Catalytic-dependent and independent functions of the histone acetyltransferase CBP promote pioneer factor-mediated zygotic genome activation

Catalytic-dependent and independent functions of the histone acetyltransferase CBP promote pioneer factor-mediated zygotic genome activation | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Catalytic-dependent and independent functions of the histone acetyltransferase CBP promote pioneer factor-mediated zygotic genome activation View ORCID Profile Audrey J. Marsh , View ORCID Profile Sergei Pirogov , Abby J. Ruffridge , Suresh Sajwan , Tyler J. Gibson , George Hunt , Yadwinder Kaur , View ORCID Profile Melissa M. Harrison , View ORCID Profile Mattias Mannervik doi: https://doi.org/10.1101/2024.10.04.616638 Audrey J. Marsh 1 Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health , Madison WI 53706 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Audrey J. Marsh Sergei Pirogov 2 Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm University , 10691 Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sergei Pirogov Abby J. Ruffridge 1 Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health , Madison WI 53706 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Suresh Sajwan 2 Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm University , 10691 Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tyler J. Gibson 1 Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health , Madison WI 53706 USA 3 Present address: Department of Pediatrics, Section of Developmental Biology, University of Colorado Anschutz Medical Campus , Aurora, CO 80045 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site George Hunt 2 Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm University , 10691 Stockholm, Sweden 4 Present address: Biotech Research and Innovation Centre, Faculty of Health and Medical Sciences, University of Copenhagen , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yadwinder Kaur 1 Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health , Madison WI 53706 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Melissa M. Harrison 1 Department of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health , Madison WI 53706 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Melissa M. Harrison For correspondence: mharrison3{at}wisc.edu Mattias Mannervik 2 Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm University , 10691 Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mattias Mannervik For correspondence: mattias.mannervik{at}su.se Abstract Full Text Info/History Metrics Supplementary material Preview PDF Summary Immediately after fertilization the genome is transcriptionally quiescent. Maternally encoded pioneer transcription factors reprogram the chromatin state and facilitate the transcription of the zygotic genome. In Drosophila , transcription is initiated by the pioneer factor Zelda. While Zelda-occupied sites are enriched with histone acetylation, a post-translational mark associated with active cis -regulatory regions, the functional relationship between Zelda and histone acetylation in zygotic genome activation remained unclear. We show that Zelda-mediated recruitment of the histone acetyltransferase CBP is essential for zygotic transcription. CBP catalytic activity is necessary for release of RNA Polymerase II (Pol II) into transcription elongation and for embryonic development. However, CBP also activates zygotic transcription independent of acetylation through Pol II recruitment. Neither acetylation nor CBP are required for the pioneering function of Zelda. Our data suggest that pioneer factor-mediated recruitment of CBP is a conserved mechanism required to activate zygotic transcription but that this role is separable from the function of pioneer factors in restructuring chromatin accessibility. Introduction Immediately following fertilization, the newly formed genome is transcriptionally silent. This allows for the zygotic genome to be rapidly reprogrammed to enable the generation of a new, unique organism. This fast-paced and conserved period of metazoan development is called the maternal-to-zygotic transition (MZT), in which maternal mRNAs and proteins loaded into the egg during oogenesis trigger expression of the zygotic genome after fertilization 1 . Across animals, reprogramming during the MZT is driven by pioneer factors. In contrast to many transcription factors for which nucleosomes are a barrier to binding, pioneer factors bind nucleosomes and reorganize chromatin accessibility. These changes to chromatin accessibility result in the recruitment of downstream transcription factors and the activation of new gene expression programs. As a result, pioneer factors act at the top of transcriptional networks to drive developmental transitions 2 , 3 . Understanding pioneer factor function is therefore critical for elucidating how the genome is interpreted through dynamic developmental transitions. The first major activator of zygotic transcription, Zelda (Zld), was initially identified in Drosophila melanogaster 4 , and Drosophila have continued to be a powerful model for studying the regulatory principles that govern how pioneer factors remodel the genome and drive development. In Drosophila , the MZT occurs over the first three hours after egg laying (AEL). During this period, the nuclei undergo 14 nuclear division cycles (NC) within a syncytium 5 . At NC8, maternally encoded zld is translated leading to the initiation of zygotic transcription 6 – 8 . Transcription from the zygotic genome is gradually activated with widespread transcription occurring at NC14, coincident with the slowing of the division cycle. Zld is required for chromatin accessibility at hundreds of cis- regulatory elements 9 , 10 . This accessibility potentiates the binding of additional transcription factors and promotes proximal gene expression 4 , 9 – 14 . Zld binds to nucleosomes in vitro , and ectopic expression of Zld in culture induces chromatin accessibility 15 – 17 . Together these studies demonstrate that Zld is a pioneer factor necessary for reprogramming the zygotic genome. Nonetheless, how Zld facilitates chromatin accessibility after nucleosome binding remains unclear. Here, we explore mechanisms of Zld pioneer activity to understand how pioneer factors facilitate dramatic changes in transcription during developmental transitions. Prior to Zld-mediated genome activation, the histone tails are largely devoid of post-translational modifications as assayed by chromatin immunoprecipitation followed by sequencing (ChIP-seq) 18 . Acetylation of H3K18, H3K27, and H4K8 is detected initially at NC8 and is enriched at Zld-bound regions 9 , 18 , 19 . Similarly, in zebrafish H3K27ac accumulates prior to activation of the zygotic genome, and pioneer factors are required for the deposition of this mark 20 – 22 . While acetylation is thought to promote chromatin accessibility by neutralizing the positive charges of lysine groups on histone tails, the connection between histone acetylation, gene expression and chromatin accessibility remains largely correlative 23 , 24 . Histone acetylation also recruits bromodomain containing nucleosome remodelers to clear nucleosomes from cis- regulatory regions 25 . Thus, Zld may promote chromatin accessibility through the recruitment of a histone acetyltransferase (HAT). Acetylation of H3K18, H3K27 and H4K8 are dependent upon the deeply conserved CREB-binding protein (CBP)/p300 HAT family 26 – 32 . CBP/p300 is a widespread transcriptional coactivator. Indeed, CBP/p300 binding and the acetylation of H3K27 it catalyzes are markers used to identify active cis- regulatory regions 33 , 34 . The catalytic core of CBP/p300 is functionally required for HAT activity and includes a bromodomain, RING, PhD finger, HAT, ZZ, and TAZ domains. Catalytic activity must be activated through acetylation of an autoinhibitory loop within the HAT domain 35 – 37 . Therefore, CBP/p300 occupancy alone is not predictive of its catalytic activity or whether CBP-bound sites are enriched with histone acetylation 38 . In fact, non-catalytic activities of CBP/p300 contribute to the regulation of gene expression 30 , 39 . Because Drosophila have a single CBP/p300 homologue, encoded by the gene nejire, they provide a simplified system to investigate the possible relationship between CBP/p300 and pioneer factors in the early embryo 40 . Here, we investigated the connection between Zld pioneer activity, acetylation, and gene expression. We discovered that Zld is required for CBP recruitment to the genome at a subset of sites. CBP mediates zygotic gene expression and is necessary for embryonic development. CBP activates gene expression through two distinct mechanisms that depend on catalytic-dependent and independent activities. Independent of catalytic activity, CBP is needed for the recruitment or stability of RNA polymerase II (Pol II) at gene promoters. Pol II initiates but pauses 40-60 bp downstream of the transcription start site at many zygotic genes 41 . Release from this promoter-proximal pausing depends on the kinase activity of P-TEFb 42 , 43 . We found that the catalytic activity of CBP is required for Pol II pause release and robust transcription. In contrast to the essential role of CBP in zygotic gene expression, CBP is dispensable for chromatin accessibility. Thus, Zld pioneer activity is independent of its ability to recruit CBP and is separable from activating gene expression. These data suggest that together Zld and CBP coordinate the activation of the zygotic genome and elucidate a mechanism by which pioneer factors recruit cofactors to reprogram transcription and drive developmental transitions. Results Zld is required for recruitment of CBP to a subset of loci The correlation between Zld-bound sites and CBP-dependent histone acetylation suggested that Zld might recruit CBP to these sites to catalyze acetylation. To confirm CBP is expressed during the MZT, we endogenously tagged the N-terminus of CBP with GFP using Cas9-mediated genome engineering (Figure S1A). CBP GFP was evident in nuclei throughout the MZT beginning as early as NC10 and into NC14 ( Figure 1A ). ChIP-seq for CBP GFP on hand-sorted stage 5 (NC14) embryos identified 5,479 regions bound by CBP. To avoid technical differences in peak numbers, we used the same ChIP-seq protocol to identify Zld-bound loci at stage 5, when the major wave of zygotic transcription initiates. Based on the overlap of Zld-bound regions with CBP-dependent histone acetylation marks, we predicted that CBP and Zld would have overlapping genome occupancy. Indeed, we identified 2,932 Zld-bound sites, of which 1202 were shared with CBP ( Figure 1B ). For downstream analysis, we split the total combined Zld and CBP GFP peaks into three classes: shared, Zld-unique, and CBP-unique. ( Figure 1C-E ). Annotation of individual peaks by the type of cis- regulatory element showed that CBP occupancy is largely at promoters, as both shared (52.7%) and CBP unique (67.0%) classes have a high proportion of promoter-bound sites as compared to other genomic elements. ( Figure 1F ). Download figure Open in new tab Figure 1. The pioneer factor Zld is required for CBP recruitment and H3K27ac deposition at co-occupied sites and is sufficient to induce H3K27ac at Zld-pioneered regions. (A) His2AvRFP (white) or CBP GFP (teal) at NC14 (stage 5) in a CBP GFP ;His2AvRFP embryo. Scale bar, 25µM. (B) Venn diagram showing the proportion of Zld and CBP GFP ChIP-seq peaks that overlap in stage 5 embryos. (C) Metaplots of the Zld or CBP GFP ChIP-seq signals centered on the peak. Peaks from each ChIP-seq experiment were divided into shared (dashed), Zld-unique (red), or CBP-unique (teal) classes. Data is normalized to background. (D) Heatmaps showing Zld, CBP GFP , or H3K27ac occupancy as measured by ChIP-seq in stage 5 wild-type (wt) or zld-RNAi embryos. All peaks are ranked by Zld-binding intensity. Zld and H3K27ac experiments are z-score normalized. CBP GFP experiments are spike-in normalized. (E) Representative genome browser track of the bitesize (btsz) locus depicting peaks from the shared class (red bar) and CBP-unique class (teal bar). (F) Pie charts depicting the proportion of ChIP-seq peaks bound to distinct cis- regulatory elements. Promoters were defined as -500bp and +100bp from the transcription start site (TSS) of the closest coding region to each peak. (G) Heatmaps of Zld occupancy (ChIP-seq), chromatin accessibility (ATAC-seq), and H3K27ac (CUT&RUN) at regions of closed chromatin bound by Zld upon expression in S2 cells. Peaks are separated based on whether they gain accessibility following Zld induction: Zld-closed (remain inaccessible) and Zld-pioneered (gain accessibility). Signals are z-score normalized. (H) Representative genome browser track from 1G, highlighting a region from the Zld-pioneered class (red bar) at the Dpp target gene ( Dtg ) locus. CBP is incapable of binding directly to DNA. The overlap of Zld- and CBP-bound regions suggested that Zld might recruit CBP to co-occupied sites. To test this, we used RNAi to deplete maternally encoded Zld in CBP GFP embryos and identified CBP-binding sites using ChIP-seq (Figure S1B) 10 . CBP GFP binding was strongly reduced at shared regions but was maintained at loci corresponding to the CBP-unique peaks ( Figure 1D,E ). Thus, Zld is required to recruit CBP to the genome at shared regions. As expected, CBP-catalyzed H3K27ac was enriched at CBP-bound regions in wild-type embryos. Levels of H3K27ac were strongly reduced at Zld-bound sites in zld-RNAi, reflecting the loss of CBP occupancy ( Figure 1D,E ). Unexpectedly, H3K27ac was also reduced at the Zld-unique peaks, suggesting CBP may be dynamically recruited to these regions in a manner that is not captured by ChIP-seq. This is supported by evidence that H3K27ac is exclusively dependent upon CBP in the early embryo, making it unlikely that another HAT is responsible for H3K27ac at these sites 30 . Thus, Zld is recruiting CBP to thousands of genomic loci and promoting H3K27ac. From these data, it is unclear whether Zld is directly recruiting CBP through a protein-protein interaction or indirectly through promoting chromatin occupancy of another transcription factor. As expected, variations of the CAGGTAG motif to which Zld binds were the most enriched motifs at shared and Zld-unique classes. The top motifs identified in CBP-unique peaks are bound by the insulator proteins BEAF-32 and Dref, highlighting a potential distinct function of these regions compared to Zld-CBP shared sites (Figure S1C). Bicoid (Bcd), Dorsal (Dl), and Twist (Twi) are transcription factors that depend on Zld-mediated pioneer activity to access their binding motifs 11 – 13 . Therefore, these factors could function to indirectly recruit CBP to Zld-pioneered regions. The Dl motif was found to be enriched in all three peak classes, suggesting that at both Zld-bound and CBP-unique sites Dl might facilitate CBP binding. The Bcd motif was specific to Zld-bound classes, while the Twi motif was enriched in CBP-unique sites (Figure S1C). Analysis of published ChIP-seq data showed that binding of both Bcd and Dl at shared sites, but not CBP-unique sites, depended on Zld (Figure S1D,E) 10 , 13 . This further supports a possible role for both transcription factors in facilitating CBP binding at these loci. This analysis highlights factors that might function with Zld to direct CBP binding in the early embryo. We showed that Zld is necessary for CBP binding to embryonic chromatin. To determine if Zld was sufficient to promote CBP recruitment, we exogenously expressed Zld in Schneider 2 cells (S2), where endogenous Zld expression is below the level of detection 16 . We previously used this system to show that exogenously expressed Zld bound closed chromatin and promoted accessibility at a subset of loci (Zld-pioneered sites) 16 . To investigate how Zld binding affects histone acetylation, we performed CUT&RUN for H3K27ac with and without Zld expression. We identified enrichment of H3K27ac specifically at the Zld-pioneered class upon Zld induction ( Figure 1G,H and S2). Together with our data from embryos, this demonstrates that Zld is not only necessary for histone acetylation but is also sufficient for promoting this histone modification. While motif analysis in embryos suggested the possible involvement of other factors, such as Dl, Bcd and Twi, these factors are not expressed in S2 cells. Thus, Zld is either directly recruiting CBP to promote acetylation of closed chromatin in S2 cells or Zld-mediated accessibility facilitates the binding of other factors that promote CBP recruitment. Maternally encoded CBP is essential for zygotic genome activation The correlation between Zld binding and CBP occupancy suggested that CBP might be essential for transcriptional activation during ZGA. We explored this hypothesis by depleting CBP GFP protein using a maternally driven deGradFP transgene 44 , 45 . This construct expresses a GFP nanobody fused to an F-box-containing protein that can intercalate with an endogenous ubiquitin ligase complex to selectively degrade GFP-tagged proteins. We confirmed that this system results in depletion of CBP GFP at NC14 ( Figure 2A ) and a robust decrease in H3K27ac and H3K18ac levels (Figure S3A,B). Hatching rates performed roughly 24h after egg laying (AEL) demonstrated that CBP deGrad embryos were inviable, similar to zygotic mutants ( Figure 2B ) 40 . Comparable results were obtained with RNAi knockdown of CBP 30 , 46 . We conclude that maternally encoded CBP is essential for early embryo development. Download figure Open in new tab Figure 2. Maternal CBP is required for zygotic genome activation. (A) GFP signal in CBP GFP control and CBP deGrad embryos staged at NC14. Scale bar, 25uM. (B) Percent CBP GFP (n= 388) or CBP deGrad (n= 451) embryos hatched 24hrs AEL. Error bars are the standard deviation between three replicates. (C) Volcano plot of single embryo RNA-seq from CBP deGrad embryos as compared to CBP GFP embryos. Genes with Zld-proximal peaks are indicated in red. Navy represents genes that change in expression lacking a proximal Zld-binding sites, and grey represents genes with statistically insignificant changes in expression (adjusted p-value 1). (D) Pie charts of the expression patterns of genes with decreased (left) or increased (right) expression in CBP deGrad embryos as compared to CBP GFP embryos during the MZT: maternal, zygotic, or both. Using this tool to robustly deplete CBP from the embryo, we performed single-embryo mRNA-seq on control ( CBP GFP ; His2AvRFP ) and CBP deGrad ;His2AvRFP embryos harvested precisely 15 min into NC14. Differential analysis revealed 1045 genes with decreased expression upon CBP degradation and 931 with increased expression ( Figure 2C ). These genes are similarly dysregulated when CBP is depleted by RNAi (Figure S3C) 30 . Increased and decreased genes were classified as maternal or zygotically expressed based on prior analysis 47 . 337 increased and 485 decreased genes could not be classified, as they were not present within the original referenced dataset. Of the genes that were classifiable, 82.7% (491/594) of increased genes were maternally expressed, suggesting most of the increased genes are maternally provided mRNAs that fail to be efficiently degraded when CBP is absent. These are likely indirect targets of embryonically expressed CBP. By contrast, genes with decreased mRNA levels are enriched for those that are zygotically expressed (60.2%, 448/560 genes), and are therefore likely to be enriched for those directly activated by CBP ( Figure 2D ). 43% of these zygotic genes have CBP bound to a proximal region as assayed by ChIP-seq. This is likely an underestimate of CBP occupancy as ChIP-seq only reflects binding sites that enable cross-linking of CBP to chromatin. Thus, CBP binding functions broadly to activate gene expression during the MZT. Given that CBP depends on Zld for recruitment to the genome at thousands of loci, genes that depend upon CBP for expression may be Zld targets. We therefore used immunoblots to test whether the effects of CBP depletion on gene expression were the indirect result of changes to Zld levels. Zld levels did not change in maternally depleted CBP embryos (Figure S3D). Because Zld binds and activates hundreds of zygotically expressed genes, we would expect that Zld-binding sites would be enriched near those genes that depend on CBP for expression. Indeed, 37.9% (396/1045) of decreased genes had a proximal Zld-binding site, which was more than 2.5x higher than the enrichment near increased genes (14.2% (132/931)) ( Figure 2C ). To further test the connection between CBP- and Zld-mediated gene expression, we analyzed single-embryo RNA-seq from embryos in which maternal Zld was optogenetically inactivated during zygotic genome activation 15 . The log 2 fold change in expression of Zld-dependent genes correlated with the log 2 fold change of the same genes in CBP deGrad RNA-seq. Genes that were decreased in Zld-inactivated embryos were also down in CBP deGrad , indicating that Zld-dependent genes also require CBP for activation (Figure S3E). These results cumulatively support a model in which Zld recruitment of CBP is necessary to mediate gene expression during the MZT. CBP-mediated acetylation is required in the zygote for embryonic development Both the previously published RNAi knockdown and our deGrad depletion rely on expression in the maternal germline 30 , 45 , making it impossible to disentangle effects caused by any knockdown in the germline as compared to the early embryo. To overcome this challenge, we used an optogenetic strategy that has previously been used to precisely inactivate transcriptional activators during the period of zygotic expression (NC10-14) and, in so doing, circumvents phenotypes nonspecific to ZGA that can arise when maternally expressed factors, like CBP, are attenuated during oogenesis 15 , 48 . For this purpose, the blue-light responsive CRY2 polypeptide was engineered onto the N-terminus of endogenous CBP ( Figure 3A ). Inactivation of CBP CRY2 by blue light was tested by assaying for CBP-mediated histone acetylation levels (H3K27ac and H3K18ac) by immunoblot on extract from either wild-type or CBP CRY2 embryos treated with blue light from 1-3h AEL. CBP-mediated acetylation of H3K27 and H3K18 were robustly decreased in CBP CRY2 embryos exposed to blue light as compared to both wild-type controls or CBP CRY2 embryos kept in the dark (Figure S4A). CUT&Tag for histone acetylation on stage 5 embryos treated with blue light from 1-3 hr AEL showed a genome-wide decrease in H3K27ac and H3K18ac upon blue-light inactivation ( Figure 3B ). Blue-light treatment did not generally affect histone acetylation as the CBP-independent mark H3K9ac was unaffected after blue-light treatment ( Figure 3B ). These assays demonstrate that blue-light treatment during the MZT resulted in inactivation of the acetyltransferase activity of CBP CRY2 . Download figure Open in new tab Figure 3. Both catalytic-dependent and independent functions of CBP are required for embryonic development and ZGA. (A,D) Diagrams of endogenous CBP CRY2 (A) and CBP HAT (D) with predicted protein domains from UniProt database. (B,E) Heatmaps of H3K27ac, H3K18ac, and H3K9ac CUT&Tag from stage 5 CBP CRY2 embryos treated in the dark (-) or in blue light (+) (B) and wild-type or CBP HAT embryos (E) centered on CBP-binding sites. (C,F) Heatmaps of CUT&Tag for CBP from stage 5 CBP CRY2 embryos treated in the dark (-) or in blue light (+). (C) or for CBP from stage 5 wild-type or CBP HAT embryos (F) . (G) Hatching rates for wild-type or CBP CRY2 embryos raised in the dark (wild type n= 411, CBP CRY2 n=429) or treated with blue light (wild type n= 507, CBP CRY2 n=400) during the MZT (0-3hrs AEL). Error bars are the standard deviation between replicates. (G) Wild-type, CBP HAT , and blue-light treated CBP CRY2 embryos at gastrulation stained with 4′,6-diamidino-2-phenylindole (DAPI). Arrowhead points to invagination arrest observed in mutants (I) Volcano plot of single-embryo RNA-seq from blue-light treated CBP CRY2 embryos as compared to wild-type embryos similarly exposed to blue light. Navy represents genes that change in expression, and grey represents genes with statistically insignificant changes in expression (adjusted p-value 1). (J) Volcano plot of bulk RNA-seq from CBP HAT embryos as compared to wild-type embryos. Navy represents genes that change in expression, and grey represents genes with statistically insignificant changes in expression (adjusted p-value 1). (K) Venn diagram showing the overlap of decreased, zygotically expressed genes identified in CBP deGrad , CBP CRY2 with blue light, and CBP HAT embryos. To determine whether blue-light treatment causes the release of CBP from chromatin and the subsequent decrease in acetylation, we assayed for CBP CRY2 occupancy with and without blue-light treatment. Unexpectedly, CBP CRY2 occupancy was largely retained after blue-light inactivation ( Figure 3C ), suggesting blue-light exposure specifically inhibited the catalytic activity of CBP without disrupting its binding. Despite the overall retention of inactivated CBP CRY2 on chromatin, a small subset of CBP-binding sites was lost upon blue-light treatment. Our results suggest that blue-light treatment of CBP CRY2 results in specific inactivation of the catalytic activity of CBP. To test this further, we generated an allele that specifically inhibits the catalytic activity of endogenous CBP (F2161A within the HAT domain) ( Figure 3D ) 26 , 49 . This mutation was not viable as a homozygote, demonstrating that the catalytic activity of CBP is required for development and necessitating the use of germline clones to produce embryos with only the catalytic dead mutant maternally provided (CBP HAT ). Similar to the CBP CRY2 embryos, CBP HAT embryos had reduced levels of H3K27ac and H3K18ac, but not H3K9ac ( Figure 3E and S4B). Furthermore, CBP HAT was also largely retained on chromatin with reduced occupancy at a subset of binding sites ( Figure 3F ). The similarity between CBP CRY2 and CBP HAT demonstrates that CBP CRY2 allows for optogenetic control of CBP catalytic activity. We assayed the viability of both CBP CRY2 embryos treated with blue light during the MZT and CBP HAT embryos to determine the effects of loss of CBP catalytic activity on early embryonic development. Both conditions resulted in embryos that failed to hatch, and analysis of fixed embryos suggest embryos arrest at gastrulation ( Figure 3G,H ). It is possible that retention of the catalytic-dead CBP on chromatin dominantly inhibits development, similar to what was reported previously for CRY2-tagged Bicoid 48 . To test this, we assayed hatching rates for progeny from mothers heterozygous for CBP CRY2 whose progeny will inherit both wild-type and CRY2-tagged CBP. There was no difference in hatching rates between blue-light treated and dark controls, suggesting CBP CRY2 is not acting as a dominant negative upon blue-light inactivation (Figure S4C). We then used our optogenetic allele to test whether maternally provided CBP activity is required in the early embryo for development. For this purpose, we performed directional crosses in which only one of the parents contributed the CBP CRY2 allele and compared hatching rates of the progeny exposed to either blue light for 0-3 hr AEL or kept in the dark. Progeny from crosses in which the mothers contributed the CBP CRY2 exhibited lethality rates comparable to homozygous CBP CRY2 when treated with blue light (Figure S4D). By contrast, progeny inheriting CBP CRY2 from their fathers, and therefore only possessing zygotically encoded CBP CRY2 , were unaffected by blue-light treatment (Figure S4E). Thus, maternally encoded CBP catalytic activity is required in the early embryo for progression through the MZT. CBP activates gene expression through both catalytic-dependent and independent mechanisms Knockdown of CBP, either through protein degradation or RNAi, resulted in dramatic changes to the transcriptome during ZGA ( Figure 2C ) 30 . Nonetheless, it remained unclear whether CBP-mediated gene expression depends on CBP-mediated acetylation. Our CBP CRY2 and CBP HAT alleles provided powerful tools to determine the catalytic-dependent and independent functions of CBP in genome activation. We performed single-embryo RNA-seq on CBP CRY2 embryos treated with blue light from NC10 until 15 minutes into NC14 along with controls (blue-light treated His2Av embryos and CBP CRY2 embryos kept in the dark). Differential analysis identified 207 genes with decreased expression and 80 with increased expression in CBP CRY2 embryos as compared to controls ( Figure 3I ). As we did previously, we identified genes with changes in expression accounting for effects caused by both the addition of the CRY2 tag to endogenous CBP and treatment with blue light 15 . As in the CBP deGrad embryos, many of the increased genes are maternally expressed (47.7%, 21/42 genes), while the majority of decreased genes are zygotic (66.7%, 88/133 genes) (Figure S4E). These data suggest that CBP-mediated acetylation is important for zygotic gene expression and is supported by bulk RNA-seq from stage 5 CBP HAT embryos ( Figure 3J ). Compared to CBP CRY2 , analysis of the bulk RNA-seq on the CBP HAT embryos identified a larger number of genes with changes in gene expression as compared to controls; 438 genes increased in expression and 455 genes decreased ( Figure 3J ). As before, the increased genes were enriched for those that are maternally expressed while the decreased genes were enriched for zygotically expressed transcripts ( Figure 3J and S4F). Differences in the number of differential genes may result from the longer collection period that was sampled in the bulk RNA-seq as compared to the precisely staged single-embryo RNA-seq or the fact that CBP HAT embryos result from germline clones that may affect maternally provided products. Independent of the genotype used to inactivate CBP catalytic activity or the sequencing method utilized, a subset of zygotically expressed genes depend on CBP catalytic activity for transcriptional activation. While our data demonstrated that CBP catalytic activity is required for activation of a subset of the zygotic genome, we identified fewer genes that changed in expression upon inhibition of CBP catalytic activity as compared to the degradation of the entire protein. When we focused on the zygotically expressed genes, there were 226 genes that were uniquely decreased in the CBP deGrad embryos. Only 16 genes were reduced in the CBP CRY2 embryos as compared to the CBP deGrad embryos and 61 in the CBP HAT as compared to the CBP deGrad ( Figure 3K ). To determine whether the reduction in gene expression in our catalytically inhibited CBP embryos was due to loss of CBP binding at the loci or the absence of acetylation, we determined whether CBP was bound proximally to these genes and, if so, whether binding was maintained in CBP HAT embryos. We then plotted the average log 2 fold change of these CBP-bound genes. This analysis demonstrated that expression was reduced for genes proximal to CBP-bound regions regardless of whether proximal CBP binding was reduced in the catalytic dead mutants (Figure S4G). Thus, the observed decrease in gene expression cannot be fully explained by the loss of CBP genome occupancy in catalytically dead or inactivated embryos. Together, our analysis of multiple mutants that disrupt CBP function demonstrates that CBP acts through both catalytic-dependent and independent mechanisms to activate expression from the zygotic genome. CBP recruits Pol II independent of catalytic activity but catalytic activity is required for release of Pol II from promoter-proximal pausing To explore how catalytic and non-catalytic CBP activities affect gene expression, we performed spike-in normalized CUT&Tag experiments with antibodies that recognize the initiating form of RNA polymerase II (Pol II) marked by serine 5-phosphorylation on the C-terminal domain of Pol II (Ser5-P). In 2-3 hr old CBP deGrad embryos, the global Ser5-P signal over transcription start sites (TSS) was severely reduced as compared to CBP GFP , indicating that Pol II recruitment or stability at the promoter depends on CBP ( Figure 4A ). Supporting this finding, TATA-binding protein (TBP) was similarly reduced at promoters in 2-3 hr CBP deGrad embryos ( Figure 4B ). To compare catalytic with non-catalytic functions, we performed similar experiments on 2-3 hr CBP CRY2 embryos with and without blue light. In contrast to the results with CBP deGrad embryos, Ser5-P CUT&Tag signal was unaffected over the TSS in CBP CRY2 embryos exposed to blue light ( Figure 4C ). However, Ser2-P, the elongating form of Pol II, was reduced as compared to embryos not exposed to blue light ( Figure 4D ). These data suggest that catalytically inactive CBP can recruit Pol II to promoters, but this Pol II is not able to release into productive transcription. In early embryos, Pol II is localized to small foci and this localization requires both Zld and CBP 46 , 50 . By contrast, the more dramatic accumulation of Pol II at the histone locus body is not dependent on these factors. As expected based on these prior studies, staining of control and CBP deGrad embryos showed a similar reduction in Pol II foci upon CBP depletion ( Figure 4E ). By contrast, Pol II foci were still evident in CBP CRY2 embryos exposed and fixed in blue light ( Figure 4F ). Together our genomic analysis and immunostaining indicate that CBP is required for Pol II recruitment, but that catalytic activity is only necessary for a subsequent step. Download figure Open in new tab Figure 4. Catalytic activity of CBP is required for RNA Pol II elongation but not recruitment. (A, B) Heatmaps of CUT&Tag from stage 5 CBP GFP control and CBP deGrad embryos for pSer5 Pol II (A) and TBP (B) centered on the TSS of Pol II transcribed genes. (C, D) Heatmaps of CUT&Tag from stage 5 CBP CRY2 embryos treated in the dark (-) or in blue light (+) for pSer5 (C) and pSer2 Pol II (D) centered on the TSS of Pol II transcribed genes. (E) Staining for RNA Polymerase II in CBP GFP control and CBP deGrad embryos. (F) Staining for RNA Polymerase II in CBP CRY2 embryos treated in the dark (-) or in blue light (+). Large foci correspond to the histone locus bodies. Scale bars, 5 µm. To provide a map of transcriptionally engaged Pol II, we performed Precision run-on sequencing (PRO-seq). This analysis identified 207 genes that were transcriptionally downregulated and 54 genes upregulated after spike-in normalization in 2-3 hr CBP deGrad embryos (Figure S5A). While not identical to the gene expression changes identified by mRNA-seq, the gene expression changes identified by PRO-seq correlate well with the single-embryo RNA-seq (Figure S5B). Importantly, PRO-seq captures promoter-proximal paused polymerases. Downregulated genes had Pol II paused at the transcription start site (TSS) in CBP GFP control embryos, whereas unaffected and upregulated genes had little Pol II pausing ( Figure 5A , B). Consistent with the Ser5-P and TBP CUT&Tag, Pol II pausing was reduced in CBP deGrad embryos ( Figure 5A , B). CBP occupancy was enriched at downregulated gene promoters, but upregulated and unaffected promoters had little CBP. This suggests that downregulated genes are direct CBP targets whereas upregulated genes are indirectly affected by CBP depletion ( Figure 5C ). These results indicate that CBP is needed to establish paused Pol II by recruiting or stabilizing Pol II at promoters, consistent with earlier findings 51 . Download figure Open in new tab Figure 5. RNA Pol II is retained at promoters in the absence of CBP catalytic activity. (A) PRO-seq metaplots centered on the TSS of down-regulated, up-regulated and non-affected genes in stage 5 CBP GFP control and CBP deGrad embryos. (B) Box plots of PRO-seq promoter and gene body signal of down-regulated genes in CBP deGrad as compared to CBP GFP controls. (C) CBP CUT&Tag signal at promoters of down-regulated, up-regulated and unaffected genes in CBP GFP control embryos. (D) PRO-seq metaplots centered on the TSS of down-regulated, up-regulated and unaffected genes in stage 5 CBP CRY2 embryos treated in the dark (-) or in blue light (+) ( E ). Box plots of PRO-seq promoter and gene body signal of down-regulated genes in CBP CRY2 embryos treated with blue light as compared to untreated CBP CRY2 embryos ( F ). CBP CUT&Tag signal in promoters of down-regulated, up-regulated and non-affected genes in CBP CRY2 embryos kept in the dark or treated with blue light. ( G,H ). Genome browser tracks showing PRO-seq signal over rhomboid ( rho ) (G) or prospero ( pros ) (H) in embryos as indicated to the left. Gene bodies (blue-highlighted regions) are shown with an increased scale (as noted) to enable visualization of PRO-seq reads. (I,J) Heatmaps of CUT&Tag for BRD4/fs(1)h (I) or CycT (J) from stage 5 CBP CRY2 embryos treated in the dark (-) or in blue light (+). PRO-seq on CBP CRY2 embryos identified 230 downregulated genes and 315 upregulated genes, which are correlated with changes identified by mRNA-seq (Figure S5C,D). In contrast to the decrease in Pol II pausing observed in the CBP deGrad embryos, promoter-proximal PRO-seq signal increased in CBP CRY2 embryos upon blue-light exposure ( Figure 5D , E). Despite this increase in Pol II pausing upon blue-light exposure, these CBP-bound genes were down-regulated ( Figure 5E , F). This is evident at the rhomboid ( rho ) and prospero ( pros ) genes where promoter-proximal Pol II is decreased only in the CBP deGrad embryos, but gene body Pol II is decreased in both blue-light treated CBP CRY2 and CBP deGrad embryos ( Figure 5 G,H). Together these data strongly suggest that Pol II cannot be efficiently released into productive elongation in the absence of CBP catalytic activity. Release of Pol II from pausing depends on P-TEFb, consisting of the Cdk9 kinase and Cyclin T (CycT), and on the bromodomain protein Brd4, also known as female sterile (1) homeotic, fs(1)h, in Drosophila 52 – 55 . CUT&Tag with antibodies recognizing Drosophila Brd4 and CycT demonstrated that Brd4 occupancy was reduced, but not absent, in CBP CRY2 embryos ( Figure 5I ). Indeed, CycT remained bound to promoters in CBP CRY2 embryos despite the reduction in Brd4, suggesting that P-TEFb is recruited in an inactive state independent of Brd4 ( Figure 5J ). These results support a model that identifies two distinct activities for CBP in zygotic genome activation: CBP establishes paused Pol II by a catalytically independent mechanism, whereas catalytic activity is important for release of paused Pol II into elongation downstream of P-TEFb recruitment. The pioneering activity of Zld does not depend on CBP Our data identify two functions for CBP in promoting gene expression but do not define the relationship between CBP and pioneer activity. Because we showed that Zld recruits CBP to activate zygotic gene expression, we wanted to test if CBP-mediated acetylation was required for Zld to promote chromatin accessibility. To test this, we induced Zld expression in S2 cells and treated with either A-485, a specific catalytic inhibitor of CBP, or DMSO, as a control, and performed ATAC-seq 56 . We confirmed catalytic inactivation of CBP using ChIP-seq and immunoblots to assay for H3K27ac levels, which were globally decreased at all Zld-bound sites (Figure S6A,B). In contrast to the dramatic reduction in acetylation, chromatin accessibility was unchanged at Zld-pioneered regions ( Figure 6A ), indicating that histone acetylation is not necessary for Zld-mediated accessibility at these sites. We then tested the role of acetylation in embryos by performing single embryo ATAC-seq on CBP CRY2 embryos exposed to blue light and compared chromatin accessibility at CBP-bound sites to His2AvRFP controls also exposed to blue light. Similar to our results in culture, we did not identify global changes in accessibility at either Zld-bound or CBP-unique loci ( Figure 6B ). Quantitative analysis identified 5,757 sites with changes in accessibility between CBP CRY2 and control embryos (1454 increased, 4303 decreased), but only 7.88% were bound by CBP, suggesting these are indirect effects (Figure S6C). Our analysis in cell culture and embryos demonstrates that CBP-mediated histone acetylation is not required for Zld pioneer activity. Download figure Open in new tab Figure 6. CBP is not required for Zld-mediated pioneer activity. (A) Heatmaps of Zld occupancy (ChIP-seq), chromatin accessibility (ATAC-seq) in S2 cells treated with either DMSO or A-485 divided into regions that Zld pioneers (Zld-pio.) and those that remain inaccessible (Zld-closed). Signals are z-score normalized. (B) Heatmaps of single embryo ATAC-seq with peaks sorted into shared, Zld-unique, and CBP-unique classes in wild-type, CBP deGrad or CBP CRY2 embryos (as labeled). Embryos were staged precisely 15 min into NC14 before harvesting. Plus and minus signs denote whether embryos were treated with blue light from NC10-14. Signals are z-score normalized. (C) Model depicting Zld recruitment of CBP to cis- regulatory regions in the early embryo. Independent from its role as a histone acetyltransferase, CBP is needed to recruit Pol II. By contrast, CBP catalytic activity is required for Pol II elongation. To investigate if CBP is more generally important for chromatin accessibility, we leveraged our deGrad system to perform in vivo , single-embryo ATAC-seq on CBP GFP and CBP deGrad embryos precisely 15 min into NC14. Similar to what we observed when CBP catalytic activity was inactivated but CBP occupancy was retained, chromatin accessibility was largely unchanged at Zld-bound and CBP-unique sites ( Figure 6B ). Quantitatively calling differential sites identified only 1,094 sites (671 up, 423 down) that changed in accessibility in CBP deGrad embryos as compared to controls and only 8.87% (97 sites) overlapped with CBP GFP ChIP-seq (Figure S6D). Thus, CBP and CBP-mediated acetylation are not broadly required for chromatin accessibility during the MZT. Discussion We demonstrated that CBP is required for zygotic transcription during the MZT, and its recruitment is dependent upon the pioneer factor Zld at shared cis -regulatory sites. Two mechanisms could explain this Zld-mediated recruitment of CBP. Zld might indirectly recruit CBP through its pioneer activity by promoting the binding of an additional transcription factor that directly interacts with CBP. Possible candidate transcription factors are Bcd and Dl, which directly interact with CBP and depend on Zld for recruitment 12 , 13 , 40 , 57 – 59 . Our motif analysis supports this model, as we identified Bcd motifs enriched at Zld/CBP shared regions and Dl motifs enriched more broadly at CBP-bound sites. Alternatively, Zld might directly recruit CBP to shared sites either through interactions with CBP or with an intermediate cofactor. Direct interactions between Zld and CBP have not been reported. Nonetheless, Zld is sufficient to induce H3K27ac at Zld-pioneered regions in S2 cells, where Bcd and Dl are not expressed. Thus, in S2 cells Zld might directly promote CBP binding or could function through another transcription factor that is endogenously expressed in S2 cells. Further experiments will be required to distinguish between these two models. Our identification of CBP-bound regions that were distinct from Zld-bound regions suggests that CBP recruitment is not solely dependent upon Zld. Those sites uniquely bound by CBP were enriched for motifs bound by the insulator binding proteins Dref and BEAF-32, suggesting that CBP might play an important role in establishing tertiary chromatin structures. Indeed, CBP is known to bind outside of active cis-regulatory regions, including insulators where CBP-mediated acetylation of H3K27 blocks the spreading of silencing H3K27me3 into euchromatic regions 38 . Catalytic inhibition of CBP/p300 in cell culture disrupts enhancer and promoter interactions 60 . Uniquely bound CBP sites may therefore play a distinct role in maintaining higher order organization of the genome. Degradation of maternally encoded CBP results in the downregulation of over a thousand genes during widespread genome activation. Our finding is supported by orthogonal approaches of CBP mediated knock down at the transcript level rather than protein level 30 . Many of the genes that depend on CBP are also bound and dependent upon Zld for activation, indicating CBP works in conjunction with Zld to upregulate transcription of the zygotic genome. Coordinated activation of these targets is likely a stepwise process, where Zld first binds to the genome and recruits CBP, which stimulates the downstream recruitment of RNA Pol II to promoters. Formation of transcriptional hubs has been suggested to increase local concentrations of transcriptional regulators at promoters to drive transcription 61 . High-resolution microscopy resolved the formation of Zld-dependent transcriptional hubs 62 , 63 , and removal of Zld from the nucleus or knock down of CBP by RNAi abolishes RNA Pol II cluster formation 46 , 50 . Our work provides mechanistic details, demonstrating that CBP and Zld can bind to the same genomic loci, that CBP binding depends on Zld, and that both factors are required for transcriptional activation. The CBP/p300 HAT family is multifaceted in its coactivator function where CBP and p300 can activate transcription through acetylation of histone tails, acetylation of transcriptional coactivators, or independent of HAT activity by acting as a transcriptional bridge between enhancers and promoters 64 . We showed that CBP mediates gene expression through catalytic-dependent and independent mechanisms ( Figure 6C ). A majority of acetylation-dependent genes overlapped with genes that require CBP for activation, but not vice versa. Using RNA-seq, we identified a more dramatic reduction in transcription in embryos with a reduction in CBP protein as compared to those in which only catalytic activity was disrupted. These data indicate that CBP-mediated transcriptional activation is largely dependent on functions separate from catalytic activity. Possible mechanisms of catalytic-independent activation by CBP include the recruitment of general transcription factors, like TFIIB, to help the formation or stabilization of the pre-initiation complex of RNA Pol II 51 , 65 – 67 . This is consistent with the reduction in Ser5-P Pol II and TBP at promoters and lack of Pol II foci in CBP-depleted embryos. Alternatively, CBP-mediated histone acetylation has been shown to facilitate recruitment of bromodomain containing coactivors such as Brd4 or TBP 46 , 68 . Thus, CBP facilitates the recruitment of the transcription machinery through multiple diverse functions. This is similar to what has recently been shown for other histone modifiers and highlights the diversity of functions that can be carried out by these large enzymes 69 . Despite the milder effects on gene expression of catalytic inactivation as compared to CBP depletion, our data demonstrate that the catalytic function of maternally encoded CBP is essential for embryogenesis; embryos are nonviable when we deplete maternal CBP protein or inactivate catalytic activity. This contradicts a recent report in which transgenic overexpression of the F2161A catalytic dead allele of CBP restored viability to embryos in which CBP was depleted through RNAi 30 . Immunoblots for CBP showed considerable loss of CBP protein after RNAi knock down, however, there were detectable levels of CBP. We propose that low levels of wild-type catalytically active CBP protein present in these knockdown embryos was sufficient to restore viability with the presence of ectopically expressed catalytic dead CBP. The reproducibility of results observed in both CBP CRY2 inactivated and CBP HAT mutant embryos strongly supports our conclusion that catalytic activity of maternally provided CBP is essential during ZGA. We find that CBP-target genes contain promoter-proximal paused Pol II and that CBP catalytic activity is needed for release of paused Pol II into productive elongation. In agreement with this, pause release can be stimulated by increased acetylation 70 . In embryos without CBP catalytic activity paused genes become more strongly paused, loose Ser2-P Pol II, and nascent transcription over gene bodies is decreased. Loss of acetylation results in impaired binding of BRD4, but not P-TEFb. Although phosphorylation of Pol II and negative elongation factors by P-TEFb is necessary for release into elongation 42 , BRD4 is also needed for Pol II pause release independent of P-TEFb recruitment 71 – 73 . Since BRD4 recognizes acetylated histones 25 , a plausible scenario is that CBP-mediated histone acetylation allows BRD4 to engage with paused zygotic genes to stimulate pause release. Zld was the first pioneer factor identified as a master regulator of zygotic transcription across metazoans and has provided a paradigm in understanding how the genome is reprogrammed during early embryo development. Nonetheless, the mechanisms by which Zld mediates the displacement of nucleosomes and activates zygotic transcription remain unclear. Prior to this study, we hypothesized that recruitment of HAT cofactors by Zld might promote chromatin accessibility as histone acetylation has been correlated with active chromatin 33 , 74 . In contrast to this expectation, our data clearly separates CBP-mediated gene expression from chromatin accessibility and demonstrate that the ability of Zld to open chromatin is independent from CBP recruitment, consistent with earlier studies on the relationship between CBP and chromatin accessibility 75 . Screening for potential Zld-recruited cofactors may help shed light on how Zld mediates chromatin opening. However, it is possible that Zld promotes chromatin accessibility through creating a transient hub that concentrates both itself and other factors and in so doing promotes chromatin occupancy. Our work makes it evident that pioneering function and transcriptional activation are separable and that to uncover the mechanism of Zld pioneer function it will be essential to focus on chromatin accessibility apart from gene expression. While Zld has served as a paradigm for understanding pioneer-factor regulated genome activation, Zld is not conserved outside of the Pancrustacea clade of arthropods 76 . By contrast, CBP is broadly conserved 77 , 78 . Similar to our demonstration that Zld recruits CBP to activate gene expression, pioneer factor mediated recruitment of p300/CBP initiates ZGA in vertebrates. In zebrafish, Nanog, Pou5f3, and Sox19b activate zygotic transcription and recruit p300a, which is essential for ZGA 21 , 22 , 79 . As in flies, histone acetylation is separable from chromatin accessibility 22 . Members of the Dux transcription factor family initiate ZGA in mammals 80 , 81 . Dux4 in humans directly interacts with p300, where removal of the Dux4-p300 interacting domain results in a failure to activate transcription 82 . Furthermore, inhibition of p300/CBP catalytic activity in mouse embryos impedes zygotic transcription 83 . Thus, while the individual pioneer factors are not conserved across model systems, they share a conserved role in recruiting CBP/p300 to activate zygotic transcription. Our work describes a model by which this conserved HAT coordinates the activation of the zygotic genome in tandem with a pioneer factor to jump start development and identifies roles in both Pol II recruitment and release. Declaration of Interests The authors declare no competing interests. Author contributions AJM, SP, TJG, GH, MMH, and MM designed the experiments. AJM, SP, AJR, SS, TJG, GH, YK performed the experiments and data analysis. AJM, SP, MMH, and MM wrote the original draft. AJM, SP, TJG, MMH and MM revised and edited the manuscript. AJM, MMH, and MM acquired funding. Data availability All sequencing data is available through GEO accession number GSE276949. Materials and Methods Drosophila husbandry and strains All stocks used in this study were maintained at 25°C and fed a molasses or potato mash diet. Non-CRY2 lines were raised on a 12-hour light and dark cycle. CBP CRY2 flies were laid and hatched in the dark. Stocks are listed in the Reagents Table. Cell culture The stable S2 MT-Zld line used in this study was described previously 16 . Cells were cultured in Schneider’s medium (Thermo Fisher Scientific) supplemented with 10% FBS (Omega Scientific) and 10% antibiotic-antimycotic (Thermo Fisher Scientific). Puromycin (Fisher Scientific) was added to media to a final concentration of 1 µg/ml to select for transgenic cells. Cas9-mediated genome engineering The N-terminus of CBP was endogenously tagged with GFP or CRY2 using a previously described method for Cas9 mediated genome engineering 84 . The double stranded donor used as a template for homologous recombination was generated via Gibson assembly (NEB). Sequence encoding either GFP or CRY2 was added immediately after the start codon of the CBP open reading frame and flanked by 1kb homology arms. For screening purposes, a 3XP3-DsRed cassette was inserted into the first CBP intron and flanked by long terminal repeats recognized by the PiggyBac transposase. The guide RNA sequence (GTCAAACTAACTCTATATGA) was cloned via inverse PCR into pBSK downstream of a U6 promoter. Donor and guide RNA plasmids were purified and sent to The Best Gene Inc. for injection into w[1118]; PBac{y[+mDint2]=vas-Cas9}VK00027 embryos. Lines were then screened for DsRed positive eye expression to identify Cas9-edited flies, followed by excision of the DsRed cassette by the PiggyBac transposase. To validate proper editing, each founder line was confirmed by sequencing. A point mutation that disrupts CBP catalytic activity 49 , F2161A, was generated by a two-step CRISPR- and recombination mediated cassette exchange (RMCE)-based strategy 85 . Two gRNAs and a 3xP3-DsRed containing donor plasmid with attP sites were injected into vas-Cas9 flies to delete exons 9 and 10 and the intervening intron (1.4 kb). To select the gRNAs, vas-Cas9 genomic DNA from flanking introns was amplified with primers 5pSequenceFw, 5pSequenceRw, 3pSequenceFw and 3pSequenceRw and sequence verified. The gRNAs were cloned into pCFD3. Around 1 kb long homology arms were amplified with primers CBP HAL-Fw, CBP HAL-Rw, CBP HAR-Fw and CBP HAR-Rw and subcloned in the pJET 1.2 vector by CloneJET PCR blunt end cloning (Thermofisher Scientific K1231). The resulting plasmid was combined with plasmid pJET1.2-STOP-dsRed by Golden Gate assembly using BsmBI to make the final pBS-STOP-dsRed dCBP donor plasmid. The pCFD3 gRNAs (110ng/ul each) and pBS-STOP-dsRed dCBP plasmid (500ng/ul) were injected into w[1118]; PBac{y[+mDint2]=vas-Cas9}VK00027 embryos. Four females with dsRed positive eye expression were recovered and two of these had ends-out targeting of the donor plasmid as determined by PCR. A stock from one of these CBP RMCE flies was injected with a vasa-phiC31 plasmid and attB-flanked 1.4 kb genomic DNA containing exons 9 and 10 with the F2161A substitution. For the attB-dCBP plasmid, primers AmpCBP2step-Fw and AmpCBP2step-Rw were used to amplify genomic DNA and cloned at HindIII and KpnI restriction sites of pABC 2.0. The desired nucleotide changes (TTT to GCC, F2161A) were introduced by site directed mutagenesis with primers SiteD-CBPFw and SiteD-CBPRw. F1 progeny were screened for absence of dsRed, and correct orientation of the genomic DNA after RMCE confirmed by PCR. This CBP HAT stock was balanced with FM7h. To rule out splicing defects by the inserted intronic attR sequences, cDNA was generated and primers CBPForward and CBPRev1 used to amplify the exons which were sequence verified. To ensure that no other lethal mutations were present in the stock, it was crossed to a heat shock CBP transgenic line, and heat shock-induced CBP expression was able to rescue viability. To introduce a FRT sites into this line, we mated CBP HAT /FM7h flies with FRT strain P{w[+mC]=Ubi-mRFP.nls}, w1118, P{ry[+t7.2]=neoFRT}19A (Bloomington #31416) for meiotic recombination. We confirmed successful recombination by PCR detection of the FRT insertion and Sanger sequencing of the F2161A mutation. To obtain homozygous CBP HAT mutant embryos we used the dominant female sterile technique. We crossed CBP HAT FRT /FM7h females with ovoD1 hsFLP FRT (Bloomington #23880) males. Progeny from this cross were heat-shocked at 37°C for 2 h 15 min on days 3, 4, and 5 after egglaying. Embryos were collected on apple juice plates supplemented with fresh yeast and aged at 25°C for specific time ranges dependent on the particular experiment, detailed in the relevant methods section. Hatching rates Embryos were collected on molasses agar plates fitted to embryo collection cages (Genesee Scientific). Following a one-hour pre-lay, the plate was replaced and embryos were collected. 1 hr after egg laying (AEL) embryos were picked from the plate and aligned in the middle of a new plate. More than 24 hours AEL, unhatched embryos were counted and used to calculate the percent embryos viable from each experiment. At least three replicates were performed for each experimental genotype. CRY2 control experiments were laid and aged in the dark. Blue-light treated CBP CRY2 embryo cages were set up in a cardboard box fastened with blue LED light strips for an hour lay. Following the hour, the molasses collection plate was removed and left in the blue-light box for another 2 hours to ensure blue-light inactivation through the MZT. After a total of 3 hours, embryos were aligned on a new plate and left to age for the remainder of the 24 hours in the dark. Western blots Protein lysates were transferred from a polyacrylamide gel (6% for Zld, 8% for tubulin, 15% for histones) to a 0.45µm pore PVDF membrane (Fisher Scientific) for Zld or tubulin, and a 0.2µm nitrocellulose membrane (Pall Life Sciences) for H3K27ac immunoblotting. Transfers to PVDF membranes was done in a 20% methanol, 25mM Tris, 200mM glycine buffer for 75min at 500 mA. Transfer buffer for nitrocellulose membranes was supplemented with 0.375% SDS and transferred for 2 hours at 280 mA. Transfer of CBP was done overnight in 10% methanol, 25 mM Tris, 200 mM glycine buffer with 0.05% Tween 20 at 25V. Membranes were blocked for 30min at room temperature, then incubated overnight with primary Zld 6 (1:750), tubulin (Sigma, 1:5000), H3K27ac (Active motif, 1:1000), CBP 58 (1:250), H3K18ac (Abcam, 1:750), H4 (Abcam 1:1500), or H3 (Abcam 1:1000) antibody at 4°C. Secondary antibodies goat anti-rabbit IgG-HRP (BioRad) and goat anti-mouse IgG-HRP (BioRad) were used at 1:3000 and incubated at 1 hour at room temperature. Activation of the chemiluminescent reaction was stimulated using the SuperSignal West Pico Plus kit (Fisher Scientific) and imaged on film or digitally on the Azure Biosytems 600 imaging system. Fluorescent secondary antibodies used were goat anti-rabbit IRDye 680RD (LI-COR, 1:10000) and goat anti-mouse IRDye 800CW (LI-COR, 1:5000) and were imaged on the Odyssey FC (LI-COR Biosciences) dual-mode imaging system. Immunostaining and confocal microscopy For DAPI staining, embryos were collected on apple juice agar plates supplemented with yeast for two hours and aged for two hour (2-4 hr AEL). The embryos were washed, dechorionated in bleach, and fixed in formaldehyde as previously described 86 . DAPI was used at a concentration of 1 μg/mL. Images were acquired with a Zeiss LSM 780 confocal microscope using a 20x objective. Staining for Pol II was executed as described before 50 . Embryos were dechorionated with bleach, fixed in 4% formaldehyde mixed with heptane for 25 min, blocked for 30 min in 1x normal goat serum, and incubated overnight in anti-RNA Pol II-647 conjugate antibody (Sigma, 1:100). The next day, primary stained embryos were washed 4x with 0.1% PBS with Triton-X100 for 30 mins, and stained with DAPI for 30 mins in 50% glycerol. Finally, embryos were transferred to 75% glycerol and mounted onto a slide for imaging on a Nikon A1R+ confocal. Pol II staining images were taken using a 100x objective at a 4.48 zoom. The 647 images were taken using a laser power of 1 and a line averaging of 2. CBP GFP ;His2av-RFP and CBP deGrad ; His2av-RFP embryos were live imaged on a Nikon A1R+ confocal provided through the University of Wisconsin-Madison Biochemistry Optical Core. Prior to imaging, 2-3hr embryos were dechorionated in 50% bleach for 3min then mounted on a hydrophobic membrane with halocarbon oil. Imaging was done on a 60x objective in which a single plane was used to capture GFP and RFP fluorescence via 488 and 560 lasers, respectively. Processing of images was done in FIJI 87 . ChIP sequencing The ChIP protocol used on fixed embryos in this study was adapted from a published protocol 88 . Embryos were collected 2-3hrs AEL, dechorionated in 50% bleach for 3 min, and followed by a 15min fixation in formaldehyde (.45% formaldehyde for Zld and H3K27ac, 1.8% for CBP GFP ). Two replicates of 1000 stage five embryos per experiment were hand sorted under a dissecting scope to avoid contamination by older embryos. Sorted embryos were homogenized in 1mL of RIPA buffer (50 mM Tris-HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 0.5% sodium deoxycholate, and 150 mM NaCl) and underwent 11 cycles of sonication for 20s at 20% output on full duty cycle. For CBP GFP ChIP, a spike-in of fixed and sonicated H3.3-GFP MEF chromatin was added before removing 5% input. IPs were incubated with 6µg antibody overnight at 4°C and purified using Protein A magnetic beads (Invitrogen). After washing and eluting purified IP, DNA from IPs and inputs were treated with 90µg of RNAseA for 30mins at 37°C and decrosslinked by adding 100µg of Proteinase K overnight at 65°C. DNA was purified using a phenol:chloroform extraction with an overnight ethanol precipitation step to concentrate samples. Libraries for inputs and IPs were prepared using the commercial NEB Next Ultra II kit. ChIP in S2 cells was performed as previously described 16 . 5x10 7 cells were fixed in .8% formaldehyde for 7 min. Fixed chromatin was sonicated on a Covaris S220 for five 120s rounds with 60s delay, peak power at 170, a duty factor of 10%, and 200 cycles per burst. A spike-in of 5% MEF chromatin was added to H3K27ac sonicated chromatin before separating IPs from 5% input. IPs were incubated with antibody at 4°C for 4 hours. IP purification, RNAse treatment, decrosslinking, and DNA concentration was performed identically to the embryo ChIP protocol stated above. All ChIP samples were prepared using the NEB Next Ultra II kit (NEB). Samples were sent to the NUseq Core Facility at Northwestern and sequenced on the Illumina HiSeq or Illumina NextSeq 500 using single end 50bp or 75bp reads, respectively. ChIP-sequencing analysis Reads were aligned to the Drosophila melanogaster genome (dm6) using bowtie2 v2.4.4 89 . Reads mapped to mitochondrial or scaffold DNA, aligned multiple times, or were unmapped were discarded. MACS2 v2.2 was used to call peaks between each IP and its corresponding input 90 . The BEDtools intersectBed function was used to define high confidence peaks present in both replicates 91 . All bigwigs were generated using bamCoverage from deepTools v3.5.1 92 and were z-score normalized by taking the average read count across all bins genome wide and dividing by the standard deviation. IPs for H3K27ac in S2 cells and CBP GFP were spike-in normalized in which a scaling factor was determined by the ratio of percent MEF chromatin aligned in the IPs as compared to input. Imaging of live embryos for single embryo sequencing Collection and processing of single embryo replicates for RNA-seq or ATAC-seq was performed as described previously 15 , 93 . Embryos were collected and washed prior to mounting in halocarbon oil on a glass bottom dish. Real time staging of embryos was possible through the His2av-RFP marker used to measure nuclear density (nuclei/2500µm 2 ). Live imaging was performed on a Nikon Eclipse Ti2 inverted fluorescent microscope. Embryos were processed for ATACseq or RNA-seq exactly 15 min into NC14. For optogenetic experiments, His2Av-RFP and CBP CRY2 ;His2Av-RFP embryos were treated with a repeating sequence of 60s exposure to 470nm filtered light followed immediately by a 10 ms exposure to 555nm. This sequence was initiated upon entry into NC10 and ended 15 min into nuclear-cycle 14. The single embryo was transferred from the imaging disc into 40µL Trizol and pierced with a sterile needle to free RNA into solution. Individual samples were then frozen and stored at -80°C until all replicates were collected and ready for RNA extraction. Embryos for ATAC-seq were immediately processed for tagmentation upon reaching 15 mins into NC14. Bulk mRNA sequencing Bulk embryo collections used for the CBP HAT sequencing were collected at 2h15min -3hr AEL. Three replicates were performed between CBP HAT and wild-type controls. After collection, embryos were dechorionated in bleach and added to Trizol. After chloroform extraction, RNA was purified with RNEasy Mini Elute Clean up Kit (Qiegen). Libraries were prepared with the TrueSeq Stranded mRNA kit and sequenced on a NovaSeq 6000. Single-embryo mRNA sequencing Embryos frozen in Trizol at -80°C were homogenized with a sterile pestle. After, 960µL of Trizol supplemented with 200µg/mL glycogen was added. RNA was extracted, cleaned, and concentrated through ethanol precipitation. Libraries were prepared using the Illumina TrueSeq RNA prep kit V2. And sequenced either on the Illumina HiSeq 4000 using single-end 50bp reads or the NovaSeq X Plus using paired-end 150bp reads. RNA-sequencing analysis Alignment of reads to the Drosophila melanogaster dm6 reference genome was done with HISAT2 v2.1.0 with a mapping quality threshold of ≥ 30 94 . Reads below this threshold were rejected as were reads that mapped to the mitochondrial or scaffold DNA. Aligned reads were annotated to genes using FeatureCounts 2.0 from Subread 95 . Differential analysis between RNA-seq samples was performed using DEseq2 with statistically significance was defined at padj, 0.05 and |log 2 fold change| > 1 96 . Changes in gene expression after blue-light treatment that were not specific to CRY2-mediated inactivation were subtracted out by comparing the log 2 fold change of CBP CRY2 embryos to blue-light treated His2Av-RFP control embryos. Changes in gene expression due to the addition of the CRY2 tag alone to the CBP protein were removed by identifying expression changes in CBP CRY2 dark embryos over His2av-RFP dark controls. Methods of subtracting changes in gene expression not specific to blue-light inactivation has been described at length previously 15 . For CBP HAT the analysis was performed using the nf-core/rnaseq best-practice analysis pipeline (10.5281/zenodo.1400710). ATAC sequencing Staged single embryos were picked and homogenized in 10µL of pre-chilled lysis buffer (10mM Tris pH 7.5, 10mM NaCl, 3mM MgCl 2 , 0.1%NP-40). Embryo homogenate was resuspended by adding an additional 40µL of lysis buffer and spun down at 500g for 10 min at 4°C. The supernatant was removed under a dissecting scope to ensure the small pellet was not disturbed. 2.5µL of water, 2.5µL of Tn5 enzyme, and 5µL of TD buffer (Illumina Tagment DNA Enzyme and Buffer Kit) were added to resuspend the pellet, followed by a 37°C incubation for 30 min. Libraries were prepared using IDT for Illumina Nextera DNA Unique Dual indices, and PCR amplified with NEBNext Hi-Fi 2x PCR Master Mix (72°C for 5min, 98°C for 30s, followed by 12 cycles of 98°C for 10s, 63°C for 30s, and 72°C for 1min). Libraries were DNA purified using magnetic axygen beads and washed with ethanol (Thermo Fisher Scientific). ATAC-seq in S2 cells was carried out similarly, in which 200,000 cells were spun down for 3min at 600g at 4°C, washed with 1X PBS, and resuspended in 100μL lysis buffer. Lysed cell material was pelleted after centrifuging for 10min at 600g at 4°C. The supernatant was replaced with 47.5UL TD buffer and 2.5 Tn5 enzyme (Illumina) and incubated at 37°C for exactly 30min. Libraries were prepared exactly as described above. Sequencing of these ATAC libraries was done at the University of Wisconsin Madison Biotech Center on the NovaSeq6000 with paired-end 150bp reads. ATAC-sequencing analysis ATAC analysis on the other datasets was performed as described previously 16 . Briefly, Adapter sequences were trimmed from reads using NGmerge v0.3 97 . Bowtie2 v2.4.4 89 was used to align trimmed reads to the dm6 reference genome with a mapping quality threshold of ≥ 30. Reads with a poor mapping quality or aligned to mitochondrial or scaffold DNA were thrown out. For analysis, only fragment sizes smaller than 100bp were used. Reads were merged between replicates before using MACS2 v2.2 90 to call peaks. Bigwigs were zscore normalized between experiments and differential analysis was performed using DEseq2 96 with the same parameters described in the RNA-seq analysis description. CUT&RUN CUT&RUN was used to identify H3K27ac deposition in S2 cells using the EpiCypher CUTANA kit and protocol. 2x10 5 cells were extracted and treated with 0.5μL of H3K27ac antibody or an IgG control overnight at 4°C. After immunopurification, libraries were generated using the NEBNext Ultra II library kit (NEB) and sequenced on an Illumina NovaSeq 6000 with150bp paired-end reads. CUT&RUN analysis Reads were trimmed and aligned as described in the ATAC-seq analysis section. Peaks were called on merged replicates using MACS2 v2.2 90 . Bigwigs were z-score normalized as described above. CUT&Tag Embryos were collected for one hour and aged for another two hours (2-3 h AEL). They were then dechorionated, rinsed in embryo wash buffer (PBS, 0.1% Triton X-100), and crude nuclear extracts prepared using a glass douncer in Nuclear Extraction buffer (20 mM HEPES pH 7.9, 10 mM KCl, 0.5 mM spermidine, 0.1% Triton X-100, 20% glycerol with protease inhibitor cocktail (Roche)) 98 and centrifuged at 700g for 10 min at 4°C. The nuclear pellets were resuspended in a Nuclear Extraction buffer and mixed with Drosophila virilis nuclei extracted from 3rd instar larvae (approximately 10% of the total number of nuclei). Nuclei corresponding to at least 100 embryos per reaction were incubated with 25 μl of BioMag®Plus Concanavalin A beads (Polysciences) (prepared in Binding buffer (20 mM HEPES pH 7.5, 10 mM KCl, 1mM CaCl2, and 1 mM MnCl2)) on a nutator for 10 min at 4°C. CUT&Tag was performed according to a published protocol 99 . Nuclei-bead complexes were resuspended in 100 μl antibody buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.05% digitonin, 2 mM EDTA pH 8.0, and 0.1% BSA supplemented with protease inhibitor cocktail (Roche)). Antibodies were added and samples were incubated overnight at 4°C. We used the following antibodies: 1 μl rabbit H3K27ac (Abcam, ab4729), 1 μl rabbit H3K18ac (Abcam, ab1191), 1 μl rabbit H3K9ac (Abcam, ab4441), 1.2 μl rabbit CBP 58 , 1 μl TBP (a kind gift from Jim Kadonaga, UCSD), 1.2 μl rabbit anti-BRD4/fs(1)h (a gift of Renato Paro, kindly provided by Nicola Iovino 100 , 1.2 μl rabbit anti-CycT (a kind gift of Kazuko Hanyu-Nakamura) 101 , rabbit anti-RNA Polymerase II CTD repeat YSPTSPS (phospho-serine 5) (5SerP) (Abcam, ab5131), rabbit anti-RNA Polymerase II CTD repeat YSPTSPS (phospho-serine 2) (2SerP) (Abcam, ab5095). Following overnight incubation, the experimental procedure was followed using guinea pig α-rabbit antibody (Antibodies online cat. no. ABIN101961) secondary antibodies and purified pA-Tn5 (Protein Science Facility, KI, Stockholm). Tagmented DNA was PCR amplified using custom i5 and i7 PCR primers and Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB). PCR conditions were as follows: 72°C for 5 min, 98°C for 30 s, followed by thermocycling (98°C for 10 s and 63°C for 10 s) for 14 cycles and final extension at 72°C for 1 min. Amplified libraries were purified using Agencourt AMPure XP beads (Beckman Coulter) (1.1:1 bead to sample volume ratio). Libraries were paired-end (2 × 37 bp) sequenced on an Illumina NextSeq 2000 platform at the BEA core facility, Karolinska Institutet, Stockholm. CUT&Tag analysis Sequencing data were uploaded to the Galaxy public server usegalaxy.org 102 . CUT&Tag reads with trimmed adapters were mapped to the Drosophila melanogaster (dm6) genome assembly using Bowtie2 (v.2.4.5) in the very sensitive local alignment mode. The unstranded BedGraph spike-in normalized files from individual replicates were generated using the BedTools (v.2.30.0) tool “Genome Coverage” using the default parameters 91 . A spike-in scaling factor was calculated as 10^8/[mapped D. virilis reads]. BedGraph files were converted to bigWig format, and then replicates were merged with the average signal by deepTools tool “bigwigCompare” 92 . CBP peaks were called using MACS2 (v. 2.2.7.1) with the following parameters: --mfold 30, 100 --bw 400 --qvalue 1e-7. CycT and Brd4 peaks were called with the following parameters: --mfold 5,50 --bw 300 --qvalue 0,0001. Precision run-on sequencing (qPRO-seq) A variant of PRO-seq, qPRO-seq was performed on CBP deGrad and CBP CRY2 embryos collected for one hour and aged for a further two hours (2–3 h AEL). Collected embryos were dechorionated in dilute bleach and rinsed thoroughly in embryo wash buffer (PBS, 0.1% Triton X-100) before being flash-frozen in liquid nitrogen and stored at −80°C. qPRO-seq was performed as previously described 103 , 104 . Briefly, embryos were resuspended in cold nuclear extraction buffer A (10 mM Tris-HCl pH 7.5, 300 mM sucrose, 10 mM NaCl, 3 mM CaCl2, 2 mM MgCl2, 0.1% Triton X, 0.5 mM DTT, protease inhibitor cocktail (Roche) and 4 µ/ml RNase inhibitor (SUPERaseIN, Ambion)), transferred to a dounce homogenizer and dounced with the loose pestle for 20 strokes. To remove large debris, the suspension was passed through Miracloth tissue (Merck, 475855-1R) followed by douncing with a tight pestle for 10 strokes. Nuclei were pelleted at 700g for 10 min at 4°C and washed twice in buffer A and once in buffer D (10 mM Tris-HCl pH 8, 25% glycerol, 5mM MgAc2, 0.1 mM EDTA, 0.5 mM DTT). For qPRO-seq, we used 2 million nuclei resuspended in buffer D and stored at −80°C. For further spike-in normalization, they were mixed with Drosophila virilis embryo nuclei (2% of the total number of nuclei). Nuclear run-on assays were performed in biological duplicates exactly as previously described using all four biotinylated dNTPs 103 , 104 . qPRO-seq libraries were sequenced (single-end 1 × 75 bp) on the Illumina NextSeq 2000 platform at the BEA core facility, Karolinska Institutet, Stockholm. qPRO-seq analysis Sequencing data were uploaded to the Galaxy public server usegalaxy.org 102 . qPRO-seq reads were mapped after removing adapters to the Drosophila melanogaster (dm6) genome assembly using Bowtie2 (v.2.4.5) with the very sensitive end-to-end analysis mode 89 . The bam files were deduplicated using UMI, and the strand-separated spike-in normalized BedGraph coverage files from individual replicates were generated using the BedTools (v.2.30.0) tool “Genome Coverage” using the default parameters 91 . Strand-separated BedGraph were converted to bigWig format, and then two replicates of the same strand were merged with the average signal by deepTools tool “bigwigCompare” 92 . To identify genes with differential nascent transcription, we used DEseq2 with estimateSizeFactor provided by user that equals to spike-in scaling factor. DEseq2 compared length-normalized read counts obtained by featureCounts on the bodies of shortest transcripts for each gene (defined as 500 bp downstream of the TSS to 100 bp upstream of the TES). The statistically significant difference was defined as padj 1. Genes in the first quartile by the number of reads mapping to the gene body were removed from the analysis. Genes with normalized counts below 50 for CBP CRY2 samples and 20 for CBP deGrad samples were rejected. To examine Pol II promoter-proximal pausing, the promoter read counts (defined as 50 bp upstream of the TSS to 100 bp downstream of the TSS) were extracted with featureCounts and compared by DEseq2. Acknowledgements We would like to thank Renato Paro, Nicola Iovino, Kazuko Hanyu Nakamura, and Jim Kadonaga for sharing antibodies used in the study. We also thank the Bloomington Drosophila Stock Center and the Drosophila Genome Resource Center for providing reagents and fly lines. We acknowledge the University of Wisconsin-Madison Biochemistry Department Optical Core and Imaging facility at Stockholm University (IFSU) for access to microscopes and the University of Wisconsin-Madison Biotechnology Center, the NUSeq Core Facility, Bioinformatics and Expression Analysis (BEA) core facility at Karolinska Institutet, and SciLifeLab, Stockholm for sequencing. AJM was supported by an NSF graduate research fellowship. Experiments were supported by a NIH R35 GM136298 (MMH), Swedish Research Council, 2022-03650 and Cancerfonden, 23 2959 Pj grants (MM). MMH was also supported by a Vallee Scholar Award. MMH is a Romnes Faculty Fellow and Vilas Faculty Mid-Career Investigator. Footnotes ↵ 6 Lead contact: mharrison3{at}wisc.edu References 1. ↵ Vastenhouw , N.L. , Cao , W.X. , and Lipshitz , H.D . ( 2019 ). The maternal-to-zygotic transition revisited . Development 146 , dev161471. doi: 10.1242/dev.161471 . OpenUrl Abstract / FREE Full Text 2. ↵ Zaret , K.S . ( 2020 ). Pioneer Transcription Factors Initiating Gene Network Changes . Annu Rev Genet 54 , 367 – 385 . doi: 10.1146/annurev-genet-030220-015007 . OpenUrl CrossRef PubMed 3. ↵ Larson , E.D. , Marsh , A.J. , and Harrison , M.M . ( 2021 ). Pioneering the developmental frontier . Mol Cell 81 , 1640 – 1650 . doi: 10.1016/j.molcel.2021.02.020 . OpenUrl CrossRef 4. ↵ Liang , H.L. , Nien , C.Y. , Liu , H.Y. , Metzstein , M.M. , Kirov , N. , and Rushlow , C . ( 2008 ). The zinc-finger protein Zelda is a key activator of the early zygotic genome in Drosophila . Nature 456 , 400 – 403 . nature07388 [pii] doi: 10.1038/nature07388 . OpenUrl CrossRef PubMed Web of Science 5. ↵ Harrison , M.M. , Marsh , A.J. , and Rushlow , C.A . ( 2023 ). Setting the stage for development: the maternal-to-zygotic transition in Drosophila . Genetics 225 , iyad142. doi: 10.1093/genetics/iyad142 . OpenUrl CrossRef 6. ↵ Harrison , M.M. , Botchan , M.R. , and Cline , T.W . ( 2010 ). Grainyhead and Zelda compete for binding to the promoters of the earliest-expressed Drosophila genes . Dev Biol 345 , 248 – 255 . S0012-1606(10)00846-8 [pii] doi: 10.1016/j.ydbio.2010.06.026 . OpenUrl CrossRef PubMed 7. ↵ Nien , C.Y. , Liang , H.L. , Butcher , S. , Sun , Y. , Fu , S. , Gocha , T. , Kirov , N. , Manak , J.R. , and Rushlow , C . ( 2011 ). Temporal coordination of gene networks by Zelda in the early Drosophila embryo . PLoS Genet 7 , e1002339 . doi: 10.1371/journal.pgen.1002339 . OpenUrl CrossRef PubMed 8. ↵ Larson , E.D. , Komori , H. , Fitzpatrick , Z.A. , Krabbenhoft , S.D. , Lee , C.-Y. , and Harrison , M . ( 2022 ). Premature translation of the Drosophila zygotic genome activator Zelda is not sufficient to precociously activate gene expression . G3 (Bethesda) 12 , jkac159 . doi: 10.1093/g3journal/jkac159 . OpenUrl CrossRef 9. ↵ Schulz , K.N. , Bondra , E.R. , Moshe , A. , Villalta , J.E. , Lieb , J.D. , Kaplan , T. , McKay , D.J. , and Harrison , M.M . ( 2015 ). Zelda is differentially required for chromatin accessibility, transcription factor binding, and gene expression in the early Drosophila embryo . Genome Res 25 , 1715 – 1726 . doi: 10.1101/gr.192682.115 . OpenUrl Abstract / FREE Full Text 10. ↵ Sun , Y. , Nien , C.-Y. , Chen , K. , Liu , H.-Y. , Johnston , J. , Zeitlinger , J. , and Rushlow , C . ( 2015 ). Zelda overcomes the high intrinsic nucleosome barrier at enhancers during Drosophila zygotic genome activation . Genome Res 25 , 1703 – 1714 . doi: 10.1101/gr.192542.115 . OpenUrl Abstract / FREE Full Text 11. ↵ Yanez-Cuna , J.O. , Dinh , H.Q. , Kvon , E.Z. , Shlyueva , D. , and Stark , A . ( 2012 ). Uncovering cis-regulatory sequence requirements for context specific transcription factor binding . Genome research 22 , 2018 – 2030 . doi: 10.1101/gr.132811.111 . OpenUrl Abstract / FREE Full Text 12. ↵ Foo , S.M. , Sun , Y. , Lim , B. , Ziukaite , R. , O’Brien , K. , Nien , C.Y. , Kirov , N. , Shvartsman , S.Y. , and Rushlow , C.A . ( 2014 ). Zelda potentiates morphogen activity by increasing chromatin accessibility . Curr Biol 24 , 1341 – 1346 . doi: 10.1016/j.cub.2014.04.032 . OpenUrl CrossRef PubMed 13. ↵ Xu , Z. , Chen , H. , Ling , J. , Yu , D. , Struffi , P. , and Small , S . ( 2014 ). Impacts of the ubiquitous factor Zelda on Bicoid-dependent DNA binding and transcription in Drosophila . Genes Dev 28 , 608 – 621 . doi: 10.1101/gad.234534.113 . OpenUrl Abstract / FREE Full Text 14. ↵ Harrison , M.M. , Li , X.-Y.Y. , Kaplan , T. , Botchan , M.R. , and Eisen , M.B . ( 2011 ). Zelda binding in the early Drosophila melanogaster embryo marks regions subsequently activated at the maternal-to-zygotic transition . PLoS Genet 7 , e1002266 . doi: 10.1371/journal.pgen.1002266 . OpenUrl CrossRef PubMed 15. ↵ McDaniel , S.L. , Gibson , T.J. , Schulz , K.N. , Fernandez Garcia , M. , Nevil , M. , Jain , S.U. , Lewis , P.W. , Zaret , K.S. , and Harrison , M.M . ( 2019 ). Continued Activity of the Pioneer Factor Zelda Is Required to Drive Zygotic Genome Activation . Mol Cell 74 , 185 – 195 .e4. doi: 10.1016/j.molcel.2019.01.014 . OpenUrl CrossRef 16. ↵ Gibson , T.J. , Larson , E.D. , and Harrison , M.M . ( 2024 ). Protein-intrinsic properties and context-dependent effects regulate pioneer factor binding and function . Nat Struct Mol Biol 31 , 548 – 558 . doi: 10.1038/s41594-024-01231-8 . OpenUrl CrossRef 17. ↵ Fernandez Garcia , M. , Moore , C.D. , Schulz , K.N. , Alberto , O. , Donague , G. , Harrison , M.M. , Zhu , H. , and Zaret , K.S. ( 2019 ). Structural Features of Transcription Factors Associating with Nucleosome Binding . Mol Cell 75 , 921 – 932 .e6. doi: 10.1016/j.molcel.2019.06.009 . OpenUrl CrossRef PubMed 18. ↵ Li , X.-Y. , Harrison , M.M. , Villalta , J.E. , Kaplan , T. , and Eisen , M.B . ( 2014 ). Establishment of regions of genomic activity during the Drosophila maternal to zygotic transition . Elife 3 . doi: 10.7554/eLife.03737 . OpenUrl CrossRef PubMed 19. ↵ Hunt , G. , Vaid , R. , Pirogov , S. , Pfab , A. , Ziegenhain , C. , Sandberg , R. , Reimegård , J. , and Mannervik , M . ( 2024 ). Tissue-specific RNA Polymerase II promoter-proximal pause release and burst kinetics in a Drosophila embryonic patterning network . Genome Biol 25 , 2 . doi: 10.1186/s13059-023-03135-0 . OpenUrl CrossRef 20. ↵ Sato , Y. , Hilbert , L. , Oda , H. , Wan , Y. , Heddleston , J.M. , Chew , T.-L. , Zaburdaev , V. , Keller , P. , Lionnet , T. , Vastenhouw , N. , et al. ( 2019 ). Histone H3K27 acetylation precedes active transcription during zebrafish zygotic genome activation as revealed by live-cell analysis . Development 146 , dev179127. doi: 10.1242/dev.179127 . OpenUrl Abstract / FREE Full Text 21. ↵ Chan , S.H. , Tang , Y. , Miao , L. , Darwich-Codore , H. , Vejnar , C.E. , Beaudoin , J.-D. , Musaev , D. , Fernandez , J.P. , Benitez , M.D.J. , Bazzini , A.A. , et al. ( 2019 ). Brd4 and P300 Confer Transcriptional Competency during Zygotic Genome Activation . Dev Cell 49 , 867 – 881 .e8. doi: 10.1016/j.devcel.2019.05.037 . OpenUrl CrossRef 22. ↵ Miao , L. , Tang , Y. , Bonneau , A.R. , Chan , S.H. , Kojima , M.L. , Pownall , M.E. , Vejnar , C.E. , Gao , F. , Krishnaswamy , S. , Hendry , C.E. , et al. ( 2022 ). The landscape of pioneer factor activity reveals the mechanisms of chromatin reprogramming and genome activation . Mol Cell 82 , 986 – 1002 .e9. doi: 10.1016/j.molcel.2022.01.024 . OpenUrl CrossRef 23. ↵ Chen , Y.-J.C. , Koutelou , E. , and Dent , S.Y.R . ( 2022 ). Now open: Evolving insights to the roles of lysine acetylation in chromatin organization and function . Mol Cell 82 , 716 – 727 . doi: 10.1016/j.molcel.2021.12.004 . OpenUrl CrossRef 24. ↵ Brower-Toland , B. , Wacker , D.A. , Fulbright , R.M. , Lis , J.T. , Kraus , W.L. , and Wang , M.D . ( 2005 ). Specific contributions of histone tails and their acetylation to the mechanical stability of nucleosomes . J Mol Biol 346 , 135 – 146 . doi: 10.1016/j.jmb.2004.11.056 . OpenUrl CrossRef PubMed Web of Science 25. ↵ Filippakopoulos , P. , Picaud , S. , Mangos , M. , Keates , T. , Lambert , J.-P. , Barsyte-Lovejoy , D. , Felletar , I. , Volkmer , R. , Müller , S. , Pawson , T. , et al. ( 2012 ). Histone recognition and large-scale structural analysis of the human bromodomain family . Cell 149 , 214 – 231 . doi: 10.1016/j.cell.2012.02.013 . OpenUrl CrossRef PubMed Web of Science 26. ↵ Ludlam , W.H. , Taylor , M.H. , Tanner , K.G. , Denu , J.M. , Goodman , R.H. , and Smolik , S.M . ( 2002 ). The acetyltransferase activity of CBP is required for wingless activation and H4 acetylation in Drosophila melanogaster . Mol Cell Biol 22 , 3832 – 3841 . doi: 10.1128/MCB.22.11.3832-3841.2002 . OpenUrl Abstract / FREE Full Text 27. Tie , F. , Banerjee , R. , Stratton , C.A. , Prasad-Sinha , J. , Stepanik , V. , Zlobin , A. , Diaz , M.O. , Scacheri , P.C. , and Harte , P.J . ( 2009 ). CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing . Development 136 , 3131 – 3141 . doi: 10.1242/dev.037127 . OpenUrl Abstract / FREE Full Text 28. Pasini , D. , Malatesta , M. , Jung , H.R. , Walfridsson , J. , Willer , A. , Olsson , L. , Skotte , J. , Wutz , A. , Porse , B. , Jensen , O.N. , et al. ( 2010 ). Characterization of an antagonistic switch between histone H3 lysine 27 methylation and acetylation in the transcriptional regulation of Polycomb group target genes . Nucleic Acids Res 38 , 4958 – 4969 . doi: 10.1093/nar/gkq244 . OpenUrl CrossRef PubMed Web of Science 29. Jin , Q. , Yu , L. , Wang , L. , Zhang , Z. , Kasper , L.H. , Lee , J. , Wang , C. , Brindle , P.K. , Dent , S.Y.R. , and Ge , K . ( 2011 ). Distinct roles of GCN5/PCAF-mediated H3K9ac and CBP/p300-mediated H3K18/27ac in nuclear receptor transactivation . The EMBO Journal 30 , 249 – 262 . doi: 10.1038/emboj.2010.318 . OpenUrl Abstract / FREE Full Text 30. ↵ Ciabrelli , F. , Rabbani , L. , Cardamone , F. , Zenk , F. , Löser , E. , Schächtle , M.A. , Mazina , M. , Loubiere , V. , and Iovino , N . ( 2023 ). CBP and Gcn5 drive zygotic genome activation independently of their catalytic activity . Sci. Adv . 9 , eadf2687. doi: 10.1126/sciadv.adf2687 . OpenUrl CrossRef 31. Feller , C. , Forné , I. , Imhof , A. , and Becker , P.B . ( 2015 ). Global and specific responses of the histone acetylome to systematic perturbation . Mol Cell 57 , 559 – 571 . doi: 10.1016/j.molcel.2014.12.008 . OpenUrl CrossRef PubMed 32. ↵ Bannister , A.J. , and Kouzarides , T . ( 1996 ). The CBP co-activator is a histone acetyltransferase . Nature 384 , 641 – 643 . doi: 10.1038/384641a0 . OpenUrl CrossRef PubMed Web of Science 33. ↵ Creyghton , M.P. , Cheng , A.W. , Welstead , G.G. , Kooistra , T. , Carey , B.W. , Steine , E.J. , Hanna , J. , Lodato , M.A. , Frampton , G.M. , Sharp , P.A. , et al. ( 2010 ). Histone H3K27ac separates active from poised enhancers and predicts developmental state . Proceedings of the National Academy of Sciences 107 , 21931 – 21936 . doi: 10.1073/pnas.1016071107 . OpenUrl Abstract / FREE Full Text 34. ↵ Heintzman , N.D. , Hon , G.C. , Hawkins , R.D. , Kheradpour , P. , Stark , A. , Harp , L.F. , Ye , Z. , Lee , L.K. , Stuart , R.K. , Ching , C.W. , et al. ( 2009 ). Histone modifications at human enhancers reflect global cell-type-specific gene expression . Nature 459 , 108 – 112 . doi: 10.1038/nature07829 . OpenUrl CrossRef PubMed Web of Science 35. ↵ Thompson , P.R. , Wang , D. , Wang , L. , Fulco , M. , Pediconi , N. , Zhang , D. , An , W. , Ge , Q. , Roeder , R.G. , Wong , J. , et al. ( 2004 ). Regulation of the p300 HAT domain via a novel activation loop . Nat Struct Mol Biol 11 , 308 – 315 . doi: 10.1038/nsmb740 . OpenUrl CrossRef PubMed Web of Science 36. Delvecchio , M. , Gaucher , J. , Aguilar-Gurrieri , C. , Ortega , E. , and Panne , D . ( 2013 ). Structure of the p300 catalytic core and implications for chromatin targeting and HAT regulation . Nat Struct Mol Biol 20 , 1040 – 1046 . doi: 10.1038/nsmb.2642 . OpenUrl CrossRef PubMed Web of Science 37. ↵ Ortega , E. , Rengachari , S. , Ibrahim , Z. , Hoghoughi , N. , Gaucher , J. , Holehouse , A.S. , Khochbin , S. , and Panne , D . ( 2018 ). Transcription factor dimerization activates the p300 acetyltransferase . Nature 562 , 538 – 544 . doi: 10.1038/s41586-018-0621-1 . OpenUrl CrossRef PubMed 38. ↵ Philip , P. , Boija , A. , Vaid , R. , Churcher , A.M. , Meyers , D.J. , Cole , P.A. , Mannervik , M. , and Stenberg , P . ( 2015 ). CBP binding outside of promoters and enhancers in Drosophila melanogaster . Epigenetics Chromatin 8 , 48 . doi: 10.1186/s13072-015-0042-4 . OpenUrl CrossRef 39. ↵ Hunt , G. , Boija , A. , and Mannervik , M . ( 2022 ). p300/CBP sustains Polycomb silencing by non-enzymatic functions . Mol Cell 82 , 3580 – 3597 .e9. doi: 10.1016/j.molcel.2022.09.005 . OpenUrl CrossRef 40. ↵ Akimaru , H. , Hou , D.-X. , and Ishii , S . ( 1997 ). Drosophila CBP is required for dorsal–dependent twist gene expression . Nature Genetics 17 , 211 – 214 . doi: 10.1038/ng1097-211 . OpenUrl CrossRef PubMed Web of Science 41. ↵ Chen , K. , Johnston , J. , Shao , W. , Meier , S. , Staber , C. , and Zeitlinger , J . ( 2013 ). A global change in RNA polymerase II pausing during the Drosophila midblastula transition . eLife 2 , e00861 . doi: 10.7554/eLife.00861 . OpenUrl CrossRef PubMed 42. ↵ Fujinaga , K. , Huang , F. , and Peterlin , B.M . ( 2023 ). P-TEFb: The master regulator of transcription elongation . Mol Cell 83 , 393 – 403 . doi: 10.1016/j.molcel.2022.12.006 . OpenUrl CrossRef 43. ↵ Jonkers , I. , Kwak , H. , and Lis , J.T . ( 2014 ). Genome-wide dynamics of Pol II elongation and its interplay with promoter proximal pausing, chromatin, and exons . Elife 3 , e02407 . doi: 10.7554/eLife.02407 . OpenUrl CrossRef PubMed 44. ↵ Caussinus , E. , Kanca , O. , and Affolter , M . ( 2011 ). Fluorescent fusion protein knockout mediated by anti-GFP nanobody . Nat Struct Mol Biol 19 , 117 – 121 . doi: 10.1038/nsmb.2180 . OpenUrl CrossRef PubMed 45. ↵ Gaskill , M.M. , Gibson , T.J. , Larson , E.D. , and Harrison , M.M . ( 2021 ). GAF is essential for zygotic genome activation and chromatin accessibility in the early Drosophila embryo . Elife 10 . doi: 10.7554/eLife.66668 . OpenUrl CrossRef 46. ↵ Cho , C.-Y. , and O’Farrell , P.H . ( 2023 ). Stepwise modifications of transcriptional hubs link pioneer factor activity to a burst of transcription . Nat Commun 14 , 4848 . doi: 10.1038/s41467-023-40485-6 . OpenUrl CrossRef 47. ↵ Lott , S.E. , Villalta , J.E. , Schroth , G.P. , Luo , S. , Tonkin , L.A. , and Eisen , M.B . ( 2011 ). Noncanonical Compensation of Zygotic X Transcription in Early Drosophila melanogaster Development Revealed through Single-Embryo RNA-Seq . PLoS Biol 9 , e1000590 . doi: 10.1371/journal.pbio.1000590 . OpenUrl CrossRef PubMed 48. ↵ Huang , A. , Amourda , C. , Zhang , S. , Tolwinski , N.S. , and Saunders , T.E . ( 2017 ). Decoding temporal interpretation of the morphogen Bicoid in the early Drosophila embryo . eLife 6 , e26258 . doi: 10.7554/eLife.26258 . OpenUrl CrossRef 49. ↵ Lilja , T. , Aihara , H. , Stabell , M. , Nibu , Y. , and Mannervik , M . ( 2007 ). The acetyltransferase activity of Drosophila CBP is dispensable for regulation of the Dpp pathway in the early embryo . Dev Biol 305 , 650 – 658 . doi: 10.1016/j.ydbio.2007.01.036 . OpenUrl CrossRef PubMed 50. ↵ Huang , S.-K. , Whitney , P.H. , Dutta , S. , Shvartsman , S.Y. , and Rushlow , C.A . ( 2021 ). Spatial organization of transcribing loci during early genome activation in Drosophila . Curr Biol 31 , 5102 – 5110 .e5. doi: 10.1016/j.cub.2021.09.027 . OpenUrl CrossRef 51. ↵ Boija , A. , Mahat , D.B. , Zare , A. , Holmqvist , P.-H. , Philip , P. , Meyers , D.J. , Cole , P.A. , Lis , J.T. , Stenberg , P. , and Mannervik , M . ( 2017 ). CBP Regulates Recruitment and Release of Promoter-Proximal RNA Polymerase II . Mol Cell 68 , 491 – 503 .e5. doi: 10.1016/j.molcel.2017.09.031 . OpenUrl CrossRef 52. ↵ Henriques , T. , Gilchrist , D.A. , Nechaev , S. , Bern , M. , Muse , G.W. , Burkholder , A. , Fargo , D.C. , and Adelman , K . ( 2013 ). Stable pausing by RNA polymerase II provides an opportunity to target and integrate regulatory signals . Mol Cell 52 , 517 – 528 . doi: 10.1016/j.molcel.2013.10.001 . OpenUrl CrossRef PubMed Web of Science 53. Gaub , A. , Sheikh , B.N. , Basilicata , M.F. , Vincent , M. , Nizon , M. , Colson , C. , Bird , M.J. , Bradner , J.E. , Thevenon , J. , Boutros , M. , et al. ( 2020 ). Evolutionary conserved NSL complex/BRD4 axis controls transcription activation via histone acetylation . Nat Commun 11 , 2243 . doi: 10.1038/s41467-020-16103-0 . OpenUrl CrossRef 54. Chang , Y.-L. , King , B. , Lin , S.-C. , Kennison , J.A. , and Huang , D.-H . ( 2007 ). A double-bromodomain protein, FSH-S, activates the homeotic gene ultrabithorax through a critical promoter-proximal region . Mol Cell Biol 27 , 5486 – 5498 . doi: 10.1128/MCB.00692-07 . OpenUrl Abstract / FREE Full Text 55. ↵ Aoi , Y. , and Shilatifard , A . ( 2023 ). Transcriptional elongation control in developmental gene expression, aging, and disease . Mol Cell 83 , 3972 – 3999 . doi: 10.1016/j.molcel.2023.10.004 . OpenUrl CrossRef 56. ↵ Lasko , L.M. , Jakob , C.G. , Edalji , R.P. , Qiu , W. , Montgomery , D. , Digiammarino , E.L. , Hansen , T.M. , Risi , R.M. , Frey , R. , Manaves , V. , et al. ( 2017 ). Discovery of a selective catalytic p300/CBP inhibitor that targets lineage-specific tumours . Nature 550 , 128 – 132 . doi: 10.1038/nature24028 . OpenUrl CrossRef PubMed 57. ↵ Fu , D. , and Ma , J . ( 2005 ). Interplay between positive and negative activities that influence the role of Bicoid in transcription . Nucleic Acids Res 33 , 3985 – 3993 . doi: 10.1093/nar/gki691 . OpenUrl CrossRef PubMed Web of Science 58. ↵ Holmqvist , P.H. , Boija , A. , Philip , P. , Crona , F. , Stenberg , P. , and Mannervik , M . ( 2012 ). Preferential genome targeting of the CBP co-activator by Rel and Smad proteins in early Drosophila melanogaster embryos . PLoS Genet 8 , e1002769 . doi: 10.1371/journal.pgen.1002769 . OpenUrl CrossRef PubMed 59. ↵ Brennan , K.J. , Weilert , M. , Krueger , S. , Pampari , A. , Liu , H.-Y. , Yang , A.W.H. , Morrison , J.A. , Hughes , T.R. , Rushlow , C.A. , Kundaje , A. , et al. ( 2023 ). Chromatin accessibility in the Drosophila embryo is determined by transcription factor pioneering and enhancer activation . Dev Cell 58 , 1898 – 1916 .e9. doi: 10.1016/j.devcel.2023.07.007 . OpenUrl CrossRef 60. ↵ Sungalee , S. , Liu , Y. , Lambuta , R.A. , Katanayeva , N. , Donaldson Collier , M. , Tavernari , D. , Roulland , S. , Ciriello , G. , and Oricchio , E . ( 2021 ). Histone acetylation dynamics modulates chromatin conformation and allele-specific interactions at oncogenic loci . Nat Genet 53 , 650 – 662 . doi: 10.1038/s41588-021-00842-x . OpenUrl CrossRef 61. ↵ Demmerle , J. , Hao , S. , and Cai , D . ( 2023 ). Transcriptional condensates and phase separation: condensing information across scales and mechanisms . Nucleus 14 , 2213551 . doi: 10.1080/19491034.2023.2213551 . OpenUrl CrossRef 62. ↵ Mir , M. , Stadler , M.R. , Ortiz , S.A. , Hannon , C.E. , Harrison , M.M. , Darzacq , X. , and Eisen , M.B . ( 2018 ). Dynamic multifactor hubs interact transiently with sites of active transcription in Drosophila embryos . eLife 7 , e40497 . doi: 10.7554/eLife.40497 . OpenUrl CrossRef 63. ↵ Dufourt , J. , Trullo , A. , Hunter , J. , Fernandez , C. , Lazaro , J. , Dejean , M. , Morales , L. , Nait-Amer , S. , Schulz , K.N. , Harrison , M.M. , et al. ( 2018 ). Temporal control of gene expression by the pioneer factor Zelda through transient interactions in hubs . Nature Communications 9 , 5194 . doi: 10.1038/s41467-018-07613-z . OpenUrl CrossRef PubMed 64. ↵ Chan , H.M ., and La Thangue , N.B . ( 2001 ). p300/CBP proteins: HATs for transcriptional bridges and scaffolds . Journal of Cell Science 114 , 2363 – 2373 . doi: 10.1242/jcs.114.13.2363 . OpenUrl Abstract / FREE Full Text 65. ↵ Kwok , R.P. , Lundblad , J.R. , Chrivia , J.C. , Richards , J.P. , Bächinger , H.P. , Brennan , R.G. , Roberts , S.G. , Green , M.R. , and Goodman , R.H . ( 1994 ). Nuclear protein CBP is a coactivator for the transcription factor CREB . Nature 370 , 223 – 226 . doi: 10.1038/370223a0 . OpenUrl CrossRef PubMed Web of Science 66. Cho , H. , Orphanides , G. , Sun , X. , Yang , X.J. , Ogryzko , V. , Lees , E. , Nakatani , Y. , and Reinberg , D . ( 1998 ). A human RNA polymerase II complex containing factors that modify chromatin structure . Mol Cell Biol 18 , 5355 – 5363 . doi: 10.1128/MCB.18.9.5355 . OpenUrl Abstract / FREE Full Text 67. ↵ Narita , T. , Ito , S. , Higashijima , Y. , Chu , W.K. , Neumann , K. , Walter , J. , Satpathy , S. , Liebner , T. , Hamilton , W.B. , Maskey , E. , et al. ( 2021 ). Enhancers are activated by p300/CBP activity-dependent PIC assembly, RNAPII recruitment, and pause release . Mol Cell 81 , 2166 – 2182 .e6. doi: 10.1016/j.molcel.2021.03.008 . OpenUrl CrossRef 68. ↵ Mitsiou , D.J. , and Stunnenberg , H.G . ( 2003 ). p300 is involved in formation of the TBP-TFIIA-containing basal transcription complex, TAC . EMBO J 22 , 4501 – 4511 . doi: 10.1093/emboj/cdg419 . OpenUrl Abstract / FREE Full Text 69. ↵ Morgan , M.A.J. , and Shilatifard , A . ( 2023 ). Epigenetic moonlighting: Catalytic-independent functions of histone modifiers in regulating transcription . Sci Adv 9 , eadg6593. doi: 10.1126/sciadv.adg6593 . OpenUrl CrossRef 70. ↵ Vaid , R. , Wen , J. , and Mannervik , M . ( 2020 ). Release of promoter-proximal paused Pol II in response to histone deacetylase inhibition . Nucleic Acids Res 48 , 4877 – 4890 . doi: 10.1093/nar/gkaa234 . OpenUrl CrossRef PubMed 71. ↵ Winter , G.E. , Mayer , A. , Buckley , D.L. , Erb , M.A. , Roderick , J.E. , Vittori , S. , Reyes , J.M. , di Iulio , J. , Souza , A. , Ott , C.J ., et al. ( 2017 ). BET Bromodomain Proteins Function as Master Transcription Elongation Factors Independent of CDK9 Recruitment . Mol Cell 67 , 5 – 18 .e19. doi: 10.1016/j.molcel.2017.06.004 . OpenUrl CrossRef PubMed 72. Arnold , M. , Bressin , A. , Jasnovidova , O. , Meierhofer , D. , and Mayer , A . ( 2021 ). A BRD4-mediated elongation control point primes transcribing RNA polymerase II for 3’-processing and termination . Mol Cell 81 , 3589 – 3603 .e13. doi: 10.1016/j.molcel.2021.06.026 . OpenUrl CrossRef 73. ↵ Zheng , B. , Aoi , Y. , Shah , A.P. , Iwanaszko , M. , Das , S. , Rendleman , E.J. , Zha , D. , Khan , N. , Smith , E.R. , and Shilatifard , A . ( 2021 ). Acute perturbation strategies in interrogating RNA polymerase II elongation factor function in gene expression . Genes Dev 35 , 273 – 285 . doi: 10.1101/gad.346106.120 . OpenUrl Abstract / FREE Full Text 74. ↵ Shvedunova , M. , and Akhtar , A . ( 2022 ). Modulation of cellular processes by histone and non-histone protein acetylation . Nat Rev Mol Cell Biol 23 , 329 – 349 . doi: 10.1038/s41580-021-00441-y . OpenUrl CrossRef 75. ↵ Hogg , S.J. , Motorna , O. , Cluse , L.A. , Johanson , T.M. , Coughlan , H.D. , Raviram , R. , Myers , R.M. , Costacurta , M. , Todorovski , I. , Pijpers , L. , et al. ( 2021 ). Targeting histone acetylation dynamics and oncogenic transcription by catalytic P300/CBP inhibition . Mol Cell 81 , 2183 – 2200 .e13. doi: 10.1016/j.molcel.2021.04.015 . OpenUrl CrossRef PubMed 76. ↵ Ribeiro , L. , Tobias-Santos, V., Santos, D., Antunes, F., Feltran, G., de Souza Menezes, J., Aravind, L., Venancio, T.M., and Nunes da Fonseca, R. ( 2017 ). Evolution and multiple roles of the Pancrustacea specific transcription factor zelda in insects . PLOS Genetics 13 , 1 – 25 . doi: 10.1371/journal.pgen.1006868 . OpenUrl CrossRef 77. ↵ Arany , Z. , Sellers , W.R. , Livingston , D.M. , and Eckner , R . ( 1994 ). E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators . Cell 77 , 799 – 800 . doi: 10.1016/0092-8674(94)90127-9 . OpenUrl CrossRef PubMed Web of Science 78. ↵ Bordoli , L. , Netsch , M. , Lüthi , U. , Lutz , W. , and Eckner , R . ( 2001 ). Plant orthologs of p300/CBP: conservation of a core domain in metazoan p300/CBP acetyltransferase-related proteins . Nucleic Acids Research 29 , 589 – 597 . doi: 10.1093/nar/29.3.589 . OpenUrl CrossRef PubMed Web of Science 79. ↵ Lee , M.T. , Bonneau , A.R. , Takacs , C.M. , Bazzini , A.A. , DiVito , K.R. , Fleming , E.S. , and Giraldez , A.J . ( 2013 ). Nanog , Pou 5f 1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition. Nature 503 , 360–364. doi: 10.1038/nature12632 . OpenUrl CrossRef PubMed Web of Science 80. ↵ De Iaco , A. , Planet , E. , Coluccio , A. , Verp , S. , Duc , J. , and Trono , D . ( 2017 ). DUX-family transcription factors regulate zygotic genome activation in placental mammals . Nat Genet 49 , 941 – 945 . doi: 10.1038/ng.3858 . OpenUrl CrossRef PubMed 81. ↵ Hendrickson , P.G. , Doráis , J.A. , Grow , E.J. , Whiddon , J.L. , Lim , J.-W. , Wike , C.L. , Weaver , B.D. , Pflueger , C. , Emery , B.R. , Wilcox , A.L. , et al. ( 2017 ). Conserved roles of mouse DUX and human DUX4 in activating cleavage-stage genes and MERVL/HERVL retrotransposons . Nat Genet 49 , 925 – 934 . doi: 10.1038/ng.3844 . OpenUrl CrossRef PubMed 82. ↵ Choi , S.H. , Gearhart , M.D. , Cui , Z. , Bosnakovski , D. , Kim , M. , Schennum , N. , and Kyba , M . ( 2016 ). DUX4 recruits p300/CBP through its C-terminus and induces global H3K27 acetylation changes . Nucleic Acids Res 44 , 5161 – 5173 . doi: 10.1093/nar/gkw141 . OpenUrl CrossRef PubMed 83. ↵ Wang , M. , Chen , Z. , and Zhang , Y . ( 2022 ). CBP /p300 and HDAC activities regulate H3K27 acetylation dynamics and zygotic genome activation in mouse preimplantation embryos . The EMBO Journal 41 , e112012 . doi: 10.15252/embj.2022112012 . OpenUrl CrossRef 84. ↵ Hamm , D.C. , Larson , E.D. , Nevil , M. , Marshall , K.E. , Bondra , E.R. , and Harrison , M.M . ( 2017 ). A conserved maternal-specific repressive domain in Zelda revealed by Cas9-mediated mutagenesis in Drosophila melanogaster . PLoS Genet 13 , e1007120 . doi: 10.1371/journal.pgen.1007120 . OpenUrl CrossRef 85. ↵ Zhang , X. , Koolhaas , W.H. , and Schnorrer , F . ( 2014 ). A versatile two-step CRISPR- and RMCE-based strategy for efficient genome engineering in Drosophila . G3 (Bethesda) 4 , 2409–2418 . doi: 10.1534/g3.114.013979 . OpenUrl Abstract / FREE Full Text 86. ↵ Haecker , A. , Bergman , M. , Neupert , C. , Moussian , B. , Luschnig , S. , Aebi , M. , and Mannervik , M . ( 2008 ). Wollknäuel is required for embryo patterning and encodes the Drosophila ALG5 UDP-glucose:dolichyl-phosphate glucosyltransferase . Development 135 , 1745 – 1749 . doi: 10.1242/dev.020891 . OpenUrl Abstract / FREE Full Text 87. ↵ Schindelin , J. , Arganda-Carreras , I. , Frise , E. , Kaynig , V. , Longair , M. , Pietzsch , T. , Preibisch , S. , Rueden , C. , Saalfeld , S. , Schmid , B ., et al. ( 2012 ). Fiji: an open-source platform for biological-image analysis. Nat Methods 9 , 676–682 . doi: 10.1038/nmeth.2019 . OpenUrl CrossRef 88. ↵ Blythe , S.A. , and Wieschaus , E.F . ( 2015 ). Zygotic genome activation triggers the DNA replication checkpoint at the midblastula transition . Cell 160 , 1169 – 1181 . doi: 10.1016/j.cell.2015.01.050 . OpenUrl CrossRef PubMed 89. ↵ Langmead , B. , and Salzberg , S.L . ( 2012 ). Fast gapped-read alignment with Bowtie 2 . Nat Methods 9 , 357 – 359 . doi: 10.1038/nmeth.1923 . OpenUrl CrossRef PubMed Web of Science 90. ↵ Zhang , Y. , Liu , T. , Meyer , C.A. , Eeckhoute , J. , Johnson , D.S. , Bernstein , B.E. , Nusbaum , C. , Myers , R.M. , Brown , M. , Li , W. , et al. ( 2008 ). Model-based analysis of ChIP-Seq (MACS) . Genome Biol 9 , R137 . doi: 10.1186/gb-2008-9-9-r137 . OpenUrl CrossRef PubMed 91. ↵ Quinlan , A.R. , and Hall , I.M . ( 2010 ). BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics 26 , 841 – 842 . doi: 10.1093/bioinformatics/btq033 . OpenUrl CrossRef PubMed Web of Science 92. ↵ Ramírez , F. , Ryan , D.P. , Grüning , B. , Bhardwaj , V. , Kilpert , F. , Richter , A.S. , Heyne , S. , Dündar , F. , and Manke , T . ( 2016 ). deepTools2: a next generation web server for deep-sequencing data analysis . Nucleic Acids Res 44 , W160 – 165 . doi: 10.1093/nar/gkw257 . OpenUrl CrossRef PubMed 93. ↵ McDaniel , S.L. , and Harrison , M.M . ( 2019 ). Optogenetic Inactivation of Transcription Factors in the Early Embryo of Drosophila . Bio Protoc 9 , e3296 . doi: 10.21769/BioProtoc.3296 . OpenUrl CrossRef 94. ↵ Kim , D. , Langmead , B. , and Salzberg , S.L . ( 2015 ). HISAT: a fast spliced aligner with low memory requirements . Nature methods 12 , 357 – 360 . doi: 10.1038/nmeth.3317 . OpenUrl CrossRef PubMed 95. ↵ Liao , Y. , Smyth , G.K. , and Shi , W . ( 2014 ). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features . Bioinformatics 30 , 923 – 930 . doi: 10.1093/bioinformatics/btt656 . OpenUrl CrossRef PubMed Web of Science 96. ↵ Love , M.I. , Huber , W. , and Anders , S . ( 2014 ). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biology 15 , 550 . doi: 10.1186/s13059-014-0550-8 . OpenUrl CrossRef PubMed 97. ↵ Gaspar , J.M . ( 2018 ). NGmerge: merging paired-end reads via novel empirically-derived models of sequencing errors . BMC Bioinformatics 19 , 536 . doi: 10.1186/s12859-018-2579-2 . OpenUrl CrossRef PubMed 98. ↵ Hainer , S.J. , and Fazzio , T.G . ( 2019 ). High-Resolution Chromatin Profiling Using CUT&RUN . Curr Protoc Mol Biol 126 , e85 . doi: 10.1002/cpmb.85 . OpenUrl CrossRef PubMed 99. ↵ Kaya-Okur , H.S. , Janssens , D.H. , Henikoff , J.G. , Ahmad , K. , and Henikoff , S . ( 2020 ). Efficient low-cost chromatin profiling with CUT&Tag . Nat Protoc 15 , 3264 – 3283 . doi: 10.1038/s41596-020-0373-x . OpenUrl CrossRef PubMed 100. ↵ Kockmann , T. , Gerstung , M. , Schlumpf , T. , Xhinzhou , Z. , Hess , D. , Beerenwinkel , N. , Beisel , C. , and Paro , R . ( 2013 ). The BET protein FSH functionally interacts with ASH1 to orchestrate global gene activity in Drosophila . Genome Biology 14 , R18 . doi: 10.1186/gb-2013-14-2-r18 . OpenUrl CrossRef PubMed 101. ↵ Hanyu-Nakamura , K. , Sonobe-Nojima , H. , Tanigawa , A. , Lasko , P. , and Nakamura , A . ( 2008 ). Drosophila Pgc protein inhibits P-TEFb recruitment to chromatin in primordial germ cells . Nature 451 , 730 – 733 . doi: 10.1038/nature06498 . OpenUrl CrossRef PubMed Web of Science 102. ↵ The Galaxy Community ( 2024 ). The Galaxy platform for accessible, reproducible, and collaborative data analyses: 2024 update . Nucleic Acids Research 52 , W83 – W94 . doi: 10.1093/nar/gkae410 . OpenUrl CrossRef 103. ↵ Judd , J. , Wojenski , L.A. , Wainman , L.M. , Tippens , N.D. , Rice , E.J. , Dziubek , A. , Villafano , G.J. , Wissink , E.M. , Versluis , P. , Bagepalli , L. , et al. ( 2020 ). A rapid, sensitive, scalable method for Precision Run-On sequencing (PRO-seq) . Preprint at bioRxiv , doi: 10.1101/2020.05.18.102277 . OpenUrl Abstract / FREE Full Text 104. ↵ Kwak , H. , Fuda , N.J. , Core , L.J. , and Lis , J.T . ( 2013 ). Precise maps of RNA polymerase reveal how promoters direct initiation and pausing . Science 339 , 950 – 953 . doi: 10.1126/science.1229386 . OpenUrl Abstract / FREE Full Text Back to top Previous Next Posted October 05, 2024. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Catalytic-dependent and independent functions of the histone acetyltransferase CBP promote pioneer factor-mediated zygotic genome activation Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Catalytic-dependent and independent functions of the histone acetyltransferase CBP promote pioneer factor-mediated zygotic genome activation Audrey J. Marsh , Sergei Pirogov , Abby J. Ruffridge , Suresh Sajwan , Tyler J. Gibson , George Hunt , Yadwinder Kaur , Melissa M. Harrison , Mattias Mannervik bioRxiv 2024.10.04.616638; doi: https://doi.org/10.1101/2024.10.04.616638 Share This Article: Copy Citation Tools Catalytic-dependent and independent functions of the histone acetyltransferase CBP promote pioneer factor-mediated zygotic genome activation Audrey J. Marsh , Sergei Pirogov , Abby J. Ruffridge , Suresh Sajwan , Tyler J. Gibson , George Hunt , Yadwinder Kaur , Melissa M. Harrison , Mattias Mannervik bioRxiv 2024.10.04.616638; doi: https://doi.org/10.1101/2024.10.04.616638 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (8051) Biochemistry (18818) Bioengineering (14943) Bioinformatics (44613) Biophysics (22677) Cancer Biology (19800) Cell Biology (26983) Clinical Trials (138) Developmental Biology (14018) Ecology (21076) Epidemiology (2067) Evolutionary Biology (25514) Genetics (16207) Genomics (23572) Immunology (18766) Microbiology (42664) Molecular Biology (18132) Neuroscience (93788) Paleontology (703) Pathology (2994) Pharmacology and Toxicology (5112) Physiology (8148) Plant Biology (16043) Scientific Communication and Education (2099) Synthetic Biology (4578) Systems Biology (10264) Zoology (2394) window.__CF$cv$params={r:'a41ac870f9c69839',t:'MTc5MDUxNDk4Nw==',u:'01a0e3028cfd729f8bf147acdd43b767',ut:'tBBSCYb2tZLIEtCq9023fETF7_78RJjSMLp3VqMs6Dc-1790514990-1.2.1.1-ycQN7eL6MZNVlPRyP3nKlNmp79Xp1eyVfoBRPshfoXNOdehxK5yb__xTWWfi85ghJEtA5HCi10JJ1e6RrLyTMTFK20SOXOHFF_zKVKSA0BM',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();