves of indicator species using carborundum (400-mesh silicon carbide, Aldrich) as abrasive. Inoculated plants were maintained in greenhouses (24\u0026deg;C, 14/10 h photoperiod) for one month with daily inspections.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eVirion observation and inoculation\u003c/h3\u003e\n\u003cp\u003eFor the visualisation of virions, a simplified protocol dedicated for the semi-purification of TRV particle was followed (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Briefly, 10 g of symptomatic sage leaves were first ground in liquid nitrogen in a mortar using a pestle. The resulting powder was mixed with 20 ml of CP buffer (0.18 M McIlvaine buffer, pH 7) supplemented with 0.2% thioglycolic acid, and squeezed through a nylon filter cloth. One vol of diethylether: carbon tetrachloride was added, followed by slow mixing for 5 min. The phases were then separated by low-speed centrifugation (20 min, 4,000 rpm) and the upper phase was used for high-speed centrifugation (1 h, 40,000 rpm). The resulting pellet was suspended in 1 mL CP buffer. The low and high-speed centrifugation steps were repeated, and the final pellet was resuspended in 0.1 mL CP buffer. Particles were observed by transmission electron microscopy (TEM) using the Tecnai G2 Spirit electron microscope as previously described (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Semi-purified particles were also used for plant inoculation as described in the previous section.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and RT-PCR\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eRNA extraction and RT-PCR\u003c/div\u003e \u003cp\u003eTotal RNA was extracted from 0.5 g of leaves using a 3% CTAB protocol, which was followed by DNase treatment as previously-described (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). RNA concentration was estimated with the Qubit 3 Fluorometer (Invitrogen). RT-PCR were conducted using the M-MLV reverse transcriptase and the Go Taq polymerase (Promega) as described before (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). The primer pair Katu/Katd was used to assess the presence of PhMV (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). TRV RNA1 was amplified using the primer pair TRV_F/R (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), while the new primer pair TRV2JS_F/R (TCGGGGTTTACTTGGTTCCG/CTCCTAACGCATTGTTGGCG) was designed to amplify RNA2. The segments L and S of the phenuivirid were amplified using the pairs PPV1_F2/R2 (GCTAGGGACGATGCAGAGGG/GCACCTGAGCTTTGTAGACGC) and PPV2_F1/R1 (CCGCCAGAGTGAGTGAGAGG/AGACAGAGCAAGGAGGCGAG). PCR amplicons were analysed by agarose gel electrophoresis.\u003c/p\u003e\n\u003ch3\u003eGenome sequencing\u003c/h3\u003e\n\u003cp\u003eThe DNase-treated RNA extracted from the leaves of two symptomatic Jerusalem sages was sent to Macrogen (South Korea) for an Illumina sequencing as previously documented (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). A total of 95,985,190 reads were generated, of which 93.6% exhibited high quality scores (\u0026gt;\u0026thinsp;Q30) and were further used for trimming using Trimmomatic (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e) and \u003cem\u003ede novo\u003c/em\u003e assembly with Spades (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). Contigs longer than 500 bp were then submitted to BlastX searches against a local virus database. Contigs with hits E-value\u0026thinsp;\u0026lt;\u0026thinsp;0.001 were further examined by online BlastX and BlastN searches.\u003c/p\u003e\n\u003ch3\u003eBioinformatics analyses\u003c/h3\u003e\n\u003cp\u003eViral genomes were analysed on Jalview (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e) and Ugene (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Functional annotation was performed using the MOTIF webserver (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genome.jp/tools/motif/\u003c/span\u003e\u003cspan address=\"https://www.genome.jp/tools/motif/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Accession numbers for the proteins used in this study are available in Table S2 and S3. Protein alignments were obtained using Muscle (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). For phylogenetic analyses, alignments were first loaded into ModelFinder (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e) in order to find the best aa substitution model. Maximum-likelihood (ML) phylogenetic trees were then built with IQ-Tree (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e) in combination with ultrafast bootstrap (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). The ML trees were manually curated on ITol (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). RNA secondary structures were predicted using the RNAfold webserver (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Homologs of viral proteins in fungal genomes were further screened on the MycoCosm portal (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eA new TRV isolate\u003c/h2\u003e \u003cp\u003eIn the summer 2022, large chlorotic rings and irregular patches were noted on leaves of Jerusalem sages in a private garden in Lausanne (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Total RNA samples extracted from these plants tested negative for PhMV by RT-PCR. Sap inoculations of several indicator species were unsuccessful, and examination of crude extracts by TEM did not reveal viral particle. Furthermore, a cellulose-based extraction protocol failed to evidence any dsRNA element in the leaves (data not shown). Altogether, these results prompted an HTS analysis of total RNA. Following \u003cem\u003ede novo\u003c/em\u003e assembly and Blast analyses, two viral contigs (6,752 and 4,590 nt) were identified, corresponding to the RNA1 and 2 of a new TRV isolate. Both contigs were assembled with high coverages (1,547x and 691x, respectively) and exhibited partial TRV termini (data not shown), indicating near-complete sequencing. This new TRV isolate is hereafter dubbed \u0026ldquo;Phlo\u0026rdquo;, and its RNA1 and RNA2 sequences are available in NCBI Genbank under accession numbers PV297904 and PV297905, respectively.\u003c/p\u003e \u003cp\u003eRT-PCR analyses confirmed the presence of Phlo RNA1 and 2 in symptomatic Jerusalem sages, while there was no detection in samples from healthy sages collected at the same location (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Rod-shaped particles \u003cem\u003eca.\u003c/em\u003e 50\u0026ndash;150 nm in length were observed in semi-purified extracts from sage leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). These particles exhibited a clear central canal, in line with previous characterization of TRV virions (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Mechanical inoculation using semi-purified virions was successful on plants of sugar beet (\u003cem\u003eBeta vulgaris\u003c/em\u003e), \u003cem\u003eChenopodium (C. quinoa\u003c/em\u003e and \u003cem\u003eC. amaranticolor\u003c/em\u003e), tobacco (\u003cem\u003eNicotiana tabacum\u003c/em\u003e and \u003cem\u003eN. benthamiana\u003c/em\u003e) and periwinkle (\u003cem\u003eCatharanthus roseus\u003c/em\u003e). Mild chlorosis appeared at 4 days post inoculation (dpi) on leaves of both \u003cem\u003eNicotiana\u003c/em\u003e species, but systemic symptoms were only noted on plants of \u003cem\u003eN. tabacum\u003c/em\u003e, on which ringspots and severe mosaic developed locally at 7 dpi, and later spread on upper tissues as well (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Periwinkles did not exhibit local symptoms but showed chlorotic spots on upper leaves after one week. Conversely, plants of sugar beet developed local chlorotic spots at 7 dpi, but no systemic symptom was noted. Chlorotic and necrotic spots appeared 3 dpi on the inoculated leaves of the two \u003cem\u003eChenopodium\u003c/em\u003e species. Inoculated leaves of \u003cem\u003eC. quinoa\u003c/em\u003e eventually became completely necrotic and collapsed. After one week, chlorosis, necrotic spots and deformations were noted on the upper leaves of these species. This last result is quite remarkable as long-distance movement in \u003cem\u003eChenopodium\u003c/em\u003e has only been reported for SYM among TRV isolates (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnalysis of Phlo genome\u003c/h3\u003e\n\u003cp\u003ePhlo RNA1 is highly similar to other TRV RNA1s, showing a classic architecture, with the closest sequence being ppk20 RNA1 (AF406990.1, 100% cover, 99.5% nt id.). In contrast, Phlo RNA2 is rather unusual, as it is longer than other reported TRV RNA2 and harbours five long (\u0026gt;\u0026thinsp;200 nt) ORFs dubbed \u0026ldquo;ORF1-5\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). BlastP searches on these ORFs yielded intriguing results (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Both ORF1 and 2 show homology to the CP-preceding HP of IFA65, but also to the HPs of SYM and Mlo7. ORF3 corresponds to the CP, while ORF4 encodes a distant homolog of 2b from TRV 11r21, an isolate collected at the same location of Mlo7 (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). ORF5 hypothetically encodes a small protein of 9 kDa (9K) that is also present on IFA65 RNA2, but does not show homology to any other sequence in the NCBI databases. Consistent with these results, a BlastN search on Phlo RNA2 yielded IFA65 RNA2 as the closest sequence (ON156783.1, 77% cover, 98% nt id.). Both RNAs are almost identical except for the 2b-encoding region lacking in IFA65 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDescription of the best BlastP hits for the ORFs of TRV Phlo RNA2.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eORF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSize (aa)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBest hit\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCover (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eID (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSize (aa)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAcc. number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e314\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIFA65 RNA2 ORF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e527\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWCJ12589.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIFA65 RNA2 ORF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e527\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWCJ12589.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e221\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIFA65 RNA2 CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e221\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWCJ12590.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e371\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11r21 RNA2 2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e369\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAHG52767.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIFA65 RNA2 ORF3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWCJ12591.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eA phylogeny of the \u003cem\u003eTobravirus\u003c/em\u003e CPs, which is the only conserved gene in RNA2, reveals that most isolates fall in four main lineages: \u0026ldquo;alpha\u0026rdquo;, \u0026ldquo;beta\u0026rdquo;, \u0026ldquo;gamma\u0026rdquo;, and \u0026ldquo;delta\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), consistent with a previous study (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). The isolates harboring CP-preceding ORFs belong to two groups within the alpha lineage, with Da and Db forming the \u0026ldquo;alpha 1\u0026rdquo; subclade, while Phlo and the remaining isolates forming the \u0026ldquo;alpha 2\u0026rdquo; subclade (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). A third group, the subclade \u0026ldquo;alpha 3\u0026rdquo; accommodates isolates with a classic architecture shared with other TRV RNA2s. Hypothetically, three gene acquisitions occurred among members of the alpha 1 and 2 subclades, and several deletion events also occurred. 2b is truncated in SYM and totally lost in Mlo7 and IFA65. The CP-preceding HPs also have experienced deletions, with total lost in 11r21. An alignment of these HPs shows that no isolate seem to harbor a full-length ancestral version (Fig. S2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eA novel phenuivirid\u003c/h2\u003e \u003cp\u003eIn addition to Phlo, a second RNA virus was identified in the HTS dataset. Indeed, two contigs (5,832 and 3,372 nt) were found harbouring ORFs related to proteins from phenuivirids (BlastX hits with E-value\u0026thinsp;=\u0026thinsp;0). These contigs were thus assigned to the long (L) and short (S) segments of a novel virus tentatively named \u0026ldquo;Phlomis phenuivirus 1\u0026rdquo; (PPV1, accession numbers PV370485 and PV370486). The sequencing coverages of PPV1 segments (71x and 141x, respectively) were significantly lower than that of Phlo, indicative of a lower viral titre. Interestingly, RT-PCR analyses showed the presence of PPV1 not only in symptomatic but also in healthy Jerusalem sages (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), suggesting that the virus might be latent on this species. While TRV was detected by RT-PCR in the mechanically-inoculated symptomatic plants, there was no signal for PPV1 RNAs (data not shown). A RACE protocol was followed to obtain the sequences of the RNA termini, without success.\u003c/p\u003e \u003cp\u003eA representation of the genome of PPV1 is provided on Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. PPV1 segment L encodes a large (partial) protein of 1,919 aa with the \u003cem\u003eBunyavirus\u003c/em\u003e RdRp domain pfam04196 at positions 615\u0026ndash;1286. PPV1 segment S is ambisense, harboring two ORFs in opposite frames. The 425 nt-long intergenic region separating these ORFs is highly rich in AT, and it is predicted to fold into a stable secondary structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), which are features described in many phenuivirids. The first ORF of PPV1 segment S encodes a protein of 359 aa containing the \u003cem\u003eTenuivirus/Phlebovirus\u003c/em\u003e N domain pfam05733 (positions 47\u0026ndash;307), and the second ORF encodes a HP of 448 aa with no known domain. BlastP search on this HP revealed distant homology (\u0026lt;\u0026thinsp;30% aa id.) with the putative MPs associated with several other cogu-like viruses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic analyses of PPV1\u003c/h2\u003e \u003cp\u003eML phylogenetic trees were built for PPV1 proteins and their homologs from representative phenuivirids (Table S2). In the RdRp tree (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, left panel), PPV1 is placed in a strongly-supported clade with Muscari virus A (MvA), a virus identified by HTS in grape hyacinth (\u003cem\u003eMuscari neglectum\u003c/em\u003e) in Western Australia (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Both viruses arguably form a new genus of cogu-like viruses as their RdRp share very low level of aa identities (\u0026lt;\u0026thinsp;37%) with the closest sequences. We propose therefore the novel genus \u0026ldquo;Maladivirus\u0026rdquo; (from the location of the sampled sages in the \u0026ldquo;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eMaladi\u003c/span\u003e\u0026egrave;re\u0026rdquo; area) to accommodate PPV1 and MvA.\u003c/p\u003e \u003cp\u003eMaladiviruses represent a sister clade of the genus \u003cem\u003eEntovirus\u003c/em\u003e that consists of the mycovirus \u0026ldquo;Entoleuca phenui-like virus 1\u0026rdquo; (EnPLV1) and sequences retrieved from metaviromics studies of soils and sediments in China (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). The genera \u0026ldquo;Maladivirus\u0026rdquo; and \u003cem\u003eEntovirus\u003c/em\u003e share a common bi-segmented genome architecture with other cogu-like viruses, with some exceptions found among laulaviruses and bociviruses for which the N and MP ORFs are located on distinct segments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, right panel).\u003c/p\u003e \u003cp\u003eIn the phylogenetic tree of N proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), which is not available for MvA, PPV1 appears again most closely related to entoviruses. In contrast to the RdRp and N that are shared with other phenuivirids, the MPs of cogu-like are unique in the family \u003cem\u003ePhenuiviridae\u003c/em\u003e and show distant homology to the MPs of ophioviruses (family \u003cem\u003eAspiviridae\u003c/em\u003e), which are negative-strand RNA viruses infecting a great diversity of plants (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). The MP tree was therefore built using ophioviruses\u0026rsquo; MPs as outgroup (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In this tree, cogu-like viruses form two distinct clades, with maladiviruses again closely related to several members of the genus \u003cem\u003eEntoviruses\u003c/em\u003e. The MPs of maladiviruses appear also related to the MPs of lentinuviruses, which have been exclusively associated with fungi (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). Interestingly, in both N and MP trees, a few phylogenetic incongruences appear among coguviruses and entoviruses, suggesting possible events of recombination/reassortment.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEndogenous viral elements homolog to PPV1 MP in \u003cem\u003eG. morchelliformis\u003c/em\u003e GMNE.BST.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEVE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eScaffold\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDS positions\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eStrand\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCDS accessions\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSize (aa)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e401\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e67,301\u0026thinsp;\u0026minus;\u0026thinsp;68,401\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKAF8490304.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e366\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eG\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e158\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e206,30 1-206,667 and 206,884\u0026thinsp;\u0026minus;\u0026thinsp;207,395\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKAF8510981.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e292\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eG\u0026rsquo;\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e207,359\u0026thinsp;\u0026minus;\u0026thinsp;207,644 and 207,720\u0026thinsp;\u0026minus;\u0026thinsp;207,760\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKAF8511336.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCuriously, an online BlastP search revealed a distant homolog of PPV1 MP (KAF8490304.1, 366 aa, 64% cover, 27% id.) in the genome of the mycorrhizal fungus \u003cem\u003eGautieria morchelliformis\u003c/em\u003e strain GMNE.BST (assembly \u0026ldquo;Gaumor1_1\u0026rdquo;, acc. number: GCA_015179125.1 (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e)). The associated ORF likely represents an \u0026ldquo;endogenous viral element\u0026rdquo; (dubbed \u0026ldquo;EVE-Gm\u0026rdquo;) which presumably results from the reverse-transcription and integration of a viral sequence into its host genome (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). A previous study already evidenced an EVE related to lentinuviral N in the genome of the powdery mildew pathogen \u003cem\u003eErysiphe cichoracearum\u003c/em\u003e (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). EVE-Gm is specifically related to the MPs of maladiviruses, entoviruses and lentinuviruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Additional BlastN searches revealed two other similar EVEs (EVE-Gm\u0026rsquo; and EVE-Gm\u0026rsquo;\u0026rsquo;, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) on other scaffolds of the same assembly. These sequences are truncated and likely correspond to pseudogenized EVEs. In terms of genomic neighbourhood, EVE-Gm and EVE-Gm\u0026rsquo;\u0026rsquo; are preceded by an ORF harboring the domain COG3378 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), corresponding to a DNA primase/helicase associated with mobile genetic elements (MGE). BlastP search on this ORF yielded significant hits in other fungal genomes (data not shown), suggesting that it may represent a fungus-specific MGE. In the case of EVE-Gm\u0026rsquo;, the MP-related ORF is followed by a HP with no known domain.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur HTS analysis revealed the mixed infection of two RNA viruses in symptomatic samples of Jerusalem sages. Genome analysis for these viruses provides interesting evolutionary insights for distant taxa within the \u003cem\u003eRiboviria\u003c/em\u003e realm.\u003c/p\u003e \u003cp\u003eA near-complete genome was reconstructed for Phlo, which corresponds to a new TRV isolate most likely responsible for the chlorotic patches and ring patterns observed on the sages. These symptoms are indeed consistent with those previously described on other plant species upon TRV infection (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Of particular interest, Phlo RNA2 is remarkably long, and is closely related to the RNA2s of the European isolates IFA65, SYM, Mlo7, and 11r21. All these RNA2s presumably derive from a common ancestor that acquired one (or multiple) CP-preceding ORF, and experienced various deletion events. Similar deletions have been previously reported for other TRV RNA2s upon repeated mechanical inoculations or extended \u003cem\u003ein planta\u003c/em\u003e infection (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). As for the CP-preceding HPs, their function remain uncertain. Reverse genetics studies on SYM mutants lacking HPs have not revealed changes in viral titre or spread in \u003cem\u003eN. benthamiana\u003c/em\u003e (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Nevertheless, early studies on this isolate have linked its RNA2 with long-distance movement in \u003cem\u003eC. quinoa\u003c/em\u003e, an ability that is shared by Phlo but absent in isolates with a common architecture (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e). Hence, the CP-preceding HPs might be involved in systemic infection in a host-specific manner. This could be easily experimentally tested using infectious clones in future research. It is important to highlight that most TRV sequences available to date have been obtained from potato (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Consequently, further characterization of TRV isolates from alternative host species is warranted to improve our understanding of the genomic diversity of this virus.\u003c/p\u003e \u003cp\u003eThe second RNA virus identified in the sages is PPV1, which represents a novel phenuivirid likely latent on sages. Together with MvA, PPV1 belongs to the proposed genus \u0026ldquo;Maladivirus\u0026rdquo; within the large group of cogu-like viruses. A fascinating aspect of these viruses lies in their host diversity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Some genera have been associated with one host kingdom. This is the case for coguviruses that infect plants and lentinuviruses that are mycoviruses. All members of \u003cem\u003eBocivirus\u003c/em\u003e have been described as mycoviruses, except Sanya phenuivirus 1 (SPV1) that has been detected in a horse fly. The recently-described laulavirus VmNSRV1 has been described both in plant and fungus, and other laulaviruses have been identified in plants, fungi and even arthropods. The case of \u003cem\u003eEntovirus\u003c/em\u003e is unclear as the host status has only been clearly established for the mycovirus EnPLV1, whereas other members of this genus have been obtained from soil and sediment metaviromics studies. As far as maladiviruses are concerned, both MvA and PPV1 were detected in plant samples. However, clear demonstration of plant infection is still needed, as it is possible that these viruses actually infect plant-associated organisms (e.g. fungal endophytes) rather than plants themselves. Altogether, the host diversity of cogu-like viruses remind the case of members the family \u003cem\u003ePartitiviridae\u003c/em\u003e, which are dsRNA viruses detected in multiple eukaryotic kingdoms. A recent study has demonstrated replication of several partitivirids in plants, fungi and animals (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e), and this triple cross-kingdom infection capacity is worth testing for cogu-like viruses.\u003c/p\u003e \u003cp\u003eAnother intriguing aspect of cogu-like viruses concerns their putative MPs. These proteins are arguably involved in the intercellular movement of coguviruses and plant-infecting cogu-like viruses, which is supported by the localization of VmNSRV1 MP in plasmodesmata (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). However, the presence of such homologs in cogu-like viruses not associated with plants is puzzling. Either these proteins might be required during a hypothetical plant stage, or they could serve another function in non-plant hosts. Interestingly, the MPs of maladiviruses are particularly close to homologs found in mycoviruses as well as putative EVEs from the fungus \u003cem\u003eG. morchelliformis\u003c/em\u003e. These findings further question the true host of PPV1 and suggest a function in fungal hosts for these putative MPs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Sabine Bonnard, Stefan Kellenberger, Marc Passerat and Larissa Grosu for taking care of the plants. We are also thankful to Jacques Mahillon and Rapha\u0026euml;l Groux for critical review of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no external funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eMM performed the plant sampling. ND and MM performed virus Purification and TEM. JB, IK and MM produced the HTS and conducted subsequent bioinformatics and molecular analyses. JB and MM performed biological assays. MM wrote the initial draft. AB and OS critically reviewed the manuscript. All authors have read the manuscript and agree for publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDolja VV, Krupovic M, Koonin EV. Deep Roots and Splendid Boughs of the Global Plant Virome. Annu Rev Phytopathol. 2020 Aug 25;58:23\u0026ndash;53. \u003c/li\u003e\n\u003cli\u003eLebas B, Adams I, Al Rwahnih M, Baeyen S, Bilodeau GJ, Blouin AG, et al. Facilitating the adoption of high-throughput sequencing technologies as a plant pest diagnostic test in laboratories: A step-by-step description. EPPO Bulletin. 2022;52(2):394\u0026ndash;418. \u003c/li\u003e\n\u003cli\u003eSaldarelli P, Boscia D, De Stradis A, Vovlas C. A New Member of the Family Flexiviridae from Phlomis Fructicosa. Journal of Plant Pathology. 2008;90(2):281\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eAdams MJ, Adkins S, Bragard C, Gilmer D, Li D, MacFarlane SA, et al. ICTV Virus Taxonomy Profile: Virgaviridae. J Gen Virol. 2017 Aug;98(8):1999\u0026ndash;2000. \u003c/li\u003e\n\u003cli\u003eHarrison BD, Robinson DJ. Tobraviruses. In: Van Regenmortel MHV, Fraenkel-Conrat H, editors. The Plant Viruses: The Rod-Shaped Plant Viruses [Internet]. Boston, MA: Springer US; 1986 [cited 2023 Nov 23]. p. 339\u0026ndash;69. (The Viruses). Available from: https://doi.org/10.1007/978-1-4684-7026-0_17\u003c/li\u003e\n\u003cli\u003eMacfarlane SA. Tobraviruses--plant pathogens and tools for biotechnology. Mol Plant Pathol. 2010 Jul;11(4):577\u0026ndash;83. \u003c/li\u003e\n\u003cli\u003eAdams MJ, Antoniw JF. DPVweb: a comprehensive database of plant and fungal virus genes and genomes. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D382-385. \u003c/li\u003e\n\u003cli\u003evan Griethuysen PA, Redeker KR, MacFarlane SA, Neilson R, Hartley SE. Virus-induced changes in root volatiles attract soil nematode vectors to infected plants. New Phytologist. 2024;241(5):2275\u0026ndash;86. \u003c/li\u003e\n\u003cli\u003eCooper JI, Harrison BD. The role of weed hosts and the distribution and activity of vector nematodes in the ecology of tobacco rattle virus. Annals of Applied Biology. 1973;73(1):53\u0026ndash;66. \u003c/li\u003e\n\u003cli\u003eNixon HL, Harrison BD. Electron Microscopic Evidence on the Structure of the Particles of Tobacco Rattle Virus582. Microbiology. 1959;21(3):582\u0026ndash;90. \u003c/li\u003e\n\u003cli\u003evan Belkum A, Cornelissen B, Linthorst H, Bol J, Pley C, Bosch L. tRNA-like properties of tobacco rattle virus RNA. Nucleic Acids Res. 1987 Apr 10;15(7):2837\u0026ndash;50. \u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;n-Hern\u0026aacute;ndez AM, Baulcombe DC. Tobacco Rattle Virus 16-Kilodalton Protein Encodes a Suppressor of RNA Silencing That Allows Transient Viral Entry in Meristems. Journal of Virology. 2008 Apr 15;82(8):4064\u0026ndash;71. \u003c/li\u003e\n\u003cli\u003eDeng X, Kelloniemi J, Haikonen T, Vuorinen AL, Elomaa P, Teeri TH, et al. Modification of Tobacco rattle virus RNA1 to serve as a VIGS vector reveals that the 29K movement protein is an RNA silencing suppressor of the virus. Mol Plant Microbe Interact. 2013 May;26(5):503\u0026ndash;14. \u003c/li\u003e\n\u003cli\u003eYue N, Jiang Z, Pi Q, Yang M, Gao Z, Wang X, et al. Zn2+-dependent association of cysteine-rich protein with virion orchestrates morphogenesis of rod-shaped viruses. PLOS Pathogens. 2024 Jun 17;20(6):e1012311. \u003c/li\u003e\n\u003cli\u003eKoenig R, Lesemann DE, Pleij CWA. Tobacco rattle virus genome alterations in the Hosta hybrid \u0026lsquo;Green Fountain\u0026rsquo; and other plants: reassortments, recombinations and deletions. Arch Virol. 2012 Oct 1;157(10):2005\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eMacfarlane SA. Molecular determinants of the transmission of plant viruses by nematodes. Mol Plant Pathol. 2003 May 1;4(3):211\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eHeinze C, Von Bargen S, Sadowska-Rybak M, Willingmann P, Adam G. Sequences of Tobacco Rattle Viruses from Potato. Journal of Phytopathology. 2000;148(9\u0026ndash;10):547\u0026ndash;54. \u003c/li\u003e\n\u003cli\u003eKurppa A, Jones AT, Harrison BD, Bailiss KW. Properties of spinach yellow mottle, a distinctive strain of tobacco rattle virus. Annals of Applied Biology. 1981;98(2):243\u0026ndash;54. \u003c/li\u003e\n\u003cli\u003eAshfaq M, McGavin W, Macfarlane SA. RNA2 of TRV SYM breaks the rules for tobravirus genome structure. Virus Res. 2011 Sep;160(1\u0026ndash;2):435\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eYin Z, Pawełkowicz M, Michalak K, Chrzanowska M, Zimnoch-Guzowska E. The genomic RNA1 and RNA2 sequences of the tobacco rattle virus isolates found in Polish potato fields. Virus Research. 2014 Jun 24;185:110\u0026ndash;3. \u003c/li\u003e\n\u003cli\u003eLindner K, Hilbrich I, Koenig R. Molecular characterization of variants of a new \u0026lsquo;rule-breaking\u0026rsquo; tobacco rattle virus RNA2 in potatoes. Virus Research. 2018 Jan 15;244:270\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eConti M, Masenga V. Identification and Prevalence of Pepper Viruses in Northwest Italy. Journal of Phytopathology. 1977;90(3):212\u0026ndash;22. \u003c/li\u003e\n\u003cli\u003eHerath V, Romay G, Urrutia CD, Verchot J. Family Level Phylogenies Reveal Relationships of Plant Viruses within the Order Bunyavirales. Viruses. 2020 Sep;12(9):1010. \u003c/li\u003e\n\u003cli\u003eSun MH, Ji YF, Li GH, Shao JW, Chen RX, Gong HY, et al. Highly adaptive Phenuiviridae with biomedical importance in multiple fields. Journal of Medical Virology. 2022;94(6):2388\u0026ndash;401. \u003c/li\u003e\n\u003cli\u003eSasaya T, Palacios G, Briese T, Di Serio F, Groschup MH, Neriya Y, et al. ICTV Virus Taxonomy Profile: Phenuiviridae 2023. Journal of General Virology. 2023;104(9):001893. \u003c/li\u003e\n\u003cli\u003eKuhn JH, Brown K, Adkins S, de la Torre JC, Digiaro M, Erg\u0026uuml;nay K, et al. Promotion of order Bunyavirales to class Bunyaviricetes to accommodate a rapidly increasing number of related polyploviricotine viruses. Journal of Virology. 2024 Sep 20;98(10):e01069-24. \u003c/li\u003e\n\u003cli\u003eFalk BW, Tsai JH. BIOLOGY AND MOLECULAR BIOLOGY OF VIRUSES IN THE GENUS TENUIVIRUS. Annual Review of Phytopathology. 1998 Sep 1;36(Volume 36, 1998):139\u0026ndash;63. \u003c/li\u003e\n\u003cli\u003eNavarro B, Zicca S, Minutolo M, Saponari M, Alioto D, Di Serio F. A Negative-Stranded RNA Virus Infecting Citrus Trees: The Second Member of a New Genus Within the Order Bunyavirales. Frontiers in Microbiology [Internet]. 2018 [cited 2023 Jun 10];9. Available from: https://www.frontiersin.org/articles/10.3389/fmicb.2018.02340\u003c/li\u003e\n\u003cli\u003eLecoq H, Wipf-Scheibel C, Verdin E, Desbiez C. Characterization of the first tenuivirus naturally infecting dicotyledonous plants. Arch Virol. 2019 Jan 1;164(1):297\u0026ndash;301. \u003c/li\u003e\n\u003cli\u003eDiaz-Lara A, Navarro B, Di Serio F, Stevens K, Hwang MS, Kohl J, et al. Two Novel Negative-Sense RNA Viruses Infecting Grapevine Are Members of a Newly Proposed Genus within the Family Phenuiviridae. Viruses. 2019 Jul 26;11(8):685. \u003c/li\u003e\n\u003cli\u003eGaafar YZA, Richert-P\u0026ouml;ggeler KR, Sieg-M\u0026uuml;ller A, L\u0026uuml;ddecke P, Herz K, Hartrick J, et al. A divergent strain of melon chlorotic spot virus isolated from black medic (Medicago lupulina) in Austria. Virology Journal. 2019 Jul 5;16(1):89. \u003c/li\u003e\n\u003cli\u003eNavarro B, Minutolo M, De Stradis A, Palmisano F, Alioto D, Di Serio F. The first phlebo-like virus infecting plants: a case study on the adaptation of negative-stranded RNA viruses to new hosts. Mol Plant Pathol. 2018 May;19(5):1075\u0026ndash;89. \u003c/li\u003e\n\u003cli\u003eButkovic A, Dolja VV, Koonin EV, Krupovic M. Plant virus movement proteins originated from jelly-roll capsid proteins. PLOS Biology. 2023 Jun 15;21(6):e3002157. \u003c/li\u003e\n\u003cli\u003eChen YM, Sadiq S, Tian JH, Chen X, Lin XD, Shen JJ, et al. RNA viromes from terrestrial sites across China expand environmental viral diversity. Nat Microbiol. 2022 Aug;7(8):1312\u0026ndash;23. \u003c/li\u003e\n\u003cli\u003eTokarz R, Sameroff S, Tagliafierro T, Jain K, Williams SH, Cucura DM, et al. Identification of Novel Viruses in Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis Ticks. mSphere. 2018;3(2):e00614-17. \u003c/li\u003e\n\u003cli\u003eLin YH, Fujita M, Chiba S, Hyodo K, Andika IB, Suzuki N, et al. Two novel fungal negative-strand RNA viruses related to mymonaviruses and phenuiviruses in the shiitake mushroom (Lentinula edodes). Virology. 2019 Jul 1;533:125\u0026ndash;36. \u003c/li\u003e\n\u003cli\u003eBertazzon N, Chitarra W, Angelini E, Nerva L. Two New Putative Plant Viruses from Wood Metagenomics Analysis of an Esca Diseased Vineyard. Plants. 2020 Jul;9(7):835. \u003c/li\u003e\n\u003cli\u003eKuhn JH, Adkins S, Alioto D, Alkhovsky SV, Amarasinghe GK, Anthony SJ, et al. 2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. Arch Virol. 2020 Dec 1;165(12):3023\u0026ndash;72. \u003c/li\u003e\n\u003cli\u003eSadiq S, Harvey E, Mifsud JCO, Minasny B, McBratney AB, Pozza LE, et al. Australian terrestrial environments harbour extensive RNA virus diversity. Virology. 2024 May 1;593:110007. \u003c/li\u003e\n\u003cli\u003eDai R, Yang S, Pang T, Tian M, Wang H, Zhang D, et al. Identification of a negative-strand RNA virus with natural plant and fungal hosts. Proceedings of the National Academy of Sciences. 2024 Mar 19;121(12):e2319582121. \u003c/li\u003e\n\u003cli\u003eGugerli P. Different States of Aggregation of Tobacco Rattle Virus Coat Protein. Journal of General Virology. 1976;33(2):297\u0026ndash;307. \u003c/li\u003e\n\u003cli\u003eMahillon M, Brodard J, Kellenberger I, Blouin AG, Schumpp O. A novel weevil-transmitted tymovirus found in mixed infection on hollyhock. Virology Journal. 2023 Jan 30;20(1):17. \u003c/li\u003e\n\u003cli\u003eMahillon M, Groux R, Bussereau F, Brodard J, Debonneville C, Demal S, et al. Virus Yellows and Syndrome \u0026ldquo;Basses Richesses\u0026rdquo; in Western Switzerland: A Dramatic 2020 Season Calls for Urgent Control Measures. Pathogens. 2022;11(8):885. \u003c/li\u003e\n\u003cli\u003eDovas CI, Katis NI. A spot nested RT-PCR method for the simultaneous detection of members of the Vitivirus and Foveavirus genera in grapevine. J Virol Methods. 2003 Jan;107(1):99\u0026ndash;106. \u003c/li\u003e\n\u003cli\u003eBoutsika K, Phillips MS, MacFarlane SA, Brown DJF, Holeva RC, Blok VC. Molecular diagnostics of some trichodorid nematodes and associated Tobacco rattle virus. Plant Pathology. 2004;53(1):110\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eMahillon M, Kellenberger I, Dubuis N, Brodard J, Bunter M, Weibel J, et al. First report of Tomato brown rugose fruit virus in tomato in Switzerland. New Disease Reports. 2022;45(1):e12065. \u003c/li\u003e\n\u003cli\u003eBolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014 Aug 1;30(15):2114\u0026ndash;20. \u003c/li\u003e\n\u003cli\u003ePrjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes De Novo Assembler. Current Protocols in Bioinformatics. 2020;70(1):e102. \u003c/li\u003e\n\u003cli\u003eWaterhouse AM, Procter JB, Martin DMA, Clamp M, Barton GJ. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009 May 1;25(9):1189\u0026ndash;91. \u003c/li\u003e\n\u003cli\u003eOkonechnikov K, Golosova O, Fursov M, UGENE team. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics. 2012 Apr 15;28(8):1166\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eEdgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eKalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods. 2017 Jun;14(6):587\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eNguyen LT, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015 Jan;32(1):268\u0026ndash;74. \u003c/li\u003e\n\u003cli\u003eHoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol. 2018 01;35(2):518\u0026ndash;22. \u003c/li\u003e\n\u003cli\u003eLetunic I, Bork P. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. 2019 Jul 2;47(W1):W256\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eGruber AR, Lorenz R, Bernhart SH, Neub\u0026ouml;ck R, Hofacker IL. The Vienna RNA Websuite. Nucleic Acids Research. 2008 Jul 1;36(suppl_2):W70\u0026ndash;4. \u003c/li\u003e\n\u003cli\u003eGrigoriev IV, Nikitin R, Haridas S, Kuo A, Ohm R, Otillar R, et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucleic Acids Res. 2014 Jan 1;42(Database issue):D699\u0026ndash;704. \u003c/li\u003e\n\u003cli\u003eWylie SJ, Tran TT, Nguyen DQ, Koh SH, Chakraborty A, Xu W, et al. A virome from ornamental flowers in an Australian rural town. Arch Virol. 2019 Sep;164(9):2255\u0026ndash;63. \u003c/li\u003e\n\u003cli\u003eShi M, Lin XD, Tian JH, Chen LJ, Chen X, Li CX, et al. Redefining the invertebrate RNA virosphere. Nature. 2016 Dec;540(7634):539\u0026ndash;43. \u003c/li\u003e\n\u003cli\u003eVelasco L, Arjona-Girona I, Cretazzo E, L\u0026oacute;pez-Herrera C. Viromes in Xylariaceae fungi infecting avocado in Spain. Virology. 2019 Jun 1;532:11\u0026ndash;21. \u003c/li\u003e\n\u003cli\u003eLi W, Sun H, Cao S, Zhang A, Zhang H, Shu Y, et al. Extreme Diversity of Mycoviruses Present in Single Strains of Rhizoctonia cerealis, the Pathogen of Wheat Sharp Eyespot. Microbiol Spectr. 11(4):e00522-23. \u003c/li\u003e\n\u003cli\u003eMiyauchi S, Kiss E, Kuo A, Drula E, Kohler A, S\u0026aacute;nchez-Garc\u0026iacute;a M, et al. Large-scale genome sequencing of mycorrhizal fungi provides insights into the early evolution of symbiotic traits. Nat Commun. 2020 Oct 12;11(1):5125. \u003c/li\u003e\n\u003cli\u003eHolmes EC. The Evolution of Endogenous Viral Elements. Cell Host Microbe. 2011 Oct 20;10(4):368\u0026ndash;77. \u003c/li\u003e\n\u003cli\u003eHernandez C, Carette JE, Brown DJ, Bol JF. Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2. Journal of Virology. 1996 Aug;70(8):4933\u0026ndash;40. \u003c/li\u003e\n\u003cli\u003eLister RM, Bracker CE. Defectiveness and dependence in three related strains of tobacco rattle virus. Virology. 1969 Feb 1;37(2):262\u0026ndash;75. \u003c/li\u003e\n\u003cli\u003eTelengech P, Hyodo K, Ichikawa H, Kuwata R, Kondo H, Suzuki N. Replication of single viruses across the kingdoms, Fungi, Plantae, and Animalia. Proceedings of the National Academy of Sciences. 2024 Jun 18;121(25):e2318150121. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"bunyaviricetes, coguvirus, entovirus, phenuiviridae, phlomis, tobravirus, TRV, virgaviridae","lastPublishedDoi":"10.21203/rs.3.rs-6578422/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6578422/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTwo RNA viruses were identified by high-throughput sequencing analysis of leaf samples of Jerusalem sages (\u003cem\u003ePhlomis fruticosa\u003c/em\u003e) in Switzerland. The first virus, representing a novel isolate of tobacco rattle virus (TRV) named \"Phlo\", was identified in symptomatic plants but not in healthy ones. Phlo is distinguished by its exceptionally long RNA2 that harbours two ORFs preceding the CP ORF. This peculiar genetic make-up is shared by a set of closely-related European TRV RNA2s, and it could be associated with host-specific systemic infection ability. The second virus, detected both in symptomatic and asymptomatic sages, is a novel member of the family \u003cem\u003ePhenuiviridae\u003c/em\u003e named \"Phlomis phenuivirus 1\" (PPV1). PPV1 exhibits a \u0026ldquo;cogu-like\u0026rdquo; architecture with a probable bi-segmented, ambisense RNA genome encoding a replicase, nucleocapsid, and putative movement protein (MP). PPV1 is related to Muscari virus A, a virus identified in an ornamental in Australia, and together they likely constitute a new genus for which the name \"Maladivirus\" is proposed. This taxon represents a sister clade of the genus \u003cem\u003eEntovirus\u003c/em\u003e, whose members have been identified in a fungus and diverse environmental samples. Intriguingly, the putative MPs of maladiviruses and entoviruses cluster with those of lentinuviruses (i.e. cogu-like mycoviruses) and with putative endogenous viral elements from a mycorrhizal fungus, suggesting a role in fungal hosts.\u003c/p\u003e","manuscriptTitle":"Characterization of an unusual tobacco rattle virus isolate and a novel phenuivirid in the Jerusalem sage","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-09 09:32:21","doi":"10.21203/rs.3.rs-6578422/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-07-08T11:44:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-08T08:56:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"46496064927436455317536550083467526338","date":"2025-06-24T07:41:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-19T09:58:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"156499043416329644330939986297896887458","date":"2025-05-24T08:41:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"25628870950834199631786468164042776952","date":"2025-05-23T13:02:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-06T06:49:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-05T22:34:10+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-05T22:22:45+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2025-05-02T12:23:44+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"367684d9-8171-4aca-9b32-c8b727ef5946","owner":[],"postedDate":"May 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-11T16:06:25+00:00","versionOfRecord":{"articleIdentity":"rs-6578422","link":"https://doi.org/10.1186/s12985-025-02896-3","journal":{"identity":"virology-journal","isVorOnly":false,"title":"Virology Journal"},"publishedOn":"2025-08-06 15:57:58","publishedOnDateReadable":"August 6th, 2025"},"versionCreatedAt":"2025-05-09 09:32:21","video":"","vorDoi":"10.1186/s12985-025-02896-3","vorDoiUrl":"https://doi.org/10.1186/s12985-025-02896-3","workflowStages":[]},"version":"v1","identity":"rs-6578422","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6578422","identity":"rs-6578422","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}