Transcriptomic, histological and biochemical analyses of Macrobrachium nipponense response to acute heat stress

Transcriptomic, histological and biochemical analyses of Macrobrachium nipponense response to acute heat stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transcriptomic, histological and biochemical analyses of Macrobrachium nipponense response to acute heat stress Xiao Wu, Yaoran Fan, Keyi Ma, Jiale Li, Jianbin Feng This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2320616/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Temperature is an essential factor affecting the viability of crustaceans, and high temperature can cause damage or even death. The oriental river prawn, Macrobrachium nipponense , is an important economic aquaculture species in China, Japan, and Vietnam. To identify the transcriptomic, histological, and biochemical response of M. nipponense and reveal their adaptation mechanisms, the prawns were placed at 25 ℃, 30 ℃, and 35 ℃ for 24 h. The histological damages in the gills and hepatopancreas of M. nipponense were found under acute heat stress. Additionally, acute heat stress enhanced the digestive, metabolic, and antioxidative capacity of M. nipponense by biochemical analysis. The total RNA of hepatopancreas and gills were isolated and sequenced using the RNA-Seq method. After filtration, assembly, and aggregation, a total of 131690 unigenes were identified. Gene ontology (GO) analysis revealed that differentially expressed genes (DEGs) were significantly involved in the regulation of transcription by RNA polymerase II, proteolysis, nucleus, cytoplasm, nucleus, and ATP binding. In the hepatopancreas, several pathways were significantly enriched in the treatment groups, including neuroactive ligand-receptor interaction, thyroid hormone synthesis, and ECM-receptor interaction. And in the gills, cGMP-PKG signaling pathway, ribosome, and calcium signaling pathway, were enriched. The transcriptomic analysis provided insights into the thermoregulation and molecular mechanisms of M. nipponense in response to acute heat stress. Macrobrachium nipponense Acute heat stress RNA-Seq Histological Biochemical Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Temperature is an essential factor affecting the viability of crustaceans, and high temperature can cause damage or even death (Liu et al. 2013 ). As the global climate has been changing over the last few decades, high temperature has become more frequent. Hence, it is evident that crustaceans suffer more heat stress (Jacox 2019 ). It has been found that when macrobrachium species reach their higher critical thermal limit, they have a higher oxygen consumption rate. Therefore, these prawns can no longer appropriately control their metabolic functions (García-Guerrero et al. 2022 ). Additionally, acute or chronic heat stress can cause a lower reproductive molt rate, embryonic development, and hatching success in Macrobrachium rosenbergii (Mohamad et al. 2018 ). More seriously, heat stress leads to a higher mortality rate in crustaceans, besides the rapid heating rate leads to more deaths (Beladjal et al. 2008 ; Hoang et al. 2020 ). Although specific thermoreceptors have not been identified in crustaceans, studies have found that the peripheral nervous system appears to have maintained thermal sensitivity and adaptation independently of the central nervous system (Lagerspetz and Vainio 2006 ). The oriental river prawn, Macrobrachium nipponense , has become an economic aquaculture species in China, Japan, and Vietnam. (Fan et al. 2022b ). Studies have illustrated that the optimal growth water temperature for M. nipponense is 25 ℃ (Wang et al. 2006 ), and its oxidative stress is minimized at this temperature. M. nipponense , as a poikilotherm, due to its low metabolism and lack of thermoregulatory mechanisms, its body temperature changes with the external temperature (Guschina and Harwood 2006 ). Therefore, M. nipponense require a rapid and effective response to heat stress at the physiological and molecular levels in order to maintain homeostasis (Tan et al. 2019 ). A higher intensity of oxidative stress often accompanies high temperature in the organism. Besides, high temperature can lead to lower antioxidant capacity and reduce the immune response of M. nipponense (Lv et al. 2021 ). Heat stress is a major environmental challenge for prawns in culture, and the hepatopancreas and gills are essential tissues for coping with thermal environment (Sun et al. 2017 ). Despite considerable advances in the study of M. nipponense , relatively few studies have been reported on acute heat stress in M. nipponense , especially at the transcriptomic level. This study aims to determine how heat stress affects the digestion, metabolism, and immune response of M. nipponense . In this study, after M. nipponense was exposed to acute heat stress, the structural alterations of hepatopancreas and gills was investigated by H&E staining of tissue sections. In addition, the activities of antioxidant, digestive, and metabolic enzymes in hepatopancreas were measured to analyze the response of M. nipponense exposed to acute heat stress. Finally, the transcriptomic profile, key regulator genes and enriched pathways were characterized by transcriptomic analysis. Above all, the results of this study will help identify the molecular mechanisms underlying the heat stress adaptation of M. nipponense and contribute to the further understanding of how crustaceans adapt to heat stress on a molecular level. 2. Materials And Methods 2.1 Sample collection and preparation Healthy M. nipponense (average body length 3.5 ± 0.5 cm and body weight 0.75 ± 0.33 g) used in this study were collected from Wuyi county (Zhejiang province, China). The prawns were cultivated at Hangzhou Fishery Research Institution. Before 72 hours of the experiment, the prawns were acclimated in three recirculating aerated water aquariums, in which, the temperature (25 ± 0.5 ℃), pH (7.6 ± 0.3), and dissolved oxygen (6.2 ± 0.3 mg/L) were maintained. In the process of temporal acclimation, M. nipponense was fed commercial pellets twice per day (8:00 am and 7:00 pm). After acclimatization, thirty prawns from each aquarium were collected as the control group (25 ℃). Subsequently, the water temperature was increased by 1.5 ℃ daily from 25 ℃ to 30 ℃. After one day of keeping, thirty prawns from each aquarium were sampled as the 30 ℃ group. The same method was used for the 35 ℃ group. For the following experiments, the gills and hepatopancreas were dissected from M. nipponense of the control (25 ℃) and heat treatment (30 ℃ and 35 ℃) groups after anesthesia in ice, and immediately frozen in liquid nitrogen. 2.2 Histological analysis of hepatopancreas and gills in M. nipponense exposed to acute heat stress The hepatopancreas and gills of M. nipponense were fixed in 4% paraformaldehyde solution for 24 hours and then transferred to 70% ethanol for histological analysis. The samples were then embedded in paraffin after being dehydrated in a graded ethanol series. Eventually, using a manual rotary microtome, each piece was cut into six 4–5 µm thick sections. After staining with H&E, sections were viewed under a light microscope (Leica, DM3000). 2.3 Biochemical analysis of hepatopancreas in M. nipponense under acute heat stress To study the effects of acute heat stress on the biochemistry of M. nipponense , three digestive enzymes (amylase; trypsin, and lipase), three metabolism-related enzymes (glycogen, GLU; triglyceride, TG; and total cholesterol, TCHO), and six immune-related enzymes (malondialdehyde, MDA; glutathione S-transferase, GST; total superoxide dismutase, T-SOD; catalase, CAT; glutathione peroxidase, GPX; and glutathione, GSH) were measured using commercially available kits (Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s protocols. The measurements were performed using a Microplate reader (BIOTEK, Synergy H1). All experiments were conducted in three biological replicates and three technical replicates. 2.4 RNA Isolation, Library Construction, and Sequencing Total RNA was extracted from the heat treatment and control groups in M. nipponense , respectively. The RNeasy Plus Mini Kit (Qiagen) was used following the manufacturer's instructions. The NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) was used to assess the RNA purity and quantification. The integrity of the RNA in the samples was evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). In order to analyze the mRNA expression profiles in the gills and hepatopancreas, the RNA sequencing (RNA-Seq) was conducted by OE Biotech Co., Ltd. (Shanghai, China). In brief, the mRNA obtained after purification was fragmented and replicated into first-strand cDNA using random primers and reverse transcriptase, and then the second-strand cDNA was synthesized. A poly (A)-tail was attached to the sequencing linker after the double-stranded cDNA was purified and subjected to 3-end repair, followed by the PCR amplification was carried out. Lastly, 150 base pair (bp) double-end reads were generated from the library using the Illumina HiSeq 2000 sequencer. 2.5 De novo assembly and data analysis Initially, raw reads (FASTQ) were filtered using Trimmomatic (version 0.36) (Bolger et al. 2014 ), and then the transcripts were obtained from filtered clean readings using Trinity (version 2.4) (Grabherr et al. 2011 ). Subsequently, the transcripts were aggregated into unigenes by Corset software (Davidson and Oshlack 2014 ), and the unigene sequences was annotated using five databases, including the NCBI non-redundant protein sequences (NR), the NCBI non-redundant nucleotide sequences (NT), the Protein Family (Pfam) database, the Gene Ontology (GO) database, and the Kyoto Encyclopedia of Genes and Genomes (KEGG). After mapping clean reads to the reference unigene set, the read number of gene expression in each sample was calculated using RSEM software (Li and Dewey 2011 ), and the FPKM (fragments per kilobase of transcript sequence per millions of base pairs sequenced)(Trapnell et al. 2010 ) was used to calculate gene expression level. Finally, the differentially expressed genes (DEGs) were detected in gills and hepatopancreas between the control and two heat treatment groups using the DESeq2 R package (Love et al. 2014 ). The P-value computing model was used to conduct the hypothesis test, and Padj was introduced to correct the P-value (Storey et al. 2003 ). To screen for DEGs based on the screening criteria, the p 2 or > 0.5 were used. All DEGs were enriched by GO enrichment and KEGG pathways analyses using R packages(Wickham 2011 ) based on hypergeometric distributions, respectively. 2.6 Transcriptomic validation using Quantitative Real-time PCR (qRT-PCR) To validate the results of RNA-Seq analysis, 12 DEGs from gills and hepatopancreas were screened for real-time PCR expression analysis. The qRT-PCR was conducted in the CFX96TM Real-time PCR Detection System with the SYBR Green Master Mix (TaKaRa, Shanghai, China). The RNA used for qPCR was the same as RNA-Seq. Thereafter, cDNA was synthesized using PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa, Shanghai, China), according to the manufacturer's instructions. The 20 µL reaction system (6.8µl of RNase-free water, 1.6 µl of cDNA, 0.8 µl each of forward and reverse primers, and 10 µl of SYBR Green Master Mix) was applied. The expression level of each gene was normalized towards the reference gene (β-actin) (Table 1 ). The relative gene expression was calculated, according to the 2 −ΔΔCt method (Rao et al. 2013 ). Ultimately, the data were recorded as the mean ± standard deviation of three replicates. A one-way analysis of variance was used to analyze all data ( p < 0.05). Table 1 Primers used to verify transcriptomic data. Gene name Gene ID Primers (5’-3’) Ubiquitin comp262984_c0_seq1 F: AGCGCGTGAATAGCCAAGAT R: AGAAAGTGTGCGACCGTCTT TMEM47 comp257850_c1_seq14 F: AGCGCTTTCATCGTCAGACT R: TGACATCCGACTTCAGCGTT Myosin comp218951_c0_seq1 F: AGGTAAGCACCGACTCGAAA R: AAACGGAAGGTCGTCAGTCA Actin comp190010_c0_seq2 F: TCGTTGCCGATCGTGATGACTT R: CCCTCGACTTTGACGAGGAAAT Hemoglobin comp255933_c1_seq3 F: GTTGCGTGACAGCAAAACCT R: TTTCATTTGGCATGTCGGCG CYP450 comp242293_c0_seq1 F: AGAAGCGATCATGGTCGAAGA R: TGCCATTTGTGGGGAGAAGA RPS11 comp262825_c4_seq1 F: TTGCCTTGTCCTGAGCCAAT R: GCCCAATGCGACAACACATA ATP7A comp263787_c0_seq3 F: ACACGCCTTCGTCCACATTA R: TATGGCGTTGAACCTGGCTT ATP1A1 comp260570_c1_seq2 F: AGTGTCGACCAACAAACGCT R: TCCTTCGTTGTCGTCTGCTT Peroxidase comp110980_c0_seq2 F: ATTGACACGGTCGTTGAATGC R: ACAATGGACAAAGGCGTTGA Lqf comp258001_c0_seq1 F: GCATCTTTGCACTTCACGCA R: ATTACTCGTCGCTTCACGCA RNF comp259432_c0_seq12 F: TGGAAAACGGGCGCTTCATA R: TCGCGTCTTCGTGCTTGATA β-actin F: GTGCCCATCTACGAGGGTTA R: CGTCAGGGAGCTCGTAAGAC 3. Results 3.1 Histological analysis of M. nipponense exposed to acute heat stress Morphological differences of the gills and hepatopancreas of M. nipponense in three heat stress gradients (25 ℃, 30 ℃, and 35 ℃) were identified by histological analysis. In the 30 ℃ and 35 ℃ groups, the hepatopancreatic cells of M. nipponense showed atrophy, localized vacuolation in the middle, and disorderly arrangement. Besides, partial cells of the hepatopancreas in the 35 ℃ group expressed necrosis (Fig. 1 A, B, and C). In the 30 ℃ and 35 ℃ groups, the gills structure of M. nipponense had enlarged blood cavities, slightly curved lamellar epithelium, increased and disorganized blood cells, and even lesions at the terminal site of gills in the 35 ℃ group (Fig. 1 D, E, and F). 3.2 Biochemical analysis of hepatopancreas in M. nipponense exposed to acute heat stress 3.2.1 Digestive enzyme activities in hepatopancreas exposed to acute heat stress To elucidate the activities of digestive enzymes under different heat gradients, amylase, trypsin, and lipase were applied in this study. It was obvious that there was a significant difference between the control and two heat groups for amylase ( p < 0.05). However, no significant change was indicated between the 30 ℃ and 35 ℃ groups (Fig. 2 A). Besides, trypsin activity did not illustrate a significant difference between the control and 30 ℃ groups. Then the trypsin activity reached a maximum in the 35 ℃ group ( p < 0.05) (Fig. 2 B). Eventually, lipase activity was significantly different only between the control and 35 ℃ group ( p < 0.05) (Fig. 2 C). 3.2.2 Metabolic enzyme contents in hepatopancreas exposed to acute heat stress To determine the antioxidant system alternation, the content of GLU, TCHO, and TG was calculated. The TCHO content was first decreased at 30 ℃ and then increased at 35 ℃ ( p < 0.05) (Fig. 3 A). Furthermore, the GLU activity kept increasing from 25 ℃ to 35 ℃ ( p < 0.05) (Fig. 3 B). Eventually, the TG content increased significantly only at 35 ℃. Nevertheless, there was no change at 30 ℃ ( p < 0.05) (Fig. 3 C). 3.2.3 Immune-related enzyme activities in hepatopancreas exposed to acute heat stress To explore the immune system of the M. nipponense , the activities of T-SOD, CAT, GPX, and GST, as well as the content of MDA, and GSH were calculated. The T-SOD, CAT, GPX, and GST activities increased with the heat rise ( p < 0.05) (Fig. 4 A, B, D, and F). On the contrary, MDA content decreased with the increase in temperature ( p < 0.05) (Fig. 4 C). Finally, the difference in GSH content was insignificant between the control and 30 ℃ groups, then increased in 35 ℃ group ( p < 0.05) (Fig. 4 E). 3.3 Data analysis of transcriptomic sequencing based on statistics RNA-Seq was performed on gills and hepatopancreas from the heat treatment and control groups. After this, 47.65 million 150 bp paired-end reads were generated in gills, and 41.71 million 150 bp paired-end reads were generated in hepatopancreas. After trimming, 42.22 million clean reads in gills and 38.61 million quality reads in hepatopancreas were obtained for further analysis. The mean of Q30 percentage and GC content for the entire data set were 87.30% and 44.64%, respectively (Table 2 ). A total of 131690 unigenes were identified, among which 31944 (24.26%), 40734 (30.93%), 31550 (23.96%), 31478 (23.90%), and 34074 (25.87%) unigenes were found to be homologous to the sequences in the Nr, Nt, Pfam, GO, and KEGG databases, respectively. Additionally, 22737 unigenes were matched with all databases (Table 3 ). Table 2 Illumination expressed short reads generation and trimming. Sample Group Number of raw reads, million Number of clean reads, million Q30, % GC content, % Gills 25 ℃ 15.45 13.66 91.77 44.74 30 ℃ 16.69 14.62 90.34 45.23 35 ℃ 15.51 13.94 88.02 45.56 Hepatopancreas 25 ℃ 14.92 13.26 91.31 44.23 30 ℃ 13.17 12.51 89.10 44.53 35 ℃ 13.62 12.84 89.83 44.73 Term Unigene All 131690 N50 1303 Average length 691.20 Table 3 Summary of annotation results for M. nipponense . Databases used: Nr: Nt; Pfam: GO; KEGG. Databases Nr Nt Pfam GO KEGG Numbers of unigenes 31944 40734 31550 31478 34074 Percentage of unigenes (%) 24.26 30.93 23.96 23.90 25.87 Numbers of unigenes matched with all database 22737 3.4 DEGs analysis of hepatopancreas and gills in response to acute heat stress To investigate the gene expression pattern, the number of unigenes from the two heat treatment groups (30 ℃ and 35 ℃) was compared with the control group (25 ℃), respectively. In the hepatopancreas, 1320 DEGs (939 up- and 381 down-regulated) in the 30 ℃ group and 1984 DEGs (911 up- and 1073 down-regulated) in the 35 ℃ group were identified (FC > 2 or < 0.5, p 2 or < 0.5, p < 0.05). Most of the DEGs in the hepatopancreas were associated with transcription, energy supply, and immunity, such as translation initiation factor, NADH dehydrogenase, and heat shock protein. In the gills, 1538 DEGs (900 up- and 638 down-regulated) in the 30 ℃ group and 755 DEGs (584 up- and 171 down-regulated) in the 35 ℃ were identified (FC > 2 or < 0.5, p 2 or < 0.5, p < 0.05) (Table 4 ). The majority of DEGs in gills were linked to ion exchange and antioxidants, like myosin, actin, and glycine receptor. Table 4 Number of DEGs between the 25 ℃, 30 ℃, and 35 ℃ groups under acute heat stress. Gills Hepatopancreas 30 ℃ VS 25 ℃ 35 ℃ VS 25 ℃ 35 ℃ VS 30 ℃ 30 ℃ VS 25 ℃ 35 ℃ VS 25 ℃ 35 ℃ VS 30 ℃ Number of up-regulated genes 900 584 225 939 911 457 Number of down-regulated genes 638 171 132 381 1073 665 Subtotal 1538 755 357 1320 1984 1122 3.5 GO enrichment and KEGG pathways analyses based on DEGs To understand the impact of acute heat stress on the antioxidant and metabolic systems of M. nipponense , the DEGs were further analyzed by Gene ontology (GO) term enrichment analysis for potential functions. The results illustrated that the primary significant biological processes of DEGs were similar in gills and hepatopancreas under acute heat stress. These GO terms involved nucleus (GO:0005634), cytoplasm (GO:0005737), regulation of transcription by RNA polymerase II (GO:0006357), proteolysis (GO:0006508), nucleus (GO:0005634), and ATP binding (GO:0005524) (Fig. 5 ). The top 20 enriched pathways identified by mapping DEGs to the KEGG database were used to identify molecular networks in cells and variants specific to tissues. Compared with the control group of hepatopancreas, six pathways were significantly enriched in the two heat treatment groups, including neuroactive ligand-receptor interaction (ko04080), thyroid hormone synthesis (ko04918), ECM-receptor interaction (ko04512), complement and coagulation cascades (ko04610), inositol phosphate metabolism (ko00562), and signaling pathways regulating pluripotency of stem cells (ko04550). In addition, four KEGG pathways were enriched in gills, including cGMP-PKG signaling pathway (ko04022), ribosome (ko03010), calcium signaling pathway (ko04020), and adrenergic signaling in cardiomyocytes (ko0461) (Fig. 6 ). 3.6 Validation of transcriptomic data via qRT-PCR Six cDNA templates from the hepatopancreas and gills were used for qRT-PCR experiments in order to validate the transcriptomic data. Randomly selected 12 DEGs were included in the treatment to ensure compliance with the strict requirement. Based on the results of the qRT-PCR and the transcriptomic analysis, the expression trends of the 12 candidate DEGs were consistent, indicating a high degree of credibility for the transcriptomic data (Fig. 7 ). 4. Discussion High temperature can cause an increase in the rate of oxygen consumption, which will lead to excessive production of reactive oxygen species (ROS) in aquatic animals triggering oxidative stress (Sun et al. 2015 ). Heat tolerance is a characteristic of most crustaceans, and they can live within a certain range of temperatures. It has been shown that when crustaceans are subjected to acute heat stress, the antioxidant system of their bodies activates to eliminate reactive oxygen species (Sun et al. 2018 ). In spite of this, exceeding the controllable range of heat resistance may result in oxidative damage and even death. In recent years, understanding the mechanisms of thermal regulation found in crustaceans has attracted increased attention. Despite numerous studies examining the molecular mechanisms of heat adaptation, limited evidence is available to explain how acute heat stress influences the gills and hepatopancreas of crustaceans. The hepatopancreas is a vital metabolic and digestive organ of crustaceans (Wang et al. 2022 ). The changes in hepatopancreatic structure are significantly related to discrepancies in physiological status (Liu et al. 2021 ). As the breathing organ of crustaceans, the gills are in direct contact with the external environment (Bechmann et al. 2019 ). The histological analysis of M. nipponense under acute heat stress indicated that acute heat stress caused damage to the gills and hepatopancreas of M. nipponense . In the gills, structural damage affected the normal physiological function of prawns and reduced the gas exchange capacity, thus causing oxidative damage to the tissues. In the hepatopancreas, there were mainly blister-like cell (B cell) for secretion, digestion, and absorption, as well as resorptive cell (R cell) for storage of nutrients (Al-Mohanna and Nott 1986 ). In this study, the number of B cell was significantly higher in the 35 ℃ group, indicating that high temperature had little effect on B cell in the hepatopancreas. Hence, the 35 ℃ might lead to a stronger digestion and absorption capacity of M. nipponense to maintain growth requirements. In this study, digestive enzyme activities (trypsin, amylase, and lipase) were measured, directly reflecting the ability to digest and absorb nutrients in the hepatopancreas of M. nipponense . The high activity of the three digestive enzymes in the heat treatment groups suggested that the M. nipponense activated a higher digestion level to provide more energy to defend against acute heat stress. Antioxidant enzymes T-SOD, CAT, GPX, GST, and GSH can assist in eliminating ROS and reduce the damage produced by oxidative stress (Xiang et al. 2011 ; Fan et al. 2022a ). T-SOD is responsible for converting toxic O 2- produced by the body into H 2 O 2 , which continues to be metabolized by CAT into non-toxic H 2 O, and GPX catalyzes hydrogen peroxide substances. Besides, GST has a role in scavenging lipid peroxides produced by the metabolism of the shrimp organism (Arockiaraj et al. 2014 ). Additionally, MDA is the main product of lipid peroxidation (Kumar et al. 2022 ). In this study, T-SOD activities only in the 35 ℃ groups were significantly higher than in the control group (Fig. 3 A). In addition, all the other enzyme activities were significantly different in the 30 ℃ and 35 ℃ groups from the control group (Fig. 3 B, C, D, E, and F). This illustrated that M. nipponense was activated with a high antioxidant capacity to cope with oxidative stress at 35 ℃. In terms of metabolism, GLU, TG, and TCHO activities were all significantly higher at 35 ℃ than at 25 ℃ (Fig. 2 ). This indicated that the metabolic capacity of M. nipponense was considerably enhanced at 35 ℃. Through RNA-Seq analysis, several heat-related genes, including heat shock proteins (HSPs) and cytochrome P450 (CYP450), also play a crucial role for heat tolerance in M. nipponense . After the discovery of HSPs, increasing functions were attached to HSPs, such as molecular chaperones in protein folding and unfolding (Fan et al. 2022c ), and managing the transcription machinery (Cui et al. 2014 ). In this study, both HSP70 and HSP90 were significantly induced in the 35 ℃ group which illustrated that when exposed to acute heat stress, the higher expression of HSPs assisted the M. nipponense in relieving the damage caused by acute heat stress (Fig. 8 ). The results were found identical in the study of Scylla paramamosain (Liu et al. 2018 ). On the other hand, the functions of CYP450 were through the monooxygenase pathway for thermoregulation (Burkina et al. 2012 ). In this study, the expression of CYP2 and CYP2E1 was up-regulated at 30 ℃. However, the CYP3 expression was up-regulated, and CYP2 was down-regulated at 35 ℃ (Fig. 9 ). These results indicated that CYP2 and CYP2E1 were active at 30 ℃. In comparison, CYP3A was functioning at 35 ℃ when M. nipponense was exposed to acute heat stress. To further understand the molecular response of M. nipponense exposed to acute heat stress, the GO classification and KEGG enrichment analyses were applied. GO classification can define the characteristics of genes and their products (Lena et al. 2015 ). In addition, KEGG is a database resource for understanding the high-level functions and utilities of a biological system (Minoru et al. 2004 ). In this study, several GO enrichment terms and enchried KEGG pathways associated with acute heat stress were identified in the gills and hepatopancreas of M. nipponense by RNA-Seq analysis. The results showed that the GO enrichment terms of gills and hepatopancreas were not entirely the same in the 30 ℃ and 35 ℃ groups, however the main GO enrichment terms were highly similar (Fig. 5 ). These DEGs were significantly enriched in the regulation of transcription by RNA polymerase II, proteolysis, cytoplasm, nucleus, metal ion binding, and ATP binding. Proteolysis plays an essential role in crustaceans, such as providing amino acids to the body, assisting in the production of active proteins, regulating physiological and cellular processes, and preventing the accumulation of unnecessary or abnormal proteins in cells (Triebel et al. 2022 ). Metal ion binding is involved in transporting oxygen and improving the immunity of the body (Shrivastava et al. 2017 ). Therefore, it can be speculated that the enrichments of metal ion binding and ATP binding may be attributed to the expansion of ion exchange channels in the gills and hepatopancreas of M. nipponense exposed to acute heat stress. Furthermore, the KEGG enrichment analysis revealed that the pathways enriched in the hepatopancreas and gills were mostly different. The pathways significantly enriched in the hepatopancreas at 30 ℃ and 35 ℃ were neuroactive ligand-receptor interaction, thyroid hormone synthesis, ECM-receptor interaction, complement and coagulation cascades, inositol phosphate metabolism, and signaling pathways regulating pluripotency of stem cells. The neuroactive ligand-receptor interaction pathway contains several genes predicted to be associated with heat tolerance (Cheruiyot et al. 2021 ). The synthesis of thyroid hormones promotes the metabolic level of the organism to help combat heat stress (Ross et al. 2022 ). The extracellular matrix (ECM) affects ROS synthesis through integrins (Mlih and Karpac 2022 ). The enrichment of these pathways also demonstrated that the hepatopancreas enables M. nipponense adapt to acute heat stress mainly through metabolic function and reducing ROS. In addition, four KEGG pathways were enriched in gills, including cGMP-PKG signaling pathway, ribosome, calcium signaling pathway, and adrenergic signaling in cardiomyocytes. Cyclic guanosine monophosphate (cGMP) is usually involved in opening cell membrane ion channels and glycogenolysis (Zhou et al. 2021 ). Calcium ions can reduce ROS (hydrogen peroxide and the oxide ion) and thus shield the organism from heat stress (Carreras-Sureda et al. 2018 ). This shows that the gills are mainly used to protect M. nipponense from oxidative stress through ion exchange channels and scavenging of ROS. Although the gills and hepatopancreas enable M. nipponense to cope with acute heat stress in various ways, they both play a significant role in the regulation process. 5. Conclusions The thermoregulation of crustaceans is a complex physiological process. This study performed histological, biochemical, and transcriptomic analyses of M. nipponense exposed to acute heat stress. The histological analysis results indicated that acute heat stress could damage the structure of the hepatopancreas and gills in M. nipponense . Besides, the biochemical analysis results illustrated that acute heat stress activates the capacity of digestion, antioxidant, and metabolism of M. nipponense . Ultimately, the transcriptomic results demonstrated that the M. nipponense exposed to acute heat stress was regulated by the energy metabolism, ion exchange, and immune response to acclimate to the altered environment. In conclusion, histological, biochemical, and transcriptomic analyses provide insights into the thermoregulation and molecular mechanisms of M. nipponense under acute heat stress. Declarations Availability of data and materials The data that support the results of this study are available from the corresponding author upon reasonable request. Competing Interests The authors declare that they have no competing interests. Funding This work was supported by the Innovation Action Plan Project of the Science and Technology Commission of Shanghai Municipality (19391900900, 21002410500). Authors’ Contributions Jianbin Feng and Jiale Li conceived the project and provided funding acquisition and paper revision. Xiao Wu and Yaoran Fan sampled the species, performed a formal analysis, and collected the specimens and performed the experiments. Xiao Wu performed bioinformatics work, paper writing, revision, and editing. Jianbin Feng and Keyi Ma critically evaluated and approved the article. Ethics approval M. nipponense is neither an endangered species in China nor in other countries. During this study, all experimental procedures involving prawns were conducted following the approval of the care and utilization of animals for scientific purposes set up by the Institutional Animal Care and the Use Committee (IACUS) of Shanghai Ocean University, Shanghai, China. The prawns were sedated with ice before removing the tissue samples under ARRIVE guidance. References Al-Mohanna SY, Nott JA (1986) B-cells and digestion in the hepatopancreas of penaeus semisulcatus (Crustacea: Decapoda). J Mar Biol Association United Kingd 66:403–414. https://doi.org/10.1017/S0025315400043034 Arockiaraj J, Gnanam AJ, Palanisamy R et al (2014) A cytosolic glutathione s-transferase, GST-theta from freshwater prawn Macrobrachium rosenbergii : molecular and biochemical properties. Gene 546:437–442. https://doi.org/10.1016/j.gene.2014.05.063 Bechmann RK, Arnberg M, Gomiero A et al (2019) Gill damage and delayed mortality of Northern shrimp ( Pandalus borealis ) after short time exposure to anti-parasitic veterinary medicine containing hydrogen peroxide. Ecotoxicol Environ Saf 180:473–482. https://doi.org/10.1016/j.ecoenv.2019.05.045 Beladjal L, Mertens J, Clegg JS (2008) Biochemical and biophysical aspects of the tolerance of anhydrobiotic crustacean embryos to very high temperatures. J Therm Biol 33:117–127. https://doi.org/10.1016/j.jtherbio.2007.11.003 Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: A flexible read trimming tool for Illumina NGS data. Bioinformatics 30:2114–2120. https://doi.org/10.1093/bioinformatics/btu170 Burkina V, Zamaratskaia G, Randak T et al (2012) Verapamil does not modify catalytic activity of CYP450 in rainbow trout after long-term exposure. Ecotoxicol Environ Saf 79:148–152. https://doi.org/https://doi.org/10.1016/j.ecoenv.2011.12.012 Carreras-Sureda A, Pihán P, Hetz C (2018) Calcium signaling at the endoplasmic reticulum: fine-tuning stress responses. Cell Calcium 70:24–31. https://doi.org/10.1016/j.ceca.2017.08.004 Cheruiyot EK, Haile-Mariam M, Cocks BG et al (2021) New loci and neuronal pathways for resilience to heat stress in cattle. Sci Rep 11:16619. https://doi.org/10.1038/s41598-021-95816-8 Cui Y, Liu B, Xie J et al (2014) Effect of enrofloxacin and emodin on heat-shock proteins’ expression in hepatic cells of grass carp ( Ctenopharyngodon idellus ). Aquacult Int 22:1067–1077. https://doi.org/10.1007/s10499-013-9727-5 Davidson NM, Oshlack A (2014) Corset: enabling differential gene expression analysis for de novo assembled transcriptomes. Genome Biol 15:410. https://doi.org/10.1186/s13059-014-0410-6 Fan W, Yang P, Qiao Y et al (2022a) Polystyrene nanoplastics decrease molting and induce oxidative stress in adult Macrobrachium nipponense . Fish Shellfish Immunol 122:419–425. https://doi.org/10.1016/j.fsi.2022.02.028 Fan Y, Feng J, Wang Z et al (2022b) Integrated transcriptomic and metabolic analysis response in gills, hepatopancreas, and muscle metabolism in oriental river prawn Macrobrachium nipponense in response to acute high salinity stress. Aquac Rep 27:101358. https://doi.org/10.1016/j.aqrep.2022.101358 Fan Y, Feng J, Xie N et al (2022c) RNA-seq Provides Novel Insights into Response to Acute Salinity Stress in Oriental River Prawn Macrobrachium nipponense . Mar Biotechnol 24:820–829. https://doi.org/10.1007/s10126-022-10151-x García-Guerrero M, Avilés-Espinoza N, Lizarraga-Sanchez G et al (2022) Maximum critical temperature and oxygen consumption during thermoregulation in Macrobrachium americanum (Bate, 1868) adult prawns. Lat Am J Aquat Res 50:301–309. https://doi.org/10.3856/vol50-issue2-fulltext-2824 Grabherr MG, Haas BJ, Yassour M et al (2011) Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 29:644–652. https://doi.org/10.1038/nbt.1883 Guschina IA, Harwood JL (2006) Mechanisms of temperature adaptation in poikilotherms. FEBS Lett 580:5477–5483. https://doi.org/10.1016/j.febslet.2006.06.066 Hoang T, Bui THH, Ho HC, Le NPT (2020) Thermal challenge of the Indian shrimp Penaeus indicus . Aquac Res 51:1480–1486. https://doi.org/10.1111/are.14493 Jacox MG (2019) Marine heatwaves in a changing climate. Nature 571:485–487. https://doi.org/10.1038/d41586-019-02196-1 Kumar M, Gupta G, Muhammed NP et al (2022) Toxicity ameliorative effect of vitamin E against super-paramagnetic iron oxide nanoparticles on haemato-immunological responses, antioxidant capacity, oxidative stress, and metabolic enzymes activity during exposure and recovery in Labeo rohita fingerlings. Aquacult Int 30:1711–1739. https://doi.org/10.1007/s10499-022-00870-2 Lagerspetz KYH, Vainio LA (2006) Thermal behaviour of crustaceans. Biol Rev 81:237–258. https://doi.org/10.1017/S1464793105006998 di Lena P, Domeniconi G, Margara L, Moro G (2015) GOTA: GO term annotation of biomedical literature. BMC Bioinformatics 16:346. https://doi.org/10.1186/s12859-015-0777-8 Li B, Dewey CN (2011) RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12:93–99. https://doi.org/10.1186/1471-2105-12-323 Liu S, Wang X, Sun F et al (2013) RNA-Seq reveals expression signatures of genes involved in oxygen transport, protein synthesis, folding, and degradation in response to heat stress in catfish. Physiol Genomics 45:462–476. https://doi.org/10.1152/physiolgenomics.00026.2013 Liu X, Jiang H, Ye B et al (2021) Comparative transcriptome analysis of the gills and hepatopancreas from Macrobrachium rosenbergii exposed to the heavy metal Cadmium (Cd 2+ ). Sci Rep 11:1–11. https://doi.org/10.1038/s41598-021-95709-w Liu ZM, Zhu XL, Lu J et al (2018) Effect of high temperature stress on heat shock protein expression and antioxidant enzyme activity of two morphs of the mud crab Scylla paramamosain . Comp Biochem Physiol A Mol Integr Physiol 223:10–17. https://doi.org/10.1016/j.cbpa.2018.04.016 Love MI, Huber W, Anders S (2014) moderated estimation of fold change and dispersion for rna-seq data with deseq2 moderated estimation of fold change and dispersion for rna-seq data with deseq2. Genome Biol 15:550. https://doi.org/10.1186/s13059-014-0550-8 Lv B, Liu B, Zhou Q et al (2021) Effects of different temperatures and protein levels on growth performance, physiological response and expression of immune-related genes of juvenile oriental river prawn ( Macrobrachium nipponense ). Aquaculture 536:736435. https://doi.org/10.1016/j.aquaculture.2021.736435 Minoru K, Susumu G, Shuichi K et al (2004) The KEGG resource for deciphering the genome. Nucleic Acids Res 32:D277–D280. https://doi.org/10.1093/NAR/GKH063 Mlih M, Karpac J (2022) Integrin–ECM interactions and membrane-associated Catalase cooperate to promote resilience of the Drosophila intestinal epithelium. PLoS Biol 20:1–29. https://doi.org/10.1371/journal.pbio.3001635 Mohamad A, Arshad A, Sung YY, Jasmani S (2018) Effect of thermal stress on Hsp70 gene expression and female reproductive performance of giant freshwater prawn, Macrobrachium rosenbergii . Aquac Res 49:135–150. https://doi.org/10.1111/are.13442 Rao X, Huang X, Zhou Z, Lin X (2013) An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostatistics 3:71–85 Ross I, Omengan DB, Huang GN, Payumo AY (2022) Thyroid hormone-dependent regulation of metabolism and heart regeneration. J Endocrinol 252:R71–R82. https://doi.org/10.1530/JOE-21-0335 Shrivastava J, Sinha AK, Cannaerts S et al (2017) Temporal assessment of metabolic rate, ammonia dynamics and ion-status in common carp during fasting: A promising approach for optimizing fasting episode prior to fish transportation. Aquaculture 481:218–228. https://doi.org/10.1016/j.aquaculture.2017.09.008 Storey JD, Tibshirani R, Green PP (2003) Statistical significance for genomewide studies. Proc Natl Acad Sci U S A 100:9440–9445. https://doi.org/10.1073/pnas.1530509100 Sun S, Gu Z, Fu H et al (2018) Hypoxia induces changes in amp-activated protein kinase activity and energy metabolism in muscle tissue of the oriental river prawn Macrobrachium nipponense . Front Physiol 9:751. https://doi.org/10.3389/fphys.2018.00751 Sun S, Xuan F, Fu H et al (2017) Molecular cloning and functional characterization of a hexokinase from the oriental river prawn Macrobrachium nipponense in response to hypoxia. Int J Mol Sci 18:1256. https://doi.org/10.3390/ijms18061256 Sun S, Xuan F, Fu H et al (2015) Transciptomic and histological analysis of hepatopancreas, muscle and gill tissues of oriental river prawn ( Macrobrachium nipponense ) in response to chronic hypoxia. BMC Genomics 16:491. https://doi.org/10.1186/s12864-015-1701-3 Tan S, Wang W, Tian C et al (2019) Heat stress induced alternative splicing in catfish as determined by transcriptome analysis. Comp Biochem Physiol Part D Genomics Proteomics 29:166–172. https://doi.org/10.1016/j.cbd.2018.11.008 Trapnell C, Williams BA, Pertea G et al (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28:511–515. https://doi.org/10.1038/nbt.1621 Triebel J, Robles JP, Zamora M et al (2022) New horizons in specific hormone proteolysis. Trends in Endocrinology & Metabolism 33:371–377. https://doi.org/10.1016/j.tem.2022.03.004 Wang R-F, Wang Y, Zhang J et al (2022) The effects of dietary fermented wheat bran polysaccharides on mucosal and serum immune parameters, hepatopancreas antioxidant indicators, and immune-related gene expression of common carp ( Cyprinus carpio ) juveniles. Aquacult Int 30:1835–1853. https://doi.org/10.1007/s10499-022-00877-9 Wang W-N, Wang A-L, Liu Y et al (2006) Effects of temperature on growth, adenosine phosphates, ATPase and cellular defense response of juvenile shrimp Macrobrachium nipponense . Aquaculture 256:624–630. https://doi.org/10.1016/j.aquaculture.2006.02.009 Wickham H (2011) ggplot2. Wiley Interdiscip Rev Comput Stat 3:180–185. https://doi.org/10.1002/wics.147 Xiang S, GuiLing W, JiaLe L (2011) Variation in activities of phosphatase in prawn Macrobrachium nipponense and M. rosenbergii under different water temperature. Fisheries Sci (Dalian) 30:168–170 Zhou J, Rasmussen M, Ekström P (2021) cGMP-PKG dependent transcriptome in normal and degenerating retinas: Novel insights into the retinitis pigmentosa pathology. Exp Eye Res 212:108752. https://doi.org/10.1016/j.exer.2021.108752 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2320616","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":155977705,"identity":"a6835b3a-2207-4c26-ab56-356f9575e83f","order_by":0,"name":"Xiao Wu","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Wu","suffix":""},{"id":155977706,"identity":"2ac5202d-15c4-4ada-aecc-4c5072b27214","order_by":1,"name":"Yaoran Fan","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Yaoran","middleName":"","lastName":"Fan","suffix":""},{"id":155977707,"identity":"7cb8840e-af18-4b21-8830-3d4a55cf3178","order_by":2,"name":"Keyi Ma","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Keyi","middleName":"","lastName":"Ma","suffix":""},{"id":155977708,"identity":"79d7fbaa-6626-4ded-99f6-dc807b9e8fc9","order_by":3,"name":"Jiale Li","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Jiale","middleName":"","lastName":"Li","suffix":""},{"id":155977709,"identity":"71baf10a-fae7-44ef-a62e-45a889459f0b","order_by":4,"name":"Jianbin Feng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYBACxhmMD4CUDYMBmMtGlBZmkOI0ErQwSIC1HCZBC/PsZsbHBb/O25uz9xgwfCg7zMA/u4GAw+YcZjae2Xc7cWfPGQPGGecOM0jcOUBAy4z8Y9K8PbcTDG7kGDDztgFdKJFASEsy+2/ennP2YC1/idTCxszz4wDjBpAWRqK0AP0izduQnLjhzLGCgz3n0nkkbhDQYggMsc88f+zsDY43b3zwo8xajn8GIS0NIKvaIJwDQMyDXz0QyIPJPwTVjYJRMApGwUgGAHhZRBiGCDeyAAAAAElFTkSuQmCC","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":true,"prefix":"","firstName":"Jianbin","middleName":"","lastName":"Feng","suffix":""}],"badges":[],"createdAt":"2022-11-28 11:14:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2320616/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2320616/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":29782734,"identity":"abc9950d-3376-42f3-8817-50cd8ee2171d","added_by":"auto","created_at":"2022-12-01 16:31:02","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":9354798,"visible":true,"origin":"","legend":"\u003cp\u003eHistological observation of the gills (A: 25 ℃, B:30 ℃, and C: 35 ℃) and hepatopancreas (D: 25 ℃, E:30 ℃, and F: 35 ℃) by H\u0026amp;E staining in \u003cem\u003eM. nipponense\u003c/em\u003e. The histological differences were tagged (by arrowheads).\u003c/p\u003e","description":"","filename":"Figure.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/fe4fb7a94dc27f1c5e2c03ba.jpg"},{"id":29782805,"identity":"93a1290a-ce4e-47bc-bb92-fde923df1d28","added_by":"auto","created_at":"2022-12-01 16:31:11","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":806242,"visible":true,"origin":"","legend":"\u003cp\u003eThe changes of three digestive enzyme activities in the hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e under acute heat stress. A, Amylase; B, Trypsin; C, Lipase.\u003c/p\u003e","description":"","filename":"Figure.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/ca9129d604f94be071ff9604.jpg"},{"id":29782725,"identity":"f1c174df-b33f-4072-a0f8-e57557a1dd29","added_by":"auto","created_at":"2022-12-01 16:30:59","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1000073,"visible":true,"origin":"","legend":"\u003cp\u003eThe changes of metabolic enzyme contents in the hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e under acute heat stress. A, GLU; B, TG; C, TCHO.\u003c/p\u003e","description":"","filename":"Figure.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/f0ed8303e0c75d066f2a9c9b.jpg"},{"id":29782809,"identity":"1648d3e4-b0e1-44ca-8739-72fb5bdfc83a","added_by":"auto","created_at":"2022-12-01 16:31:11","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1520388,"visible":true,"origin":"","legend":"\u003cp\u003eThe changes of six antioxidant enzyme activities in the hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003eunder acute heat stress. A, T-SOD; B, CAT; C, MDA; D GPX; E, GST; F, GSH.\u003c/p\u003e","description":"","filename":"Figure.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/bc47a60d2c032ad78134356e.jpg"},{"id":29782803,"identity":"be81b92f-3fb7-4085-9425-be830bd041c1","added_by":"auto","created_at":"2022-12-01 16:31:10","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1666513,"visible":true,"origin":"","legend":"\u003cp\u003eGene ontology (GO) terms of DEGs in response to acute heat stress in \u003cem\u003eM. nipponense\u003c/em\u003e. Results of the enrichment analysis of the gene ontology (GO) terms of DEGs between the control and 30 ℃ groups (A), the control and 35 ℃ groups (B), and the 30 ℃ and 35 ℃ groups (C) in gills, respectively. And in hepatopancreas\u003cem\u003e, \u003c/em\u003egene ontology (GO) terms of DEGs between the control and 30 ℃ groups (D), the control and 35 ℃ groups (E), and the 30 ℃ and 35 ℃ groups (F), respectively.\u003c/p\u003e","description":"","filename":"Figure.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/a04c81ec7279c25c76b87c48.jpg"},{"id":29782740,"identity":"1de6732b-77c6-484b-aac3-b9f75c456507","added_by":"auto","created_at":"2022-12-01 16:31:02","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1264476,"visible":true,"origin":"","legend":"\u003cp\u003eEnrichment of top 20 KEGG pathways in response to acute heat stress in \u003cem\u003eM. nipponense\u003c/em\u003e. Results of Top 20 KEGG pathways enrichment of DEGs between the control and 30 ℃ groups (A), the control and 35 ℃ groups (B), and the 30 ℃ and 35 ℃ groups (C) in gills, respectively. And in hepatopancreas\u003cem\u003e,\u003c/em\u003e the\u003cem\u003e \u003c/em\u003etop 20 KEGG pathways enrichment of DEGs between the control and 30 ℃ groups (D), the control and 35 ℃ groups (E), and the 30 ℃ and 35 ℃ groups (F), respectively.\u003c/p\u003e","description":"","filename":"Figure.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/57e66a556bf2668e147415a6.jpg"},{"id":29782811,"identity":"476553d4-b03e-40e9-b06e-6d62f0a22837","added_by":"auto","created_at":"2022-12-01 16:31:12","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":853747,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic validation of randomly selected genes by RNA-seq and qRT-PCR. Data were presented as mean ± standard deviation (SD) of three replicates. An asterisk on each bar indicates statistically significant differences at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure.7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/60e7926473162b2ef9b86c20.jpg"},{"id":29782786,"identity":"388aae7d-4be1-4090-a858-d0ee4e44cb26","added_by":"auto","created_at":"2022-12-01 16:31:06","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":3382061,"visible":true,"origin":"","legend":"\u003cp\u003eDEGs identified by KEGG enrichment in the antigen processing and presentation pathway (HSPs). A, 30 ℃ VS 25 ℃; B, 35 ℃ VS 25 ℃; C, 35 ℃ VS 30 ℃.\u003c/p\u003e","description":"","filename":"Figure.8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/f3038055996bfceb5ddf80c3.jpg"},{"id":29782814,"identity":"e94594d3-e275-422e-89bb-bdfa6f4c82c5","added_by":"auto","created_at":"2022-12-01 16:31:14","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":9805886,"visible":true,"origin":"","legend":"\u003cp\u003eSignificantly DEGs identified by KEGG in the retinol metabolism pathway (CYP450). A, 30 ℃ VS 25 ℃; B, 35 ℃ VS 25 ℃; C, 35 ℃ VS 30 ℃.\u003c/p\u003e","description":"","filename":"Figure.9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/6844fce93abb33e7c1229549.jpg"},{"id":30420506,"identity":"1e3f0114-15cd-4eb0-a052-3a86d74b3268","added_by":"auto","created_at":"2022-12-16 11:14:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1415550,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2320616/v1/981a945a-04ff-4561-8846-25514c17cf17.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Transcriptomic, histological and biochemical analyses of Macrobrachium nipponense response to acute heat stress","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eTemperature is an essential factor affecting the viability of crustaceans, and high temperature can cause damage or even death (Liu et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). As the global climate has been changing over the last few decades, high temperature has become more frequent. Hence, it is evident that crustaceans suffer more heat stress (Jacox \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It has been found that when \u003cem\u003emacrobrachium\u003c/em\u003e species reach their higher critical thermal limit, they have a higher oxygen consumption rate. Therefore, these prawns can no longer appropriately control their metabolic functions (Garc\u0026iacute;a-Guerrero et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, acute or chronic heat stress can cause a lower reproductive molt rate, embryonic development, and hatching success in \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e (Mohamad et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). More seriously, heat stress leads to a higher mortality rate in crustaceans, besides the rapid heating rate leads to more deaths (Beladjal et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Hoang et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Although specific thermoreceptors have not been identified in crustaceans, studies have found that the peripheral nervous system appears to have maintained thermal sensitivity and adaptation independently of the central nervous system (Lagerspetz and Vainio \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe oriental river prawn, \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e, has become an economic aquaculture species in China, Japan, and Vietnam. (Fan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). Studies have illustrated that the optimal growth water temperature for \u003cem\u003eM. nipponense\u003c/em\u003e is 25 ℃ (Wang et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), and its oxidative stress is minimized at this temperature. \u003cem\u003eM. nipponense\u003c/em\u003e, as a poikilotherm, due to its low metabolism and lack of thermoregulatory mechanisms, its body temperature changes with the external temperature (Guschina and Harwood \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Therefore, \u003cem\u003eM. nipponense\u003c/em\u003e require a rapid and effective response to heat stress at the physiological and molecular levels in order to maintain homeostasis (Tan et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A higher intensity of oxidative stress often accompanies high temperature in the organism. Besides, high temperature can lead to lower antioxidant capacity and reduce the immune response of \u003cem\u003eM. nipponense\u003c/em\u003e (Lv et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHeat stress is a major environmental challenge for prawns in culture, and the hepatopancreas and gills are essential tissues for coping with thermal environment (Sun et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Despite considerable advances in the study of \u003cem\u003eM. nipponense\u003c/em\u003e, relatively few studies have been reported on acute heat stress in \u003cem\u003eM. nipponense\u003c/em\u003e, especially at the transcriptomic level. This study aims to determine how heat stress affects the digestion, metabolism, and immune response of \u003cem\u003eM. nipponense\u003c/em\u003e. In this study, after \u003cem\u003eM. nipponense\u003c/em\u003e was exposed to acute heat stress, the structural alterations of hepatopancreas and gills was investigated by H\u0026amp;E staining of tissue sections. In addition, the activities of antioxidant, digestive, and metabolic enzymes in hepatopancreas were measured to analyze the response of \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress. Finally, the transcriptomic profile, key regulator genes and enriched pathways were characterized by transcriptomic analysis. Above all, the results of this study will help identify the molecular mechanisms underlying the heat stress adaptation of \u003cem\u003eM. nipponense\u003c/em\u003e and contribute to the further understanding of how crustaceans adapt to heat stress on a molecular level.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003e2.1 Sample collection and preparation\u003c/h2\u003e\n\u003cp\u003eHealthy \u003cem\u003eM. nipponense\u003c/em\u003e (average body length 3.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 cm and body weight 0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33 g) used in this study were collected from Wuyi county (Zhejiang province, China). The prawns were cultivated at Hangzhou Fishery Research Institution. Before 72 hours of the experiment, the prawns were acclimated in three recirculating aerated water aquariums, in which, the temperature (25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 ℃), pH (7.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3), and dissolved oxygen (6.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 mg/L) were maintained. In the process of temporal acclimation, \u003cem\u003eM. nipponense\u003c/em\u003e was fed commercial pellets twice per day (8:00 am and 7:00 pm). After acclimatization, thirty prawns from each aquarium were collected as the control group (25 ℃). Subsequently, the water temperature was increased by 1.5 ℃ daily from 25 ℃ to 30 ℃. After one day of keeping, thirty prawns from each aquarium were sampled as the 30 ℃ group. The same method was used for the 35 ℃ group. For the following experiments, the gills and hepatopancreas were dissected from \u003cem\u003eM. nipponense\u003c/em\u003e of the control (25 ℃) and heat treatment (30 ℃ and 35 ℃) groups after anesthesia in ice, and immediately frozen in liquid nitrogen.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003e2.2 Histological analysis of hepatopancreas and gills in \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress\u003c/h2\u003e\n\u003cp\u003eThe hepatopancreas and gills of \u003cem\u003eM. nipponense\u003c/em\u003e were fixed in 4% paraformaldehyde solution for 24 hours and then transferred to 70% ethanol for histological analysis. The samples were then embedded in paraffin after being dehydrated in a graded ethanol series. Eventually, using a manual rotary microtome, each piece was cut into six 4\u0026ndash;5 \u0026micro;m thick sections. After staining with H\u0026amp;E, sections were viewed under a light microscope (Leica, DM3000).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003e2.3 Biochemical analysis of hepatopancreas in \u003cem\u003eM. nipponense\u003c/em\u003e under acute heat stress\u003c/h2\u003e\n\u003cp\u003eTo study the effects of acute heat stress on the biochemistry of \u003cem\u003eM. nipponense\u003c/em\u003e, three digestive enzymes (amylase; trypsin, and lipase), three metabolism-related enzymes (glycogen, GLU; triglyceride, TG; and total cholesterol, TCHO), and six immune-related enzymes (malondialdehyde, MDA; glutathione S-transferase, GST; total superoxide dismutase, T-SOD; catalase, CAT; glutathione peroxidase, GPX; and glutathione, GSH) were measured using commercially available kits (Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer\u0026rsquo;s protocols. The measurements were performed using a Microplate reader (BIOTEK, Synergy H1). All experiments were conducted in three biological replicates and three technical replicates.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4 RNA Isolation, Library Construction, and Sequencing\u003c/h2\u003e\n\u003cp\u003eTotal RNA was extracted from the heat treatment and control groups in \u003cem\u003eM. nipponense\u003c/em\u003e, respectively. The RNeasy Plus Mini Kit (Qiagen) was used following the manufacturer's instructions. The NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) was used to assess the RNA purity and quantification. The integrity of the RNA in the samples was evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). In order to analyze the mRNA expression profiles in the gills and hepatopancreas, the RNA sequencing (RNA-Seq) was conducted by OE Biotech Co., Ltd. (Shanghai, China). In brief, the mRNA obtained after purification was fragmented and replicated into first-strand cDNA using random primers and reverse transcriptase, and then the second-strand cDNA was synthesized. A poly (A)-tail was attached to the sequencing linker after the double-stranded cDNA was purified and subjected to 3-end repair, followed by the PCR amplification was carried out. Lastly, 150 base pair (bp) double-end reads were generated from the library using the Illumina HiSeq 2000 sequencer.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5 De novo assembly and data analysis\u003c/h2\u003e\n\u003cp\u003eInitially, raw reads (FASTQ) were filtered using Trimmomatic (version 0.36) (Bolger et al. \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e), and then the transcripts were obtained from filtered clean readings using Trinity (version 2.4) (Grabherr et al. \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e). Subsequently, the transcripts were aggregated into unigenes by Corset software (Davidson and Oshlack \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e), and the unigene sequences was annotated using five databases, including the NCBI non-redundant protein sequences (NR), the NCBI non-redundant nucleotide sequences (NT), the Protein Family (Pfam) database, the Gene Ontology (GO) database, and the Kyoto Encyclopedia of Genes and Genomes (KEGG). After mapping clean reads to the reference unigene set, the read number of gene expression in each sample was calculated using RSEM software (Li and Dewey \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e), and the FPKM (fragments per kilobase of transcript sequence per millions of base pairs sequenced)(Trapnell et al. \u003cspan class=\"CitationRef\"\u003e2010\u003c/span\u003e) was used to calculate gene expression level. Finally, the differentially expressed genes (DEGs) were detected in gills and hepatopancreas between the control and two heat treatment groups using the DESeq2 R package (Love et al. \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). The P-value computing model was used to conduct the hypothesis test, and Padj was introduced to correct the P-value (Storey et al. \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e). To screen for DEGs based on the screening criteria, the \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and fold change (FC)\u0026thinsp;\u0026gt;\u0026thinsp;2 or \u0026gt;\u0026thinsp;0.5 were used. All DEGs were enriched by GO enrichment and KEGG pathways analyses using R packages(Wickham \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e) based on hypergeometric distributions, respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003e2.6 Transcriptomic validation using Quantitative Real-time PCR (qRT-PCR)\u003c/h2\u003e\n\u003cp\u003eTo validate the results of RNA-Seq analysis, 12 DEGs from gills and hepatopancreas were screened for real-time PCR expression analysis. The qRT-PCR was conducted in the CFX96TM Real-time PCR Detection System with the SYBR Green Master Mix (TaKaRa, Shanghai, China). The RNA used for qPCR was the same as RNA-Seq.\u0026nbsp;Thereafter, cDNA was synthesized using PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa, Shanghai, China), according to the manufacturer's instructions. The 20 \u0026micro;L reaction system (6.8\u0026micro;l of RNase-free water, 1.6 \u0026micro;l of cDNA, 0.8 \u0026micro;l each of forward and reverse primers, and 10 \u0026micro;l of SYBR Green Master Mix) was applied. The expression level of each gene was normalized towards the reference gene (\u0026beta;-actin) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The relative gene expression was calculated, according to the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method (Rao et al. \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). Ultimately, the data were recorded as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation of three replicates. A one-way analysis of variance was used to analyze all data (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimers used to verify transcriptomic data.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene ID\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimers (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eUbiquitin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp262984_c0_seq1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: AGCGCGTGAATAGCCAAGAT\u003c/p\u003e\n\u003cp\u003eR: AGAAAGTGTGCGACCGTCTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTMEM47\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp257850_c1_seq14\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: AGCGCTTTCATCGTCAGACT\u003c/p\u003e\n\u003cp\u003eR: TGACATCCGACTTCAGCGTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMyosin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp218951_c0_seq1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: AGGTAAGCACCGACTCGAAA\u003c/p\u003e\n\u003cp\u003eR: AAACGGAAGGTCGTCAGTCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eActin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp190010_c0_seq2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: TCGTTGCCGATCGTGATGACTT\u003c/p\u003e\n\u003cp\u003eR: CCCTCGACTTTGACGAGGAAAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHemoglobin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp255933_c1_seq3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: GTTGCGTGACAGCAAAACCT\u003c/p\u003e\n\u003cp\u003eR: TTTCATTTGGCATGTCGGCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCYP450\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp242293_c0_seq1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: AGAAGCGATCATGGTCGAAGA\u003c/p\u003e\n\u003cp\u003eR: TGCCATTTGTGGGGAGAAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRPS11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp262825_c4_seq1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: TTGCCTTGTCCTGAGCCAAT\u003c/p\u003e\n\u003cp\u003eR: GCCCAATGCGACAACACATA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATP7A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp263787_c0_seq3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: ACACGCCTTCGTCCACATTA\u003c/p\u003e\n\u003cp\u003eR: TATGGCGTTGAACCTGGCTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATP1A1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp260570_c1_seq2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: AGTGTCGACCAACAAACGCT\u003c/p\u003e\n\u003cp\u003eR: TCCTTCGTTGTCGTCTGCTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePeroxidase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp110980_c0_seq2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: ATTGACACGGTCGTTGAATGC\u003c/p\u003e\n\u003cp\u003eR: ACAATGGACAAAGGCGTTGA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLqf\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp258001_c0_seq1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: GCATCTTTGCACTTCACGCA\u003c/p\u003e\n\u003cp\u003eR: ATTACTCGTCGCTTCACGCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRNF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecomp259432_c0_seq12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: TGGAAAACGGGCGCTTCATA\u003c/p\u003e\n\u003cp\u003eR: TCGCGTCTTCGTGCTTGATA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: GTGCCCATCTACGAGGGTTA\u003c/p\u003e\n\u003cp\u003eR: CGTCAGGGAGCTCGTAAGAC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003e3.1 Histological analysis of \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress\u003c/h2\u003e\n\u003cp\u003eMorphological differences of the gills and hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e in three heat stress gradients (25 ℃, 30 ℃, and 35 ℃) were identified by histological analysis. In the 30 ℃ and 35 ℃ groups, the hepatopancreatic cells of \u003cem\u003eM. nipponense\u003c/em\u003e showed atrophy, localized vacuolation in the middle, and disorderly arrangement. Besides, partial cells of the hepatopancreas in the 35 ℃ group expressed necrosis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA, B, and C). In the 30 ℃ and 35 ℃ groups, the gills structure of \u003cem\u003eM. nipponense\u003c/em\u003e had enlarged blood cavities, slightly curved lamellar epithelium, increased and disorganized blood cells, and even lesions at the terminal site of gills in the 35 ℃ group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD, E, and F).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Biochemical analysis of hepatopancreas in \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress\u003c/h2\u003e\n\u003cdiv id=\"Sec12\" class=\"Section3\"\u003e\n\u003ch2\u003e3.2.1 Digestive enzyme activities in hepatopancreas exposed to acute heat stress\u003c/h2\u003e\n\u003cp\u003eTo elucidate the activities of digestive enzymes under different heat gradients, amylase, trypsin, and lipase were applied in this study. It was obvious that there was a significant difference between the control and two heat groups for amylase (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, no significant change was indicated between the 30 ℃ and 35 ℃ groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Besides, trypsin activity did not illustrate a significant difference between the control and 30 ℃ groups. Then the trypsin activity reached a maximum in the 35 ℃ group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Eventually, lipase activity was significantly different only between the control and 35 ℃ group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\n\u003ch2\u003e3.2.2 Metabolic enzyme contents in hepatopancreas exposed to acute heat stress\u003c/h2\u003e\n\u003cp\u003eTo determine the antioxidant system alternation, the content of GLU, TCHO, and TG was calculated. The TCHO content was first decreased at 30 ℃ and then increased at 35 ℃ (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). Furthermore, the GLU activity kept increasing from 25 ℃ to 35 ℃ (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). Eventually, the TG content increased significantly only at 35 ℃. Nevertheless, there was no change at 30 ℃ (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section3\"\u003e\n\u003ch2\u003e3.2.3 Immune-related enzyme activities in hepatopancreas exposed to acute heat stress\u003c/h2\u003e\n\u003cp\u003eTo explore the immune system of the \u003cem\u003eM. nipponense\u003c/em\u003e, the activities of T-SOD, CAT, GPX, and GST, as well as the content of MDA, and GSH were calculated. The T-SOD, CAT, GPX, and GST activities increased with the heat rise (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, D, and F). On the contrary, MDA content decreased with the increase in temperature (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC). Finally, the difference in GSH content was insignificant between the control and 30 ℃ groups, then increased in 35 ℃ group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE).\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003e3.3 Data analysis of transcriptomic sequencing based on statistics\u003c/h2\u003e\n\u003cp\u003eRNA-Seq was performed on gills and hepatopancreas from the heat treatment and control groups. After this, 47.65\u0026nbsp;million 150 bp paired-end reads were generated in gills, and 41.71\u0026nbsp;million 150 bp paired-end reads were generated in hepatopancreas. After trimming, 42.22\u0026nbsp;million clean reads in gills and 38.61\u0026nbsp;million quality reads in hepatopancreas were obtained for further analysis. The mean of Q30 percentage and GC content for the entire data set were 87.30% and 44.64%, respectively (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). A total of 131690 unigenes were identified, among which 31944 (24.26%), 40734 (30.93%), 31550 (23.96%), 31478 (23.90%), and 34074 (25.87%) unigenes were found to be homologous to the sequences in the Nr, Nt, Pfam, GO, and KEGG databases, respectively. Additionally, 22737 unigenes were matched with all databases (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eIllumination expressed short reads generation and trimming.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSample\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGroup\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNumber of raw reads, million\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNumber of clean reads, million\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eQ30, %\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGC content, %\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eGills\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e25 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.66\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e91.77\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e44.74\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e30 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.69\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e14.62\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e90.34\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e45.23\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e35 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.94\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e88.02\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e45.56\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eHepatopancreas\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e25 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e14.92\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.26\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e91.31\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e44.23\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e30 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e12.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e89.10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e44.53\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e35 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.62\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e12.84\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e89.83\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e44.73\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTerm\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"5\" align=\"left\"\u003e\n\u003cp\u003eUnigene\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAll\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"5\" align=\"left\"\u003e\n\u003cp\u003e131690\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eN50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"5\" align=\"left\"\u003e\n\u003cp\u003e1303\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAverage length\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"5\" align=\"left\"\u003e\n\u003cp\u003e691.20\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eSummary of annotation results for \u003cem\u003eM. nipponense\u003c/em\u003e. Databases used: Nr: Nt; Pfam: GO; KEGG.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eDatabases\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNr\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNt\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePfam\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGO\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eKEGG\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNumbers of unigenes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e31944\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e40734\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e31550\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e31478\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e34074\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePercentage of unigenes (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e24.26\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e30.93\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e23.96\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e23.90\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e25.87\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNumbers of unigenes matched with all database\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"5\" align=\"left\"\u003e\n\u003cp\u003e22737\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003e3.4 DEGs analysis of hepatopancreas and gills in response to acute heat stress\u003c/h2\u003e\n\u003cp\u003eTo investigate the gene expression pattern, the number of unigenes from the two heat treatment groups (30 ℃ and 35 ℃) was compared with the control group (25 ℃), respectively. In the hepatopancreas, 1320 DEGs (939 up- and 381 down-regulated) in the 30 ℃ group and 1984 DEGs (911 up- and 1073 down-regulated) in the 35 ℃ group were identified (FC\u0026thinsp;\u0026gt;\u0026thinsp;2 or \u0026lt;\u0026thinsp;0.5, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), respectively. In addition, compared with the 30 ℃ group, 1122 DEGs (457 up- and 665 down-regulated) in the 35 ℃ group were identified (FC\u0026thinsp;\u0026gt;\u0026thinsp;2 or \u0026lt;\u0026thinsp;0.5, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Most of the DEGs in the hepatopancreas were associated with transcription, energy supply, and immunity, such as translation initiation factor, NADH dehydrogenase, and heat shock protein. In the gills, 1538 DEGs (900 up- and 638 down-regulated) in the 30 ℃ group and 755 DEGs (584 up- and 171 down-regulated) in the 35 ℃ were identified (FC\u0026thinsp;\u0026gt;\u0026thinsp;2 or \u0026lt;\u0026thinsp;0.5, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), respectively. In addition, compared with the 30 ℃ group, 357 DEGs (225 up- and 132 down-regulated) in the 35 ℃ group were identified (FC\u0026thinsp;\u0026gt;\u0026thinsp;2 or \u0026lt;\u0026thinsp;0.5, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). The majority of DEGs in gills were linked to ion exchange and antioxidants, like myosin, actin, and glycine receptor.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab4\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eNumber of DEGs between the 25 ℃, 30 ℃, and 35 ℃ groups under acute heat stress.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eGills\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eHepatopancreas\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e30 ℃\u003c/p\u003e\n\u003cp\u003eVS\u003c/p\u003e\n\u003cp\u003e25 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e35 ℃\u003c/p\u003e\n\u003cp\u003eVS\u003c/p\u003e\n\u003cp\u003e25 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e35 ℃\u003c/p\u003e\n\u003cp\u003eVS\u003c/p\u003e\n\u003cp\u003e30 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e30 ℃\u003c/p\u003e\n\u003cp\u003eVS\u003c/p\u003e\n\u003cp\u003e25 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e35 ℃\u003c/p\u003e\n\u003cp\u003eVS\u003c/p\u003e\n\u003cp\u003e25 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e35 ℃\u003c/p\u003e\n\u003cp\u003eVS\u003c/p\u003e\n\u003cp\u003e30 ℃\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNumber of up-regulated genes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e900\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e584\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e225\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e939\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e911\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e457\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNumber of down-regulated genes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e638\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e171\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e132\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e381\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1073\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e665\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSubtotal\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1538\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e755\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e357\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1320\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1984\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1122\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003e3.5 GO enrichment and KEGG pathways analyses based on DEGs\u003c/h2\u003e\n\u003cp\u003eTo understand the impact of acute heat stress on the antioxidant and metabolic systems of \u003cem\u003eM. nipponense\u003c/em\u003e, the DEGs were further analyzed by Gene ontology (GO) term enrichment analysis for potential functions. The results illustrated that the primary significant biological processes of DEGs were similar in gills and hepatopancreas under acute heat stress. These GO terms involved nucleus (GO:0005634), cytoplasm (GO:0005737), regulation of transcription by RNA polymerase II (GO:0006357), proteolysis (GO:0006508), nucleus (GO:0005634), and ATP binding (GO:0005524) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe top 20 enriched pathways identified by mapping DEGs to the KEGG database were used to identify molecular networks in cells and variants specific to tissues. Compared with the control group of hepatopancreas, six pathways were significantly enriched in the two heat treatment groups, including neuroactive ligand-receptor interaction (ko04080), thyroid hormone synthesis (ko04918), ECM-receptor interaction (ko04512), complement and coagulation cascades (ko04610), inositol phosphate metabolism (ko00562), and signaling pathways regulating pluripotency of stem cells (ko04550). In addition, four KEGG pathways were enriched in gills, including cGMP-PKG signaling pathway (ko04022), ribosome (ko03010), calcium signaling pathway (ko04020), and adrenergic signaling in cardiomyocytes (ko0461) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003e3.6 Validation of transcriptomic data via qRT-PCR\u003c/h2\u003e\n\u003cp\u003eSix cDNA templates from the hepatopancreas and gills were used for qRT-PCR experiments in order to validate the transcriptomic data. Randomly selected 12 DEGs were included in the treatment to ensure compliance with the strict requirement. Based on the results of the qRT-PCR and the transcriptomic analysis, the expression trends of the 12 candidate DEGs were consistent, indicating a high degree of credibility for the transcriptomic data (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eHigh temperature can cause an increase in the rate of oxygen consumption, which will lead to excessive production of reactive oxygen species (ROS) in aquatic animals triggering oxidative stress (Sun et al. \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e). Heat tolerance is a characteristic of most crustaceans, and they can live within a certain range of temperatures. It has been shown that when crustaceans are subjected to acute heat stress, the antioxidant system of their bodies activates to eliminate reactive oxygen species (Sun et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). In spite of this, exceeding the controllable range of heat resistance may result in oxidative damage and even death. In recent years, understanding the mechanisms of thermal regulation found in crustaceans has attracted increased attention. Despite numerous studies examining the molecular mechanisms of heat adaptation, limited evidence is available to explain how acute heat stress influences the gills and hepatopancreas of crustaceans.\u003c/p\u003e\n\u003cp\u003eThe hepatopancreas is a vital metabolic and digestive organ of crustaceans (Wang et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). The changes in hepatopancreatic structure are significantly related to discrepancies in physiological status (Liu et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). As the breathing organ of crustaceans, the gills are in direct contact with the external environment (Bechmann et al. \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e). The histological analysis of \u003cem\u003eM. nipponense\u003c/em\u003e under acute heat stress indicated that acute heat stress caused damage to the gills and hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e. In the gills, structural damage affected the normal physiological function of prawns and reduced the gas exchange capacity, thus causing oxidative damage to the tissues. In the hepatopancreas, there were mainly blister-like cell (B cell) for secretion, digestion, and absorption, as well as resorptive cell (R cell) for storage of nutrients (Al-Mohanna and Nott \u003cspan class=\"CitationRef\"\u003e1986\u003c/span\u003e). In this study, the number of B cell was significantly higher in the 35 ℃ group, indicating that high temperature had little effect on B cell in the hepatopancreas. Hence, the 35 ℃ might lead to a stronger digestion and absorption capacity of \u003cem\u003eM. nipponense\u003c/em\u003e to maintain growth requirements.\u003c/p\u003e\n\u003cp\u003eIn this study, digestive enzyme activities (trypsin, amylase, and lipase) were measured, directly reflecting the ability to digest and absorb nutrients in the hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e. The high activity of the three digestive enzymes in the heat treatment groups suggested that the \u003cem\u003eM. nipponense\u003c/em\u003e activated a higher digestion level to provide more energy to defend against acute heat stress. Antioxidant enzymes T-SOD, CAT, GPX, GST, and GSH can assist in eliminating ROS and reduce the damage produced by oxidative stress (Xiang et al. \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e; Fan et al. \u003cspan class=\"CitationRef\"\u003e2022a\u003c/span\u003e). T-SOD is responsible for converting toxic O\u003csup\u003e2-\u003c/sup\u003e produced by the body into H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, which continues to be metabolized by CAT into non-toxic H\u003csub\u003e2\u003c/sub\u003eO, and GPX catalyzes hydrogen peroxide substances. Besides, GST has a role in scavenging lipid peroxides produced by the metabolism of the shrimp organism (Arockiaraj et al. \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). Additionally, MDA is the main product of lipid peroxidation (Kumar et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this study, T-SOD activities only in the 35 ℃ groups were significantly higher than in the control group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). In addition, all the other enzyme activities were significantly different in the 30 ℃ and 35 ℃ groups from the control group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB, C, D, E, and F). This illustrated that \u003cem\u003eM. nipponense\u003c/em\u003e was activated with a high antioxidant capacity to cope with oxidative stress at 35 ℃. In terms of metabolism, GLU, TG, and TCHO activities were all significantly higher at 35 ℃ than at 25 ℃ (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). This indicated that the metabolic capacity of \u003cem\u003eM. nipponense\u003c/em\u003e was considerably enhanced at 35 ℃.\u003c/p\u003e\n\u003cp\u003eThrough RNA-Seq analysis, several heat-related genes, including heat shock proteins (HSPs) and cytochrome P450 (CYP450), also play a crucial role for heat tolerance in \u003cem\u003eM. nipponense\u003c/em\u003e. After the discovery of HSPs, increasing functions were attached to HSPs, such as molecular chaperones in protein folding and unfolding (Fan et al. \u003cspan class=\"CitationRef\"\u003e2022c\u003c/span\u003e), and managing the transcription machinery (Cui et al. \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). In this study, both HSP70 and HSP90 were significantly induced in the 35 ℃ group which illustrated that when exposed to acute heat stress, the higher expression of HSPs assisted the \u003cem\u003eM. nipponense\u003c/em\u003e in relieving the damage caused by acute heat stress (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). The results were found identical in the study of \u003cem\u003eScylla paramamosain\u003c/em\u003e (Liu et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). On the other hand, the functions of CYP450 were through the monooxygenase pathway for thermoregulation (Burkina et al. \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). In this study, the expression of CYP2 and CYP2E1 was up-regulated at 30 ℃. However, the CYP3 expression was up-regulated, and CYP2 was down-regulated at 35 ℃ (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e). These results indicated that CYP2 and CYP2E1 were active at 30 ℃. In comparison, CYP3A was functioning at 35 ℃ when \u003cem\u003eM. nipponense\u003c/em\u003e was exposed to acute heat stress.\u003c/p\u003e\n\u003cp\u003eTo further understand the molecular response of \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress, the GO classification and KEGG enrichment analyses were applied. GO classification can define the characteristics of genes and their products (Lena et al. \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition, KEGG is a database resource for understanding the high-level functions and utilities of a biological system (Minoru et al. \u003cspan class=\"CitationRef\"\u003e2004\u003c/span\u003e). In this study, several GO enrichment terms and enchried KEGG pathways associated with acute heat stress were identified in the gills and hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e by RNA-Seq analysis. The results showed that the GO enrichment terms of gills and hepatopancreas were not entirely the same in the 30 ℃ and 35 ℃ groups, however the main GO enrichment terms were highly similar (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). These DEGs were significantly enriched in the regulation of transcription by RNA polymerase II, proteolysis, cytoplasm, nucleus, metal ion binding, and ATP binding. Proteolysis plays an essential role in crustaceans, such as providing amino acids to the body, assisting in the production of active proteins, regulating physiological and cellular processes, and preventing the accumulation of unnecessary or abnormal proteins in cells (Triebel et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Metal ion binding is involved in transporting oxygen and improving the immunity of the body (Shrivastava et al. \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, it can be speculated that the enrichments of metal ion binding and ATP binding may be attributed to the expansion of ion exchange channels in the gills and hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress. Furthermore, the KEGG enrichment analysis revealed that the pathways enriched in the hepatopancreas and gills were mostly different. The pathways significantly enriched in the hepatopancreas at 30 ℃ and 35 ℃ were neuroactive ligand-receptor interaction, thyroid hormone synthesis, ECM-receptor interaction, complement and coagulation cascades, inositol phosphate metabolism, and signaling pathways regulating pluripotency of stem cells. The neuroactive ligand-receptor interaction pathway contains several genes predicted to be associated with heat tolerance (Cheruiyot et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). The synthesis of thyroid hormones promotes the metabolic level of the organism to help combat heat stress (Ross et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). The extracellular matrix (ECM) affects ROS synthesis through integrins (Mlih and Karpac \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). The enrichment of these pathways also demonstrated that the hepatopancreas enables \u003cem\u003eM. nipponense\u003c/em\u003e adapt to acute heat stress mainly through metabolic function and reducing ROS. In addition, four KEGG pathways were enriched in gills, including cGMP-PKG signaling pathway, ribosome, calcium signaling pathway, and adrenergic signaling in cardiomyocytes. Cyclic guanosine monophosphate (cGMP) is usually involved in opening cell membrane ion channels and glycogenolysis (Zhou et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Calcium ions can reduce ROS (hydrogen peroxide and the oxide ion) and thus shield the organism from heat stress (Carreras-Sureda et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). This shows that the gills are mainly used to protect \u003cem\u003eM. nipponense\u003c/em\u003e from oxidative stress through ion exchange channels and scavenging of ROS. Although the gills and hepatopancreas enable \u003cem\u003eM. nipponense\u003c/em\u003e to cope with acute heat stress in various ways, they both play a significant role in the regulation process.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThe thermoregulation of crustaceans is a complex physiological process. This study performed histological, biochemical, and transcriptomic analyses of \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress. The histological analysis results indicated that acute heat stress could damage the structure of the hepatopancreas and gills in \u003cem\u003eM. nipponense\u003c/em\u003e. Besides, the biochemical analysis results illustrated that acute heat stress activates the capacity of digestion, antioxidant, and metabolism of \u003cem\u003eM. nipponense\u003c/em\u003e. Ultimately, the transcriptomic results demonstrated that the \u003cem\u003eM. nipponense\u003c/em\u003e exposed to acute heat stress was regulated by the energy metabolism, ion exchange, and immune response to acclimate to the altered environment. In conclusion, histological, biochemical, and transcriptomic analyses provide insights into the thermoregulation and molecular mechanisms of \u003cem\u003eM. nipponense\u003c/em\u003e under acute heat stress.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the results of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Innovation Action Plan Project of the Science and Technology Commission of Shanghai Municipality (19391900900, 21002410500).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJianbin Feng and Jiale Li conceived the project and provided funding acquisition and paper revision. Xiao Wu and Yaoran Fan sampled the species, performed a formal analysis, and collected the specimens and performed the experiments. Xiao Wu performed bioinformatics work, paper writing, revision, and editing. Jianbin Feng and Keyi Ma critically evaluated and approved the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eM. nipponense\u003c/em\u003e is neither an endangered species in China nor in other countries. During this study, all experimental procedures involving prawns were conducted following the approval of the care and utilization of animals for scientific purposes set up by the Institutional Animal Care and the Use Committee (IACUS) of Shanghai Ocean University, Shanghai, China. The prawns were sedated with ice before removing the tissue samples under ARRIVE guidance. \u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAl-Mohanna SY, Nott JA (1986) B-cells and digestion in the hepatopancreas of \u003cem\u003epenaeus semisulcatus\u003c/em\u003e (Crustacea: Decapoda). J Mar Biol Association United Kingd 66:403\u0026ndash;414. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0025315400043034\u003c/span\u003e\u003cspan address=\"10.1017/S0025315400043034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArockiaraj J, Gnanam AJ, Palanisamy R et al (2014) A cytosolic glutathione s-transferase, GST-theta from freshwater prawn \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e: molecular and biochemical properties. Gene 546:437\u0026ndash;442. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gene.2014.05.063\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2014.05.063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBechmann RK, Arnberg M, Gomiero A et al (2019) Gill damage and delayed mortality of Northern shrimp (\u003cem\u003ePandalus borealis\u003c/em\u003e) after short time exposure to anti-parasitic veterinary medicine containing hydrogen peroxide. Ecotoxicol Environ Saf 180:473\u0026ndash;482. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ecoenv.2019.05.045\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2019.05.045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeladjal L, Mertens J, Clegg JS (2008) Biochemical and biophysical aspects of the tolerance of anhydrobiotic crustacean embryos to very high temperatures. J Therm Biol 33:117\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jtherbio.2007.11.003\u003c/span\u003e\u003cspan address=\"10.1016/j.jtherbio.2007.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B (2014) Trimmomatic: A flexible read trimming tool for Illumina NGS data. Bioinformatics 30:2114\u0026ndash;2120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btu170\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btu170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurkina V, Zamaratskaia G, Randak T et al (2012) Verapamil does not modify catalytic activity of CYP450 in rainbow trout after long-term exposure. Ecotoxicol Environ Saf 79:148\u0026ndash;152. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.ecoenv.2011.12.012\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2011.12.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarreras-Sureda A, Pih\u0026aacute;n P, Hetz C (2018) Calcium signaling at the endoplasmic reticulum: fine-tuning stress responses. Cell Calcium 70:24\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ceca.2017.08.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ceca.2017.08.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheruiyot EK, Haile-Mariam M, Cocks BG et al (2021) New loci and neuronal pathways for resilience to heat stress in cattle. Sci Rep 11:16619. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-95816-8\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-95816-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui Y, Liu B, Xie J et al (2014) Effect of enrofloxacin and emodin on heat-shock proteins\u0026rsquo; expression in hepatic cells of grass carp (\u003cem\u003eCtenopharyngodon idellus\u003c/em\u003e). Aquacult Int 22:1067\u0026ndash;1077. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10499-013-9727-5\u003c/span\u003e\u003cspan address=\"10.1007/s10499-013-9727-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavidson NM, Oshlack A (2014) Corset: enabling differential gene expression analysis for de novo assembled transcriptomes. Genome Biol 15:410. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13059-014-0410-6\u003c/span\u003e\u003cspan address=\"10.1186/s13059-014-0410-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan W, Yang P, Qiao Y et al (2022a) Polystyrene nanoplastics decrease molting and induce oxidative stress in adult \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. Fish Shellfish Immunol 122:419\u0026ndash;425. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2022.02.028\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2022.02.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Feng J, Wang Z et al (2022b) Integrated transcriptomic and metabolic analysis response in gills, hepatopancreas, and muscle metabolism in oriental river prawn \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e in response to acute high salinity stress. Aquac Rep 27:101358. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aqrep.2022.101358\u003c/span\u003e\u003cspan address=\"10.1016/j.aqrep.2022.101358\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Feng J, Xie N et al (2022c) RNA-seq Provides Novel Insights into Response to Acute Salinity Stress in Oriental River Prawn \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. Mar Biotechnol 24:820\u0026ndash;829. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10126-022-10151-x\u003c/span\u003e\u003cspan address=\"10.1007/s10126-022-10151-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Guerrero M, Avil\u0026eacute;s-Espinoza N, Lizarraga-Sanchez G et al (2022) Maximum critical temperature and oxygen consumption during thermoregulation in \u003cem\u003eMacrobrachium americanum\u003c/em\u003e (Bate, 1868) adult prawns. Lat Am J Aquat Res 50:301\u0026ndash;309. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3856/vol50-issue2-fulltext-2824\u003c/span\u003e\u003cspan address=\"10.3856/vol50-issue2-fulltext-2824\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrabherr MG, Haas BJ, Yassour M et al (2011) Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 29:644\u0026ndash;652. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt.1883\u003c/span\u003e\u003cspan address=\"10.1038/nbt.1883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuschina IA, Harwood JL (2006) Mechanisms of temperature adaptation in poikilotherms. FEBS Lett 580:5477\u0026ndash;5483. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.febslet.2006.06.066\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2006.06.066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoang T, Bui THH, Ho HC, Le NPT (2020) Thermal challenge of the Indian shrimp \u003cem\u003ePenaeus indicus\u003c/em\u003e. Aquac Res 51:1480\u0026ndash;1486. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/are.14493\u003c/span\u003e\u003cspan address=\"10.1111/are.14493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacox MG (2019) Marine heatwaves in a changing climate. Nature 571:485\u0026ndash;487. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/d41586-019-02196-1\u003c/span\u003e\u003cspan address=\"10.1038/d41586-019-02196-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar M, Gupta G, Muhammed NP et al (2022) Toxicity ameliorative effect of vitamin E against super-paramagnetic iron oxide nanoparticles on haemato-immunological responses, antioxidant capacity, oxidative stress, and metabolic enzymes activity during exposure and recovery in Labeo rohita fingerlings. Aquacult Int 30:1711\u0026ndash;1739. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10499-022-00870-2\u003c/span\u003e\u003cspan address=\"10.1007/s10499-022-00870-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLagerspetz KYH, Vainio LA (2006) Thermal behaviour of crustaceans. Biol Rev 81:237\u0026ndash;258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S1464793105006998\u003c/span\u003e\u003cspan address=\"10.1017/S1464793105006998\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003edi Lena P, Domeniconi G, Margara L, Moro G (2015) GOTA: GO term annotation of biomedical literature. BMC Bioinformatics 16:346. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12859-015-0777-8\u003c/span\u003e\u003cspan address=\"10.1186/s12859-015-0777-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B, Dewey CN (2011) RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12:93\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2105-12-323\u003c/span\u003e\u003cspan address=\"10.1186/1471-2105-12-323\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu S, Wang X, Sun F et al (2013) RNA-Seq reveals expression signatures of genes involved in oxygen transport, protein synthesis, folding, and degradation in response to heat stress in catfish. Physiol Genomics 45:462\u0026ndash;476. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/physiolgenomics.00026.2013\u003c/span\u003e\u003cspan address=\"10.1152/physiolgenomics.00026.2013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Jiang H, Ye B et al (2021) Comparative transcriptome analysis of the gills and hepatopancreas from \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e exposed to the heavy metal Cadmium (Cd\u003csup\u003e2+\u003c/sup\u003e). Sci Rep 11:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-95709-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-95709-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu ZM, Zhu XL, Lu J et al (2018) Effect of high temperature stress on heat shock protein expression and antioxidant enzyme activity of two morphs of the mud crab \u003cem\u003eScylla paramamosain\u003c/em\u003e. Comp Biochem Physiol A Mol Integr Physiol 223:10\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbpa.2018.04.016\u003c/span\u003e\u003cspan address=\"10.1016/j.cbpa.2018.04.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S (2014) moderated estimation of fold change and dispersion for rna-seq data with deseq2 moderated estimation of fold change and dispersion for rna-seq data with deseq2. Genome Biol 15:550. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13059-014-0550-8\u003c/span\u003e\u003cspan address=\"10.1186/s13059-014-0550-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv B, Liu B, Zhou Q et al (2021) Effects of different temperatures and protein levels on growth performance, physiological response and expression of immune-related genes of juvenile oriental river prawn (\u003cem\u003eMacrobrachium nipponense\u003c/em\u003e). Aquaculture 536:736435. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2021.736435\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2021.736435\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinoru K, Susumu G, Shuichi K et al (2004) The KEGG resource for deciphering the genome. Nucleic Acids Res 32:D277\u0026ndash;D280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/NAR/GKH063\u003c/span\u003e\u003cspan address=\"10.1093/NAR/GKH063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMlih M, Karpac J (2022) Integrin\u0026ndash;ECM interactions and membrane-associated Catalase cooperate to promote resilience of the Drosophila intestinal epithelium. PLoS Biol 20:1\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pbio.3001635\u003c/span\u003e\u003cspan address=\"10.1371/journal.pbio.3001635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamad A, Arshad A, Sung YY, Jasmani S (2018) Effect of thermal stress on Hsp70 gene expression and female reproductive performance of giant freshwater prawn, \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e. Aquac Res 49:135\u0026ndash;150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/are.13442\u003c/span\u003e\u003cspan address=\"10.1111/are.13442\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao X, Huang X, Zhou Z, Lin X (2013) An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostatistics 3:71\u0026ndash;85\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoss I, Omengan DB, Huang GN, Payumo AY (2022) Thyroid hormone-dependent regulation of metabolism and heart regeneration. J Endocrinol 252:R71\u0026ndash;R82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/JOE-21-0335\u003c/span\u003e\u003cspan address=\"10.1530/JOE-21-0335\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShrivastava J, Sinha AK, Cannaerts S et al (2017) Temporal assessment of metabolic rate, ammonia dynamics and ion-status in common carp during fasting: A promising approach for optimizing fasting episode prior to fish transportation. Aquaculture 481:218\u0026ndash;228. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2017.09.008\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2017.09.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStorey JD, Tibshirani R, Green PP (2003) Statistical significance for genomewide studies. Proc Natl Acad Sci U S A 100:9440\u0026ndash;9445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1530509100\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1530509100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun S, Gu Z, Fu H et al (2018) Hypoxia induces changes in amp-activated protein kinase activity and energy metabolism in muscle tissue of the oriental river prawn \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. Front Physiol 9:751. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2018.00751\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2018.00751\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun S, Xuan F, Fu H et al (2017) Molecular cloning and functional characterization of a hexokinase from the oriental river prawn \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e in response to hypoxia. Int J Mol Sci 18:1256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms18061256\u003c/span\u003e\u003cspan address=\"10.3390/ijms18061256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun S, Xuan F, Fu H et al (2015) Transciptomic and histological analysis of hepatopancreas, muscle and gill tissues of oriental river prawn (\u003cem\u003eMacrobrachium nipponense\u003c/em\u003e) in response to chronic hypoxia. BMC Genomics 16:491. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12864-015-1701-3\u003c/span\u003e\u003cspan address=\"10.1186/s12864-015-1701-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan S, Wang W, Tian C et al (2019) Heat stress induced alternative splicing in catfish as determined by transcriptome analysis. Comp Biochem Physiol Part D Genomics Proteomics 29:166\u0026ndash;172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbd.2018.11.008\u003c/span\u003e\u003cspan address=\"10.1016/j.cbd.2018.11.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrapnell C, Williams BA, Pertea G et al (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28:511\u0026ndash;515. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt.1621\u003c/span\u003e\u003cspan address=\"10.1038/nbt.1621\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTriebel J, Robles JP, Zamora M et al (2022) New horizons in specific hormone proteolysis. Trends in Endocrinology \u0026amp; Metabolism 33:371\u0026ndash;377. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tem.2022.03.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tem.2022.03.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R-F, Wang Y, Zhang J et al (2022) The effects of dietary fermented wheat bran polysaccharides on mucosal and serum immune parameters, hepatopancreas antioxidant indicators, and immune-related gene expression of common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) juveniles. Aquacult Int 30:1835\u0026ndash;1853. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10499-022-00877-9\u003c/span\u003e\u003cspan address=\"10.1007/s10499-022-00877-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W-N, Wang A-L, Liu Y et al (2006) Effects of temperature on growth, adenosine phosphates, ATPase and cellular defense response of juvenile shrimp \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. Aquaculture 256:624\u0026ndash;630. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2006.02.009\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2006.02.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWickham H (2011) ggplot2. Wiley Interdiscip Rev Comput Stat 3:180\u0026ndash;185. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/wics.147\u003c/span\u003e\u003cspan address=\"10.1002/wics.147\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang S, GuiLing W, JiaLe L (2011) Variation in activities of phosphatase in prawn \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e and \u003cem\u003eM. rosenbergii\u003c/em\u003e under different water temperature. Fisheries Sci (Dalian) 30:168\u0026ndash;170\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Rasmussen M, Ekstr\u0026ouml;m P (2021) cGMP-PKG dependent transcriptome in normal and degenerating retinas: Novel insights into the retinitis pigmentosa pathology. Exp Eye Res 212:108752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.exer.2021.108752\u003c/span\u003e\u003cspan address=\"10.1016/j.exer.2021.108752\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Macrobrachium nipponense, Acute heat stress, RNA-Seq, Histological, Biochemical","lastPublishedDoi":"10.21203/rs.3.rs-2320616/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2320616/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTemperature is an essential factor affecting the viability of crustaceans, and high temperature can cause damage or even death. The oriental river prawn, \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e, is an important economic aquaculture species in China, Japan, and Vietnam. To identify the transcriptomic, histological, and biochemical response of \u003cem\u003eM. nipponense\u003c/em\u003e and reveal their adaptation mechanisms, the prawns were placed at 25 ℃, 30 ℃, and 35 ℃ for 24 h. The histological damages in the gills and hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e were found under acute heat stress. Additionally, acute heat stress enhanced the digestive, metabolic, and antioxidative capacity of \u003cem\u003eM. nipponense\u003c/em\u003e by biochemical analysis. The total RNA of hepatopancreas and gills were isolated and sequenced using the RNA-Seq method. After filtration, assembly, and aggregation, a total of 131690 unigenes were identified. Gene ontology (GO) analysis revealed that differentially expressed genes (DEGs) were significantly involved in the regulation of transcription by RNA polymerase II, proteolysis, nucleus, cytoplasm, nucleus, and ATP binding. In the hepatopancreas, several pathways were significantly enriched in the treatment groups, including neuroactive ligand-receptor interaction, thyroid hormone synthesis, and ECM-receptor interaction. And in the gills, cGMP-PKG signaling pathway, ribosome, and calcium signaling pathway, were enriched. The transcriptomic analysis provided insights into the thermoregulation and molecular mechanisms of \u003cem\u003eM. nipponense\u003c/em\u003e in response to acute heat stress.\u003c/p\u003e","manuscriptTitle":"Transcriptomic, histological and biochemical analyses of Macrobrachium nipponense response to acute heat stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-01 16:27:56","doi":"10.21203/rs.3.rs-2320616/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"74192e55-6710-465f-9f2e-960018d5129f","owner":[],"postedDate":"December 1st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-12-16T11:14:34+00:00","versionOfRecord":[],"versionCreatedAt":"2022-12-01 16:27:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2320616","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2320616","identity":"rs-2320616","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}