Exosomes derived from SDF1-overexpressing mesenchymal stem cells inhibit ischemic myocardial cell apoptosis and promote cardiac endothelial microvascular regeneration in mice with myocardial infarction.

OA: closed
AI-generated summary by qwen3.7-flash, 2026-09-16

Exosomes from SDF1-overexpressing mesenchymal stem cells inhibited ischemic myocardial cell apoptosis and autophagy while promoting endothelial microvascular regeneration and protecting cardiac function in mice with myocardial infarction.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-09-18 · read from full text

This study investigated whether exosomes derived from mesenchymal stem cells overexpressing stromal-derived factor 1 (SDF1) could mitigate myocardial infarction damage in mice. The researchers found that these modified exosomes inhibited apoptosis and autophagy in ischemic myocardial cells while promoting microvascular regeneration in endothelial cells through the activation of the PI3K signaling pathway. In vivo experiments confirmed that treatment with SDF1-overexpressing exosomes protected cardiac function and reduced tissue injury in a mouse model of myocardial infarction. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Exosomes extracted from mesenchymal stem cells (MSCs) was reported to reduce myocardial ischemia/reperfusion damage. Besides, stromal-derived factor 1 (SDF1a) functions as cardiac repair after myocardial infarction (MI). Therefore, the present study aims to identify whether exosomes (Exo) released from SDF1-overexpressing MSCs display a beneficial effect on ischemic myocardial infarction. Initially, a gain-of-function study was performed to investigate the function of SDF1 in ischemic myocardial cells and cardiac endothelial cells. Coculture experiments were performed to measure potential exosomic transfer of SDF1 from MSCs to ischemic myocardial cells and cardiac endothelial cells. During the coculture experiments, exosome secretion was disrupted by neutral sphingomyelinase inhibitor GW4869 and upregulated exosomal SDF1 using SDF1 plasmid. Effects of Exo-SDF1 on cardiac function in MI mice were investigated in vivo. MSCs suppressed myocardial cell apoptosis and promoted microvascular regeneration of endothelial cells through secretion of exosomes. The addition of GW4869 led to increased apoptotic capacity of myocardial cells, decreased microvascular formation ability of endothelial cells, enhanced autophagy ability, and elevated Beclin-1 level as well as ratio of LC3II/LC3I. Overexpression of SDF1 and Exo-SDF1 inhibited apoptosis and autophagy of myocardial cells, but promoted tube formation of endothelial cells. The interference of PI3K signaling pathway promoted apoptosis and autophagy of myocardial cells, but inhibited tube formation of endothelial cells. SDF1 activated the PI3K signaling pathway. Exo-SDF1 protected cardiac function of MI mice and inhibited myocardial tissue damage. This study provided evidence that SDF1 overexpression in MSCs-derived exosomes inhibited autophagy of ischemic myocardial cells and promoted microvascular production of endothelial cells.
Full text 59,034 characters · extracted from oa-html · 3 sections · click to expand

Abstract

Exosomes extracted from mesenchymal stem cells (MSCs) was reported to reduce myocardial ischemia/reperfusion damage. Besides, stromal‐derived factor 1 (SDF1a) functions as cardiac repair after myocardial infarction (MI). Therefore, the present study aims to identify whether exosomes (Exo) released from SDF1‐overexpressing MSCs display a beneficial effect on ischemic myocardial infarction. Initially, a gain‐of‐function study was performed to investigate the function of SDF1 in ischemic myocardial cells and cardiac endothelial cells. Coculture experiments were performed to measure potential exosomic transfer of SDF1 from MSCs to ischemic myocardial cells and cardiac endothelial cells. During the coculture experiments, exosome secretion was disrupted by neutral sphingomyelinase inhibitor GW4869 and upregulated exosomal SDF1 using SDF1 plasmid. Effects of Exo‐SDF1 on cardiac function in MI mice were investigated in vivo. MSCs suppressed myocardial cell apoptosis and promoted microvascular regeneration of endothelial cells through secretion of exosomes. The addition of GW4869 led to increased apoptotic capacity of myocardial cells, decreased microvascular formation ability of endothelial cells, enhanced autophagy ability, and elevated Beclin‐1 level as well as ratio of LC3II/LC3I. Overexpression of SDF1 and Exo‐SDF1 inhibited apoptosis and autophagy of myocardial cells, but promoted tube formation of endothelial cells. The interference of PI3K signaling pathway promoted apoptosis and autophagy of myocardial cells, but inhibited tube formation of endothelial cells. SDF1 activated the PI3K signaling pathway. Exo‐SDF1 protected cardiac function of MI mice and inhibited myocardial tissue damage. This study provided evidence that SDF1 overexpression in MSCs‐derived exosomes inhibited autophagy of ischemic myocardial cells and promoted microvascular production of endothelial cells.

Keywords

apoptosis, autophagy, exosomes, mesenchymal stem cells, microvascular regeneration, myocardial infarction, stromal cell‐derived factor 1 Stromal‐derived factor 1 (SDF1) overexpression in mesenchymal stem cells (MSCs)‐derived exosomes inhibited autophagy of ischemic myocardial cells and promoted microvascular production of endothelial cells. 1. INTRODUCTION Myocardial infarction (MI), one of the leading causes of lethal heart diseases with high morbidity and mortality worldwide, can be triggered by interrupted blood flow due to the obstruction of one or more vessels in the coronary artery (Groehler et al., 2018; Harisharan, Singh, Dangal, Surapaneni, & Joshi, 2015). Currently, primary coronary angioplasty is considered to be the most effective treatment of MI, but the stent placement of the infarct related artery would cause stent thrombosis, leading to another infarction (Komosa, Lesiak, Siniawski, Mularek‐Kubzdela, & Grajek, 2014). Nevertheless, the development of new high sensitivity and specific biomarkers in the early diagnosis of MI has never ceased (Komosa et al., 2014). Recent studies have displayed cell therapy as an effective treatment of MI by repairing damaged myocardium (Mao, Lv, & Zhuang, 2014). Increasing evidence demonstrates that circulating bone marrow progenitor cells are involved in cardiac repair by entering the damaged myocardium (Vassalli & Moccetti, 2011). Meanwhile, mesenchymal stem cells (MSCs) have been considered as a potential target for MI treatment (Li, Sheng, Yang, Yao, & Ma, 2011). MSCs is a heterogeneous subgroup of stromal stem cells which can be self‐renewed and differentiated into mesodermal lineages and other embryonic lineages (Si, Zhao, Hao, Fu, & Han, 2011). A recent clinical study showed that MSC therapy is safe and can improve cardiac function and structural remodeling in patients with acute MI (Wen, Zheng, Zhou, Wang, & Wang, 2011). MSC‐based cardiac repair after MI can be achieved by differentiation and paracrine of cardiovascular cells, improving neovascularization, anti‐inflammatory, endogenous cardiac regeneration, antiapoptosis, anti‐remodeling, and cardiac contractions (Wen et al., 2012). As reported, the management of the exosomes originating from MSCs has been indicated to be able to recover tissue function and induce in vitro effects in various disease/injury models (Marote, Teixeira, Mendes‐Pinheiro, & Salgado, 2016). Exosomes, 40–100 nm microvesicles, are considered to be vital mediators for the paracrine effect of MSCs by transferring functional proteins and RNA to receptor cells (Yu et al., 2016). In addition, different cell‐derived exosomes could induce microRNA expression, which can avoid cell death in ischemia. This is also involved in cardiac remodeling post MI (Yuan, Maghsoudi, & Wang, 2016). Moreover, exosomes for cancer therapy upregulate tumor promoting factors, such as stromal‐derived factor 1 (SDF1), vascular endothelial growth factor (VEGF), CC chemokine receptor 5 (CCR5), and transforming growth factor β (TGFβ; Cho, Park, Lim, & Lee, 2012). SDF1a [C‐X‐C motif chemokine ligand 12 (CXCL12)], a stem cell chemical attraction factor, is considered to assist in cardiac repair after MI (Boyle et al., 2011). SDF1 is produced in response to hypoxia and transfers proangiogenic cells carrying CXCR4 to sites of ischemia (Seeger et al., 2012). Based on the previous literature, it was hypothesized that SDF1, which contains MSCs‐derived exosomes, plays an inhibitory role in MI. The present study aims to identify the potential therapeutic role of MSCs‐derived exosomes in inhibiting ischemic myocardial cell apoptosis and promoting cardiac endothelial microvascular regeneration via transferring SDF1 to the targets. 2. MATERIALS AND METHODS 2.1. Ethic statement The animal experiments in the study were strictly in accordance with the instructions of animal protection and animal usage given by American National Institutes of Health (NIH). 2.2. Establishment of mice model of myocardial infarction (MI) A total of 40 male C57 mice weighing 20–25 g, were selected, among which 30 mice were used for model establishment. The remaining 10 mice were used for control as sham group. The mice were subjected to depilation in advance, and anesthesia was applied through intraperitoneal injection of 3% pentobarbital (50 mg/kg) before operation. An incision was made in the chest of the mice to expose the heart. The coronary artery was ligated using nylon thread at 0.1 cm parallel to the inferior edge of left atrial appendage, and the coronary artery in the sham group was not ligated. In the ischemic area, however, the myocardium immediately turned pale and weakened. After ligation of the left anterior descending branch, the four locations of the infarct area were treated by applying myocardial injection of 2 × 105 MSCs (re‐suspended by Dulbecco's Modified Eagle's Medium [DMEM]). The survival rate of MI mice was 70% (21/30). A total of eight mice in the sham group were randomly selected, and 16 out of the 21 MI model mice were chosen. The MI model mice were then assigned into the MI + Exo‐SDF1‐NC group (MSCs transfected with SDF1‐NC plasmid‐extracted exosome) and the MI + Exo‐SDF1 group (MSCs transfected with SDF1 plasmid‐extracted exosome). Finally, the chest was closed layer by layer, and the mice were placed on a heated pad for resuscitation. 2.3. Isolation and culture of human umbilical cord blood (UCB)‐MSCs The isolation and identification procedure were performed as previously described (Gong et al., 2016). Briefly, to isolate mononuclear cells (MNCs), each UCB sample was diluted to a 1:1 ratio by phosphate‐buffered solution (PBS) and 15 ml of the diluted blood was gently loaded onto a 20 ml Ficoll Paque PLUS gradient (1.077 g/ml, GE). After centrifugation at 600 × g for 20 min, MNCs were harvested from the interface and suspended in DMEM/F12 medium containing 10% fetal bovine serum (Gibco, Grand Island, NY) and 1% penicillin/streptomycin. The medium was replaced after 5 days and every 3 days thereafter until putative MSC colonies were observed. UCB was collected with the consent of the mother and the ethical committee of Fuxing Hospital. The study was performed according to the guidelines of the Declaration of Helsinki. 2.4. Myocardial cell isolation and culture The newborn mice (within 24 hr) were euthanized and immersed in alcohol. Afterwards, the apical tissues were collected by opening the chest between the third and fourth ribs, and washed with pre‐cooled phosphate‐buffered saline (PBS). The tissues were cut into 1–3 mm of sections and subjected to 10 ml of digestive juice containing 0.05% pancreatic enzymes and 0.05% type II collagenase for incubation at a shaking table of a constant temperature of 37°C for 10 min. The supernatant was then collected and transferred to a 50‐ml tube containing 10 ml 10% fetal bovine serum (FBS) high sugar DMEM to terminate the detachment. The tissue residue was treated 4–5 more times following the above‐mentioned digestion method until enough cells were prepared estimating from the amount of remaining tissues. Moreover, all solutions were collected for centrifugation at 1,000 × g for 8 min and the deposit was re‐suspended with high sugar DMEM containing 10% FBS, followed by inoculation into T25. After differential velocity adherence for 1.5 hr, the upper cell suspension not adhering to the wall was collected, and bromodeoxyuridine (Brdu) was added (the final concentration was 100 μmol/l) for preparation of fibroblast. Cells were counted using a cell count plate, inoculated in a 6‐well plate (105/per well), and cultured at 37°C in 5% CO2 incubators with constant temperature and hypoxia. After 48 hr of cultivation under hypoxic and serum deficient conditions, the culture medium was replaced. 2.5. Endothelial cell isolation and culture The newborn mice (within 24 hr) were euthanized and immersed in alcohol. Next, the chest (between the third and fourth ribs) was opened to obtain the apical tissues, which were thoroughly rinsed using PBS. Then the tissue blocks were cut into 1–3 mm, treated with 10 ml of digestive juice containing 0.05% trypsin and 0.05% type II collagenase, and incubated at a shaking table at a constant temperature of 37°C for 10 min. Afterwards, the supernatant was transferred into a 50‐ml tube containing 10 ml 10% FBS high sugar DMEM to terminate the detachment. The digestive solution was centrifuged at 1,000 × g for 10 min at room temperature. Moreover, the supernatant was discarded and the deposit was re‐suspended. After filtration, the filtrate was obtained and centrifuged at 1,000 × g for 10 min at room temperature. The supernatant was discarded and the deposit was re‐suspended with DMEM solution; it was then inoculated in the glass disk which was pre‐covered with fibrous collagen. Then, the disk was placed in a 5% CO2 incubator at constant temperature of 37°C under the condition of deficient hypoxia and serum. After 24 hr, the culture medium was changed and replaced every 3 days. The growth state of endothelial cells was observed under an inverted microscope on a daily basis. 2.6. Transfection and grouping of cells Once cell confluence reached 70%, myocardial and endothelial cells were roughly washed two times using serum‐free Opti‐MEM and supplemented with 1.5 ml Opti‐MEM. Then, 250 μl Opti‐MEM was used to dilute 3 μg SDF1 plasmid and negative plasmid respectively, and the dilution was gently mixed before the addition of 1 μg high expression vector. Meanwhile, 10 μl Lipofectamine 2000 reagent was uniformly diluted with 250 μl Opti‐MEM and then incubated at room temperature for 5 min. Diluted plasmid and Lipofectamine 2000 diluent were gently mixed and placed at room temperature for 20 min. A total of 500 μl of plasmid complex was added into each individual well and gently mixed. The medium was then replaced by complete culture medium after incubation in a 5% CO2 incubator at 37°C for 6 hr, and cultured in a 5% CO2 incubator at 37°C overnight. A fluorescence microscope at the wavelength of 488 nm was used to observe the cell transfection the following day. Cells of each group with transfection efficiency over 80% could potentially be used for subsequent experiments. Afterwards, cells were assigned into three batches of transfection below: In the first batch, myocardial or endothelial cells were nontransfected or transfected with SDF1‐NC and SDF1 plasmids; in the second batch, MSCs were cocultured with untreated exosomes from myocardial and endothelial cells, or those transfected with SDF1‐NC and SDF1 plasmids; and in the third batch, cells were nontransfected or transfected with LY294002 (signaling pathway inhibitor), SDF1‐NC and SDF1 plasmids, or cotransfected with SDF1 and LY294002. 2.7. Cell coculture Myocardial and endothelial cells were inoculated into 6‐well plates and 24‐well plates respectively. Umbilical cord blood‐derived MSCs cells were inoculated into the transwell chamber (aperture of 0.4 μm). After the removal of the cell culture medium, cells were washed three times using sterilized PBS and transferred into DMEM medium without FBS. Next, the transwell chamber inoculated with MSCs was removed, and washed three times with sterilized PBS. Finally, the plate was cultured in a 5% CO2 incubator at a constant temperature of 37°C for 24 hr. Cells were treated with 5 μM GW4869 for 48 hr once cell confluence reached 80% (Trajkovic et al., 2008). 2.8. Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) Cells were collected after 48 hr of cultivation and the expression of SDF1, Bcl‐2‐associated X protein (Bax), B‐Cell CLL/Lymphoma 2 (Bcl‐2), Beclin‐1, matrix metalloprotein‐2 (MMP‐2), MMP‐9, and vascular endothelial growth factor (VEGF) were monitored in individual groups using reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR). Total RNA of tissues and cells were extracted using the Trizol method (16096020, Thermo Fisher Scientific Inc., Waltham, MA), and the purity and concentration of RNA were evaluated using an ultraviolet spectrophotometer (DU640, Beckman Coulter Inc., Kraemer Boulevard Brea, CA). The messenger RNA (mRNA) was transcribed to complementary DNA (cDNA) based on the instructions of a Primescript RT reagent kit (TaKaRa Bio Inc., Kyoto, Japan). The RT‐qPCR was performed using a SYBR Green staining. The amplification system included 9 μl of the SYBR mix (TaKaRa Bio Inc., Kyoto, Japan), 0.5 μl upstream primer, 0.5 μl downstream primer, 2 μl cDNA, and 0.8 μl RNase Free dH2O. The reaction conditions comprised of 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min. A total of 40 cycles were used to detect the SYBR Green fluorescence value. The primer sequences (Beijing Genomics Institute, Beijing, China) are exhibited in Table 1 and β‐actin was referred to as internal reference. The relative expression level of the gene was expressed by 2−△△Ct, ΔCt = ΔCtexperimental group – ΔCtcontrol group, ΔCt = Cttarget gene – Ctinternal reference. Each experiment was repeated three times independently. Table 1. | Gene | Prime sequence (5′–3′) | |---|---| | SDF1 | F: CCTCGAGGTCGACGGTATCGATA | | R: ATGGACCTCTTTCGAAATTTGTTCCCTTAAGCC | | | Bax | F: AGACAGGGGCCTTTTTGCTAC | | R: AATTCGCCGGAGACACTCG | | | Bcl‐2 | F: TACCGTCGTGACTTCGCAGAG | | R: GGCAGGCTGAGCAGGGTCTT | | | Beclin‐1 | F: GAGCTGGCTCCTGTGAGTATG | | R: CGCCTTCTATCGCCTTCTTGACGAGTTCT | | | MMP‐2 | F: CCCGATCTACACCTACACCAA | | R: AAACCGGTCCTTGAAGAAGAA | | | MMP‐9 | F: CGTCGTGATCCCCACTTACTA | | R: AAGATGAACGGGAACACACAG | | | VEGF | F: GAGCAGAAGTCCCATGAAGTG | | R: CATGGTGATGTTGCTCTCTGA | | | LC3 | F: GACCGCTGTAAGGAGGTGC | | R: AGAAGCCGAAGGTTTCTTGGG | | | β‐actin | F: CTTAGTTGCGTTACACCCTTTCTTG | | R: CTGCTGTCACCTTCACCGTTCC | Note. Bax: Bcl‐2‐associated X protein; Bcl‐2: B‐Cell CLL/Lymphoma 2; F: forward; MMP: matrix metalloprotein; RT‐qPCR: reverse transcription‐quantitative polymerase chain reaction; R: reverse; SDF1: stromal‐derived factor 1; VEGF: vascular endothelial growth factor. 2.9. Western blot analysis A total of 500 μl protein lysate (RIPA, Pierce, Rockford, IL) was added to cells in each group and placed on ice for 60 min. The solution was then transferred to a 1.5‐ml EP tube and centrifuged at 25,764 × g for 30 min at 4°C. Moreover, the supernatant was transferred to an EP tube, and the protein concentration was measured in accordance to the BCA protein quantitative reagent box (BCA1‐1KT, Sigma‐Aldrich Chemical Company, St Louis, MO). Deionized water was used to adjust the protein sample amount to 30 μg. Subsequently, 10% separation gels and 5% spacer gels were prepared. Sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) denatured protein electrophoresis gels were also prepared. The extracted total protein buffer was boiled at 100°C for 5 min, and cooled down by ice bath. The buffer was loaded into each lane using a micro injector for electrophoresis after centrifugation. The electrophoresis conditions were as follows: 100 V for 1.5 hr and 15 V of semi‐dry blotting for 10 min to transfer the protein onto a membrane. The membrane was blocked with 5% skimmed milk‐Tris‐buffered Saline with Tween 20 (TBST), and added with LC3B (1:2,000, ab48394), CD63 rabbit monoclonal antibody (1:1,000, ab134045), Alix rabbit polyclonal antibody (1:1,000, ab76608), CD9 rabbit polyclonal antibody (1:2,000, ab92726), Bax (1:1,000, ab32503), Bcl‐2 (1:2,000, ab182858), Beclin‐1 (1:2,000, ab207612), MMP‐2 (1:1,000, ab92536), MMP‐9 (1:1,000, ab38898), VEGF (1:1,000, ab32152), PI3K (1:1,000, ab40776), p‐PI3K (1:1,000, ab40577), AKT (1:500, ab106693), p‐AKT (1:1,000, ab133458), mTOR (1:2,000, ab2732), and p‐mTOR (1:1,000, ab137133) for incubation overnight at 4°C. The aforementioned antibodies were purchased from Abcam Inc. (Cambridge, MA). The β‐actin was used as internal reference. The membrane was washed three times using PBS at room temperature, each time for 5 min, and incubated with the horseradish peroxidase (HRP)‐labeled goat antirabbit secondary antibody (A0208, Beyotime Biotechnology Co., Ltd., Shanghai, China) at 37°C for 45 min. This was then followed by TBST washing for 45 min. After that, the membrane reacted with electrochemical luminescence (ECL) solution (ECL808‐25, Biomiga Inc, San Diego, CA) for 1 min at room temperature, and was developed in a dark room. The image was analyzed with image analysis software Gel‐Pro Analyzer 4.0 (Media Cybernetics, Inc. Bethesda, MD), and the relative ratio was calculated in comparison to the internal reference. The experiment was repeated three times. 2.10. Exosome isolation from MSCs FBS were centrifuged using ultracentrifugation at 100,000 × g for 8 hr to expel the exosomes. Once confluence of MSCs reached 80%, the supernatant in the culture medium was dislodged and the suspension was washed two times with PBS. The MSCs were further incubated with 10% FBS culture solution without exosomes in a CO2 incubator at 37°C for 48 hr. The culture medium was centrifuged at 300 × g at 4°C for 10 min. Furthermore, the supernatant was obtained and centrifuged two times at 2,000 × g at 4°C and 5,000 × g at 4°C for 15 min with the removal of the disposition. Then, the supernatant was finally centrifuged at 12,000 × g at 4°C for 30 min after which the disposition was collected and washed with PBS. Next, the suspension was centrifuged at 12,000 × g at 4°C for 70 min for the collection of the disposition. After differential centrifugation, the supernatant was ultra‐centrifuged at 100,000 × g for 70 min with the collection of disposition. Lastly, the collected disposition was washed once using PBS and the cell suspension was centrifuged at 100,000 × g at 4°C for 70 min to gather the disposition. 2.11. Nano particle tracking analysis (NTA) A total of 20 μg exosomes were dissolved in 1 ml of PBS, and whirled for 1 min to maintain an even distribution. Later, nano particle tracking analyzer (NanoSight, Amesbury, Wilkshire, UK) was utilized to accurately measure the diameter of exosomes, and further applied to analyze and save the data. 2.12. Transmission electron microscope (TEM) observation The prepared exosomes were fixed in 4% glutaric dialdehyde at 4°C for 2 hr, washed three times with PBS (0.1 mol/l), and later fixed with 1% osmium tetroxide for 2 hr. Next, the exosomes were subjected to gradient dehydration with normal ethanol and acetonum, followed by infusion, embedding, and polymerization with epoxy resin. The exosomes were finally sliced into 0.5 μm semi‐thin sections for optical mirror positioning. Moreover, 60 nm ultrathin sections were prepared, stained with uranyl acetate and lead citrate, and further observed under a transmission electron microscope (TEM; HT7700 Exalens, Beijing SJC Science And Trade Co., Ltd., Beijing, China). 2.13. Exosome transfer into MSCs Carboxyfluorescein diacetate succinimidyl ester (CFSE) was diluted at a ratio of 1:1,000 and evenly mixed with 20 μg of exosome suspension at 37°C for 15 min. The mixed solution was washed once with PBS and centrifuged at 100,000 × g for 70 min. Lastly, the CFSE‐labeled exosomes were cocultured with both myocardial cells and endothelial cells, and the uptake of exosomes in two cells was observed under a confocal fluorescence microscope. 2.14. Exosome secretion detection Exosomes extracted by multistep ultracentrifugation were diluted using PBS into 110 μl. A total of 37.5 μl of diluted solution was evenly added into individual wells of 96‐well plates, after which 0.1 mmol/l 5,5′‐dithiobis‐2‐nitrobenzoic acid (DTNB) solution, and 1.25 mmol/l thioacetylcholine iodide solution of equal volume were added into the plate to reach a total volume of 300 μl. After 30 min of reaction time, the plate was observed under a microplate reader to measure the optical density (OD) value of each well at an excitation wavelength of 412 nm. 2.15. Monodansylcadaverine (MDC) staining The sterile cover glass (24 mm × 24 mm) was placed in a culture disk to inoculate cell lines in each group for preparation of cell slide. When cells confluence reached 70% after 24 hr, 0.05 mmol/l monodansylcadaverine (MDC) (Sigma‐Aldrich Chemical Company, St Louis MO) was added for incubation at a 5% CO2 incubator at 37°C for 20 min, under conditions void of light, followed by washing of cells three times with PBS, each time for 5 min. Subsequently, 95% ethanol was added into the cells and washed three times with PBS, each time for 5 min. Moreover, cells were incubated with 5 μmol/l propidium iodide (PI) at room temperature for 10 min and washed three times with PBS, each time for 5 min. Cells were immediately analyzed by a fluorescence microscope through 4′,6‐diamidino‐2‐phenylindole (DAPI) filter at the excitation wavelength of 372 nm and emission wavelength of 456 nm after the slide was completely dry in a stable ventilation area. Micrographs were obtained by Leica Q Fluoro Software. 2.16. Terminal deoxynucleotidyl transferase (TdT)‐mediated dUTP nick‐end labeling (TUNEL) The cells in logarithmic growth stage were inoculated in a cover glass in a 6‐well plate with a density of 1 × 106 cells/ml. Then, the cells were fixed with 4% polyoxymethylene for 30 min, and further washed with PBS. Next, 3% H2O2 was utilized to block endogenous peroxidase for 10 min. Protease K was applied for digestion for 5 min, followed by the addition of labeled buffer solution, blocking buffer, and the biotinylated digoxin antibody for reaction for 30 min. Streptavidin‐biotin complex (SABC) was added for response time of 30 min, followed by PBS washing. Diaminobenzidine (DAB) was used for color development. Confocal fluorescence microscope was used for observation and photographing. The numbers of total cells and apoptotic cells were counted in randomly selected five visual fields. The experiment was repeated three times. 2.17. Transwell assay Matrigel (356234, Becton, Dickinson and Company, NJ) were diluted with serum‐free Roswell Park Memorial Institute (RPMI)1640 (Gibco Company, Grand Island, NY) medium at the ratio of 1:1, and then covered in the apical chamber at 37°C for 3 hr at 50 μl/well. Next, 0.25% trypsin was used as treatment of cells in each group. The cells were then suspended, centrifuged at 12,000 × g for 10 min, and collected. The suspension was diluted with serum‐free RPMI1640 (Gibco Company) (n = 3 × 104 cells/ml). The cells in each group had three duplicate wells. A total of 200 μl suspension was added to the apical chamber, whereas serum‐free medium was used in the basolateral chamber. After cultivation of 48 hr, the filter membrane was removed and cotton swabs were utilized to clean remaining cells that had not passed through micropores. Then, 0.1% crystal violet solution was utilized for staining for 10 min. A microscope was used for photography and observation, with five visual fields randomly chosen for cell number counting. The number of cells passing through Matrigel in each group was used as an index to evaluate their invasiveness. The experiment was repeated three times. 2.18. Tube formation assay The treated exosomes were incubated with endothelial cells at 37°C in a 5% CO2 incubator for 24–28 hr for tube formation assay. One day before experiments, Matrigel was taken from −20°C refrigerator and melted at a relatively low temperature. Then, a total of 50 μl of matrigel was added into each well of a 96‐well plate using a pipette and placed into an incubator at 37°C for 40 min. The experimental well was set according to the experimental requirements, and three wells were set for each group. The 2nd generations of microvascular endothelial cells were inoculated in each well of the 96‐well plate with 2 × 104 cells per well, and 200 μl medium was supplemented with different reagents in each well. The plate was cultivated at 37°C for 18 hr, after which the 96‐well plate was removed from the incubator to observe tube formation ability and photograph. The experiment was done three times and the number of nodes of tube formation was calculated using a computer software. 2.19. Masson staining Bouin's solution was added into the tissues and the tissues were further washed under running water. Next, tissues were subjected to gradient alcohol dehydration (70%, 80%, 90%, 95%, and 100%) for 1 hr/time, and cleared with xylene (X820585‐500 ml, Hong Zhe Biotechnology Co., Ltd., Anhui, China) two times (15 min/time). After being embedded, the tissues were dehydrated, wax‐infiltrated, paraffin embedded, and sliced. Moreover, Weiger's iron hematoxylin was utilized for staining for 5–10 min, followed by washing under running water, differentiation with 1% hydrochloric acid alcohol for 1 min, and washing under running water again. Subsequently, the slices were stained using Ponceau S solution for 5–10 min, and rinsed with distilled water. After 1% phosphomolybdates solution was added for 5 min, aniline blue or green solution was applied for re‐staining for 5 min. Next, 1% glacial acetic acid was used for 1‐min treatment of the slices. The slices were then dehydrated two times in gradient 95% ethanol (3 min/time, two times). Finally, the slices were observed and photographed with the Optical Microscopy. 2.20. Hematoxylin‐eosin (HE) staining After 4% polyformaldehyde (p1110‐100, Beijing tideradar Biotechnology Co., Ltd., Beijing, China) was added to fix myocardial tissues for 16–18 hr, gradient alcohol dehydration was applied for 1 hr/time, and xylene transparency was performed two times (15 min/time). After being embedded, the tissues were dehydrated, wax‐infiltrated, paraffin embedded, and sliced. After dewaxing, the slices were stained with hematoxylin (C0007, Biotechnology Co., Ltd., Shanghai, China) for 10 min at room temperature and rapidly flushed under running water for 30 ‐ 60 s. Washing was terminated once the nucleus was dyed blue. Subsequently, the slices were treated with 1% glacial acetic acid for 1 min, washed with water for 1 min, and stained with eosin at room temperature for 5–10 min, followed by gradient alcohol dehydration (1 min/time), xylene transparency two times (1 min/time), and mounted with neutral balata. Finally, microscopy (XSP‐8CA, Shanghai optical instrument factory, Shanghai, China) was used for photographing to observe morphological changes. 2.21. Enzyme linked immunosorbent assay (ELISA) The serum samples of each group were taken in accordance with the instructions of SDF1, TNF‐α, IL‐1β, IL‐6, IL‐8, and VEGF enzyme linked immunosorbent assay (ELISA) Kit (RapidBio Systems, Inc., West Hills, CA). The antigen, after being diluted with the coated diluent at a ratio of 1:20, was supplemented with 100 μl standard diluents overnight at 4°C. Then, the liquid in the well was discarded, and the samples were washed three times applying washing solution, each time for 1 min. After the samples were dried with water absorbent paper, they were preserved at 4°C. The diluted samples were added to the enzyme‐labeled plate reaction wells (100 μl per well) with both negative and positive control, and duplicate wells set. The liquid was then removed from the wells, and the samples were washed with washing solution three times, each time for 1 min. Water absorbent paper was reapplied to dry the well. Each well was added with 100 μl enzyme‐conjugates (diluted by the sample diluent to a certain multiplier) and placed at 37°C for 30 min. After washing and drying, 100 μl HRP substrate solution was added to the samples, avoiding light for color development at 37°C for 10–20 min. When the positive control showed obvious color change or when slight color change was evident in negative control, 50 μl of stopping solution was added to terminate the reaction. Finally, the absorbance of each well was measured in 20 min using an enzyme‐labeling instrument (SpectraMax M5, Molecular Devices, Inc., Silicon Valley) at a 450‐nm wavelength. 2.22. Statistical analysis All data were analyzed using SPSS 21.0 software (IBM Corp, Armonk, NY), and tested by applying normal distribution and homogeneity test of variance. Measurement data were expressed as mean ± standard deviation (SD). Independent sample t test was used for comparison between two groups, which was adjusted using Welch's test. Comparisons of data obeying normal distribution among multiple groups were analyzed with one‐way analysis of variance (ANOVA). Turkey was applied for pairwise comparison of mean value among multiple groups. Nonparametric the Kruskal‐Wallis test was performed for comparison between data failing to meet the normal distribution. The p < 0.05 was considered statistically significant. 3. RESULTS 3.1. SDF1 is downregulated in MI mice To determine the differential expression of SDF1 between MI tissue and normal tissue, ELISA was applied and results are displayed in Figure 1. After the establishment of mice model of MI, the level of SDF1 protein was significantly reduced in MI tissue compared with the sham group (p < 0.05). 3.2. Overexpression of SDF1 inhibits apoptosis and autophagy of myocardial cells Subsequently, myocardial cells were separated to detect the effect of SF1 on their apoptosis and autophagy. MDC and TUNEL staining were utilized to determine apoptosis and autophagy of myocardial cells, and the results indicated that the number of autophagic vacuoles and apoptotic cells was reduced after the overexpression of SDF1 in myocardial cells (Figure 2a,b, p < 0.05). The results of RT‐qPCR and western blot analysis indicated that Bcl‐2 expression was evidently increased, yet Bax, Beclin‐1, and LC3 as well as the ratio of LC3II/LC3I were notably decreased after SDF1 was overexpressed in myocardial cells (Figure 2c,d, p 0.05). The aforementioned results demonstrate that overexpression of SDF1 inhibits autophagy and apoptosis of myocardial cells. Recently, it has been proven that MSCs play an important role in MI (Lim et al., 2018; Yang et al., 2018a). To determine whether the changes of SDF1 in MSCs affected autophagy and apoptosis of peripheral myocardial cells, the overexpression of SDF1 in MSCs and corresponding exosomes were extracted for coculture with myocardial cells to detect the autophagy and apoptosis of myocardial cells. The results indicated that the autophagy and apoptosis of myocardial cells were significantly decreased after treatment of exosomes secreted by MSCs with overexpressed SDF1 (Figure 2e,f; all p < 0.05). Based on the results of RT‐qPCR and western blot, after the treatment of exosomes secreted by MSCs with overexpressed SDF1, Bcl‐2 expression was significantly increased, whereas Bax, Beclin‐1, and LC3 as well as the ratio of LC3II/LC3I were remarkably decreased (Figure 2g,h; all p 0.05). These results suggest that SDF1 overexpression in MSCs can affect autophagy and apoptosis of myocardial cells. However, it is still unknown how MSCs affects the biological functions of myocardial cells. 3.3. Overexpression of SDF1 promotes microvascular regeneration of cardiac endothelial cells Endothelial cells were isolated to evaluate the effect of SDF1 on their tube formation ability. Initially, Transwell assay and scratch test were applied to detect microvascular regeneration of cardiac endothelial cells. The results showed that both the number of invasive cells and the number of tube formation were significantly elevated after SDF1 was overexpressed in myocardial cells (Figure 3a–d; all p < 0.05). The results of RT‐qPCR and western blot analysis revealed that the expression of MMP‐2, MMP‐9, and VEGF increased significantly after the overexpression of SDF1 in myocardial cells (Figure 3e–g; all p < 0.05). These results suggest that overexpression of SDF1 promotes microvascular regeneration of cardiac endothelial cells. Recently, it has been proven that MSCs play an important role in endothelial cell microvasculature (McFadden et al., 2013; Toma, Wagner, Bowry, Schwartz, & Villanueva, 2009). To study whether the change of SDF1 expression in MSCs can possibly affect the microvascular regeneration of peripheral endothelial cells, SDF1 was overexpressed in MSCs and cocultured with endothelial cells to detect the number of invasive cells and tube formation of endothelial cells. The results exhibited that the number of invasive cells and the number of formed tubes were significantly elevated in MSCs after overexpression of SDF1 (Figure 3h–k; both p < 0.05). The RT‐qPCR and western blot analysis results are as follows: MMP‐2, MMP‐9, and VEGF expression were significantly increased after SDF1 was overexpressed in MSCs (Figure 3l–n; all p < 0.05). These results suggest that overexpressed SDF1 in MSCs may influence the microvascular regeneration of endothelial cells. 3.4. SDF1 expression in exosomes TEM was utilized to observe the secretions of MSCs, which showed that the secretions were characterized by typical morphologies of exosomes. These secretions, varying in size, were in spherical structure surrounded by lipid bilayer membrane. The outer layer of the secretions was a deep stained area of the bilayer lipid membrane, whereas the inner part was an inhomogeneous shallow dye area. The visible part consisted of protein density material (Figure 4a). To investigate the size distribution of these exosomes, the NanoSight NS300 nanoparticle tracking analyzer was used. The particle size was 112.2 ± 19.6 nm, and most of the particle size was in range of the diameter of the exosomes (26–143 nm). The number of particles with a diameter of 121 nm was the highest (Figure 4b). The exosomes markers were detected using western blot analysis in these secretions. The results showed that the specific marker proteins CD63, Alix, and CD9 (Figure 4c) were found in the exosomes produced by MSCs. The exosomes secreted by MSCs were isolated and identified by the three ways which were mentioned above. After SDF1 was overexpressed in MSC cells, the expression of SDF1 in the exosomes was detected using ELISA. Results showed (Figure 4d) that the expression of SDF1 in exosomes was increased after the overexpression of SDF1 in myocardial cells (p < 0.05). It demonstrates that the exosomes can carry SDF1. Finally, fluorescence microscopy observed that myocardial and endothelial cells could absorb exosomes secreted from MSCs (Figure 4e). 3.5. Exosome release suppresses myocardial cell apoptosis and promotes microvascular formation of endothelial cells To study whether SDF1 was transmitted to myocardial and endothelial cells via exosomes in vitro to alter the biological function of these cells, GW4869 was added to the Transwell chamber coculture system to specifically inhibit exosome secretion. The effect of GW4869 on the release of exosomes and SDF1 expression in the coculture supernatant was then observed. The results of the AchE activity assay showed that the activity of AchE was significantly decreased after the supplement of GW4869 to the coculture system; the release of exosomes was significantly reduced and the expression of SDF1 carried by exosomes was also suppressed (Figure 5a,b; all p < 0.05). Further examinations of the function of cocultured myocardial and endothelial cells were conducted. The results indicated that after the addition of GW4869 to the coculture system, there was an increase in apoptotic capacity of myocardial cells (Figure 5c,d; p < 0.05), decrease in microvascular formation ability of endothelial cells (Figure 5e,f; p < 0.05), enhanced autophagy ability, and elevated Beclin‐1 level as well as observation of LC3II/LC3I ratio (Figure 5g–i; p < 0.05). In conclusion, released exosomes contribute to restrained myocardial cell apoptosis and enhanced microvascular formation of endothelial cells. 3.6. SDF1 activates downstream PI3K pathway Overexpression of SDF1 inhibits apoptosis and autophagy in ischemic myocardial cells. In addition, PI3K signaling pathway is closely related to cell apoptosis and autophagy (Jian, Xuan, Qin, & Huang, 2015; Yang et al., 2018b). To determine whether SDF1 regulated PI3K pathway, PI3K signaling pathway inhibition and exosomal treatment were performed on myocardial and endothelial cells. The apoptosis and tube formation ability of myocardial cells and endothelial cells were further examined. The results revealed that after inhibition of PI3K signaling pathway in myocardial cells and endothelial cells, the apoptotic ability of myocardial cells was significantly increased, whereas the formation ability of endothelial cell was remarkably decreased. However, the PI3K signaling pathway in myocardial cells and endothelial cells were reversed by overexpression of SDF1, and the opposite trend was observed after the exosomal treatment (Figure 6a–d). The results of western blot analysis implied that interference with the PI3K signaling pathway could suppress the expression of p‐PI3K, AKT, mTOR, p‐AKT, and p‐mTOR (Figure 6e,f). However, the SDF1 group showed the opposite trend. After inhibition of the PI3K signaling pathway, the effect of overexpression of SDF1 on the myocardial cells and endothelial cells was reversed. These results show that interference with PI3K signaling pathway can promote myocardial cell apoptosis whereas inhibiting endothelial cell tube formation, and exosomal treatment of myocardial and endothelial cells can reverse the effects of PI3K signaling pathway inhibitors. 3.7. Exo‐SDF1 protects cardiac function of MI mice To further explore the clinical role of SDF1, effects of Exo‐SDF1 on cardiac function of MI mice were investigated in vivo and the results are displayed in Figure 7. In comparison to the sham group, myocardial infarct size was increased in SDF1‐NC plasmid transfected MSCs with overexpression of SDF1; the myocardium cell contour gradually disappeared with a blue‐violet granular structure forming; myocardium cell lost their nuclei, accompanied by a large number of fibrous connective tissue. Myocardial tissue damage was developed after overexpression of SDF1 in MSCs in comparison to the transfection with SDF1‐NC plasmid (Figure 7a). Hematoxylin‐eosin (HE) staining results indicated that when compared with the sham group, the arrangement of myocardial fibers in the MSCs transfected with SDF1‐NC plasmid and overexpression of SDF1 in MSCs showed a disordered state with disappearance of nuclei, accompanied by a large number of inflammatory cell infiltration, and partial multifocal fibrosis. Myocardial tissue damage was improved in SDF1 overexpression in MSCs when compared with transfection with SDF1‐NC plasmid (Figure 7b). ELISA showed that the expression of IL‐1β, IL‐6, IL‐8, and TNF‐α in the SDF1‐NC plasmid transfected MSCs and SDF1 overexpression MSCs was significantly higher than that of MI mice after operation. Moreover, the expression of VEGF was remarkably decreased (all p < 0.05). In comparison to the MSCs transfected with SDF1‐NC plasmid, the expression of IL‐1β, IL‐6, IL‐8, and TNF‐α in MSCs with overexpression of SDF1 was significantly declined, whereas the expression of VEGF was significantly elevated (all p < 0.05; Figure 7c). The results suggest that overexpression of SDF1 in MSCs can protect cardiac function of myocardial infarction mice. 4. DISCUSSION Exosomes are a group of nano‐vesicles secreted by a variety of cells; they are involved in intracellular communication and material transport via directing action of signal molecules on the surface of cell membrane and the regulation of cells in the process of cell fusion (Li, Liu, & Mao, 2017). In addition, exosomes for cancer therapy upregulate SDF1 (Cho et al., 2012). Overexpressed SDF1 has been reported to be able to rescue cardiac function in rats diagnosed with MI (Tang et al., 2009). Taken together in consideration, the investigation of the role of exo‐SDF1 in ischemic myocardial cell apoptosis and endothelial microvascular regeneration was conducted. In this study, enough evidence was provided to show that SDF1 activated the expression of PI3K signaling pathway, inhibited autophagy of myocardial cells, and promoted microvascular production of endothelial cells via MSCs‐derived exosomes. Initially, the present study found that release of exosomes suppressed myocardial cell apoptosis, whereas it promoted microvascular formation of endothelial cells and that SDF1 was upregulated in exosomes. Exosomes, as an extracellular organelle of signal transduction, regulate tumor microenvironment, and promote angiogenesis of endothelial cells (Lang et al., 2017). Besides, it was also discovered that SDF1 was downregulated in mice with MI, and overexpression of SDF1 inhibited apoptosis and autophagy of ischemic myocardial cells. In addition, SDF1 promoted microvascular regeneration of cardiac endothelial cells. It is known that SDF1 is a crucial chemokine and is indispensable for tissue repair and angiogenesis (Yang et al., 2017). A previous research declared that SDF1 is related to coronary heart disease (Wu, Zhang, Jia, & Jia, 2015). More important, injection of SDF1 is able to attract bone marrow‐derived progenitor cells from the blood, which may differentiate into cardiovascular cells, support angiogenesis, and improve cardiac function (Schesny et al., 2014). Also, SDF1 is correlated with modulation of ischemia reperfusion injury, and during pre‐ischemic exposure and reperfusion, SDF1 is dose‐dependent and high concentration induces a significant reduction in infarct size (Jang et al., 2012). A previous study revealed that SDF1 and its receptor CXC chemokine receptor 4 (CXCR4) play a key role in preserving proliferation and survival of bone marrow‐derived MSCs and respond to stress responses by improving cell proliferation and survival (Herberg et al., 2013). Another study indicated that SDF1 and CXCL4 cause decreased endometrial stromal cell autophagy in endometriosis (Mei et al., 2015). Besides, Jarrah et al. have reported that SDF1 activates cellular signals, which also attracts potentially beneficial stem cells to repair tissue in the ischemic heart, in relation to cell apoptosis (Jarrah et al., 2018). Based on the information aforementioned, it is known that overexpression of SDF1 inhibited apoptosis and autophagy of ischemic myocardial cells. Subsequently, the study presented that SDF1 overexpression activated the PI3K pathway, and activation of the PI3K pathway inhibited apoptosis and autophagy of ischemic myocardial cells, whereas also promoting microvascular regeneration of cardiac endothelial cells. Study has shown that SDF1 activates the P13k signaling pathway, inhibits high glucose, and improves diabetic nephropathy (Zhang et al., 2013). Moreover, another study has revealed that SDF1/CXCR4 could mediate the migration of bone marrow‐derived mesenchymal stem cell toward heart MI via activation of PI3K/Akt (Yu et al., 2010). In the previous report, PI3K is demonstrated to be closely associated with cell apoptosis and autophagy (Yang et al., 2018b). PI3‐kinase is involved in signal transduction of ischemic post‐conditioning in rat cardiac, which acts as a protective substance in ischemic post‐conditioning (Wagner, Tillack, Simonis, Strasser, & Weinbrenner, 2010). The activation of the PI3K‐Akt signal pathway is associated with the inhibition of myocardial apoptosis and excessive autophagy (Xuan et al., 2017). The study has also proven that SDF1 can activate PI3k pathway (Cui et al., 2016). Furthermore, to explore the clinical role of SDF1, the effect of Exo‐SDF1 on cardiac function of MI mice in vivo was investigated. The results suggested that Exo‐SDF1 protected cardiac function of MI mice. Overexpression of SDF1 through MSC results in a substantial reduction in myocardial cell apoptosis and an increase of vascular density and cardiac function (Unzek et al., 2007). Moreover, upregulation of SDF1 promotes cardiac repair in patients with AMI, and reversing the damage of SDF in AMI can further reverse the adverse effects of diabetes (Mayorga et al., 2018). Collectively, this study revealed that overexpression of SDF1 inhibited apoptosis and autophagy of ischemic myocardial cells and promoted microvascular regeneration of cardiac endothelial cells (Figure 8). Moreover, SDF1 was expressed in exosomes and the exo‐SDF1 regulated downstream PI3K pathway. The core findings indicated that SDF1 could inhibit autophagy of myocardial cells and promote the microvascular regeneration of endothelial cells via activating the PI3K signaling pathway. Lastly, it was found that SDF1 protected cardiac function of MI mice and, therefore, SDF could serve as a therapeutic agent for the treatment of MI. However, the research is still in preclinical stage, and the mechanism of action is insufficient. It may be a crucial problem to increase the efficiency and safety of SDF1 for the treatment of MI. CONFLICTS OF INTEREST All authors declare that there no conflicts of interest. AUTHORS' CONTRIBUTION Study design: XHG and HWL; data collection: HL, SJW, and GGW; data analysis: XHG and SWL; data interpretation: SJW and HWL; drafting manuscript: XHG and HL; approving final version of manuscript: XHG, HL, SJW, SWL, GGW, and HWL. ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundation of China (No. 81600196) and Beijing Key Laboratory of Metabolic Disturbance Related Cardiovascular Disease (No. OP2018DXWL01).

References

REFERENCES - Boyle, A. J. , Yeghiazarians, Y. , Shih, H. , Hwang, J. , Ye, J. , Sievers, R. , … Wilson, A. M. (2011). Myocardial production and release of MCP‐1 and SDF‐1 following myocardial infarction: Differences between mice and man. Journal of Translational Medicine, 9, 150. [DOI] [PMC free article] [PubMed] [Google Scholar] - Cho, J. A. , Park, H. , Lim, E. H. , & Lee, K. W. (2012). Exosomes from breast cancer cells can convert adipose tissue‐derived mesenchymal stem cells into myofibroblast‐like cells. International Journal of Oncology, 40(1), 130–138. [DOI] [PubMed] [Google Scholar] - Cui, C. , Wang, P. , Cui, N. , Song, S. , Liang, H. , & Ji, A. (2016). Sulfated polysaccharide isolated from the sea cucumber Stichopus japonicas promotes the SDF‐1alpha/CXCR4 axis‐induced NSC migration via the PI3K/Akt/FOXO3a, ERK/MAPK, and NF‐kappaB signaling pathways. Neuroscience Letters, 616, 57–64. [DOI] [PubMed] [Google Scholar] - Gong, X. , Wang, P. , Wu, Q. , Wang, S. , Yu, L. , & Wang, G. (2016). Human umbilical cord blood derived mesenchymal stem cells improve cardiac function in cTnT(R141W) transgenic mouse of dilated cardiomyopathy. European Journal of Cell Biology, 95(1), 57–67. [DOI] [PubMed] [Google Scholar] - Groehler, A. , Kren, S. , Li, Q. , Robledo‐Villafane, M. , Schmidt, J. , Garry, M. , & Tretyakova, N. (2018). Oxidative cross‐linking of proteins to DNA following ischemia‐reperfusion injury. Free Radical Biology and Medicine, 120, 89–101. [DOI] [PMC free article] [PubMed] [Google Scholar] - Harisharan, N. , Singh, A. K. , Dangal, N. R. , Surapaneni, & Joshi, A. (2015). Multiple risk factors of alcoholic and non‐alcoholic myocardial infarction patients. Global Journal of Health Science, 8(1), 62–71. [DOI] [PMC free article] [PubMed] [Google Scholar] - Herberg, S. , Shi, X. , Johnson, M. H. , Hamrick, M. W. , Isales, C. M. , & Hill, W. D. (2013). Stromal cell‐derived factor‐1beta mediates cell survival through enhancing autophagy in bone marrow‐derived mesenchymal stem cells. PLoS One, 8(3), e58207. [DOI] [PMC free article] [PubMed] [Google Scholar] - Jang, Y. H. , Kim, J. H. , Ban, C. , Ahn, K. , Cheong, J. H. , Kim, H. H. , … Xu, Z. (2012). Stromal cell derived factor‐1 (SDF‐1) targeting reperfusion reduces myocardial infarction in isolated rat hearts. Cardiovascular Therapeutics, 30(5), 264–272. [DOI] [PubMed] [Google Scholar] - Jarrah, A. A. , Schwarskopf, M. , Wang, E. R. , LaRocca, T. , Dhume, A. , Zhang, S. , … Tarzami, S. T. (2018). SDF‐1 induces TNF‐mediated apoptosis in cardiac myocytes. Apoptosis, 23(1), 79–91. [DOI] [PMC free article] [PubMed] [Google Scholar] - Jian, J. , Xuan, F. , Qin, F. , & Huang, R. (2015). Bauhinia championii flavone inhibits apoptosis and autophagy via the PI3K/Akt pathway in myocardial ischemia/reperfusion injury in rats. Drug Design, Development and Therapy, 9, 5933–5945. [DOI] [PMC free article] [PubMed] [Google Scholar] - Komosa, A. , Lesiak, M. , Siniawski, A. , Mularek‐Kubzdela, T. , & Grajek, S. (2014). Significance of antiplatelet therapy in emergency myocardial infarction treatment. Post?py w Kardiologii Interwencyjnej = Advances in Interventional Cardiology, 10(1), 32–39. [DOI] [PMC free article] [PubMed] [Google Scholar] - Lang, H. L. , Hu, G. W. , Zhang, B. , Kuang, W. , Chen, Y. , Wu, L. , & Xu, G. H. (2017). Glioma cells enhance angiogenesis and inhibit endothelial cell apoptosis through the release of exosomes that contain long non‐coding RNA CCAT2. Oncology Reports, 38(2), 785–798. [DOI] [PMC free article] [PubMed] [Google Scholar] - Li, M. Y. , Liu, D. W. , & Mao, Y. G. (2017). Advances in the research of effects of exosomes derived from stem cells on wound repair. Zhonghua Shao Shang Za Zhi, 33(3), 180–184. [DOI] [PubMed] [Google Scholar] - Li, Y. , Sheng, Z. , Yang, Y. , Yao, Y. , & Ma, G. (2011). Dual‐modal tracking of transplanted mesenchymal stem cells after myocardial infarction. International Journal of Nanomedicine, 6, 815–823. [DOI] [PMC free article] [PubMed] [Google Scholar] - Lim, M. , Wang, W. , Liang, L. , Han, Z. , Li, Z. , Geng, J. , … Han, Z. (2018). Intravenous injection of allogeneic umbilical cord‐derived multipotent mesenchymal stromal cells reduces the infarct area and ameliorates cardiac function in a porcine model of acute myocardial infarction. Stem Cell Research & Therapy, 9(1), 129. [DOI] [PMC free article] [PubMed] [Google Scholar] - Mao, J. , Lv, Z. , & Zhuang, Y. (2014). MicroRNA‐23a is involved in tumor necrosis factor‐alpha induced apoptosis in mesenchymal stem cells and myocardial infarction. Experimental and Molecular Pathology, 97(1), 23–30. [DOI] [PubMed] [Google Scholar] - Marote, A. , Teixeira, F. G. , Mendes‐Pinheiro, B. , & Salgado, A. J. (2016). MSCs‐derived exosomes: Cell‐secreted nanovesicles with regenerative potential. Frontiers in Pharmacology, 7, 231. [DOI] [PMC free article] [PubMed] [Google Scholar] - Mayorga, M. E. , Kiedrowski, M. , McCallinhart, P. , Forudi, F. , Ockunzzi, J. , Weber, K. , … Dong, F. (2018). Role of SDF‐1:CXCR4 in impaired post‐myocardial infarction cardiac repair in diabetes. Stem Cells Translational Medicine, 7(1), 115–124. [DOI] [PMC free article] [PubMed] [Google Scholar] - McFadden, T. M. , Duffy, G. P. , Allen, A. B. , Stevens, H. Y. , Schwarzmaier, S. M. , Plesnila, N. , … O’Brien, F. J. (2013). The delayed addition of human mesenchymal stem cells to pre‐formed endothelial cell networks results in functional vascularization of a collagen‐glycosaminoglycan scaffold in vivo. Acta Biomaterialia, 9(12), 9303–9316. [DOI] [PubMed] [Google Scholar] - Mei, J. , Zhu, X. Y. , Jin, L. P. , Duan, Z. L. , Li, D. J. , & Li, M. Q. (2015). Estrogen promotes the survival of human secretory phase endometrial stromal cells via CXCL12/CXCR4 up‐regulation‐mediated autophagy inhibition. Human Reproduction, 30(7), 1677–1689. [DOI] [PubMed] [Google Scholar] - Schesny, M. K. , Monaghan, M. , Bindermann, A. H. , Freund, D. , Seifert, M. , Eble, J. A. , … Schenke‐Layland, K. (2014). Preserved bioactivity and tunable release of a SDF1‐GPVI bi‐specific protein using photo‐crosslinked PEGda hydrogels. Biomaterials, 35(25), 7180–7187. [DOI] [PubMed] [Google Scholar] - Seeger, F. H. , Rasper, T. , Fischer, A. , Muhly‐Reinholz, M. , Hergenreider, E. , Leistner, D. M. , … Dimmeler, S. (2012). Heparin disrupts the CXCR4/SDF‐1 axis and impairs the functional capacity of bone marrow‐derived mononuclear cells used for cardiovascular repair. Circulation Research, 111(7), 854–862. [DOI] [PubMed] [Google Scholar] - Si, Y. L. , Zhao, Y. L. , Hao, H. J. , Fu, X. B. , & Han, W. D. (2011). MSCs: Biological characteristics, clinical applications and their outstanding concerns. Ageing Research Reviews, 10(1), 93–103. [DOI] [PubMed] [Google Scholar] - Tang, J. , Wang, J. , Yang, J. , Kong, X. , Zheng, F. , Guo, L. , … Huang, Y. (2009). Mesenchymal stem cells over‐expressing SDF‐1 promote angiogenesis and improve heart function in experimental myocardial infarction in rats. European Journal of Cardio‐Thoracic Surgery, 36(4), 644–650. [DOI] [PubMed] [Google Scholar] - Toma, C. , Wagner, W. R. , Bowry, S. , Schwartz, A. , & Villanueva, F. (2009). Fate of culture‐expanded mesenchymal stem cells in the microvasculature: In vivo observations of cell kinetics. Circulation Research, 104(3), 398–402. [DOI] [PMC free article] [PubMed] [Google Scholar] - Trajkovic, K. , Hsu, C. , Chiantia, S. , Rajendran, L. , Wenzel, D. , Wieland, F. , … Simons, M. (2008). Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science, 319(5867), 1244–1247. [DOI] [PubMed] [Google Scholar] - Unzek, S. , Zhang, M. , Mal, N. , Mills, W. R. , Laurita, K. R. , & Penn, M. S. (2007). SDF‐1 recruits cardiac stem cell‐like cells that depolarize in vivo. Cell Transplantation, 16(9), 879–886. [DOI] [PubMed] [Google Scholar] - Vassalli, G. , & Moccetti, T. (2011). Cardiac repair with allogeneic mesenchymal stem cells after myocardial infarction. Swiss Medical Weekly, 141, w13209. [DOI] [PubMed] [Google Scholar] - Wagner, C. , Tillack, D. , Simonis, G. , Strasser, R. H. , & Weinbrenner, C. (2010). Ischemic post‐conditioning reduces infarct size of the in vivo rat heart: Role of PI3‐K, mTOR, GSK‐3beta, and apoptosis. Molecular and Cellular Biochemistry, 339(1‐2), 135–147. [DOI] [PubMed] [Google Scholar] - Wen, Z. , Zheng, S. , Zhou, C. , Wang, J. , & Wang, T. (2011). Repair mechanisms of bone marrow mesenchymal stem cells in myocardial infarction. Journal of Cellular and Molecular Medicine, 15(5), 1032–1043. [DOI] [PMC free article] [PubMed] [Google Scholar] - Wen, Z. , Zheng, S. , Zhou, C. , Yuan, W. , Wang, J. , & Wang, T. (2012). Bone marrow mesenchymal stem cells for post‐myocardial infarction cardiac repair: MicroRNAs as novel regulators. Journal of Cellular and Molecular Medicine, 16(4), 657–671. [DOI] [PMC free article] [PubMed] [Google Scholar] - Wu, N. , Zhang, X. , Jia, P. , & Jia, D. (2015). Lack of an Association between the SDF‐1 rs1801157 Polymorphism and Coronary Heart Disease: A Meta‐Analysis. Scientific Reports, 5, 11803. [DOI] [PMC free article] [PubMed] [Google Scholar] - Xuan, F. , Jian, J. , Lin, X. , Huang, J. , Jiao, Y. , Huang, W. , … Huang, R. (2017). 17‐Methoxyl‐7‐hydroxy‐benzene‐furanchalcone ameliorates myocardial ischemia/reperfusion injury in rat by inhibiting apoptosis and autophagy via the PI3K‐Akt signal pathway. Cardiovascular Toxicology, 17(1), 79–87. [DOI] [PubMed] [Google Scholar] - Yang, F. , Wu, R. , Jiang, Z. , Chen, J. , Nan, J. , Su, S. , … Wang, J. (2018a). Leptin increases mitochondrial OPA1 via GSK3‐mediated OMA1 ubiquitination to enhance therapeutic effects of mesenchymal stem cell transplantation. Cell Death & Disease, 9(5), 556. [DOI] [PMC free article] [PubMed] [Google Scholar] - Yang, L. X. , Wei, C. L. , Guo, M. L. , Zhang, Y. , Bai, F. , & Ma, S. G. (2017). Improvement of therapeutic effects of mesenchymal stem cells in myocardial infarction through genetic suppression of microRNA‐142. Oncotarget, 8(49), 85549–85558. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted] - Yang, T. , Miao, Y. , Zhang, T. , Mu, N. , Ruan, L. , Duan, J. , … Zhang, R. (2018b). Ginsenoside Rb1 inhibits autophagy through regulation of Rho/ROCK and PI3K/mTOR pathways in a pressure‐overload heart failure rat model. Journal of Pharmacy and Pharmacology, 70(6), 830–838. [DOI] [PubMed] [Google Scholar] - Yu, B. , Shao, H. , Su, C. , Jiang, Y. , Chen, X. , Bai, L. , … Li, X. (2016). Exosomes derived from MSCs ameliorate retinal laser injury partially by inhibition of MCP‐1. Scientific Reports, 6, 34562. [DOI] [PMC free article] [PubMed] [Google Scholar] - Yu, J. , Li, M. , Qu, Z. , Yan, D. , Li, D. , & Ruan, Q. (2010). SDF‐1/CXCR4‐mediated migration of transplanted bone marrow stromal cells toward areas of heart myocardial infarction through activation of PI3K/Akt. Journal of Cardiovascular Pharmacology, 55(5), 496–505. [DOI] [PubMed] [Google Scholar] - Yuan, M. J. , Maghsoudi, T. , & Wang, T. (2016). Exosomes mediate the intercellular communication after myocardial infarction. International Journal of Medical Sciences, 13(2), 113–116. [DOI] [PMC free article] [PubMed] [Google Scholar] - Zhang, D. , Shao, S. , Shuai, H. , Ding, Y. , Shi, W. , Wang, D. , & Yu, X. (2013). SDF‐1alpha reduces fibronectin expression in rat mesangial cells induced by TGF‐beta1 and high glucose through PI3K/Akt pathway. Experimental Cell Research, 319(12), 1796–1803. [DOI] [PubMed] [Google Scholar]

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-09-13T09:25:22.628771+00:00
unpaywall
last seen: 2026-09-18T06:25:56.777850+00:00