Increasing CYLD expression improved the prognosis by downregulating the mTOR/SREBP1/lipid metabolism pathway in HPV-negative OSCC patients

Increasing CYLD expression improved the prognosis by downregulating the mTOR/SREBP1/lipid metabolism pathway in HPV-negative OSCC patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Increasing CYLD expression improved the prognosis by downregulating the mTOR/SREBP1/lipid metabolism pathway in HPV-negative OSCC patients Zhuo Lin, YiCheng Hong, Yunyi Huang, Xuanyi Chen, Zhipei Chen, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6695111/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: CYLD is associated with tumorigenesis, but its role in HPV-negative OSCC is unclear. Methods and Results: R-bioinformatics analysis from the GEO database and qPCR analysis of OSCC cell lines demonstrated that CYLD mRNA expression was significantly reduced in OSCC compared to normal tissue and normal human gingival epithelial cell lines. In 66 primary OSCC cases, immunohistochemistry revealed decreased CYLD expression in OSCC tissues. High expression of CYLD was negatively associated with OSCC recurrence in HPV-negative patients (p=0.04) and correlated with improved overall survival (OS) and disease-free survival (DFS) (p=0.02 and 0.01, respectively). CCK-8, wound healing, and Transwell assays showed that Overexpression of the CYLD group reduced OSCC proliferation, migration, and invasion in UM1 and HN6 cells compared to the Vector group. Lipidomics analysis revealed significantly lower levels of lipid subclasses in the overexpression of the CYLD group. Western blot and qPCR show that overexpression of the CYLD group inhibited mTOR phosphorylation and lipid metabolism in OSCC cells. Conclusion: CYLD expression is significantly reduced in OSCC. Elevating CYLD expression improves OS and DFS by inhibiting the mTOR pathway associated with lipid metabolism in HPV-negative OSCC. Biological sciences/Cancer/Oral cancer Health sciences/Pathogenesis Health sciences/Medical research/Biomarkers Cylindromatosis oral squamous cell carcinoma HPV-negative lipid metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 What is New 1. We first found that the expression of CYLD was positively correlated with overall survival and disease-free survival in HPV-negative OSCC patients. 2. Subsequent analysis revealed that overexpression of CYLD inhibited proliferation, invasion, migration, and lipid metabolism in OSCC. 3. Overexpression of CYLD downregulates lipid metabolism through the mTOR/SREBP1 signaling pathway. 1 Introduction Head and neck squamous cell carcinoma (HNSCC) is the 6th most common cancer in the world [ 1 ] . HNSCC causes more than 325,000 deaths annually [ 2 ] . The common sites of HNSCC are the oral cavity, larynx, nasal cavity, pharynx, and paranasal sinuses [ 3 ] . Oral squamous cell carcinoma (OSCC) is the most common type of HNSCC, representing 90% of oral cancers [ 4 ] . In 2022, approximately 65,100 new cases of OSCC were reported in China, with about 35,200 deaths [ 5 ] . Anatomically, OSCC are prone to invade the muscle tissue and jawbone and metastasize to the surrounding lymph nodes, leading to a poor prognosis [ 6 ] . The development of OSCC is closely associated with various risk factors. In addition, human papillomavirus (HPV), a small double-stranded DNA virus, has been identified as a novel risk factor for HNSCC. HPV induces human squamous epithelial hyperplasia, with the majority of tumors occurring in the oral cavity, oropharynx, hypopharynx, and larynx. [ 7 ] . HPV oropharyngeal carcinoma (HPV-OPC) was categorized as a separate entity according to the 8th edition of TNM staging. HPV-OPC has a better prognosis than HPV-negative OPC [ 8 ] . Similarly, in HPV-positive OSCC, HPV E2 protein is inactivated, leading to elevated HPV E6 and E7 proteins [ 9 ] . HPV E6 and E7 proteins inactivate two tumor suppressors, Rb and p53, which drive tumorigenesis [ 9 ] . Thus, HPV-positive OSCC may differ from HPV-negative OSCC in terms of clinical features, molecular mechanisms, and response to treatment [ 7 , 9 ] . HPV infection can be confirmed by p16 immunohistochemical staining [ 7 , 10 ] . Therefore, in the study of OSCC, it is crucial to categorize the samples into HPV-negative and HPV-positive groups based on p16 staining. Despite significant advances in surgical techniques, radiotherapy, and chemotherapy over the past 30 years, the outcomes of OSCC remain unsatisfactory. Approximately half of patients with advanced disease will die in five years [ 11 ] . Therefore, exploring new biomarkers and therapy strategies for OSCC patients is essential. CYLD is located on human chromosome 16q12.1 and encodes a protein (cylindromatosis, CYLD) containing 956 amino acids [ 12 ] . CYLD is a tumor suppressor gene that encodes a lysine-63 (K63) deubiquitinating enzyme (DUB) [ 13 ] . CYLD pathogenic mutations can lead to familial Cylindromatosis [ 14 ] . Loss of CYLD expression was observed in several diseases, such as endometrial cancer [ 15 ] , nasopharyngeal cancer [ 16 ] , cholesteatoma [ 17 ] , melanoma [ 18 ] , prostate cancer [ 19 ] , and bladder cancer [ 20 ] , with adverse outcomes. The CYLD protein consists of three glycine-rich cytoskeleton-associated protein (CAP-Gly) structural domains, two protease structural domains, a phosphorylation region, and the USP catalytic structural domain [ 14 ] . Microtubules are filamentous cellular structures involved in various cellular activities, such as cell motility and cell division [ 21 ] . The CAP-Gly structural domain of CYLD may interact with microtubules to influence the course of cellular activities [ 21 ] . It has been documented that loss of CYLD activates NF-κB [ 22 ] , Wnt/β-catenin [ 23 ] , JNK [ 24 ] , mTOR [ 25 ] , TGF-β [ 26 ] , and Notch [ 27 ] pathways, resulting in undesirable consequences, such as tissue fibrosis [ 26 ] , reduction of autophagic flux [ 25 ] , and promotion of tumorigenesis [ 28 ] . Previous studies have shown that alterations in CYLD are associated with metastasis and poor prognosis in HPV-positive HNSCC patients [ 29 ] . Moreover, HPV E6 can also directly degrade CYLD, reducing its functional significance in high-risk HPV [ 30 ] . However, the role of CYLD in HPV-negative OSCC patients remains unclear. In this study, we explore the association of CYLD with the prognosis of HPV-negative OSCC patients and their related mechanisms. 2 Materials and methods 2.1 CYLD mRNA expression in the GEO database We retrieved the original data of CYLD mRNA expression in OSCC from the National Library of Medicine (NCBI) GEO database. Then, we analyzed CYLD mRNA expression in normal oral tissues and OSCC tissues. 2.2 Patient samples 66 samples of OSCC patients were selected from the case bank of the Department of Oral Pathology, Hospital of Stomatology, Guanghua School of Stomatology, Sun Yat-sen University, Guangzhou, China. All samples were diagnosed as primary OSCC located in the oral cavity and oropharynx, including the tongue, oropharynx, cheeks, lips, gums, and floor of the mouth. The clinicopathological characteristics including age, gender, tumor size, clinical stage, pathological differentiation, depth of invasion (DOI) ( following the eighth edition of the American Joint Committee on Cancer Criteria [AJCC criteria]) [ 31 ] , smoking, recurrence, and lymph node metastasis were analyzed according to differential expression of CYLD. All methods were carried out in accordance with relevant guidelines and regulations. We requested an exemption from ethical review due to using previously collected pathological specimens for this study. The informed consent was waived by IRB AF/SC-07/v3.0. This study was approved by the Clinical Research Ethics Committee of the Affiliated Stomatological Hospital of Sun Yat-sen University on December 29, 2021(KQEC-2021-76-01). 2.3 Immunohistochemical staining CYLD and p16 were performed according to the following standard procedure. OSCC samples were cut into 4 µm-thick sections, deparaffinized in xylene, and rehydrated in serially diluted ethanol. The endogenous peroxidase activity was eliminated by the hydrogen peroxide method. Antigen recovery was performed at 10MPa EDTA (pH 9.0) for 2 min. After sections were incubated in 5% BSA for 10 min to eliminate endogenous biotin activity. Diluted primary antibody (CYLD polyclonal antibody, dilution 1:100, an antibody from Proteintech, USA; p16 polyclonal antibody, dilution 1:200, an antibody from Abcam, USA) was added to the sections and incubated at 4°C for more than 14 hours. Then, the secondary antibody was added to the sections and incubated at 37°C for 40 min. Finally, the sections were visualized with 3,3′-diaminobenzidine (DAB) substrate and counterstained with hematoxylin. Positive controls were made from human brain tissue, and negative controls were made from samples incubated with PBS instead of primary antibodies. The range and strength of staining were assessed and graded by two pathologists. The percentage of tumor-positive cells was graded as follows: 0, 70% positive cells. Staining results were categorized as low or high expression according to the score: score 0–2 for low CYLD expression (LE-CYLD), score 3–4 for high CYLD expression (HE-CYLD). According to our previous study, positive cells > 70% with strongly stained nuclei (with or without cytoplasmic staining) were considered to be positive expressions of p16 [ 32 ] . 2.4 Cell culture Normal human gingival epithelial cell lines (HGEC) and HPV-negative OSCC cell lines (UM1, HN6) were provided by the Guangdong Provincial Key Laboratory of Stomatology (Guangzhou, China). Cells were cultured in high-glucose DMEM (Gibco, Camarillo, CA, USA) medium with 10% fetal bovine serum (Gibco, Camarillo, CA, USA) with 5% CO2 at 37°C. mTOR activator (MHY1485) was purchased from Mce (New Jersey, USA) 2.5 Establishment of stable cell lines with CYLD overexpression The CYLD expression plasmid (CYLD-HA-SV40-EGFP-IRES-Puromycin) used in the experiment was provided by IGeneBio (Guangzhou, China) (Table 1 ). Plasmids were transfected into cell lines according to the protocol of the Lenti-Pac™ HIV Lentiviral Packaging Kit by IGeneBio (Guangzhou, China). Table 1 The plasmid sequences targeting CYLD. plasmid sequence CYLD ATGAGTTCAGGCTTATGGAGCCAAGAAAAAGTCACTTCACCCTACTGGGA AGAGCGGATTTTTTACTTGCTTCTTCAAGAATGCAGCGTTACAGACAAAC 2.6 CCK-8 assay Cell Counting Kit-8 (CCK-8, Beyotime, China) was prepared in a 1:10 ratio with a complete medium. The mixture was used to measure the cell value increase at 0h, 24h, 48h, 72h, and 96h. The results were determined by subtracting the reference absorbance at 450 nm using an enzyme-linked immunoassay. 2.7 Wound healing assay UM1 and HN6 cells were inoculated in 6-well plates. When the cells grew to about 90% confluence, the head was washed with a 1 ml plastic pipette to create a wound. Then, it was rinsed with PBS and incubated in the FBS-free DMEM. The wound healing distance was measured after 24h to assess the rate of cell migration. 2.8 Transwell migration/invasion assay Transwell invasion assays were performed using 24-well cell culture inserts (Corning, NY, USA) with polyethylene terephthalate membranes (8 µm pore size) and Matrigel basement membrane substrates (1:8 dilution, BD Biosciences, CA, USA). UM1 and HN6 cells were isolated using TrypLE Express (Gibco, Camarillo, CA, USA) and resuspended in serum-free DMEM. A total of 200 µl of the cell suspension (50,000 cells/well) was added to the upper chamber of the Transwell insert. The bottom chamber was filled with 600 µl of medium containing 20% FBS. After 24 hours of incubation, cells in the bottom chamber were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted under a microscope. In the absence of Matrigel in the upper chamber, the same Transwell assay was used to study cell migration. 2.9 Lipidomic UM1 cells transfected with either Vector or CYLD were cultured to confluence in a 6 cm dish. After removing the culture medium, the cells were washed once with 1 mL PBS. Subsequently, the cells were added 600 µl of pre-chilled methanol (from − 80°C) and 240 µl of ice-cold ultrapure water. The metabolites were then scraped from the cell surface using a cell scraper, transferred to a 1.5 ml EP tube, and vortexed for 10 seconds. Following this, 600 µl of pre-chilled chloroform was added, and the mixture was centrifuged at 15,000 rcf for 15 minutes at 4°C to separate the organic and aqueous phases. The lower organic phase (500 µl) was collected and dried under nitrogen gas at room temperature. The dried sample was re-dissolved in 150 µl of a solvent mixture (chloroform: methanol: water, 3:3:0.5), vortexed vigorously for 5 minutes, and centrifuged at 15,000g for 5 minutes at room temperature. Finally, 100 µl of the supernatant was transferred to a 2 ml mass spectrometry vial for subsequent analysis, while 20 µl of the supernatant was reserved in a separate 2 ml vial as a quality control (QC) sample to assess the equilibrium of the chromatography-mass spectrometry system and monitor the instrument's performance. Lipid extracts were analyzed by liquid chromatography-mass spectrometry (LC-MS) using an Ultimate 3000 LC system equipped with a Hyperil Gold C18 column (40°C, 0.30 ml/min flow rate, and 4 µl injection volume). For negative ion mode analysis, the mobile phase consisted of solvent A (40% ultrapure water, 60% acetonitrile, 10 mM ammonium formate, 0.1% formic acid) and solvent B (10% acetonitrile, 90% isopropanol, 10 mM ammonium formate, 0.1% formic acid), with the gradient program detailed in Table 2 . Lipid analysis was performed on an Orbitrap Exploris™ 240 mass spectrometer in ESI negative ion mode, with a mass range of 100–1500 m/z. The spray voltage was set to + 3500V / −3000V, sheath gas at 40 arb, auxiliary gas at 10 arb, ion transfer tube temperature at 320°C, and auxiliary gas heater at 350°C. The full scan resolution was set to 120,000, and data-dependent MS2 resolution was 30,000, with collision energies of 20, 50, and 80. The lipidomic data were processed and analyzed using Lipid Search 5.0 software for lipid identification and cohort analysis. Signal intensities for each ion were normalized to the measured protein concentration for accurate quantification. Table 2 Mobile phase gradient Time Mobile Phase A Mobile Phase B 0.00min 100 0 1.00min 100 0 6.00min 50 50 27.00min 20 80 31.00min 0 100 36.00min 0 100 36.00min 100 0 36.10min 100 0 2.10 Western blotting Cells were washed three times with cold PBS, and total proteins were lysed in RIPA lysis solution (CWBIO, Beijing, China) supplemented with 1% protease inhibitor and 1% phosphatase inhibitor at 4°C. The extracts were sonicated and centrifuged at 12,000 rpm for 10 min at 4°C. Protein concentration was measured by using the BCA Protein Assay Kit (CWBIO, Beijing, China). Proteins were separated on FuturePAGE™ 4–20% 15 Wells (Boyi Biotech, China) by adding 30 µL per well and transferred to a formaldehyde-soaked PVDF membrane (0.2 µm, Millipore, Darmstadt, Germany). Membranes were incubated overnight at 4°C with the appropriate primary antibody, then rinsed with TBST and incubated with HRP-coupled secondary antibody at a dilution of 1:3000 for 1 hour at room temperature. Membranes were imaged using a high-sensitivity chemiluminescence imaging system and ECL reagents (NCMbio, Suzhou, China). Bands were semi-quantified by using ImageJ software. β-Actin was an endogenous control. CYLD (1:1000, # A11110-1-AP), mTOR (1:1000, # 66888-1-Ig), and phospho-mTOR (1:1000, # 67778-1-Ig) antibodies were purchased from Proteintech (Rosement, IL, USA). Anti-rabbit IgG (1:3000, #7074 S) and anti-mouse IgG (1:3000, #7076 S) antibodies were purchased from Cell Signaling Technology. β-Actin (1:1000, # AF7018) antibodies were purchased from Affinity. 2.11 qPCR RNA extraction from cultured cells using the RNA Rapid Extraction Kit. (Yishan Biotech, Shanghai, China). RNA was reverse transcribed into cDNA using HiScript® III RT SuperMix for qPCR Kit (Vazyme, Nanjing, China). The resulting cDNA was then run by qPCR using specific primers and ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) in the QuantStudio 5 Real-Time PCR Systems (Table 3 ). Table 3 The primer sequences used in the experiment Primer Sequences (5’–3’) β-actin F’ TGTTACAGGAAGTCCCTTGCCATC β-actin R’ CTGTGTGGACTTGGGAGAGGAC CYLD F’ CTGGAGTTGTACGCTTCAGAGGAC CYLD R’ ACCACGACCTTCTTCCAGCAATTC ACC1 F’ CTTGAGGGCTAGGTCTTTCTGG ACC1 R’ CTGGTTCAGCTCCAGAGGTT ACLY F’ CAGTCCCAAGTCCAAGATCCC ACLY R’ GTCTCGGGAGCAGACATAGT FASN F’ AACTCCAAGGACACAGTCACCAT FASN R’ CAGCTGCTCCACGAACTCAA SCD1 F’ CACTTGGGAGCCCTGTATGG SCD1 R’ TGAGCTCCTGCTGTTATGCC SREBP1 F’ GCTGCTGACCGACATCGAA SREBP1 R’ CCAGCATAGGGTGGGTCAAA SREBP1C F’ TTAGAGCGAGCACTGAAC SREBP1C R’ TGGAACTGATGGAGAAGC 2.12 Statistical analyses SPSS 25.0, GraphPad Prism 9 for data analysis and plotting. Patient survival was assessed using the Kaplan-Meier method. A p-value of < 0.05 for the data was considered statistically significant. 3 Results 3.1 CYLD expression is decreased in OSCC We initially explored the expression of CYLD in OSCC using the GEO public database and compared the CYLD mRNA expression in OSCC samples with normal tissues in the GSE30784 and GSE37991 cohorts. Results were shown in Fig. 1 A; CYLD mRNA was downregulated in OSCC tissues compared with normal tissues (GSE30784, p = 0.01; GSE37991, p = 0.01). We used quantitative real-time PCR to analyze CYLD expression in OSCC cell lines UM1 and HN6. The results showed that CYLD expression was reduced in UM1 and HN6 compared to HGEC (Fig. 1 B). We used immunohistochemistry to compare the expression of CYLD in OSCC and paracancerous tissues, and the results showed that CYLD expression was decreased in OSCC tissues (Fig. 1 C). 3.2 CYLD expression and its relationship to clinicopathologic characteristics We performed immunohistochemical staining of 66 primary OSCC specimens to explore the CYLD expression (Fig. 2 A). The sample of 66 cases consisted of patients, including 20 females and 46 males, with an average age of 53.4 years (22–84 years old). The patients were followed for an average of 37 months (4–82 months). According to the CYLD expression in OSCC samples, we categorized the results into the following two categories: LE-CYLD (17 cases) and HE-CYLD (49 cases). CYLD staining was seen in the cytoplasm of both normal tissues and tumor cells, with high expression of CYLD, whereas the nuclei showed a lighter color and rare expression. The relationship between CYLD staining intensity and clinicopathologic characteristics (gender, age, tumor size, clinical stage, pathological grading, DOI, smoking, p16 staining, recurrence, lymph node metastatic status, and tumor site) is shown in Table 4 . The expression of CYLD was negatively correlated with lymph node metastasis ( p = 0.03) and recurrence of OSCC ( p = 0.02). Still, it was not associated with gender, age, tumor size, clinical stage, pathological grading, DOI, smoking, p16 staining, and tumor site of OSCC ( p > 0.05). Table 4 Immunohistochemical expression of CYLD protein and its relation to clinicopathologic characteristics Clinicopathological characteristics CYLD P values Samples Low High Gender 17 49 Male 46 14 32 0.19 Female 20 3 17 Age ≤ 60 46 11 35 0.60 >60 20 6 14 Tumor size T1-T2 34 6 28 0.12 T3-T4 32 11 21 Clinical stage Ⅰ-Ⅱ 27 5 22 0.26 Ⅲ-Ⅳ 39 12 27 Pathology differentiation Well 23 6 17 0.96 Moderate/poor 43 11 32 DOI DOI ≤ 5mm 14 2 12 0.13 5mm10mm 29 11 18 P16 staining Positive 23 5 18 0.59 Negative 43 12 31 Smoking Yes 23 7 16 0.53 No 43 10 33 Recurrence Yes 20 9 11 0.02 No 46 8 38 Lymph node metastasis Yes 21 9 12 0.03 No 45 8 37 Site Sig (Fisher) Tongue 40 12 28 0.55 Buccal mucosa 8 1 7 Floor of mouth 6 2 4 Gingiva 8 1 7 Palate 2 1 1 oropharynx 2 0 2 Note: Bolded p indicates statistically significant chi-square test results with p ＜0.05. 3.3 The relationship between CYLD and the prognosis in OSCC Patients We used statistical methods to assess the potential correlation between CYLD expression and survival in OSCC patients. Among the 66 OSCC patients at final follow-up, 40 cases (60.6%) survived without any disease, 6 cases (9.1%) suffered from OSCC recurrence, and 20 cases (30.3%) died of OSCC recurrence, distant metastasis, or other unrelated disease. Specifically, as shown in Fig. 2 B, HE-CYLD was significantly associated with prolonged overall survival ( p = 0.01, log-rank) and disease-free survival ( p = 0.01, log-rank). 3.4 Expression of CYLD and p16 in OSCC patients and their relationship to Clinicopathology HPV infection can be confirmed by p16 immunohistochemical staining [ 7 , 10 ] . We further assessed CYLD expression in HPV-positive (p16-positive) OSCC (23 cases) and HPV-negative (p16-negative) OSCC (43 cases). In the HPV-negative group, as shown in Table 5 , compared to LE-CYLD patients, OSCC recurrence dramatically decreased in the HE-CYLD patients (p = 0.04) but was not associated with other factors. In addition, we examined the survival outcomes of the four subgroups (Fig. 2 C). Tables 6 and 7 showed two-by-two group comparisons. In the HPV-positive OSCC subgroup, there was no statistically significant difference in overall ( p = 0.60) and disease-free survival ( p = 0.34) between the HE-CYLD and the LE-CYLD patients. In contrast, in the HPV-negative OSCC subgroup, the overall and disease-free survivals of HE-CYLD patients were statistically increased ( p = 0.02 and p = 0.01) compared with the LE-CYLD patients. Table 5: Relationship between IHC expression in CYLD and clinicopathologic parameters by p16 staining status. Clinicopathological characteristics p16-positive OSCC(n=23) p16-negative OSCC(n=43) CYLD P values CYLD P values Low High Low High Gender Male 5 13 0.55 9 19 0.49 Female 0 5 3 12 Age ≤60 2 15 0.09 9 20 0.72 ＞60 3 3 3 11 Tumor size T1-T2 1 10 0.32 5 18 0.50 T3-T4 4 8 7 13 Clinical stage Ⅰ-Ⅱ 1 9 0.34 4 13 0.74 Ⅲ-Ⅳ 4 9 8 18 Pathology differentiation Well 1 5 1.00 5 12 1.00 Moderate/poor 4 13 7 19 DOI DOI≤5mm 1 4 0.14 1 8 0.38 5mm＜DOI≤10mm 0 8 4 11 DOI＞10mm 4 6 7 12 Smoking Yes 3 9 1.00 4 7 0.47 No 2 9 8 24 Recurrence Yes 1 2 0.54 8 9 0.04 No 4 16 4 22 Lymph node metastasis Yes 2 2 0.19 7 10 0.17 No 3 16 5 21 Site Tongue 4 12 1.00 8 16 0.23 Buccal mucosa 0 0 1 7 Floor of mouth 0 3 2 1 Gingiva 1 2 0 5 Palate 0 0 1 1 oropharynx 0 1 0 1 Note: Bolded p indicates statistically significant chi-square test results with p ＜0.05. Table 6 Pairwise comparisons of Overall Survival Rates. Groups CYLD (+), p16(+) CYLD (-), p16(+) CYLD (+), p16(-) CYLD (-), p16(-) Chi-square Sig Chi-square Sig Chi-square Sig Chi-square Sig CYLD (+), p16(+) 0.27 0.60 2.50 0.11 15.05 0.01 CYLD (-), p16(+) 0.27 0.60 1.16 0.28 4.63 0.03 CYLD (+), p16(-) 2.50 0.11 1.16 0.28 9.53 0.02 CYLD (-), p16(-) 15.05 0.01 4.63 0.03 9.53 0.02 Note: Bolded p indicates statistically significant chi-square test results with p ＜0.05. Table 7 Pairwise comparisons of Disease-free Survival Rates. Groups CYLD (+), p16(+) CYLD (-), p16(+) CYLD (+), p16(-) CYLD (-), p16(-) Chi-square Sig Chi-square Sig Chi-square Sig Chi-square Sig CYLD (+), p16(+) 0.91 0.34 5.81 0.02 17.83 0.01 CYLD (-), p16(+) 0.91 0.34 0.60 0.44 3.12 0.08 CYLD (+), p16(-) 5.81 0.02 0.60 0.44 6.14 0.01 CYLD (-), p16(-) 17.83 0.01 3.12 0.08 6.14 0.01 Note: Bolded p indicates statistically significant chi-square test results with p ＜0.05. 3.5 CYLD overexpression inhibited the OSCC cell proliferation Subsequently, we used plasmids overexpressing CYLD (OE-CYLD) in UM1 and HN6 and used plasmid vectors as controls. The results of OE-CYLD were validated using western blot and quantitative real-time PCR (Fig. 3 A-B). We used the CCK-8 assay to detect OSCC proliferation after OE-CYLD. The results showed that OE-CYLD significantly inhibited OSCC cell growth compared with the vector group. This indicates that OE-CYLD inhibits OSCC cell proliferation (Fig. 3 C). 3.6 CYLD overexpression inhibited the OSCC cell migration and invasion Cell migration was detected using a wound-healing assay and a Transwell assay. The results of the wound-healing assay showed that the wound-healing rate of UM1 and HM6 cells was significantly reduced after OE-CYLD ( p < 0.05) (Fig. 3 D). Meanwhile, the Transwell assay showed that the migration and invasion ability of UM1 and HN6 cells was also significantly reduced after OE-CYLD, which indicated that OE-CYLD could inhibit the OSCC cell migration and invasion (Fig. 3 D-E). 3.7 CYLD downregulates the mTOR/SREBP1 pathway and lipid metabolism We first assessed the data availability of the lipidomics by analyzing the QC samples. The base peak ion chromatograms of the QC samples exhibited highly consistent chromatographic features, and in the PCA plot, the samples showed tight clustering, indicating good data reproducibility ( Fig. 4 A-B ) . Subsequent analysis of lipid subtypes revealed that, compared to the Vector group, the CYLD group exhibited significantly reduced levels of various lipid subclasses, including cardiolipin (CL), ceramide (Cer), fatty acid (FA), monohexosylceramide (Hex1Cer), lysophosphatidylcholine (LPC), lysophosphatidylethanolamine (LPE), phosphatidic acid (PA), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylglycerol (PG), phosphatidylinositol (PI), phosphatidylserine (PS), and sphingomyelin (SM) (Fig. 4 C). Therefore, we sought to explore the molecular mechanisms associated with lipid metabolism. We detected HN6 and UM1 cells after transfection with OE-CYLD by western blot and qPCR. The results revealed that SREBP1, an essential protein in lipid metabolism, was downregulated by OE-CYLD (Fig. 4 D). qPCR results showed that the lipid metabolic-related molecules (SREBP1, SREBP1C, FASN, ACC1, ACLY, SCD1) were downregulated in OE-CYLD compared with the vector group (Fig. 4 E). Treating the cells with 10 µM MHY1485 for 6 hours can reverse the above process (Fig. 4 F). 4 Discussion In this study, increased CYLD leads to a better prognosis in HPV-negative OSCC patients. Mechanistically, we report for the first time that increased CYLD in OSCC can inhibit lipid metabolism through the mTOR pathway, thereby suppressing OSCC proliferation, migration, and invasion (Fig. 4 G). CYLD may be a promising prognostic marker and therapeutic target in primary OSCC. CYLD plays a crucial role in tumorigenesis and tumor progression by regulating several critical biological processes, including cell proliferation, migration, and invasion. Additionally, it is associated with prognosis. [ 22 ] . In our research, we confirmed that CYLD expression was reduced in OSCC. CYLD increased in tissues inhibited lymph node metastasis and recurrence while promoting overall survival and disease-free survival in OSCC [ 14 ] . In addition, in HPV-positive OSCC patients, HPV E2 protein is inactivated, leading to elevated HPV E6 and E7 proteins [ 9 ] . HPV E6 and E7 proteins inactivate two tumor suppressors, Rb and p53, which drive tumorigenesis [ 9 ] . Thus, HPV-positive OSCC may differ from HPV-negative OSCC in terms of clinical features, molecular mechanisms, and response to treatment [ 7 , 9 ] . Therefore, we divided our samples into HPV-positive and HPV-negative for further study of the relationship with CYLD expression. Our results showed that CYLD expression in the HPV-positive group was not associated with prognosis. In contrast, in the HPV-negative group, increased CYLD expression was correlated with improved overall survival and disease-free survival in OSCC patients. This may be because in HPV-positive tumors, high-risk HPV oncogenes (e.g., E6 and E7) promote cell proliferation and survival by directly inhibiting tumor suppressors such as p53 and Rb [ 33 ] . Therefore, CYLD may serve as a prognostic marker for HPV-negative patients and could have potential clinical implications during surgery. It may justify the consideration of extended resection to prevent recurrence and lymph node dissection, followed by regular postoperative surveillance. However, the specific mechanism underlying these effects remains unclear. Furthermore, in non-alcoholic fatty liver disease (NAFLD), hepatocytes deficient in CYLD exhibit significant lipid accumulation. Conversely, overexpression of CYLD inhibits lipid accumulation, attenuating the progression of fatty liver disease [ 34 ] . Lipid metabolism is a crucial cellular process that converts nutrients into metabolic intermediates for membrane biosynthesis, energy storage, and the production of signaling molecules [ 35 ] . However, the relationship between CYLD and lipid metabolism in OSCC has not been elucidated. Our study demonstrated that CYLD can suppress the levels of lipid subclasses in OSCC. Significant lipid metabolic reprogramming is observed between tumor tissues and normal tissues. By comparing the expression differences of lipid subclasses in various samples, the potential link between abnormal lipid expression patterns and the malignant features of tumors can be elucidated. For example, PA, SM, and Cer can regulate tumor proliferation, migration, and invasion [ 36 ] . Therefore, we hypothesize that CYLD may regulate the proliferation, migration, and invasion of OSCC through lipid metabolism. Further mechanistic analysis revealed that increased CYLD expression significantly downregulated the expression of SREBP1 and its downstream fatty acid synthases, including FASN, ACC1, ACLY, and SCD1. Lipid metabolism involves key proteins such as SREBP1, SREBP1C, FASN, ACC1, ACLY, and SCD1, which regulate lipid metabolism and cholesterol synthesis [ 37 ] . Notably, SREBP1 is a crucial molecule in lipid metabolism. When activated, it induces the transcription of fatty acid synthase and promotes the elongation of polyunsaturated fatty acids [ 35 ] . SREBP1C is the predominant SREBP1 isoform in most adult tissues [ 38 ] . According to previous research, lipid cellular uptake and synthesis are upregulated through the mTOR signalling pathway in cancer [ 35 ] . mTOR is a serine/threonine protein kinase belonging to the PI3K-related kinase family and forms the catalytic subunits of two distinct protein complexes, including mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2) [ 39 ] . In vitro experiments demonstrate that CYLD deficiency promotes the mTOR pathway in the brain, thereby affecting cellular autophagy [ 25 , 40 ] , which indicates that CYLD may participate in the mTOR-related lipid mechanism. In our study, overexpression of CYLD notably decreased the phosphate-mTOR expression and fatty acid metabolism in OSCC. Treatment with MHY1485 can reverse lipid metabolism-related markers. Based on our research, we first found that increased CYLD expression may potentially downregulate the mTOR-fatty acids pathway and further suppress OSCC proliferation, migration, and invasion, which thus improves the prognosis of HPV-negative OSCC patients. 5 Limitation This study has several limitations. The clinical sample size is relatively small, and p16 can only serve as an initial screening marker for HPV. It needs to be combined with HPV DNA or RNA testing for more accurate detection. Furthermore, whether increasing CYLD expression in animal experiments exactly decreases the OSCC invasion needs to be elucidated. 6 Conclusion Our study demonstrated that increased CYLD expression potentially downregulated the phosphate-mTOR/SREBP1 pathway and decreased lipid metabolism. This, therefore, suppresses OSCC proliferation, migration, and invasion and eventually improves the prognosis of HPV-negative OSCC patients. CYLD may be not only a promising target for OSCC therapy but also a biomarker for evaluating the prognosis of HPV-negative OSCC patients. Declarations Contributions The investigation, validation, software, formal analysis, data curation and writing – original draft: Z L; methodology and conceptualization: M X, Z L, YY H, XY C and YC H; visualization: Z L, YC H and ZP C; supervision, project administration, writing – review and editing: XH C and M X; funding acquisition and resources: M X. Conflict of Interests The authors declare that they have no conflict of interest. Data availability statement The GEO dataset is available for download from the GEO database, and the remaining data will be provided as required from [email protected] . Fundings Foundation and Applied Basic Research Fund of Guangdong, Grant/Award Number: 2020A1515010529; Guangdong "New Medical Science" Education and Instruction Committee 2023 Teaching Reform Project; Undergraduate Teaching Quality Engineering project of Sun Yat-sen University [2021,2022,2023]; The College Students' Innovative Entrepreneurial Training Plan Program of Sun Yat-sen University [2024] Ethical Approval This study was approved by the Clinical Research Ethics Committee of the Affiliated Stomatological Hospital of Sun Yat-sen University on December 29, 2021 Informed Consent Not Applicable. References Johnson DE, Burtness B, Leemans CR, Lui V, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers. 2020. 6(1): 92. Gormley M, Creaney G, Schache A, Ingarfield K, Conway DI. Reviewing the epidemiology of head and neck cancer: definitions, trends and risk factors. Br Dent J. 2022. 233(9): 780-786. Mourad M, Jetmore T, Jategaonkar AA, Moubayed S, Moshier E, Urken ML. Epidemiological Trends of Head and Neck Cancer in the United States: A SEER Population Study. J Oral Maxillofac Surg. 2017. 75(12): 2562-2572. He S, Chakraborty R, Ranganathan S. Proliferation and Apoptosis Pathways and Factors in Oral Squamous Cell Carcinoma. Int J Mol Sci. 2022. 23(3): 1562. Han B, Zheng R, Zeng H, et al. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent. 2024. 4(1): 47-53. González-García R, Naval-Gías L, Rodríguez-Campo FJ, Sastre-Pérez J, Muñoz-Guerra MF, Gil-Díez Usandizaga JL. Contralateral lymph neck node metastasis of squamous cell carcinoma of the oral cavity: a retrospective analytic study in 315 patients. J Oral Maxillofac Surg. 2008. 66(7): 1390-8. Zaravinos A. An updated overview of HPV-associated head and neck carcinomas. Oncotarget. 2014. 5(12): 3956-69. Huang SH, O', Sullivan B. Overview of the 8th Edition TNM Classification for Head and Neck Cancer. Curr Treat Options Oncol. 2017. 18(7): 40. Hübbers CU, Akgül B. HPV and cancer of the oral cavity. Virulence. 2015. 6(3): 244-8. Paver EC, Currie AM, Gupta R, Dahlstrom JE. Human papilloma virus related squamous cell carcinomas of the head and neck: diagnosis, clinical implications and detection of HPV. Pathology. 2020. 52(2): 179-191. Ding D, Stokes W, Eguchi M, et al. Association Between Lymph Node Ratio and Recurrence and Survival Outcomes in Patients With Oral Cavity Cancer. JAMA Otolaryngol Head Neck Surg. 2019. 145(1): 53-61. Bignell GR, Warren W, Seal S, et al. Identification of the familial cylindromatosis tumour-suppressor gene. Nat Genet. 2000. 25(2): 160-5. Komander D, Lord CJ, Scheel H, et al. The structure of the CYLD USP domain explains its specificity for Lys63-linked polyubiquitin and reveals a B box module. Mol Cell. 2008. 29(4): 451-64. Marín-Rubio JL, Raote I, Inns J, Dobson-Stone C, Rajan N. CYLD in health and disease. Dis Model Mech. 2023. 16(6): dmm050093. Papadatou V, Tologkos S, Tsolou A, et al. CYLD expression in endometrial carcinoma and correlation with clinicohistopathological parameters. Taiwan J Obstet Gynecol. 2022. 61(4): 596-600. Wang L, Lin Y, Zhou X, et al. CYLD deficiency enhances metabolic reprogramming and tumor progression in nasopharyngeal carcinoma via PFKFB3. Cancer Lett. 2022. 532: 215586. Miyake S, Miwa T, Yoneda G, et al. Relationship between clinicopathological characteristics and CYLD expression in patients with cholesteatoma. PLoS One. 2020. 15(10): e0240216. Massoumi R, Kuphal S, Hellerbrand C, et al. Down-regulation of CYLD expression by Snail promotes tumor progression in malignant melanoma. J Exp Med. 2009. 206(1): 221-32. Gu Y, Wu S, Fan J, et al. CYLD regulates cell ferroptosis through Hippo/YAP signaling in prostate cancer progression. Cell Death Dis. 2024. 15(1): 79. Yuan H, Wei S, Ren Z, et al. KLHL21/CYLD signaling confers aggressiveness in bladder cancer through inactivating NF-κB signaling. Int Immunopharmacol. 2023. 114: 109202. Yang Y, Zhou J. CYLD - a deubiquitylase that acts to fine-tune microtubule properties and functions. J Cell Sci. 2016. 129(12): 2289-95. Sun SC. CYLD: a tumor suppressor deubiquitinase regulating NF-kappaB activation and diverse biological processes. Cell Death Differ. 2010. 17(1): 25-34. van Andel H, Kocemba KA, de Haan-Kramer A, et al. Loss of CYLD expression unleashes Wnt signaling in multiple myeloma and is associated with aggressive disease. Oncogene. 2017. 36(15): 2105-2115. Reiley W, Zhang M, Sun SC. Negative regulation of JNK signaling by the tumor suppressor CYLD. J Biol Chem. 2004. 279(53): 55161-7. Zajicek AS, Ruan H, Dai H, et al. Cylindromatosis drives synapse pruning and weakening by promoting macroautophagy through Akt-mTOR signaling. Mol Psychiatry. 2022. 27(5): 2414-2424. Lim JH, Jono H, Komatsu K, et al. CYLD negatively regulates transforming growth factor-β-signalling via deubiquitinating Akt. Nat Commun. 2012. 3: 771. Rajan N, Elliott RJ, Smith A, et al. The cylindromatosis gene product, CYLD, interacts with MIB2 to regulate notch signalling. Oncotarget. 2014. 5(23): 12126-40. Cui Z, Kang H, Grandis JR, Johnson DE. CYLD Alterations in the Tumorigenesis and Progression of Human Papillomavirus-Associated Head and Neck Cancers. Mol Cancer Res. 2021. 19(1): 14-24. Cui Z, Kang H, Li H, et al. CYLD Alterations Are Associated With Metastasis and Poor Prognosis in Human Papilloma Virus-Positive Head and Neck Cancer. Head Neck. 2025. 47(2): 606-614. An J, Mo D, Liu H, et al. Inactivation of the CYLD deubiquitinase by HPV E6 mediates hypoxia-induced NF-kappaB activation. Cancer Cell. 2008. 14(5): 394-407. Lydiatt WM, Patel SG, O'Sullivan B, et al. Head and Neck cancers-major changes in the American Joint Committee on cancer eighth edition cancer staging manual. CA Cancer J Clin. 2017. 67(2): 122-137. Cai M, Tan R, Huang Y, et al. High Expression of Tomm34 and Its Correlations With Clinicopathology in Oral Squamous Cell Carcinoma. Pathol Oncol Res. 2021. 27: 641042. Tran NH, Sais D, Tran N. Advances in human papillomavirus detection and molecular understanding in head and neck cancers: Implications for clinical management. J Med Virol. 2024. 96(6): e29746. Ji YX, Huang Z, Yang X, et al. The deubiquitinating enzyme cylindromatosis mitigates nonalcoholic steatohepatitis. Nat Med. 2018. 24(2): 213-223. Mossmann D, Park S, Hall MN. mTOR signalling and cellular metabolism are mutual determinants in cancer. Nat Rev Cancer. 2018. 18(12): 744-757. He Y, Rezaei S, Júnior R, Cruz LJ, Eich C. Multifunctional Role of Lipids in Modulating the Tumorigenic Properties of 4T1 Breast Cancer Cells. Int J Mol Sci. 2022. 23(8): 4240. Currie E, Schulze A, Zechner R, Walther TC, Farese RV Jr. Cellular fatty acid metabolism and cancer. Cell Metab. 2013. 18(2): 153-61. He Y, Qi S, Chen L, et al. The roles and mechanisms of SREBP1 in cancer development and drug response. Genes Dis. 2024. 11(4): 100987. Saxton RA, Sabatini DM. mTOR Signaling in Growth, Metabolism, and Disease. Cell. 2017. 168(6): 960-976. Colombo E, Horta G, Roesler MK, et al. The K63 deubiquitinase CYLD modulates autism-like behaviors and hippocampal plasticity by regulating autophagy and mTOR signaling. Proc Natl Acad Sci U S A. 2021. 118(47): e2110755118. Additional Declarations No competing interests reported. Supplementary Files Westernblot.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6695111","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":462964590,"identity":"fcb7181f-6268-48f7-b739-4498f74910e4","order_by":0,"name":"Zhuo Lin","email":"","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Zhuo","middleName":"","lastName":"Lin","suffix":""},{"id":462964591,"identity":"e1516c2b-8f85-4522-a88c-dbf5eb823d4e","order_by":1,"name":"YiCheng Hong","email":"","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"YiCheng","middleName":"","lastName":"Hong","suffix":""},{"id":462964592,"identity":"730f9f57-8484-46ea-93dd-6942dc45a7c3","order_by":2,"name":"Yunyi Huang","email":"","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Yunyi","middleName":"","lastName":"Huang","suffix":""},{"id":462964593,"identity":"62ee8bf2-d70f-42d9-9def-a9be68dc1ba2","order_by":3,"name":"Xuanyi Chen","email":"","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xuanyi","middleName":"","lastName":"Chen","suffix":""},{"id":462964594,"identity":"03893ed8-4394-426e-94e4-e3c3e21c3e25","order_by":4,"name":"Zhipei Chen","email":"","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Zhipei","middleName":"","lastName":"Chen","suffix":""},{"id":462964595,"identity":"01031bf0-4f36-4707-bfeb-f1d0b7ddc49b","order_by":5,"name":"Xiaohua Chen","email":"","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xiaohua","middleName":"","lastName":"Chen","suffix":""},{"id":462964596,"identity":"0259d0d9-23b1-4a04-9719-42333da2eb9d","order_by":6,"name":"Meng Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEUlEQVRIiWNgGAWjYPACGzt+IHngAYzPQ1hLWrJkA1BLAglaDjNuOACkiNJicCM78XHBL2Zm42uHHwJtqUucPyOB8cHbNgZ5cxxaJGfkbjae2cfGZ3Y7zQCo5XDihhsJzIZz2xgMdzZg18IvkbtNmreHh9nsdgJIy4HEDRIJbNK8bQxALnYtbBK523/z9kgwbp6d/gHmMPbf+LSAbGHm+WHAuEE6B2QLc2LDjQQ2ZnxaJHvebpbmbUhIlridU3AgweCw8YYzD5sl55yTMNyAQ4vB8dyNn3n+/Lfjn52++cOHijrZ+e3JBz+8KbORx2ULGDC2wU1gcGxgYGwAsiTwqAeBPwimPQGlo2AUjIJRMAIBALKlX54A/oq2AAAAAElFTkSuQmCC","orcid":"","institution":"Hospital of Stomatology, Sun Yat-sen University","correspondingAuthor":true,"prefix":"","firstName":"Meng","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2025-05-19 05:08:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6695111/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6695111/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83648140,"identity":"d982ddb3-4866-4d8b-9074-6d3524dfab11","added_by":"auto","created_at":"2025-05-30 06:20:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":449185,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCYLD expression is decreased in OSCC.\u003c/strong\u003e (A) CYLD was lowly expressed in the GEO-OSCC database; (B) CYLD is lowly expressed in OSCC cell lines; (C) CYLD is lowly expressed in OSCC tissues. *P\u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6695111/v1/6b9d14c8c0a05ada326459d6.png"},{"id":83648139,"identity":"b084735b-1354-4203-9fa4-583c98231fa7","added_by":"auto","created_at":"2025-05-30 06:20:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":370892,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHigh expression of CYLD is associated with a better prognosis.\u003c/strong\u003e (A) \u0026nbsp;Immunohistochemistry of CYLD expression in OSCC tissues; (B) High expression of CYLD protein was positively associated with a better prognosis in OSCC patients; (C) Survival curves of OS and RFS of patients were determined based on the expression of CYLD and p16.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6695111/v1/4fde283cb9754b19fdf46029.png"},{"id":83648136,"identity":"a6bbf21e-fec3-4516-80aa-893d5f7a6b71","added_by":"auto","created_at":"2025-05-30 06:20:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":574263,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOE-CYLD inhibits proliferation, migration, and invasion in OSCC. \u003c/strong\u003e(A-B) Expression levels by western blot and qPCR after OE-CYLD in cell lines(To improve the clarity and conciseness of the presentation, we have cropped the images. The sample comes from the same experiment and the blots were processed in parallel.); (C) Detection of cell proliferation with CCK-8; (D-E) Effect of CYLD on cell migration and invasion. *P\u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6695111/v1/2a9abdb695b5c1fdb21eab8c.png"},{"id":83648141,"identity":"904f9bcc-6be3-4a7e-a305-85eb71561f1a","added_by":"auto","created_at":"2025-05-30 06:20:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":342078,"visible":true,"origin":"","legend":"\u003cp\u003eHigh expression of CYLD inhibits lipid metabolism through the mTOR pathway. (A) UM1 cell QC sample chromatogram (B) Overall sample PCA analysis. (C)Lipid Subgroup Content in UM1 Cells. (D)The expression levels of the mTOR pathway and lipid metabolism-related proteins were detected by western blot in OE-CYLD cell lines. (To improve the clarity and conciseness of the presentation, we have cropped the images. The sample comes from the same experiment, respectively, and the blots were processed in parallel.) (E) The mRNA expression levels of lipid-related analysis were detected in OE-CYLD cell lines by qPCR. (F)qPCR analysis was performed on UM1 and HN6 cells after treatment with 10 µM MHY1485 for 6 hours. (G)Mechanism diagram showing the role of CYLD in OSCC. *P\u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6695111/v1/29a9b83783864fb76be3401e.png"},{"id":89838533,"identity":"ea3f8bbc-826d-4585-b2a9-4764c06aa18c","added_by":"auto","created_at":"2025-08-25 15:02:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3335968,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6695111/v1/d2e7a719-23b3-47ae-a603-30bcacde9183.pdf"},{"id":83649011,"identity":"65251a29-12eb-4eec-abba-dca56ca2d5b0","added_by":"auto","created_at":"2025-05-30 06:28:20","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":758620,"visible":true,"origin":"","legend":"","description":"","filename":"Westernblot.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6695111/v1/679de83134f4d07eca17b491.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Increasing CYLD expression improved the prognosis by downregulating the mTOR/SREBP1/lipid metabolism pathway in HPV-negative OSCC patients","fulltext":[{"header":"What is New","content":"\u003cp\u003e1. We first found that the expression of CYLD was positively correlated with overall survival and disease-free survival in HPV-negative OSCC patients.\u003c/p\u003e\n\u003cp\u003e2. Subsequent analysis revealed that overexpression of CYLD inhibited proliferation, invasion, migration, and lipid metabolism in OSCC.\u003c/p\u003e\n\u003cp\u003e3. Overexpression of CYLD downregulates lipid metabolism through the mTOR/SREBP1 signaling pathway.\u003c/p\u003e"},{"header":"1 Introduction","content":"\u003cp\u003eHead and neck squamous cell carcinoma (HNSCC) is the 6th most common cancer in the world\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. HNSCC causes more than 325,000 deaths annually\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. The common sites of HNSCC are the oral cavity, larynx, nasal cavity, pharynx, and paranasal sinuses\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Oral squamous cell carcinoma (OSCC) is the most common type of HNSCC, representing 90% of oral cancers\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. In 2022, approximately 65,100 new cases of OSCC were reported in China, with about 35,200 deaths\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Anatomically, OSCC are prone to invade the muscle tissue and jawbone and metastasize to the surrounding lymph nodes, leading to a poor prognosis\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. The development of OSCC is closely associated with various risk factors. In addition, human papillomavirus (HPV), a small double-stranded DNA virus, has been identified as a novel risk factor for HNSCC. HPV induces human squamous epithelial hyperplasia, with the majority of tumors occurring in the oral cavity, oropharynx, hypopharynx, and larynx.\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. HPV oropharyngeal carcinoma (HPV-OPC) was categorized as a separate entity according to the 8th edition of TNM staging. HPV-OPC has a better prognosis than HPV-negative OPC\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Similarly, in HPV-positive OSCC, HPV E2 protein is inactivated, leading to elevated HPV E6 and E7 proteins\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. HPV E6 and E7 proteins inactivate two tumor suppressors, Rb and p53, which drive tumorigenesis\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Thus, HPV-positive OSCC may differ from HPV-negative OSCC in terms of clinical features, molecular mechanisms, and response to treatment\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. HPV infection can be confirmed by p16 immunohistochemical staining\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Therefore, in the study of OSCC, it is crucial to categorize the samples into HPV-negative and HPV-positive groups based on p16 staining. Despite significant advances in surgical techniques, radiotherapy, and chemotherapy over the past 30 years, the outcomes of OSCC remain unsatisfactory. Approximately half of patients with advanced disease will die in five years\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Therefore, exploring new biomarkers and therapy strategies for OSCC patients is essential.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCYLD\u003c/em\u003e is located on human chromosome 16q12.1 and encodes a protein (cylindromatosis, CYLD) containing 956 amino acids\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eCYLD\u003c/em\u003e is a tumor suppressor gene that encodes a lysine-63 (K63) deubiquitinating enzyme (DUB)\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eCYLD\u003c/em\u003e pathogenic mutations can lead to familial Cylindromatosis \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Loss of CYLD expression was observed in several diseases, such as endometrial cancer\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, nasopharyngeal cancer\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, cholesteatoma\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, melanoma\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, prostate cancer\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, and bladder cancer\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, with adverse outcomes.\u003c/p\u003e \u003cp\u003eThe CYLD protein consists of three glycine-rich cytoskeleton-associated protein (CAP-Gly) structural domains, two protease structural domains, a phosphorylation region, and the USP catalytic structural domain\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Microtubules are filamentous cellular structures involved in various cellular activities, such as cell motility and cell division\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. The CAP-Gly structural domain of CYLD may interact with microtubules to influence the course of cellular activities\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. It has been documented that loss of CYLD activates NF-κB\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e, Wnt/β-catenin\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e, JNK\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e, mTOR\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e, TGF-β\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e, and Notch\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e pathways, resulting in undesirable consequences, such as tissue fibrosis\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e, reduction of autophagic flux\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e, and promotion of tumorigenesis\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that alterations in CYLD are associated with metastasis and poor prognosis in HPV-positive HNSCC patients\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Moreover, HPV E6 can also directly degrade CYLD, reducing its functional significance in high-risk HPV\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. However, the role of CYLD in HPV-negative OSCC patients remains unclear. In this study, we explore the association of CYLD with the prognosis of HPV-negative OSCC patients and their related mechanisms.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 \u003cem\u003eCYLD\u003c/em\u003e mRNA expression in the GEO database\u003c/h2\u003e \u003cp\u003eWe retrieved the original data of \u003cem\u003eCYLD\u003c/em\u003e mRNA expression in OSCC from the National Library of Medicine (NCBI) GEO database. Then, we analyzed \u003cem\u003eCYLD\u003c/em\u003e mRNA expression in normal oral tissues and OSCC tissues.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Patient samples\u003c/h2\u003e \u003cp\u003e66 samples of OSCC patients were selected from the case bank of the Department of Oral Pathology, Hospital of Stomatology, Guanghua School of Stomatology, Sun Yat-sen University, Guangzhou, China. All samples were diagnosed as primary OSCC located in the oral cavity and oropharynx, including the tongue, oropharynx, cheeks, lips, gums, and floor of the mouth. The clinicopathological characteristics including age, gender, tumor size, clinical stage, pathological differentiation, depth of invasion (DOI) ( following the eighth edition of the American Joint Committee on Cancer Criteria [AJCC criteria])\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, smoking, recurrence, and lymph node metastasis were analyzed according to differential expression of CYLD. All methods were carried out in accordance with relevant guidelines and regulations. We requested an exemption from ethical review due to using previously collected pathological specimens for this study. The informed consent was waived by IRB AF/SC-07/v3.0. This study was approved by the Clinical Research Ethics Committee of the Affiliated Stomatological Hospital of Sun Yat-sen University on December 29, 2021(KQEC-2021-76-01).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Immunohistochemical staining\u003c/h2\u003e \u003cp\u003eCYLD and p16 were performed according to the following standard procedure. OSCC samples were cut into 4 \u0026micro;m-thick sections, deparaffinized in xylene, and rehydrated in serially diluted ethanol. The endogenous peroxidase activity was eliminated by the hydrogen peroxide method. Antigen recovery was performed at 10MPa EDTA (pH 9.0) for 2 min. After sections were incubated in 5% BSA for 10 min to eliminate endogenous biotin activity. Diluted primary antibody (CYLD polyclonal antibody, dilution 1:100, an antibody from Proteintech, USA; p16 polyclonal antibody, dilution 1:200, an antibody from Abcam, USA) was added to the sections and incubated at 4\u0026deg;C for more than 14 hours. Then, the secondary antibody was added to the sections and incubated at 37\u0026deg;C for 40 min. Finally, the sections were visualized with 3,3\u0026prime;-diaminobenzidine (DAB) substrate and counterstained with hematoxylin. Positive controls were made from human brain tissue, and negative controls were made from samples incubated with PBS instead of primary antibodies. The range and strength of staining were assessed and graded by two pathologists. The percentage of tumor-positive cells was graded as follows: 0, \u0026lt;\u0026thinsp;10%; 1, 10\u0026ndash;25%; 2, 25\u0026ndash;50%; 3, 51\u0026ndash;70%; 4, \u0026gt;\u0026thinsp;70% positive cells. Staining results were categorized as low or high expression according to the score: score 0\u0026ndash;2 for low CYLD expression (LE-CYLD), score 3\u0026ndash;4 for high CYLD expression (HE-CYLD). According to our previous study, positive cells\u0026thinsp;\u0026gt;\u0026thinsp;70% with strongly stained nuclei (with or without cytoplasmic staining) were considered to be positive expressions of p16\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Cell culture\u003c/h2\u003e \u003cp\u003eNormal human gingival epithelial cell lines (HGEC) and HPV-negative OSCC cell lines (UM1, HN6) were provided by the Guangdong Provincial Key Laboratory of Stomatology (Guangzhou, China). Cells were cultured in high-glucose DMEM (Gibco, Camarillo, CA, USA) medium with 10% fetal bovine serum (Gibco, Camarillo, CA, USA) with 5% CO2 at 37\u0026deg;C. mTOR activator (MHY1485) was purchased from Mce (New Jersey, USA)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Establishment of stable cell lines with CYLD overexpression\u003c/h2\u003e \u003cp\u003eThe CYLD expression plasmid (CYLD-HA-SV40-EGFP-IRES-Puromycin) used in the experiment was provided by IGeneBio (Guangzhou, China) (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Plasmids were transfected into cell lines according to the protocol of the Lenti-Pac\u0026trade; HIV Lentiviral Packaging Kit by IGeneBio (Guangzhou, China).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe plasmid sequences targeting CYLD.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eplasmid\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003esequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYLD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGAGTTCAGGCTTATGGAGCCAAGAAAAAGTCACTTCACCCTACTGGGA\u003c/p\u003e \u003cp\u003eAGAGCGGATTTTTTACTTGCTTCTTCAAGAATGCAGCGTTACAGACAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 CCK-8 assay\u003c/h2\u003e \u003cp\u003eCell Counting Kit-8 (CCK-8, Beyotime, China) was prepared in a 1:10 ratio with a complete medium. The mixture was used to measure the cell value increase at 0h, 24h, 48h, 72h, and 96h. The results were determined by subtracting the reference absorbance at 450 nm using an enzyme-linked immunoassay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Wound healing assay\u003c/h2\u003e \u003cp\u003eUM1 and HN6 cells were inoculated in 6-well plates. When the cells grew to about 90% confluence, the head was washed with a 1 ml plastic pipette to create a wound. Then, it was rinsed with PBS and incubated in the FBS-free DMEM. The wound healing distance was measured after 24h to assess the rate of cell migration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Transwell migration/invasion assay\u003c/h2\u003e \u003cp\u003eTranswell invasion assays were performed using 24-well cell culture inserts (Corning, NY, USA) with polyethylene terephthalate membranes (8 \u0026micro;m pore size) and Matrigel basement membrane substrates (1:8 dilution, BD Biosciences, CA, USA). UM1 and HN6 cells were isolated using TrypLE Express (Gibco, Camarillo, CA, USA) and resuspended in serum-free DMEM. A total of 200 \u0026micro;l of the cell suspension (50,000 cells/well) was added to the upper chamber of the Transwell insert. The bottom chamber was filled with 600 \u0026micro;l of medium containing 20% FBS. After 24 hours of incubation, cells in the bottom chamber were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted under a microscope. In the absence of Matrigel in the upper chamber, the same Transwell assay was used to study cell migration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Lipidomic\u003c/h2\u003e \u003cp\u003eUM1 cells transfected with either Vector or CYLD were cultured to confluence in a 6 cm dish. After removing the culture medium, the cells were washed once with 1 mL PBS. Subsequently, the cells were added 600 \u0026micro;l of pre-chilled methanol (from \u0026minus;\u0026thinsp;80\u0026deg;C) and 240 \u0026micro;l of ice-cold ultrapure water. The metabolites were then scraped from the cell surface using a cell scraper, transferred to a 1.5 ml EP tube, and vortexed for 10 seconds. Following this, 600 \u0026micro;l of pre-chilled chloroform was added, and the mixture was centrifuged at 15,000 rcf for 15 minutes at 4\u0026deg;C to separate the organic and aqueous phases. The lower organic phase (500 \u0026micro;l) was collected and dried under nitrogen gas at room temperature. The dried sample was re-dissolved in 150 \u0026micro;l of a solvent mixture (chloroform: methanol: water, 3:3:0.5), vortexed vigorously for 5 minutes, and centrifuged at 15,000g for 5 minutes at room temperature. Finally, 100 \u0026micro;l of the supernatant was transferred to a 2 ml mass spectrometry vial for subsequent analysis, while 20 \u0026micro;l of the supernatant was reserved in a separate 2 ml vial as a quality control (QC) sample to assess the equilibrium of the chromatography-mass spectrometry system and monitor the instrument's performance. Lipid extracts were analyzed by liquid chromatography-mass spectrometry (LC-MS) using an Ultimate 3000 LC system equipped with a Hyperil Gold C18 column (40\u0026deg;C, 0.30 ml/min flow rate, and 4 \u0026micro;l injection volume). For negative ion mode analysis, the mobile phase consisted of solvent A (40% ultrapure water, 60% acetonitrile, 10 mM ammonium formate, 0.1% formic acid) and solvent B (10% acetonitrile, 90% isopropanol, 10 mM ammonium formate, 0.1% formic acid), with the gradient program detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Lipid analysis was performed on an Orbitrap Exploris\u0026trade; 240 mass spectrometer in ESI negative ion mode, with a mass range of 100\u0026ndash;1500 m/z. The spray voltage was set to +\u0026thinsp;3500V / \u0026minus;3000V, sheath gas at 40 arb, auxiliary gas at 10 arb, ion transfer tube temperature at 320\u0026deg;C, and auxiliary gas heater at 350\u0026deg;C. The full scan resolution was set to 120,000, and data-dependent MS2 resolution was 30,000, with collision energies of 20, 50, and 80. The lipidomic data were processed and analyzed using Lipid Search 5.0 software for lipid identification and cohort analysis. Signal intensities for each ion were normalized to the measured protein concentration for accurate quantification.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMobile phase gradient\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMobile Phase A\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMobile Phase B\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e27.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e31.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e36.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e36.00min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e36.10min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Western blotting\u003c/h2\u003e \u003cp\u003eCells were washed three times with cold PBS, and total proteins were lysed in RIPA lysis solution (CWBIO, Beijing, China) supplemented with 1% protease inhibitor and 1% phosphatase inhibitor at 4\u0026deg;C. The extracts were sonicated and centrifuged at 12,000 rpm for 10 min at 4\u0026deg;C. Protein concentration was measured by using the BCA Protein Assay Kit (CWBIO, Beijing, China). Proteins were separated on FuturePAGE\u0026trade; 4\u0026ndash;20% 15 Wells (Boyi Biotech, China) by adding 30 \u0026micro;L per well and transferred to a formaldehyde-soaked PVDF membrane (0.2 \u0026micro;m, Millipore, Darmstadt, Germany). Membranes were incubated overnight at 4\u0026deg;C with the appropriate primary antibody, then rinsed with TBST and incubated with HRP-coupled secondary antibody at a dilution of 1:3000 for 1 hour at room temperature. Membranes were imaged using a high-sensitivity chemiluminescence imaging system and ECL reagents (NCMbio, Suzhou, China). Bands were semi-quantified by using ImageJ software. β-Actin was an endogenous control.\u003c/p\u003e \u003cp\u003eCYLD (1:1000, # A11110-1-AP), mTOR (1:1000, # 66888-1-Ig), and phospho-mTOR (1:1000, # 67778-1-Ig) antibodies were purchased from Proteintech (Rosement, IL, USA). Anti-rabbit IgG (1:3000, #7074 S) and anti-mouse IgG (1:3000, #7076 S) antibodies were purchased from Cell Signaling Technology. β-Actin (1:1000, # AF7018) antibodies were purchased from Affinity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 qPCR\u003c/h2\u003e \u003cp\u003eRNA extraction from cultured cells using the RNA Rapid Extraction Kit. (Yishan Biotech, Shanghai, China). RNA was reverse transcribed into cDNA using HiScript\u0026reg; III RT SuperMix for qPCR Kit (Vazyme, Nanjing, China). The resulting cDNA was then run by qPCR using specific primers and ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) in the QuantStudio 5 Real-Time PCR Systems (Table \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences used in the experiment\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTACAGGAAGTCCCTTGCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTGTGGACTTGGGAGAGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYLD F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGAGTTGTACGCTTCAGAGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYLD R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCACGACCTTCTTCCAGCAATTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACC1 F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGAGGGCTAGGTCTTTCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACC1 R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGTTCAGCTCCAGAGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACLY F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGTCCCAAGTCCAAGATCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACLY R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTCGGGAGCAGACATAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFASN F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTCCAAGGACACAGTCACCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFASN R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCTGCTCCACGAACTCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSCD1 F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACTTGGGAGCCCTGTATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSCD1 R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAGCTCCTGCTGTTATGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSREBP1 F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGCTGACCGACATCGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSREBP1 R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGCATAGGGTGGGTCAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSREBP1C F\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTAGAGCGAGCACTGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSREBP1C R\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAACTGATGGAGAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analyses\u003c/h2\u003e \u003cp\u003eSPSS 25.0, GraphPad Prism 9 for data analysis and plotting. Patient survival was assessed using the Kaplan-Meier method. A p-value of \u0026lt;\u0026thinsp;0.05 for the data was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 CYLD expression is decreased in OSCC\u003c/h2\u003e \u003cp\u003eWe initially explored the expression of CYLD in OSCC using the GEO public database and compared the \u003cem\u003eCYLD\u003c/em\u003e mRNA expression in OSCC samples with normal tissues in the GSE30784 and GSE37991 cohorts. Results were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA; \u003cem\u003eCYLD\u003c/em\u003e mRNA was downregulated in OSCC tissues compared with normal tissues (GSE30784, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01; GSE37991, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01). We used quantitative real-time PCR to analyze CYLD expression in OSCC cell lines UM1 and HN6. The results showed that CYLD expression was reduced in UM1 and HN6 compared to HGEC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). We used immunohistochemistry to compare the expression of CYLD in OSCC and paracancerous tissues, and the results showed that CYLD expression was decreased in OSCC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 CYLD expression and its relationship to clinicopathologic characteristics\u003c/h2\u003e \u003cp\u003eWe performed immunohistochemical staining of 66 primary OSCC specimens to explore the CYLD expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The sample of 66 cases consisted of patients, including 20 females and 46 males, with an average age of 53.4 years (22\u0026ndash;84 years old). The patients were followed for an average of 37 months (4\u0026ndash;82 months). According to the CYLD expression in OSCC samples, we categorized the results into the following two categories: LE-CYLD (17 cases) and HE-CYLD (49 cases). CYLD staining was seen in the cytoplasm of both normal tissues and tumor cells, with high expression of CYLD, whereas the nuclei showed a lighter color and rare expression. The relationship between CYLD staining intensity and clinicopathologic characteristics (gender, age, tumor size, clinical stage, pathological grading, DOI, smoking, p16 staining, recurrence, lymph node metastatic status, and tumor site) is shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. The expression of CYLD was negatively correlated with lymph node metastasis (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03) and recurrence of OSCC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02). Still, it was not associated with gender, age, tumor size, clinical stage, pathological grading, DOI, smoking, p16 staining, and tumor site of OSCC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eImmunohistochemical expression of CYLD protein and its relation to clinicopathologic characteristics\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eClinicopathological characteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eCYLD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP values\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSamples\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTumor size\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT1-T2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT3-T4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinical stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅠ-Ⅱ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅢ-Ⅳ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePathology differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eModerate/poor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDOI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDOI\u0026thinsp;\u0026le;\u0026thinsp;5mm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5mm\u0026lt;DOI\u0026thinsp;\u0026le;\u0026thinsp;10mm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDOI\u0026gt;10mm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP16 staining\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmoking\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRecurrence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.02\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLymph node metastasis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.03\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSig (Fisher)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTongue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBuccal mucosa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFloor of mouth\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGingiva\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePalate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eoropharynx\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\u003cp\u003e\u003cstrong\u003eNote:\u003c/strong\u003e Bolded p indicates statistically significant chi-square test results with \u003cem\u003ep\u003c/em\u003e＜0.05.\u003c/p\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 The relationship between CYLD and the prognosis in OSCC Patients\u003c/h2\u003e \u003cp\u003eWe used statistical methods to assess the potential correlation between CYLD expression and survival in OSCC patients. Among the 66 OSCC patients at final follow-up, 40 cases (60.6%) survived without any disease, 6 cases (9.1%) suffered from OSCC recurrence, and 20 cases (30.3%) died of OSCC recurrence, distant metastasis, or other unrelated disease. Specifically, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, HE-CYLD was significantly associated with prolonged overall survival (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01, log-rank) and disease-free survival (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01, log-rank).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Expression of CYLD and p16 in OSCC patients and their relationship to Clinicopathology\u003c/h2\u003e \u003cp\u003eHPV infection can be confirmed by p16 immunohistochemical staining\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. We further assessed CYLD expression in HPV-positive (p16-positive) OSCC (23 cases) and HPV-negative (p16-negative) OSCC (43 cases). In the HPV-negative group, as shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, compared to LE-CYLD patients, OSCC recurrence dramatically decreased in the HE-CYLD patients (p\u0026thinsp;=\u0026thinsp;0.04) but was not associated with other factors. In addition, we examined the survival outcomes of the four subgroups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Tables\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and \u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e showed two-by-two group comparisons. In the HPV-positive OSCC subgroup, there was no statistically significant difference in overall (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.60) and disease-free survival (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.34) between the HE-CYLD and the LE-CYLD patients. In contrast, in the HPV-negative OSCC subgroup, the overall and disease-free survivals of HE-CYLD patients were statistically increased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01) compared with the LE-CYLD patients.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eTable 5: Relationship between IHC expression in CYLD and clinicopathologic parameters by p16 staining status.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinicopathological characteristics\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 191px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ep16-positive OSCC(n=23)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ep16-negative OSCC(n=43)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003eCYLD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 55px;\"\u003e\n \u003cp\u003eP values\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp\u003eCYLD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 55px;\"\u003e\n \u003cp\u003eP values\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 69px;\"\u003e\n \u003cp\u003eLow\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003eLow\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u0026le;60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e＞60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTumor size\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eT1-T2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eT3-T4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical stage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eⅠ-Ⅱ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.74\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eⅢ-Ⅳ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePathology differentiation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eWell\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eModerate/poor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDOI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eDOI\u0026le;5mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e5mm＜DOI\u0026le;10mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eDOI＞10mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSmoking\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.47\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRecurrence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.04\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLymph node metastasis\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.17\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSite\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eTongue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eBuccal mucosa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eFloor of mouth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eGingiva\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003ePalate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 165px;\"\u003e\n \u003cp\u003eoropharynx\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 69px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eNote:\u003c/strong\u003e Bolded p indicates statistically significant chi-square test results with \u003cem\u003ep\u003c/em\u003e＜0.05.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePairwise comparisons of Overall Survival Rates.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"12\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCYLD (+), p16(+)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eCYLD (-), p16(+)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eCYLD (+), p16(-)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e \u003cp\u003eCYLD (-), p16(-)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (+), p16(+)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e2.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e15.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e0.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (-), p16(+)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e1.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e4.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e0.03\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (+), p16(-)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e9.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e0.02\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (-), p16(-)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e0.03\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e9.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.02\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e\u003cstrong\u003eNote:\u003c/strong\u003e Bolded p indicates statistically significant chi-square test results with \u003cem\u003ep\u003c/em\u003e＜0.05.\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePairwise comparisons of Disease-free Survival Rates.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"12\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCYLD (+), p16(+)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eCYLD (-), p16(+)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eCYLD (+), p16(-)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e \u003cp\u003eCYLD (-), p16(-)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (+), p16(+)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e5.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.02\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e17.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e0.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (-), p16(+)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e3.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c12\"\u003e \u003cp\u003e0.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (+), p16(-)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.02\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e6.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e0.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCYLD (-), p16(-)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e6.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\u003cp\u003e\u003cstrong\u003eNote:\u003c/strong\u003e Bolded p indicates statistically significant chi-square test results with \u003cem\u003ep\u003c/em\u003e＜0.05.\u003c/p\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 CYLD overexpression inhibited the OSCC cell proliferation\u003c/h2\u003e \u003cp\u003eSubsequently, we used plasmids overexpressing CYLD (OE-CYLD) in UM1 and HN6 and used plasmid vectors as controls. The results of OE-CYLD were validated using western blot and quantitative real-time PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). We used the CCK-8 assay to detect OSCC proliferation after OE-CYLD. The results showed that OE-CYLD significantly inhibited OSCC cell growth compared with the vector group. This indicates that OE-CYLD inhibits OSCC cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 CYLD overexpression inhibited the OSCC cell migration and invasion\u003c/h2\u003e \u003cp\u003eCell migration was detected using a wound-healing assay and a Transwell assay. The results of the wound-healing assay showed that the wound-healing rate of UM1 and HM6 cells was significantly reduced after OE-CYLD (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Meanwhile, the Transwell assay showed that the migration and invasion ability of UM1 and HN6 cells was also significantly reduced after OE-CYLD, which indicated that OE-CYLD could inhibit the OSCC cell migration and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-E).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.7 CYLD downregulates the mTOR/SREBP1 pathway and lipid metabolism\u003c/h2\u003e \u003cp\u003eWe first assessed the data availability of the lipidomics by analyzing the QC samples. The base peak ion chromatograms of the QC samples exhibited highly consistent chromatographic features, and in the PCA plot, the samples showed tight clustering, indicating good data reproducibility \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B\u003cb\u003e)\u003c/b\u003e. Subsequent analysis of lipid subtypes revealed that, compared to the Vector group, the CYLD group exhibited significantly reduced levels of various lipid subclasses, including cardiolipin (CL), ceramide (Cer), fatty acid (FA), monohexosylceramide (Hex1Cer), lysophosphatidylcholine (LPC), lysophosphatidylethanolamine (LPE), phosphatidic acid (PA), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylglycerol (PG), phosphatidylinositol (PI), phosphatidylserine (PS), and sphingomyelin (SM) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Therefore, we sought to explore the molecular mechanisms associated with lipid metabolism. We detected HN6 and UM1 cells after transfection with OE-CYLD by western blot and qPCR. The results revealed that SREBP1, an essential protein in lipid metabolism, was downregulated by OE-CYLD (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). qPCR results showed that the lipid metabolic-related molecules (SREBP1, SREBP1C, FASN, ACC1, ACLY, SCD1) were downregulated in OE-CYLD compared with the vector group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Treating the cells with 10 \u0026micro;M MHY1485 for 6 hours can reverse the above process (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eIn this study, increased CYLD leads to a better prognosis in HPV-negative OSCC patients. Mechanistically, we report for the first time that increased CYLD in OSCC can inhibit lipid metabolism through the mTOR pathway, thereby suppressing OSCC proliferation, migration, and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). CYLD may be a promising prognostic marker and therapeutic target in primary OSCC.\u003c/p\u003e \u003cp\u003eCYLD plays a crucial role in tumorigenesis and tumor progression by regulating several critical biological processes, including cell proliferation, migration, and invasion. Additionally, it is associated with prognosis.\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. In our research, we confirmed that CYLD expression was reduced in OSCC. CYLD increased in tissues inhibited lymph node metastasis and recurrence while promoting overall survival and disease-free survival in OSCC\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. In addition, in HPV-positive OSCC patients, HPV E2 protein is inactivated, leading to elevated HPV E6 and E7 proteins\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. HPV E6 and E7 proteins inactivate two tumor suppressors, Rb and p53, which drive tumorigenesis\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Thus, HPV-positive OSCC may differ from HPV-negative OSCC in terms of clinical features, molecular mechanisms, and response to treatment\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Therefore, we divided our samples into HPV-positive and HPV-negative for further study of the relationship with CYLD expression. Our results showed that CYLD expression in the HPV-positive group was not associated with prognosis. In contrast, in the HPV-negative group, increased CYLD expression was correlated with improved overall survival and disease-free survival in OSCC patients. This may be because in HPV-positive tumors, high-risk HPV oncogenes (e.g., E6 and E7) promote cell proliferation and survival by directly inhibiting tumor suppressors such as p53 and Rb\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Therefore, CYLD may serve as a prognostic marker for HPV-negative patients and could have potential clinical implications during surgery. It may justify the consideration of extended resection to prevent recurrence and lymph node dissection, followed by regular postoperative surveillance. However, the specific mechanism underlying these effects remains unclear.\u003c/p\u003e \u003cp\u003eFurthermore, in non-alcoholic fatty liver disease (NAFLD), hepatocytes deficient in CYLD exhibit significant lipid accumulation. Conversely, overexpression of CYLD inhibits lipid accumulation, attenuating the progression of fatty liver disease\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Lipid metabolism is a crucial cellular process that converts nutrients into metabolic intermediates for membrane biosynthesis, energy storage, and the production of signaling molecules\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. However, the relationship between CYLD and lipid metabolism in OSCC has not been elucidated. Our study demonstrated that CYLD can suppress the levels of lipid subclasses in OSCC. Significant lipid metabolic reprogramming is observed between tumor tissues and normal tissues. By comparing the expression differences of lipid subclasses in various samples, the potential link between abnormal lipid expression patterns and the malignant features of tumors can be elucidated. For example, PA, SM, and Cer can regulate tumor proliferation, migration, and invasion\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Therefore, we hypothesize that CYLD may regulate the proliferation, migration, and invasion of OSCC through lipid metabolism. Further mechanistic analysis revealed that increased CYLD expression significantly downregulated the expression of SREBP1 and its downstream fatty acid synthases, including FASN, ACC1, ACLY, and SCD1. Lipid metabolism involves key proteins such as SREBP1, SREBP1C, FASN, ACC1, ACLY, and SCD1, which regulate lipid metabolism and cholesterol synthesis\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Notably, SREBP1 is a crucial molecule in lipid metabolism. When activated, it induces the transcription of fatty acid synthase and promotes the elongation of polyunsaturated fatty acids\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. SREBP1C is the predominant SREBP1 isoform in most adult tissues\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. According to previous research, lipid cellular uptake and synthesis are upregulated through the mTOR signalling pathway in cancer\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. mTOR is a serine/threonine protein kinase belonging to the PI3K-related kinase family and forms the catalytic subunits of two distinct protein complexes, including mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2)\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eIn vitro\u003c/em\u003e experiments demonstrate that CYLD deficiency promotes the mTOR pathway in the brain, thereby affecting cellular autophagy\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e, which indicates that CYLD may participate in the mTOR-related lipid mechanism. In our study, overexpression of CYLD notably decreased the phosphate-mTOR expression and fatty acid metabolism in OSCC. Treatment with MHY1485 can reverse lipid metabolism-related markers. Based on our research, we first found that increased CYLD expression may potentially downregulate the mTOR-fatty acids pathway and further suppress OSCC proliferation, migration, and invasion, which thus improves the prognosis of HPV-negative OSCC patients.\u003c/p\u003e"},{"header":"5 Limitation","content":"\u003cp\u003eThis study has several limitations. The clinical sample size is relatively small, and p16 can only serve as an initial screening marker for HPV. It needs to be combined with HPV DNA or RNA testing for more accurate detection. Furthermore, whether increasing CYLD expression in animal experiments exactly decreases the OSCC invasion needs to be elucidated.\u003c/p\u003e"},{"header":"6 Conclusion","content":"\u003cp\u003eOur study demonstrated that increased CYLD expression potentially downregulated the phosphate-mTOR/SREBP1 pathway and decreased lipid metabolism. This, therefore, suppresses OSCC proliferation, migration, and invasion and eventually improves the prognosis of HPV-negative OSCC patients. CYLD may be not only a promising target for OSCC therapy but also a biomarker for evaluating the prognosis of HPV-negative OSCC patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe investigation, validation, software, formal analysis, data curation and writing \u0026ndash; original draft: Z L; methodology and conceptualization: M X, Z L, YY H, XY C and YC H; visualization: Z L, YC H and ZP C; supervision, project administration, writing \u0026ndash; review and editing: XH C and M X; funding acquisition and resources: M X.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe GEO dataset is available for download from the GEO database, and the remaining data will be provided as required from [email protected].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFundings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFoundation and Applied Basic Research Fund of Guangdong, Grant/Award Number: 2020A1515010529; Guangdong \u0026quot;New Medical Science\u0026quot; Education and Instruction Committee 2023 Teaching Reform Project; Undergraduate Teaching Quality Engineering project of Sun Yat-sen University [2021,2022,2023]; The College Students\u0026apos; Innovative Entrepreneurial Training Plan Program of Sun Yat-sen University [2024]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Clinical Research Ethics Committee of the Affiliated Stomatological Hospital of Sun Yat-sen University on December 29, 2021\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eJohnson DE, Burtness B, Leemans CR, Lui V, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers. 2020. 6(1): 92.\u003c/li\u003e\n\u003cli\u003eGormley M, Creaney G, Schache A, Ingarfield K, Conway DI. Reviewing the epidemiology of head and neck cancer: definitions, trends and risk factors. Br Dent J. 2022. 233(9): 780-786.\u003c/li\u003e\n\u003cli\u003eMourad M, Jetmore T, Jategaonkar AA, Moubayed S, Moshier E, Urken ML. Epidemiological Trends of Head and Neck Cancer in the United States: A SEER Population Study. J Oral Maxillofac Surg. 2017. 75(12): 2562-2572.\u003c/li\u003e\n\u003cli\u003eHe S, Chakraborty R, Ranganathan S. Proliferation and Apoptosis Pathways and Factors in Oral Squamous Cell Carcinoma. Int J Mol Sci. 2022. 23(3): 1562.\u003c/li\u003e\n\u003cli\u003eHan B, Zheng R, Zeng H, et al. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent. 2024. 4(1): 47-53.\u003c/li\u003e\n\u003cli\u003eGonz\u0026aacute;lez-Garc\u0026iacute;a R, Naval-G\u0026iacute;as L, Rodr\u0026iacute;guez-Campo FJ, Sastre-P\u0026eacute;rez J, Mu\u0026ntilde;oz-Guerra MF, Gil-D\u0026iacute;ez Usandizaga JL. Contralateral lymph neck node metastasis of squamous cell carcinoma of the oral cavity: a retrospective analytic study in 315 patients. J Oral Maxillofac Surg. 2008. 66(7): 1390-8.\u003c/li\u003e\n\u003cli\u003eZaravinos A. An updated overview of HPV-associated head and neck carcinomas. Oncotarget. 2014. 5(12): 3956-69.\u003c/li\u003e\n\u003cli\u003eHuang SH, O\u0026amp;#x27, Sullivan B. Overview of the 8th Edition TNM Classification for Head and Neck Cancer. Curr Treat Options Oncol. 2017. 18(7): 40.\u003c/li\u003e\n\u003cli\u003eH\u0026uuml;bbers CU, Akg\u0026uuml;l B. HPV and cancer of the oral cavity. Virulence. 2015. 6(3): 244-8.\u003c/li\u003e\n\u003cli\u003ePaver EC, Currie AM, Gupta R, Dahlstrom JE. Human papilloma virus related squamous cell carcinomas of the head and neck: diagnosis, clinical implications and detection of HPV. Pathology. 2020. 52(2): 179-191.\u003c/li\u003e\n\u003cli\u003eDing D, Stokes W, Eguchi M, et al. Association Between Lymph Node Ratio and Recurrence and Survival Outcomes in Patients With Oral Cavity Cancer. JAMA Otolaryngol Head Neck Surg. 2019. 145(1): 53-61.\u003c/li\u003e\n\u003cli\u003eBignell GR, Warren W, Seal S, et al. Identification of the familial cylindromatosis tumour-suppressor gene. Nat Genet. 2000. 25(2): 160-5.\u003c/li\u003e\n\u003cli\u003eKomander D, Lord CJ, Scheel H, et al. The structure of the CYLD USP domain explains its specificity for Lys63-linked polyubiquitin and reveals a B box module. Mol Cell. 2008. 29(4): 451-64.\u003c/li\u003e\n\u003cli\u003eMar\u0026iacute;n-Rubio JL, Raote I, Inns J, Dobson-Stone C, Rajan N. CYLD in health and disease. Dis Model Mech. 2023. 16(6): dmm050093.\u003c/li\u003e\n\u003cli\u003ePapadatou V, Tologkos S, Tsolou A, et al. CYLD expression in endometrial carcinoma and correlation with clinicohistopathological parameters. Taiwan J Obstet Gynecol. 2022. 61(4): 596-600.\u003c/li\u003e\n\u003cli\u003eWang L, Lin Y, Zhou X, et al. CYLD deficiency enhances metabolic reprogramming and tumor progression in nasopharyngeal carcinoma via PFKFB3. Cancer Lett. 2022. 532: 215586.\u003c/li\u003e\n\u003cli\u003eMiyake S, Miwa T, Yoneda G, et al. Relationship between clinicopathological characteristics and CYLD expression in patients with cholesteatoma. PLoS One. 2020. 15(10): e0240216.\u003c/li\u003e\n\u003cli\u003eMassoumi R, Kuphal S, Hellerbrand C, et al. Down-regulation of CYLD expression by Snail promotes tumor progression in malignant melanoma. J Exp Med. 2009. 206(1): 221-32.\u003c/li\u003e\n\u003cli\u003eGu Y, Wu S, Fan J, et al. CYLD regulates cell ferroptosis through Hippo/YAP signaling in prostate cancer progression. Cell Death Dis. 2024. 15(1): 79.\u003c/li\u003e\n\u003cli\u003eYuan H, Wei S, Ren Z, et al. KLHL21/CYLD signaling confers aggressiveness in bladder cancer through inactivating NF-\u0026kappa;B signaling. Int Immunopharmacol. 2023. 114: 109202.\u003c/li\u003e\n\u003cli\u003eYang Y, Zhou J. CYLD - a deubiquitylase that acts to fine-tune microtubule properties and functions. J Cell Sci. 2016. 129(12): 2289-95.\u003c/li\u003e\n\u003cli\u003eSun SC. CYLD: a tumor suppressor deubiquitinase regulating NF-kappaB activation and diverse biological processes. Cell Death Differ. 2010. 17(1): 25-34.\u003c/li\u003e\n\u003cli\u003evan Andel H, Kocemba KA, de Haan-Kramer A, et al. Loss of CYLD expression unleashes Wnt signaling in multiple myeloma and is associated with aggressive disease. Oncogene. 2017. 36(15): 2105-2115.\u003c/li\u003e\n\u003cli\u003eReiley W, Zhang M, Sun SC. Negative regulation of JNK signaling by the tumor suppressor CYLD. J Biol Chem. 2004. 279(53): 55161-7.\u003c/li\u003e\n\u003cli\u003eZajicek AS, Ruan H, Dai H, et al. Cylindromatosis drives synapse pruning and weakening by promoting macroautophagy through Akt-mTOR signaling. Mol Psychiatry. 2022. 27(5): 2414-2424.\u003c/li\u003e\n\u003cli\u003eLim JH, Jono H, Komatsu K, et al. CYLD negatively regulates transforming growth factor-\u0026beta;-signalling via deubiquitinating Akt. Nat Commun. 2012. 3: 771.\u003c/li\u003e\n\u003cli\u003eRajan N, Elliott RJ, Smith A, et al. The cylindromatosis gene product, CYLD, interacts with MIB2 to regulate notch signalling. Oncotarget. 2014. 5(23): 12126-40.\u003c/li\u003e\n\u003cli\u003eCui Z, Kang H, Grandis JR, Johnson DE. CYLD Alterations in the Tumorigenesis and Progression of Human Papillomavirus-Associated Head and Neck Cancers. Mol Cancer Res. 2021. 19(1): 14-24.\u003c/li\u003e\n\u003cli\u003eCui Z, Kang H, Li H, et al. CYLD Alterations Are Associated With Metastasis and Poor Prognosis in Human Papilloma Virus-Positive Head and Neck Cancer. Head Neck. 2025. 47(2): 606-614.\u003c/li\u003e\n\u003cli\u003eAn J, Mo D, Liu H, et al. Inactivation of the CYLD deubiquitinase by HPV E6 mediates hypoxia-induced NF-kappaB activation. Cancer Cell. 2008. 14(5): 394-407.\u003c/li\u003e\n\u003cli\u003eLydiatt WM, Patel SG, O\u0026apos;Sullivan B, et al. Head and Neck cancers-major changes in the American Joint Committee on cancer eighth edition cancer staging manual. CA Cancer J Clin. 2017. 67(2): 122-137.\u003c/li\u003e\n\u003cli\u003eCai M, Tan R, Huang Y, et al. High Expression of Tomm34 and Its Correlations With Clinicopathology in Oral Squamous Cell Carcinoma. Pathol Oncol Res. 2021. 27: 641042.\u003c/li\u003e\n\u003cli\u003eTran NH, Sais D, Tran N. Advances in human papillomavirus detection and molecular understanding in head and neck cancers: Implications for clinical management. J Med Virol. 2024. 96(6): e29746.\u003c/li\u003e\n\u003cli\u003eJi YX, Huang Z, Yang X, et al. The deubiquitinating enzyme cylindromatosis mitigates nonalcoholic steatohepatitis. Nat Med. 2018. 24(2): 213-223.\u003c/li\u003e\n\u003cli\u003eMossmann D, Park S, Hall MN. mTOR signalling and cellular metabolism are mutual determinants in cancer. Nat Rev Cancer. 2018. 18(12): 744-757.\u003c/li\u003e\n\u003cli\u003eHe Y, Rezaei S, J\u0026uacute;nior R, Cruz LJ, Eich C. Multifunctional Role of Lipids in Modulating the Tumorigenic Properties of 4T1 Breast Cancer Cells. Int J Mol Sci. 2022. 23(8): 4240.\u003c/li\u003e\n\u003cli\u003eCurrie E, Schulze A, Zechner R, Walther TC, Farese RV Jr. Cellular fatty acid metabolism and cancer. Cell Metab. 2013. 18(2): 153-61.\u003c/li\u003e\n\u003cli\u003eHe Y, Qi S, Chen L, et al. The roles and mechanisms of SREBP1 in cancer development and drug response. Genes Dis. 2024. 11(4): 100987.\u003c/li\u003e\n\u003cli\u003eSaxton RA, Sabatini DM. mTOR Signaling in Growth, Metabolism, and Disease. Cell. 2017. 168(6): 960-976.\u003c/li\u003e\n\u003cli\u003eColombo E, Horta G, Roesler MK, et al. The K63 deubiquitinase CYLD modulates autism-like behaviors and hippocampal plasticity by regulating autophagy and mTOR signaling. Proc Natl Acad Sci U S A. 2021. 118(47): e2110755118.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cylindromatosis, oral squamous cell carcinoma, HPV-negative, lipid metabolism","lastPublishedDoi":"10.21203/rs.3.rs-6695111/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6695111/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eCYLD is associated with tumorigenesis, but its role in HPV-negative OSCC is unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods and Results: \u003c/strong\u003eR-bioinformatics analysis from the GEO database and qPCR analysis of OSCC cell lines demonstrated that CYLD mRNA expression was significantly reduced in OSCC compared to normal tissue and normal human gingival epithelial cell lines. In 66 primary OSCC cases, immunohistochemistry revealed decreased CYLD expression in OSCC tissues. High expression of CYLD was negatively associated with OSCC recurrence in HPV-negative patients (p=0.04) and correlated with improved overall survival (OS) and disease-free survival (DFS) (p=0.02 and 0.01, respectively). CCK-8, wound healing, and Transwell assays showed that Overexpression of the CYLD group reduced OSCC proliferation, migration, and invasion in UM1 and HN6 cells compared to the Vector group. Lipidomics analysis revealed significantly lower levels of lipid subclasses in the overexpression of the CYLD group. Western blot and qPCR show that overexpression of the CYLD group inhibited mTOR phosphorylation and lipid metabolism in OSCC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eCYLD expression is significantly reduced in OSCC. Elevating CYLD expression improves OS and DFS by inhibiting the mTOR pathway associated with lipid metabolism in HPV-negative OSCC.\u003c/p\u003e","manuscriptTitle":"Increasing CYLD expression improved the prognosis by downregulating the mTOR/SREBP1/lipid metabolism pathway in HPV-negative OSCC patients","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-30 06:20:15","doi":"10.21203/rs.3.rs-6695111/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"70fd6d38-2e9f-4f79-ab11-2567df59581f","owner":[],"postedDate":"May 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":49157991,"name":"Biological sciences/Cancer/Oral cancer"},{"id":49157992,"name":"Health sciences/Pathogenesis"},{"id":49157993,"name":"Health sciences/Medical research/Biomarkers"}],"tags":[],"updatedAt":"2025-08-25T14:53:58+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-30 06:20:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6695111","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6695111","identity":"rs-6695111","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}