Mutation of OsCAX1a Results in Panicle Degeneration in Rice

Mutation of OsCAX1a Results in Panicle Degeneration in Rice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mutation of OsCAX1a Results in Panicle Degeneration in Rice Quan Gan, Fengshun Song, Cuixiang Lin, Dahu Ni This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1147067/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Rice is one of the most common cereal crops in China. Increasing the yield of rice has always been a primary purpose of rice breeding. However, panicle degeneration in rice, a complex characteristic regulated by many genes and commonly encountered in rice production, seriously reduces the yield. Findings : In this study, we obtained a new apical panicle degeneration mutant named ym48 , which exhibits a serious degeneration rate and reduced grain yield in rice. After fine mapping, the OsCAX1a gene responsible for Ca 2+ selection and transportation was identified. In the ym48 mutant of the OsCAX1a gene, a A to G substitution was noted at the 190 th nucleotide, and the corresponding 64 th amino acid was changed from threonine to alanine. Also, the tolerance from Ca 2+ stress was damaged due to the mutation. Phylogenetics, protein sequence alignment and motif identification of CAX family members in Arabidopsis and rice indicated that this mutation site was highly conserved and might play an essential role in Ca 2+ transportation. Moreover, the OsCAX1a expression pattern was analyzed in rice. qRT-PCR and GUS (β-glucuronidase) staining experiments showed that OsCAX1a was highly expressed in roots, stems and panicles and that its expression increased with panicle development. Conclusions : These results demonstrated that OsCAX1a played an essential role in the regulation of panicle development for the first time and mutation of OsCAX1a would generate the panicle degeneration in rice. This study provided a new view point to explore the mechanism of panicle development and degeneration in rice. Agronomy Panicle degeneration OsCAX1a Fine mapping Expression pattern Rice Figures Figure 1 Figure 2 Figure 3 Findings Rice ( Oryza sativa ) is an important food crop that serves as a staple food for greater than half of the world's population (Tero et al. 2010). Increased yield represents the major purpose of rice genetics and breeding, which is of great significance for satisfying food requirements (Pushpendra et al. 2006). Grain yield in rice is a complex agronomic trait that is mainly determined by the number of differentiated spikelets per panicle, 1000-grain weight and the number of panicles, and the number of differentiated spikelets is a major contributor to grain yield (Xing and Zhang, 2010; Asif et al. 2019). The occurrence of panicle degeneration during floret development is widespread in rice breeding and production, which causes an approximately 20% reduction in yield. Moreover, the rate of panicle degeneration ranges from 50% to 60% under extreme weather conditions (Yamagishi et al. 2004; Zhang et al. 2017). Thus, understanding the molecular mechanisms and discovering the key genes involved in panicle development are important to breed high-yield rice varieties. Panicle differentiation in rice is regulated by a complex network of genes and initiates with the change in shoot meristems to the progression of axillary meristems (AMs). Subsequently, AMs are derived by the genes that control meristem transition to floral meristems (FMs) (Huijser and Schmid, 2011). Transcriptome research has revealed that 357 genes play an essential role in panicle development, and some of these genes are involved in the regulation of panicle degeneration (Wang et al. 2011). For example, LAX1/2 (LAX panicle 1/2), SPA (small panicle), MOC1 (MONOCULM 1) and OsH1 ( Oryza staiva homeobox 1) are involved in AM development, and their mutants displayed fewer spikelets and reduced branching (Tabuchi et al. 2011; Komatsu et al. 2003; Li et al. 2003; Sinha et al. 1997). In FMs, APO1 regulate the expression of C-class homeotic genes, and their overexpression result in an increased panicle size (Ikeda et al. 2007). APO2 suppressed the transition from the inflorescence meristem to FMs through interaction with APO1 (Ikedakawakatsu et al. 2012). Recently, research have found that the limitation of source transportation can also result in panicle degeneration in rice. SP1 (short panicle 1) regulates nitrate transportation to maintain panicle size by encoding PTR (peptide transporter), which is involved in the transportation of different assimilates to different parts of plants (Li et al. 2009). However, neither nitrate transporter activity nor any other compounds transported by known PTR proteins could be found, suggesting that SP1 may need other component(s) to be able to function as a transporter. Encoding a lipid transfer protein, OsC6 plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice (Zhang et al. 2010). Tut-1 mutants exhibit defects in the arrangement of actin filaments in trichome, indicating that TUT1 is a functional SCAR/WAVE protein and plays an essential role in panicle development (Bai et al. 2015). OsALMT7 (aluminum-activated malate transporter 7) maintains sink size and grain yield in rice by transporting malate into the apical portion of the panicle, and its mutant exhibits apical panicle degeneration that was accompanied by cell death (Heng et al. 2018). Inorganic cations are important components of plant nutrition and play an essential role in physiological and cellular processes. Their precise redistributions are regulated by vacuolar antiporters, which are important elements in mediating the intracellular sequestration of these cations (Manohar et al. 2011). In the Arabidopsis genome, 855 open reading frames code for transporters among the predicted 25498 genes (Shigaki and Hirschi, 2006). One class of transporter protein that mediates the vectorial transport of both Ca 2+ and other metal ions is the Cation/H + exchanger (CAX), a secondary energised transporter that is dependent on a proton (H + ) gradient across a membrane (Pittman and Hirschi, 2016). The past several years has found that CAXs are involved in a number of important aspects of plants growth and development, especially in crops nutritional enhancement and mitigating pollutants in soils (Conn et al. 2011). However, there is no report of the relationship between Cation/H + exchanger and panicle development and degeneration yet. In this study, to discover the key genes involved in panicle development, an ym48 mutant was created from indica rice 93-11 through irradiation treatment. The ym48 mutant was morphologically similar to wild-type 93-11 before the heading stage (Fig. 1A). However, serious degeneration appeared in the top panicle of the ym48 mutant at the heading stage (Fig. 1B). Specifically, the withered spikelet in the ym48 mutant was dried and malformed compared to the wild-type, and the flower appeared pale in color and smaller, especially in anthers and stigmas (Fig. 1C). Regarding the number of kernels, the wild-type had approximately 190 kernels in the main panicle. However, the ym48 mutant had an average degeneration rate of only 72, and the degeneration rate was approximately 40% compared to 1% in wild-type (Fig. 1G and H). With the exception of the bottom spikelet, which was not significantly different from the wild-type, the top and partial middle spikelets degenerated in the ym48 mutant and largely led to a shorter panicle length (average 23.06 cm in 93-11, 16.72 cm in ym48 ) and plant height (average 116.99 cm in 93-11, 100.50 cm in ym48 ) (Fig. 1E and F). Regarding the tiller number and thousand seed weight, no obvious differences were noted between the wild-type and ym48 mutant. In general, ym48 is a typical panicle degeneration mutant that exhibits a significant reduction in grain yield. To investigate when degeneration of the top panicle starts to occur during panicle development in the ym48 mutant, developmental process analysis was performed to compare the wild-type 93-11 and the ym48 mutant. As shown in Fig. 1D, the developmental process was divided into 8 stages according to panicle length. Here, a to h corresponded to 0.5 cm, 1 cm, 3 cm, 6 cm, 10 cm, 14 cm, 18 cm and 22 cm, respectively. During early-stage development (panicle length < 6 cm), no obvious difference was noted between 93-11 and the ym48 mutant (Fig. 1D a-c). When the panicle developed to approximately 6 cm, the top panicle stared to degenerate in the ym48 mutant, and the specific characteristic was a black and wizened spikelet (Fig. 1D d). From this stage, the degeneration in the ym48 mutant became more serious with panicle development (Fig. 1D e-h). To further determine the causal gene of the panicle degeneration phenotype in the ym48 mutant, an F2 mapping population was constructed by crossing ym48 with the indica cultivar “Yehesimiao”. In the F1 population, all individuals exhibited the normal phenotype. In the F2 population, approximately one-third of individuals (1520/4891) showed the panicle degeneration phenotype, indicating that the panicle degeneration phenotype was regulated by a single recessive gene. Next, these 1520 mutated individuals were used for mapping. The ym48 locus was initially mapped to the long arm of chromosome 1 between the markers IL-20 and IR-19 (Fig. 2A). After fine mapping, the mutation was further narrowed down to a 70-kb genomic region between markers RM11162 and IR-4, in which eleven ORFs were annotated (Fig. 2A). After sequence comparison, a single nucleotide substitution of A to G in the 190 th nucleotide in the first exon of LOC_Os01g37690 ( OsCAX1a ) was noted in the ym48 mutant, and the corresponding 64 th amino acids were substituted from threonine (T) to alanine (A) (Fig. 2B). To verify whether the OsCAX1a mutation was responsible for panicle degeneration in the ym48 mutant, transgenic knockout and overexpression were subsequently performed. In transgenic knockout analysis, target sequences of ACTGGTTGCGGTCGTAGGGCTGG were selected as sgRNA, and the CRISPR/Cas9 recombinant plasmid was introduced into wild-type 93-11. Two transgenic knockout lines ( cas9-1 and cas9-2 ) were obtained, and all individuals showed the panicle apical degeneration phenotype, which is similar to that noted in the ym48 mutant (Fig. 2C left). Sequences comparing cas9-1 , cas9-2 and 93-11 indicated that dozens of nucleotides were deleted near the sgRNA (Fig. 2E). For transgenic overexpression analysis, the CDS region of the OsCAX1a plus UBI promotor was inserted into pCAMBIA1301, and the recombinant plasmid was introduced into the ym48 mutant. Two transgenic overexpression lines ( oe-1 and oe-2 ) were obtained, and the panicle degeneration phenotype was significantly recovered (Fig. 2C right). qRT–PCR showed that the relative expression of OsCAX1a in transgenic overexpression lines was increased compared to that in the ym48 mutant (P value < 0.01) (Fig. 2D). Collectively, these results demonstrated that the OsCAX1a mutation was responsible for panicle apical degeneration. To further identify whether the Ca 2+ transportation was effect in ym48 mutant, hydroponic solutions with 7 different concentrations of CaCl 2 (0, 0.2, 0.5, 1, 5, 20 and 100 mM) were used in hydroponic experiment. As shown in Supplementary Fig. 1, the shoots development of ym48 mutant which cultivated in 0, 0.2, 0.5, 20 and 100 mM CaCl 2 was torpid compared to wild-type 93-11, especially in 0 and 100 mM CaCl 2 groups, and had no obviously different in roots and normal CaCl 2 groups. These results demonstrated that the A to G substitution at the 190 th nucleotide reduced the tolerance from extreme Ca 2+ stress and the Ca 2+ transportation was effect in ym48 mutant. OsCAX1a is a Cation/H + exchanger and plays an essential role in Ca 2+ selection and transportation in rice (Kamiya and Maeshima, 2004). OsCAX1a is a member of the CAX family. Six CAXs have been identified in Arabidopsis and rice: AtCAX1, AtCAX2, AtCAX3, AtCAX4, AtCAX5, AtCAX6, AtCAX7, OsCAX1a, OsCAX1b, OsCAX1c, OsCAX2, OsCAX3, and OsCAX4 (Supplementary Table 3) (Pittman and Hirschi, 2016). To identify the relevance of these protein sequences, a phylogenetic tree of the CAX family in Arabidopsis and rice was constructed using the NJ method and divided into two groups (Supplementary Fig. 2A). OsCAX1a, OsCAX1b, OsCAX1c, AtCAX1, AtCAX3 and AtCAX4 (Group I) exhibited significant homology, especially between OsCAX1a and OsCAX1b. Moreover, in the analysis of protein sequence alignment in the CAX family, the amino acids mutated in ym48 were all threonines in Group I and were highly conserved. In contrast, differentiation appeared in this amino acid in group II, and these sequences were deficient in OsCAX4 (Supplementary Fig. 2B). Previous research has suggested that gene structural diversity is an important resource for multigene family evolution (Liu et al. 2009). To elucidate the structural similarity and diversity of CAXs in Arabidopsis and rice, schematic diagrams of exons and introns were constructed. As shown in Supplementary Fig. 2C, slightly different numbers of exons were found in CAX genes, varying from 8 to 12. Except for OsCAX1c, the CAX family exhibited a similar construction of exons and introns, which would contribute to the explanation of functional conservation. Next, 20 conserved motifs were identified in CAX proteins using MEME tools. The composition and arrangement of these motifs were largely consistent with previous phylogenetic analysis (Supplementary Fig. 2D). Motif 9, which included the mutated amino acid in ym48 , was present in all CAX family members except OsCAX4. These results implied that these sequences might play an essential role in Ca 2+ selection and transportation. The specific sequence information is listed in Supplementary Table 2. Next, the expression pattern of OsCAX1a was investigated by qRT–PCR. OsCAX1a expression was detected in all rice organs analyzed. Relatively higher expression was noted in roots, stems and panicles, and lower expression was noted in other organs, including leaves and sheaths (Fig. 3A). A detailed expression analysis focusing on the panicle implied that OsCAX1a expression increased continuously during panicle development (Fig. 3B). The OsCAX1a expression pattern was further evaluated in plants transformed with a GUS reporter gene driven by a 2500-bp promoter sequence of OsCAX1a . We observed GUS activity in various organs examined. The strongest staining was noted in the shoot, panicle and stem, and slight staining was noted in the leaf and sheath, which is consistent with the qRT–PCR analysis results (Fig. 3C). As a Ca 2+ transporter, OsCAX1a is highly expressed in roots and stems and is responsible for Ca 2+ absorption and transportation. However, OsCAX1a was also highly expressed in panicles, and its expression increased with panicle development. The function of OsCAX1a in rice panicles remains unclear, and these results might indicate that OsCAX1a plays an important role in panicle development and differentiation. Panicle degeneration is a widespread physiological problem that reduces grain yield in rice and other cereal crops (Yamagishi et al. 2004). However, the genetic and molecular mechanisms regulating panicle degeneration remain poorly understood. Various factors could lead to panicle degeneration in rice, including abnormal meristem development, phytohormone variation, source transport limitation, and abiotic stresses (Ali et al. 2019). Our research demonstrated that Ca 2+ transportationmight be closely associated with panicle degeneration in rice. Ca 2+ played an essential role in plants. First, Ca 2+ is an essential nutrient element for plants. Ca 2+ constitutes the main component of the plant cell wall and cell membrane, accounting for 10% of plant dry weight (Marschner H, 1995). Second, Ca 2+ is one of the most important second messengers in plant cell signal transportation. A variety of external stimuli could cause changes in Ca 2+ concentration ([Ca 2+ ] CyT ) in the plant cytoplasm, thus transforming external signals into internal signals that can be sensed by plants to induce a series of physiological and biochemical reactions, achieving plant perception and responding to environmental stimuli and developmental information (Sanders et al. 2002). To maintain Ca 2+ balance in the body, plants must complete Ca 2+ transport through the Ca 2+ transfer system. There were two types of Ca 2+ channels: (1) Ca 2+ inward transporters transport Ca 2+ from the outside of the cell into the cytoplasm and (2) the outward transport system is responsible for transporting Ca 2+ out of the cytoplasm or into organelles, such as vacuoles. These transport systems included Ca 2+ -ATPase and Ca 2+ /H + reverse transporters. As a class of Ca 2+ outward transporters, Ca 2+ /H + reverse transporters play an important role in plants. Firstly, after completing their messenger role, they restored Ca 2+ concentration in the cytoplasm to the resting level in preparation for the initiation of the next signal. Second, Ca 2+ was correctly allocated to each organelle to ensure the progress of various specific biochemical reactions (White et al. 2003). Third, Ca 2+ is stored in intracellular and extracellular calcium banks and interacts with Ca 2+ channels to ensure the generation and completion of cell signals (Sanders et al. 2002). Since the first Ca 2+ /H + reverse transporter (VCX1) was identified in the tonoplast of Saccharomyces Cerevissiae, an increasing number of Ca 2+ /H + reverse transporters have been found in plants, including maize, rice, Arabidopsis (Vicente et al. 1995; Shigaki et al. 2000; Kamiya et al. 2004). In this study, fine mapping showed that A to G substitution at the 190 th nucleotide (64 th amino acid was changed from threonine to alanine) in OsCAX1a resulted in panicle degeneration in the ym48 mutant. Actually, Ca 2+ transportation was also affected by this mutation. In the hydroponic experiment, tolerance to extreme Ca 2+ concentrations was altered in the ym48 mutant compared to wild-type 93-11, which exhibited torpid development. Previous research has suggested that OsCAX1a has 11 predicted transmembrane domains (TMs) and is divided into three characteristic domains: the N-terminal regulatory region, the calcium domain, and the C domain (Kamiya and Maeshima, 2004). The N-terminal regulatory region has been shown to suppress Ca 2+ transport activity by interacting with its neighboring N-terminal sequence. The domain between TM1 and TM2 was thought to be involved in the selection of Ca 2+ . In the ym48 mutant, the 64 th amino acid was changed from threonine to alanine, and this amino acid is located in front of TM1. However, current studies have paid little attention to this domain, and its specific function remains unclear. In conclusion, a highly conserved amino acid site mutation of Cation/H + exchanger OsCAX1a was identified in ym48 mutant and generated the serious apical panicle degeneration in rice. Also, the tolerance from Ca 2+ stress was damaged due to the mutation. OsCAX1a highly expressed in roots, stems and panicles and that its expression increased with panicle development. This novel relationship between Ca 2+ transportation and panicle degeneration was not reported before and our research provided a new view point to explore the mechanism of panicle development and degeneration in rice. Abbreviations GUS: β-glucuronidase; AMs: axillary meristems; FMs: floral meristems; T: threonine; A: alanine; TMs: transmembrane domains Declarations Ethics Approval and Consent to Participate Not applicable. Consent for Publication All authors reviewed the manuscript and agreed to publish it. Availability of Data and Material The data sets supporting the results of this article are included within the article and its additional files. Competing interests The authors declare that they have no conflict of interest. Funding This research was supported by Major science and Technology Projects of Anhui Province (No. 202003a06020005 & No. 201903a06020012), Open Funding of Rice Genetics and Breeding of Anhui Province Key Laboratory (No. SDKF-2021-03 & No. SDKF-2020-01) and Natural Science Foundation of Anhui Province (No. 1908085QC135). Authors’ contributions QG, FS, CL and DN conceived and designed the experiments. QG implemented the experiments and prepared the manuscript. FS guided the molecular experiments. CL and DN collected the field data. QG analyzed the results. QG, FS, CL and DN revised the manuscript. All authors contributed to the article and approved the submitted version. Acknowledgements Not applicable. References Asif A, Xu P, Riaz A, Wu X (2019) Molecular sciences review current advances in molecular mechanisms and physiological basis of panicle degeneration in rice. International Journal of Molecular Sciences 20(7):1613 Bai J Zhu X, Wang Q, Zhang J, Chen H (2015) Ricetutou1encodes a suppressor of camp receptor-like protein that is important for actin organization and panicle development. Plant Physiology 169(2):1179–1191 Conn S, Gillham M, Athman A, Schreiber A, Baumann U, Moller I (2011) Cell-specific vacuolar calcium storage mediated by CAX1 regulates apoplastic calcium concentration, gas exchange, and plant productivity in Arabidopsis . Plant Cell 23:240–257 Heng Y, Wu C, Long Y, Luo S, Ma J, Chen J (2018) OsALMT7 maintains panicle size and grain yield in rice by mediating malate transport. Plant Cell 30(4):889–906 Huijser P, Schmid M (2011) The control of developmental phase transitions in plants. Development 138(19):4117–4129 Ikeda K, Ito M, Nagasawa N, Kyozuka J, Nagato Y (2007) Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate. Plant J 51:1030–1040 Ikedakawakatsu K, Maekawa M, Izawa T, Itoh J, Nagato Y (2015) ABERRANT PANICLE ORGANIZATION 2/RFL, the rice ortholog of Arabidopsis LEAFY, suppresses the transition from inflorescence meristem to floral meristem through interaction with APO1. The Plant Journal 69(1):168–180 Kamiya T, Maeshima M (2004) Residues in internal repeats of the rice Cation/H + exchanger are involved in the transport and selection of cations. Journal of Biological Chemistry 279(1):812–819 Komatsu K (2003) LAX and SPA: major regulators of shoot branching in rice. Proceedings of the National Academy of Sciences 100(20):11765–11770 Li S, Qian Q, Fu Z, Zeng D, Meng X, Kyozuka J (2009) Short panicle 1 encodes a putative PTR family transporter and determines rice panicle size. The Plant Journal 58(4):592–605 Li X, Qian Q, Fu Z, Wang Y, Xiong G, Zeng D (2003) Control of tillering in rice. Nature 422(6932):618–621 Liu SL, Zhuang Y, Zhang P, Adams KL (2009) Comparative analysis of structural diversity and sequence evolution in plant mitochondrial genes transferred to the nucleus. Mol Biol Evol 26(4):875–891 Manohar M, Shigaki T, Hirschi T (2011) Plant cation/H + exchangers (CAXs): biological functions and genetic manipulations. Plant Biol 13(4):561–569 Marschner H (1995) Mineral nutrition of higher plants, 2ed edn. London. Academic Press. Pittman JK, Hirschi KD (2016) Phylogenetic analysis and protein structure modelling identifies distinct Ca 2+ /Cation antiporters and conservation of gene family structure within Arabidopsis and rice species. Rice 9(1):3 Pushpendra KG, Rustgi S, Kumar N (2006) Genetic and molecular basis of grain size and grain number and its relevance to grain productivity in higher plants. Genome 49(6):565–571 Sanders D, Pelloux J, Brownlee C, Harper JF (2002) Calcium at the crossroad of signaling. Plant Cell 14:S401–S417 Shigaki T, Hirschi K (2000) Characterization of Cax-like genes in plants: implications for functional diversity. Gene 257(2):291–298 Shigaki T, Hirschi K (2006) Diverse functions and molecular properties emerging for CAX cation/H+ exchangers in plants. Plant Biol 8(4):419–429 Sinha NR, Williams RE, Hake S (1997) Overexpression of the maize homeo box gene, KNOTTED-1, causes a switch from determinate to indeterminate cell fates. Genes & Development 7(5):787–795 Tabuchi H, Zhang Y, Hattori S, Omae M, Sato Y (2011) LAX PANICLE2 of rice encodes a novel nuclear protein and regulates the formation of axillary meristems. Plant Cell 23(9):3276–3287 Terao T, Nagata K, Morino K, Hirose T (2010) A gene controlling the number of primary rachis branches also controls the vascular bundle formation and hence is responsible to increase the harvest index and grain yield in rice. Theoretical and Applied Genetics 120(5):875–893 Vicente J, Graca M, Vale P (1995) Activities of Ca 2+ pump and low affinity Ca 2+ /H + antiport in plasma membrane vesicles of corn roots. Journal of Experimental Botany 46:1551–1559 Wang D, Pan Y, Zhao X, Zhu L, Fu B, Li Z (2011) Genome-wide temporal-spatial gene expression profiling of drought responsiveness in rice. BMC Genom 12:149 White PJ, Broaley MR (2003) Calcium in plant. Annals of Botany 92:487–511 Xing Y, Zhang Q (2010) Genetic and molecular bases of rice yield. Annu. Rev. Plant Biol 61:421–442 Yamagishi J, Miyamoto N, Hirotsu S, Laza RC, Nemoto K (2004) QTLs for branching, floret formation, and pre-flowering floret abortion of rice panicle in a temperate japonica x tropical japonica cross. Theoretical & Applied Genetics 109(8):1555–1561 Zhang D, Liang W, Yin C, Zong J, Gu F, Zhang D (2010) Osc6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice. Plant Physiology 154(1):149–162 Zhang W, Chen Y, Wang Z, Yang J (2017) Polyamines and ethylene in rice young panicles in response to soil drought during panicle differentiation. Plant Growth Regulation 82(3):491–503 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.docx Additional file 1: Fig S1 SupplementaryFigure2.docx Additional file 1: Fig S2 SupplementaryTable1.docx Additional file 3: Table S1 SupplementaryTable2.docx Additional file 3: Table S2 SupplementaryTable3.docx Additional file 3: Table S3 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1147067","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":68424556,"identity":"ef3000eb-218e-4703-bbc1-85811b6ede1a","order_by":0,"name":"Quan Gan","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Quan","middleName":"","lastName":"Gan","suffix":""},{"id":68424559,"identity":"dd669168-8eea-4e0c-a3b3-443c4b5dd956","order_by":1,"name":"Fengshun Song","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fengshun","middleName":"","lastName":"Song","suffix":""},{"id":68424561,"identity":"7a657359-84f0-4469-b11e-fca18e69b743","order_by":2,"name":"Cuixiang Lin","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Cuixiang","middleName":"","lastName":"Lin","suffix":""},{"id":68424562,"identity":"b776ceb9-9d43-4bca-b2a9-59a539a4589a","order_by":3,"name":"Dahu Ni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYDCCAzxAwkBCzv7A4QMHPvwgXouFMcPBY4kHZ/YQrYWhIrHh8BnjwxxsROjgO372mHRBgURiY9uZD4cZeBjk+cUO4NcieSYvTXqGgYRxM8/ZDYcLLBgMZ85OwK/F4ECOmTSPgYRsmwRQywwehgSD24S0nH8D1sLYI//mwWEeNmK03IDYojiD4QwDcVokb7wxtgZqMTZgOGYADGQJwn7hO59jeJvnT52cAcPhxx8+/LCR55cmoAUdSJCmfBSMglEwCkYBdgAA5sZHj4xnggcAAAAASUVORK5CYII=","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"Dahu","middleName":"","lastName":"Ni","suffix":""}],"badges":[],"createdAt":"2021-12-07 01:44:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1147067/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1147067/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":16317836,"identity":"996278ec-347a-48a2-90a3-3cc5874cc271","added_by":"auto","created_at":"2021-12-09 15:44:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":315278,"visible":true,"origin":"","legend":"Phenotypic characterizations of wild-type 93-11 and ym48 mutant. A The plant type during the heading stage. Bars = 10 cm. B The panicle type before flowering. Bars = 1 cm. C Flowers and different vertical positions of grain type (top, middle and bottom). Bars in flowers indicate 0.5 cm, and bars in grain type indicate 1 cm. D Panicle type during the different development stages. a, 0.5 cm. b, 1 cm. c, 3 cm. d, 6 cm. e, 10 cm. f, 14 cm. g, 18 cm. h, 22 cm. Bars = 1 cm. E Plant height. F Panicle length. G Kernels per panicle. H Degeneration rate. All data shown are mean ± SE (n = 20). Asterisks represent statistically significant differences from wild-type 93-11, as determined by Student’s t test. ***P \u003c 0.001.","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/2b610e2c90524a7da39be185.png"},{"id":16317729,"identity":"ce5f1bbb-901d-4eb5-8c11-f7afb73c0abe","added_by":"auto","created_at":"2021-12-09 15:41:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":247463,"visible":true,"origin":"","legend":"Map-based cloning of ym48. A Fine mapping of ym48. The molecular markers are indicated above the black line, which refers to chromosome 1, and the corresponding numbers of recombinants are indicated below the black line. The candidate ORF is highlighted in red. B Gene exon-intron structure of OsCAX1a. Black rectangles indicate different exons, black lines show introns, and white rectangles signify 5’ and 3’ UTRs. The mutation site in ym48 exists in exon 1, and specific sequences are listed below. C Genetic confirmation of OsCAX1a through transgenic knockout (cas9-1 \u0026 cas9-2) and overexpression (oe-1 \u0026 oe-2). Bars = 1 cm. D Relative expression of OsCAX1a in overexpression transgenic lines. Asterisks represent statistically significant differences from ym48, as determined by Student’s t test. **P \u003c 0.01. E Sequence information in two knockout transgenic lines. The specific position is marked at both ends.","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/3e05c668fedac0f0e9596a8d.png"},{"id":16317679,"identity":"5be85bbc-6292-4b3b-b454-e0193c55dddd","added_by":"auto","created_at":"2021-12-09 15:38:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":427384,"visible":true,"origin":"","legend":"Expression pattern and subcellular localization of OsCAX1a. A Relative OsCAX1a expression in different tissues before flowering, including roots, leaves, stems, sheaths and panicles. B Relative OsCAX1a expression in different developmental stages, which is consistent with Fig. 1D. C Promoter activity of OsCAX1a as shown by GUS staining. a, shoot. b, panicle in VI stage. c, panicle in IV stage. d, stem. e, leaf. f, sheath. g and h, spikelet.","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/a84edb6839677cc7f9a2c04c.png"},{"id":16591190,"identity":"4ec90388-f64b-434d-ade6-bfdb42c0f2a0","added_by":"auto","created_at":"2021-12-19 15:44:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1083937,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/b8e5a052-0108-4a1d-8b53-c7e97e0d4962.pdf"},{"id":16317677,"identity":"809c1265-027a-47bc-acd6-a2ce6a9738db","added_by":"auto","created_at":"2021-12-09 15:38:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":495949,"visible":true,"origin":"","legend":"Additional file 1: Fig S1","description":"","filename":"SupplementaryFigure1.docx","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/1da214c58673712aa7a8a494.docx"},{"id":16317682,"identity":"b473d284-1d32-447c-b710-f5b90fc4a462","added_by":"auto","created_at":"2021-12-09 15:38:50","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":463682,"visible":true,"origin":"","legend":"Additional file 1: Fig S2","description":"","filename":"SupplementaryFigure2.docx","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/9dc8fa96cb34bfa6bf0ee9fb.docx"},{"id":16317678,"identity":"b9168cfd-1686-41a5-9474-05799ee90ad4","added_by":"auto","created_at":"2021-12-09 15:38:49","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":18138,"visible":true,"origin":"","legend":"Additional file 3: Table S1","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/d47576e783119883352bd579.docx"},{"id":16317683,"identity":"193b8b68-312f-4d7d-942b-394680e4d2db","added_by":"auto","created_at":"2021-12-09 15:38:50","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":16762,"visible":true,"origin":"","legend":"Additional file 3: Table S2","description":"","filename":"SupplementaryTable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/e28e29e11f542b6e83f6299a.docx"},{"id":16317727,"identity":"43a214ad-3956-4a1c-be47-1f30833ee874","added_by":"auto","created_at":"2021-12-09 15:41:49","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":14587,"visible":true,"origin":"","legend":"Additional file 3: Table S3","description":"","filename":"SupplementaryTable3.docx","url":"https://assets-eu.researchsquare.com/files/rs-1147067/v1/2c023b6504a5dc7c932b9855.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMutation of \u003cem\u003eOsCAX1a\u003c/em\u003e Results in Panicle Degeneration in Rice\u003c/p\u003e","fulltext":[{"header":"Findings","content":"\u003cp\u003eRice (\u003cem\u003eOryza sativa\u003c/em\u003e) is an important food crop that serves as a staple food for greater than half of the world\u0026apos;s population (Tero et al. 2010). Increased yield represents the major purpose of rice genetics and breeding, which is of great significance for satisfying food\u0026nbsp;requirements\u0026nbsp;(Pushpendra et al. 2006). Grain yield in rice is a complex agronomic trait\u0026nbsp;that\u0026nbsp;is mainly determined by the number of differentiated spikelets per panicle, 1000-grain weight and the number of panicles,\u0026nbsp;and\u0026nbsp;the number of differentiated spikelets is a major contributor to grain yield (Xing and Zhang, 2010; Asif et al. 2019). The occurrence of panicle degeneration during floret development is widespread in rice breeding and production, which causes\u0026nbsp;an\u0026nbsp;approximately 20% reduction in yield. Moreover, the rate of panicle degeneration ranges from 50% to 60% under extreme weather conditions (Yamagishi et al. 2004; Zhang et al. 2017). Thus, understanding the molecular mechanisms and discovering the key genes involved in panicle development\u0026nbsp;are\u0026nbsp;important to breed high-yield\u0026nbsp;rice varieties.\u003c/p\u003e\n\u003cp\u003ePanicle differentiation in rice is regulated by a complex network of genes and initiates with the change in shoot meristems to the progression of axillary meristems (AMs).\u0026nbsp;Subsequently, AMs are derived by the genes that control meristem transition to floral meristems (FMs) (Huijser and Schmid, 2011). Transcriptome\u0026nbsp;research has revealed that 357 genes\u0026nbsp;play\u0026nbsp;an essential role in panicle development,\u0026nbsp;and some of these genes are involved in the regulation of panicle degeneration (Wang et al. 2011). For example, LAX1/2 (LAX panicle 1/2), SPA (small panicle), MOC1 (MONOCULM 1) and OsH1 (\u003cem\u003eOryza staiva\u003c/em\u003e homeobox 1) are involved in\u0026nbsp;AM\u0026nbsp;development,\u0026nbsp;and their mutants displayed fewer spikelets and reduced branching (Tabuchi et al. 2011; Komatsu et al. 2003; Li et al. 2003; Sinha et al. 1997). In FMs, APO1 regulate the expression of C-class homeotic genes, and their overexpression\u0026nbsp;result in\u0026nbsp;an increased panicle size (Ikeda et al. 2007). APO2 suppressed the transition from\u0026nbsp;the\u0026nbsp;inflorescence meristem to FMs through interaction with APO1 (Ikedakawakatsu et al. 2012).\u003c/p\u003e\n\u003cp\u003eRecently, research have found that the limitation of source transportation can also result in panicle degeneration in rice. SP1 (short panicle 1)\u0026nbsp;regulates\u0026nbsp;nitrate transportation to maintain panicle size\u0026nbsp;by\u0026nbsp;encoding PTR (peptide transporter), which\u0026nbsp;is\u0026nbsp;involved in the transportation of different assimilates to different parts of plants (Li et al. 2009). However, neither nitrate transporter activity nor any other compounds transported by known PTR proteins could be found, suggesting that SP1 may need other component(s) to be able to function as a transporter. Encoding a lipid transfer protein, OsC6 plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice (Zhang et al. 2010). Tut-1 mutants exhibit defects in the arrangement of actin filaments in trichome, indicating that TUT1 is a functional SCAR/WAVE protein and plays an essential role in panicle development (Bai et al. 2015). OsALMT7 (aluminum-activated malate transporter 7) maintains\u0026nbsp;sink size and grain yield in rice by transporting malate into the apical portion of\u0026nbsp;the\u0026nbsp;panicle,\u0026nbsp;and\u0026nbsp;its\u0026nbsp;mutant exhibits apical panicle degeneration that was accompanied\u0026nbsp;by\u0026nbsp;cell death (Heng et al. 2018).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInorganic cations are important components of plant nutrition and play an essential role in physiological and cellular processes. Their precise redistributions are regulated by vacuolar antiporters, which are important elements in mediating the intracellular sequestration of these cations (Manohar et al. 2011). In the \u003cem\u003eArabidopsis\u003c/em\u003e genome, 855 open reading frames code for transporters among the predicted 25498 genes (Shigaki and Hirschi, 2006). One class of transporter protein that mediates the vectorial transport of both Ca\u003csup\u003e2+\u003c/sup\u003e and other metal ions is the Cation/H\u003csup\u003e+\u003c/sup\u003e exchanger (CAX), a secondary energised transporter that is dependent on a proton (H\u003csup\u003e+\u003c/sup\u003e) gradient across a membrane (Pittman and Hirschi, 2016). The past several years has found that CAXs are involved in a number of important aspects of plants growth and development, especially in crops nutritional enhancement and mitigating pollutants in soils (Conn et al. 2011). However, there is no report of the relationship between Cation/H\u003csup\u003e+\u003c/sup\u003e exchanger and panicle development and degeneration yet.\u003c/p\u003e\n\u003cp\u003eIn this study, to discover the key genes involved in panicle development, an \u003cem\u003eym48\u003c/em\u003e mutant was created from indica rice 93-11 through irradiation treatment. The \u003cem\u003eym48\u003c/em\u003e mutant was morphologically similar to wild-type 93-11 before the heading stage (Fig. 1A). However, serious degeneration appeared in the top panicle of the \u003cem\u003eym48\u003c/em\u003e mutant at the heading stage (Fig. 1B). Specifically, the withered spikelet in the \u003cem\u003eym48\u003c/em\u003e mutant was dried and malformed compared to the wild-type, and the flower appeared pale in color and smaller, especially in anthers and stigmas (Fig. 1C). Regarding the number of kernels, the wild-type had approximately 190 kernels in the main panicle. However, the \u003cem\u003eym48\u003c/em\u003e mutant had an average degeneration rate of only 72, and the degeneration rate was approximately 40% compared to 1% in wild-type (Fig. 1G and H). With the exception of the bottom spikelet, which was not significantly different from the wild-type, the top and partial middle spikelets degenerated in the \u003cem\u003eym48\u003c/em\u003e mutant and largely led to a shorter panicle length (average 23.06 cm in 93-11, 16.72 cm in \u003cem\u003eym48\u003c/em\u003e) and plant height (average 116.99 cm in 93-11, 100.50 cm in \u003cem\u003eym48\u003c/em\u003e) (Fig. 1E and F). Regarding the tiller number and thousand seed weight, no obvious differences were noted between the wild-type and \u003cem\u003eym48\u003c/em\u003e mutant. In general, \u003cem\u003eym48\u003c/em\u003e is a typical panicle degeneration mutant that exhibits a significant reduction in grain yield.\u003c/p\u003e\n\u003cp\u003eTo investigate when degeneration of the top panicle starts to occur during panicle development in the \u003cem\u003eym48\u003c/em\u003e mutant, developmental process analysis was performed to compare the wild-type 93-11 and the \u003cem\u003eym48\u003c/em\u003e mutant. As shown in Fig. 1D, the developmental process was divided into 8 stages according to panicle length. Here, a to h corresponded to 0.5 cm, 1 cm, 3 cm, 6 cm, 10 cm, 14 cm, 18 cm and 22 cm, respectively. During early-stage development (panicle length \u0026lt; 6 cm), no obvious difference was noted between 93-11 and the \u003cem\u003eym48\u003c/em\u003e mutant (Fig. 1D a-c). When the panicle developed to approximately 6 cm, the top panicle stared to degenerate in the \u003cem\u003eym48\u003c/em\u003e mutant, and the specific characteristic was a black and wizened spikelet (Fig. 1D d). From this stage, the degeneration in the \u003cem\u003eym48\u003c/em\u003e mutant became more serious with panicle development (Fig. 1D e-h).\u003c/p\u003e\n\u003cp\u003eTo further determine the causal gene of the panicle degeneration phenotype in\u0026nbsp;the\u0026nbsp;\u003cem\u003eym48\u003c/em\u003e mutant, an F2 mapping population was constructed by crossing \u003cem\u003eym48\u003c/em\u003e with the indica cultivar \u0026ldquo;Yehesimiao\u0026rdquo;. In\u0026nbsp;the\u0026nbsp;F1 population, all individuals exhibited the normal phenotype. In\u0026nbsp;the\u0026nbsp;F2 population,\u0026nbsp;approximately\u0026nbsp;one-third of\u0026nbsp;individuals (1520/4891) showed\u0026nbsp;the panicle degeneration phenotype, indicating\u0026nbsp;that the panicle degeneration phenotype was regulated by\u0026nbsp;a\u0026nbsp;single recessive gene.\u0026nbsp;Next, these 1520\u0026nbsp;mutated\u0026nbsp;individuals were used for mapping. The \u003cem\u003eym48\u003c/em\u003e locus was initially mapped to the long arm of chromosome 1 between the markers IL-20 and IR-19 (Fig. 2A). After fine mapping, the mutation was further narrowed down to a 70-kb genomic region between markers RM11162 and IR-4, in which eleven ORFs were annotated (Fig. 2A). After\u0026nbsp;sequence comparison, a single nucleotide substitution of A to G in the 190\u003csup\u003eth\u003c/sup\u003e nucleotide in the first exon of LOC_Os01g37690 (\u003cem\u003eOsCAX1a\u003c/em\u003e) was noted in\u0026nbsp;the\u0026nbsp;\u003cem\u003eym48\u003c/em\u003e mutant, and the corresponding 64\u003csup\u003eth\u003c/sup\u003e amino acids\u0026nbsp;were\u0026nbsp;substituted from threonine (T) to alanine (A) (Fig. 2B).\u003c/p\u003e\n\u003cp\u003eTo verify whether the \u003cem\u003eOsCAX1a\u003c/em\u003e mutation was responsible for panicle degeneration in the \u003cem\u003eym48\u003c/em\u003e mutant, transgenic knockout and overexpression were subsequently performed. In transgenic knockout analysis, target sequences of ACTGGTTGCGGTCGTAGGGCTGG were selected as sgRNA, and the CRISPR/Cas9 recombinant plasmid was introduced into wild-type 93-11. Two transgenic knockout lines (\u003cem\u003ecas9-1\u003c/em\u003e and \u003cem\u003ecas9-2\u003c/em\u003e) were obtained, and all individuals showed the panicle apical degeneration phenotype, which is similar to that noted in the \u003cem\u003eym48\u003c/em\u003e mutant (Fig. 2C left). Sequences comparing \u003cem\u003ecas9-1\u003c/em\u003e, \u003cem\u003ecas9-2\u0026nbsp;\u003c/em\u003eand 93-11 indicated that dozens of nucleotides were deleted near the sgRNA (Fig. 2E). For transgenic overexpression analysis, the CDS region of the \u003cem\u003eOsCAX1a\u003c/em\u003e plus UBI promotor was inserted into pCAMBIA1301, and the recombinant plasmid was introduced into the \u003cem\u003eym48\u003c/em\u003e mutant. Two transgenic overexpression lines (\u003cem\u003eoe-1\u003c/em\u003e and \u003cem\u003eoe-2\u003c/em\u003e) were obtained, and the panicle degeneration phenotype was significantly recovered (Fig. 2C right). qRT\u0026ndash;PCR showed that the relative expression of \u003cem\u003eOsCAX1a\u003c/em\u003e in transgenic overexpression lines was increased compared to that in the \u003cem\u003eym48\u003c/em\u003e mutant (P value \u0026lt; 0.01) (Fig. 2D). Collectively, these results demonstrated that the \u003cem\u003eOsCAX1a\u003c/em\u003e mutation was responsible for panicle apical degeneration. To further identify whether the Ca\u003csup\u003e2+\u003c/sup\u003e transportation was effect in \u003cem\u003eym48\u003c/em\u003e mutant, hydroponic solutions with 7 different concentrations of CaCl\u003csub\u003e2\u003c/sub\u003e (0, 0.2, 0.5, 1, 5, 20 and 100 mM) were used in hydroponic experiment. As shown in Supplementary Fig. 1, the shoots development of\u003cem\u003e\u0026nbsp;ym48\u003c/em\u003e mutant which cultivated in 0, 0.2, 0.5, 20 and 100 mM CaCl\u003csub\u003e2\u003c/sub\u003e was torpid compared to wild-type 93-11, especially in 0 and 100 mM CaCl\u003csub\u003e2\u003c/sub\u003e groups, and had no obviously different in roots and normal CaCl\u003csub\u003e2\u0026nbsp;\u003c/sub\u003egroups. These results demonstrated that the A to G substitution at the 190\u003csup\u003eth\u003c/sup\u003e nucleotide reduced the tolerance from extreme Ca\u003csup\u003e2+\u003c/sup\u003e stress and the Ca\u003csup\u003e2+\u003c/sup\u003e transportation was effect in \u003cem\u003eym48\u003c/em\u003e mutant.\u003c/p\u003e\n\u003cp\u003eOsCAX1a\u0026nbsp;is\u0026nbsp;a Cation/H\u003csup\u003e+\u003c/sup\u003e exchanger and\u0026nbsp;plays\u0026nbsp;an essential role in Ca\u003csup\u003e2+\u003c/sup\u003e selection and transportation in rice (Kamiya and Maeshima, 2004). OsCAX1a\u0026nbsp;is a\u0026nbsp;member of\u0026nbsp;the\u0026nbsp;CAX family. Six\u0026nbsp;CAXs\u0026nbsp;have been\u0026nbsp;identified in \u003cem\u003eArabidopsis\u003c/em\u003e and rice:\u0026nbsp;AtCAX1, AtCAX2, AtCAX3, AtCAX4, AtCAX5, AtCAX6, AtCAX7,\u0026nbsp;OsCAX1a, OsCAX1b, OsCAX1c, OsCAX2, OsCAX3,\u0026nbsp;and\u0026nbsp;OsCAX4 (Supplementary Table 3) (Pittman and Hirschi, 2016).\u0026nbsp;To\u0026nbsp;identify the relevance of these protein sequences,\u0026nbsp;a\u0026nbsp;phylogenetic tree of\u0026nbsp;the\u0026nbsp;CAX family in \u003cem\u003eArabidopsis\u003c/em\u003e and rice\u0026nbsp;was\u0026nbsp;constructed using the NJ method and divided into two groups (Supplementary Fig. 2A). OsCAX1a, OsCAX1b, OsCAX1c, AtCAX1, AtCAX3 and AtCAX4 (Group I) exhibited significant homology, especially between OsCAX1a and OsCAX1b. Moreover, in the analysis of protein sequence alignment in\u0026nbsp;the\u0026nbsp;CAX family, the amino\u0026nbsp;acids\u0026nbsp;mutated in\u003cem\u003e\u0026nbsp;ym48\u003c/em\u003e were\u0026nbsp;all threonines in Group I and\u0026nbsp;were\u0026nbsp;highly\u0026nbsp;conserved. In contrast,\u0026nbsp;differentiation appeared in this amino acid in group II,\u0026nbsp;and these sequences were\u0026nbsp;deficient\u0026nbsp;in OsCAX4 (Supplementary Fig. 2B). Previous research has suggested that gene structural diversity is an important resource for multigene family evolution (Liu et al. 2009). To elucidate the structural similarity and diversity of CAXs in \u003cem\u003eArabidopsis\u003c/em\u003e and rice, schematic diagrams of exons and introns were constructed. As shown in Supplementary Fig. 2C, slightly different numbers of exons were found in CAX genes, varying from 8 to 12. Except for OsCAX1c,\u0026nbsp;the\u0026nbsp;CAX family exhibited\u0026nbsp;a\u0026nbsp;similar construction of exons and introns, which would contribute to the explanation of functional\u0026nbsp;conservation. Next, 20 conserved motifs were identified in CAX proteins using MEME tools. The composition and arrangement of these motifs were largely consistent with previous phylogenetic analysis (Supplementary Fig. 2D). Motif 9, which included the mutated amino acid in \u003cem\u003eym48\u003c/em\u003e, was present in\u0026nbsp;all\u0026nbsp;CAX family members except OsCAX4. These results implied that these sequences might play an essential role in\u0026nbsp;Ca\u003csup\u003e2+\u003c/sup\u003e selection and transportation. The specific sequence information\u0026nbsp;is\u0026nbsp;listed in Supplementary Table 2.\u003c/p\u003e\n\u003cp\u003eNext, the expression pattern of \u003cem\u003eOsCAX1a\u003c/em\u003e was investigated by qRT\u0026ndash;PCR. \u003cem\u003eOsCAX1a\u003c/em\u003e expression was detected in all rice organs analyzed. Relatively higher expression was noted in roots, stems and panicles, and lower expression was noted in other organs, including leaves and sheaths (Fig. 3A). A detailed expression analysis focusing on the panicle implied that \u003cem\u003eOsCAX1a\u003c/em\u003e expression increased continuously during panicle development (Fig. 3B). The \u003cem\u003eOsCAX1a\u003c/em\u003e expression pattern was further evaluated in plants transformed with a GUS reporter gene driven by a 2500-bp promoter sequence of \u003cem\u003eOsCAX1a\u003c/em\u003e. We observed GUS activity in various organs examined. The strongest staining was noted in\u0026nbsp;the\u0026nbsp;shoot, panicle and stem, and slight staining was noted in\u0026nbsp;the\u0026nbsp;leaf and sheath, which is consistent with the qRT\u0026ndash;PCR analysis results (Fig. 3C). As a Ca\u003csup\u003e2+\u003c/sup\u003e transporter, OsCAX1a is highly expressed in roots and stems and is responsible for Ca\u003csup\u003e2+\u0026nbsp;\u003c/sup\u003eabsorption and transportation. However, \u003cem\u003eOsCAX1a\u003c/em\u003e was also highly expressed in panicles, and its expression increased with panicle development. The function of\u003cem\u003e\u0026nbsp;OsCAX1a\u003c/em\u003e in rice panicles remains unclear, and these results might indicate that \u003cem\u003eOsCAX1a\u003c/em\u003e plays an important role in panicle development and differentiation.\u003c/p\u003e\n\u003cp\u003ePanicle degeneration is a widespread physiological problem that reduces grain yield in rice and other cereal crops (Yamagishi et al. 2004). However, the genetic and molecular mechanisms regulating panicle degeneration remain poorly understood. Various factors could lead to panicle degeneration in rice, including abnormal\u0026nbsp;meristem\u0026nbsp;development,\u0026nbsp;phytohormone\u0026nbsp;variation, source transport limitation,\u0026nbsp;and\u0026nbsp;abiotic stresses (Ali et al. 2019). Our research demonstrated that Ca\u003csup\u003e2+\u003c/sup\u003e transportationmight\u0026nbsp;be\u0026nbsp;closely\u0026nbsp;associated\u0026nbsp;with panicle degeneration in rice. Ca\u003csup\u003e2+\u003c/sup\u003e played an essential role in plants. First, Ca\u003csup\u003e2+\u003c/sup\u003e is\u0026nbsp;an essential nutrient element for plants. Ca\u003csup\u003e2+\u003c/sup\u003e constitutes\u0026nbsp;the main component of\u0026nbsp;the\u0026nbsp;plant cell wall and cell membrane, accounting for 10% of plant dry weight (Marschner H, 1995). Second, Ca\u003csup\u003e2+\u003c/sup\u003e is one of the most important second messengers in plant cell signal transportation. A variety of external stimuli could cause changes in Ca\u003csup\u003e2+\u003c/sup\u003e concentration ([Ca\u003csup\u003e2+\u003c/sup\u003e] \u003csub\u003eCyT\u003c/sub\u003e) in\u0026nbsp;the\u0026nbsp;plant cytoplasm, thus transforming external signals into internal signals that can be sensed by plants to induce a series of physiological and biochemical reactions, achieving plant perception and responding to environmental stimuli and developmental information (Sanders et al. 2002).\u003c/p\u003e\n\u003cp\u003eTo maintain Ca\u003csup\u003e2+\u003c/sup\u003e balance in the body, plants must complete Ca\u003csup\u003e2+\u003c/sup\u003e transport through the Ca\u003csup\u003e2+\u003c/sup\u003e transfer system. There were two types of Ca\u003csup\u003e2+\u003c/sup\u003e channels: (1) Ca\u003csup\u003e2+\u003c/sup\u003e inward transporters transport Ca\u003csup\u003e2+\u003c/sup\u003e from the outside of the cell into the cytoplasm and (2) the outward transport system is responsible for transporting Ca\u003csup\u003e2+\u003c/sup\u003e out of the cytoplasm or into organelles, such as vacuoles. These transport systems included Ca\u003csup\u003e2+\u003c/sup\u003e-ATPase and Ca\u003csup\u003e2+\u003c/sup\u003e/H\u003csup\u003e+\u003c/sup\u003e reverse transporters. As a class of Ca\u003csup\u003e2+\u003c/sup\u003e outward transporters, Ca\u003csup\u003e2+\u003c/sup\u003e/H\u003csup\u003e+\u003c/sup\u003e reverse transporters play an important role in plants. Firstly, after completing their messenger role, they restored Ca\u003csup\u003e2+\u003c/sup\u003e concentration in the cytoplasm to the resting level in preparation for the initiation of the next signal. Second, Ca\u003csup\u003e2+\u003c/sup\u003e was correctly allocated to each organelle to ensure the progress of various specific biochemical reactions (White et al. 2003). Third, Ca\u003csup\u003e2+\u003c/sup\u003e is stored in intracellular and extracellular calcium banks and interacts with Ca\u003csup\u003e2+\u003c/sup\u003e channels to ensure the generation and completion of cell signals (Sanders et al. 2002). Since the first Ca\u003csup\u003e2+\u003c/sup\u003e/H\u003csup\u003e+\u003c/sup\u003e reverse transporter (VCX1) was identified in the tonoplast \u003cem\u003eof Saccharomyces\u0026nbsp;\u003c/em\u003eCerevissiae, an increasing number of Ca\u003csup\u003e2+\u003c/sup\u003e/H\u003csup\u003e+\u003c/sup\u003e reverse transporters have been found in plants, including maize, rice, \u003cem\u003eArabidopsis\u003c/em\u003e (Vicente et al. 1995; Shigaki et al. 2000; Kamiya et al. 2004).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, fine mapping\u0026nbsp;showed\u0026nbsp;that A to G substitution at the 190\u003csup\u003eth\u003c/sup\u003e nucleotide (64\u003csup\u003eth\u003c/sup\u003e amino acid was changed from threonine to alanine) in OsCAX1a resulted\u0026nbsp;in\u0026nbsp;panicle degeneration in\u0026nbsp;the\u0026nbsp;\u003cem\u003eym48\u003c/em\u003e mutant. Actually, Ca\u003csup\u003e2+\u003c/sup\u003e transportation was also affected by this mutation. In the hydroponic experiment, tolerance\u0026nbsp;to\u0026nbsp;extreme Ca\u003csup\u003e2+\u0026nbsp;\u003c/sup\u003econcentrations\u0026nbsp;was altered in\u0026nbsp;the\u0026nbsp;\u003cem\u003eym48\u003c/em\u003e mutant compared to wild-type 93-11, which exhibited torpid development. Previous research\u0026nbsp;has\u0026nbsp;suggested that OsCAX1a\u0026nbsp;has\u0026nbsp;11 predicted transmembrane domains (TMs) and\u0026nbsp;is\u0026nbsp;divided into three characteristic domains: the N-terminal regulatory region, the calcium domain, and the C domain (Kamiya and Maeshima, 2004). The N-terminal regulatory region\u0026nbsp;has\u0026nbsp;been shown to suppress Ca\u003csup\u003e2+\u003c/sup\u003e transport activity by interacting with its neighboring N-terminal sequence. The domain between TM1 and TM2 was thought to be involved in the selection of Ca\u003csup\u003e2+\u003c/sup\u003e. In\u0026nbsp;the\u0026nbsp;\u003cem\u003eym48\u003c/em\u003e mutant, the 64\u003csup\u003eth\u003c/sup\u003e amino\u0026nbsp;acid\u0026nbsp;was changed from threonine to alanine, and this amino acid is located in front of TM1. However, current studies\u0026nbsp;have\u0026nbsp;paid little attention to this domain,\u0026nbsp;and its specific function remains unclear.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, a highly conserved amino acid site mutation of Cation/H\u003csup\u003e+\u003c/sup\u003e exchanger OsCAX1a was identified in \u003cem\u003eym48\u003c/em\u003e mutant and generated the serious apical panicle degeneration in rice. Also, the tolerance from Ca\u003csup\u003e2+\u003c/sup\u003e stress was damaged due to the mutation. \u003cem\u003eOsCAX1a\u003c/em\u003e highly expressed in roots, stems and panicles and that its expression increased with panicle development. This novel relationship between Ca\u003csup\u003e2+\u003c/sup\u003e transportation and panicle degeneration was not reported before and our research provided a new view point to explore the mechanism of panicle development and degeneration in rice.\u003c/p\u003e"},{"header":"Abbreviations","content":"GUS: β-glucuronidase; AMs: axillary meristems; FMs: floral meristems; T: threonine; A: alanine; TMs: transmembrane domains"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors reviewed the manuscript and agreed to publish it.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data sets supporting the results of this article are included within the article and its additional files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Major science and Technology Projects of Anhui Province (No. 202003a06020005 \u0026amp; No. 201903a06020012), Open Funding of Rice Genetics and Breeding of Anhui Province Key Laboratory (No. SDKF-2021-03 \u0026amp; No. SDKF-2020-01) and Natural Science Foundation of Anhui Province (No.\u0026nbsp;1908085QC135).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQG, FS, CL and DN conceived and designed the experiments. QG implemented the experiments and prepared the manuscript. FS guided the molecular experiments. CL and DN collected the field data. QG analyzed the results. QG, FS, CL and DN revised the manuscript. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAsif A, Xu P, Riaz A, Wu X (2019) Molecular sciences review current advances in molecular mechanisms and physiological basis of panicle degeneration in rice. International Journal of Molecular Sciences 20(7):1613\u003c/li\u003e\n\u003cli\u003eBai J Zhu X, Wang Q, Zhang J, Chen H (2015) Ricetutou1encodes a suppressor of camp receptor-like protein that is important for actin organization and panicle development. Plant Physiology 169(2):1179\u0026ndash;1191\u003c/li\u003e\n\u003cli\u003eConn S, Gillham M, Athman A, Schreiber A, Baumann U, Moller I (2011) Cell-specific vacuolar calcium storage mediated by CAX1 regulates apoplastic calcium concentration, gas exchange, and plant productivity in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 23:240\u0026ndash;257\u003c/li\u003e\n\u003cli\u003eHeng Y, Wu C, Long Y, Luo S, Ma J, Chen J (2018) OsALMT7 maintains panicle size and grain yield in rice by mediating malate transport. Plant Cell 30(4):889\u0026ndash;906\u003c/li\u003e\n\u003cli\u003eHuijser P, Schmid M (2011) The control of developmental phase transitions in plants. Development 138(19):4117\u0026ndash;4129\u003c/li\u003e\n\u003cli\u003eIkeda K, Ito M, Nagasawa N, Kyozuka J, Nagato Y (2007) Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate. Plant J 51:1030\u0026ndash;1040\u003c/li\u003e\n\u003cli\u003eIkedakawakatsu K, Maekawa M, Izawa T, Itoh J, Nagato Y (2015) ABERRANT PANICLE ORGANIZATION 2/RFL, the rice ortholog of \u003cem\u003eArabidopsis\u003c/em\u003e LEAFY, suppresses the transition from inflorescence meristem to floral meristem through interaction with APO1. The Plant Journal 69(1):168\u0026ndash;180\u003c/li\u003e\n\u003cli\u003eKamiya T, Maeshima M\u0026nbsp;(2004)\u0026nbsp;Residues in internal repeats of the rice Cation/H\u003csup\u003e+\u003c/sup\u003e exchanger are involved in the transport and selection of cations. Journal of Biological Chemistry 279(1):812\u0026ndash;819\u003c/li\u003e\n\u003cli\u003eKomatsu K (2003) LAX and SPA: major regulators of shoot branching in rice. Proceedings of the National Academy of Sciences\u0026nbsp;100(20):11765\u0026ndash;11770\u003c/li\u003e\n\u003cli\u003eLi S, Qian Q, Fu Z, Zeng D, Meng X, Kyozuka J (2009) Short panicle 1 encodes a putative PTR family transporter and determines rice panicle size. The Plant Journal 58(4):592\u0026ndash;605\u003c/li\u003e\n\u003cli\u003eLi X, Qian Q, Fu Z, Wang Y, Xiong G, Zeng D (2003) Control of tillering in rice. Nature 422(6932):618\u0026ndash;621\u003c/li\u003e\n\u003cli\u003eLiu SL, Zhuang Y, Zhang P, Adams KL (2009) Comparative analysis of structural diversity and sequence evolution in plant mitochondrial genes transferred to the nucleus. Mol Biol Evol 26(4):875\u0026ndash;891\u003c/li\u003e\n\u003cli\u003eManohar M, Shigaki T, Hirschi T (2011) Plant cation/H\u003csup\u003e+\u003c/sup\u003e exchangers (CAXs): biological functions and genetic manipulations. Plant Biol 13(4):561\u0026ndash;569\u003c/li\u003e\n\u003cli\u003eMarschner H (1995) Mineral nutrition of higher plants, 2ed edn. London. Academic Press.\u003c/li\u003e\n\u003cli\u003ePittman JK, Hirschi KD (2016) Phylogenetic analysis and protein structure modelling identifies distinct Ca\u003csup\u003e2+\u003c/sup\u003e/Cation antiporters and conservation of gene family structure within \u003cem\u003eArabidopsis\u003c/em\u003e and rice species. Rice 9(1):3\u003c/li\u003e\n\u003cli\u003ePushpendra KG, Rustgi S, Kumar N (2006) Genetic and molecular basis of grain size and grain number and its relevance to grain productivity in higher plants. Genome 49(6):565\u0026ndash;571\u003c/li\u003e\n\u003cli\u003eSanders D, Pelloux J, Brownlee C, Harper JF (2002) Calcium at the crossroad of signaling. Plant Cell 14:S401\u0026ndash;S417\u003c/li\u003e\n\u003cli\u003eShigaki T, Hirschi K (2000) Characterization of Cax-like genes in plants: implications for functional diversity. Gene 257(2):291\u0026ndash;298\u003c/li\u003e\n\u003cli\u003eShigaki T, Hirschi K (2006) Diverse functions and molecular properties emerging for CAX cation/H+ exchangers in plants. Plant Biol 8(4):419\u0026ndash;429\u003c/li\u003e\n\u003cli\u003eSinha NR, Williams RE, Hake S (1997) Overexpression of the maize homeo box gene, KNOTTED-1, causes a switch from determinate to indeterminate cell fates. Genes \u0026amp; Development 7(5):787\u0026ndash;795\u003c/li\u003e\n\u003cli\u003eTabuchi H, Zhang Y, Hattori S, Omae M, Sato Y (2011) LAX PANICLE2 of rice encodes a novel nuclear protein and regulates the formation of axillary meristems. Plant Cell 23(9):3276\u0026ndash;3287\u003c/li\u003e\n\u003cli\u003eTerao T, Nagata K, Morino K, Hirose T (2010) A gene controlling the number of primary rachis branches also controls the vascular bundle formation and hence is responsible to increase the harvest index and grain yield in rice. Theoretical and Applied Genetics 120(5):875\u0026ndash;893\u003c/li\u003e\n\u003cli\u003eVicente J, Graca M, Vale P (1995) Activities of Ca\u003csup\u003e2+\u003c/sup\u003e pump and low affinity Ca\u003csup\u003e2+\u003c/sup\u003e/H\u003csup\u003e+\u003c/sup\u003e antiport in plasma membrane vesicles of corn roots. Journal of Experimental Botany 46:1551\u0026ndash;1559\u003c/li\u003e\n\u003cli\u003eWang D, Pan Y, Zhao X, Zhu L, Fu B, Li Z (2011) Genome-wide temporal-spatial gene expression profiling of drought responsiveness in rice. BMC Genom 12:149\u003c/li\u003e\n\u003cli\u003eWhite PJ, Broaley MR (2003) Calcium in plant. Annals of Botany 92:487\u0026ndash;511\u003c/li\u003e\n\u003cli\u003eXing Y, Zhang Q (2010) Genetic and molecular bases of rice yield. Annu. Rev. Plant Biol 61:421\u0026ndash;442\u003c/li\u003e\n\u003cli\u003eYamagishi J, Miyamoto N, Hirotsu S, Laza RC, Nemoto K (2004) QTLs for branching, floret formation, and pre-flowering floret abortion of rice panicle in a temperate japonica x tropical japonica cross. Theoretical \u0026amp; Applied Genetics 109(8):1555\u0026ndash;1561\u003c/li\u003e\n\u003cli\u003eZhang D, Liang W, Yin C, Zong J, Gu F, Zhang D (2010) Osc6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice. Plant Physiology 154(1):149\u0026ndash;162\u003c/li\u003e\n\u003cli\u003eZhang W, Chen Y, Wang Z, Yang J (2017) Polyamines and ethylene in rice young panicles in response to soil drought during panicle differentiation. Plant Growth Regulation 82(3):491\u0026ndash;503\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Panicle degeneration, OsCAX1a, Fine mapping, Expression pattern, Rice","lastPublishedDoi":"10.21203/rs.3.rs-1147067/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1147067/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Rice is one of the most common cereal crops in China. Increasing the yield of rice has always been a primary purpose of rice breeding. However, panicle degeneration in rice, a complex characteristic regulated by many genes and commonly encountered in rice production, seriously reduces the yield. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFindings\u003c/strong\u003e: In this study, we obtained a new apical panicle degeneration mutant named \u003cem\u003eym48\u003c/em\u003e, which exhibits a serious degeneration rate and reduced grain yield in rice. After fine mapping, the \u003cem\u003eOsCAX1a\u003c/em\u003e gene responsible for Ca\u003csup\u003e2+\u003c/sup\u003e selection and transportation was identified. In the \u003cem\u003eym48\u003c/em\u003e mutant of the \u003cem\u003eOsCAX1a\u003c/em\u003e gene, a A to G substitution was noted at the 190\u003csup\u003eth\u003c/sup\u003e nucleotide, and the corresponding 64\u003csup\u003eth\u003c/sup\u003e amino acid was changed from threonine to alanine. Also, the tolerance from Ca\u003csup\u003e2+\u003c/sup\u003e stress was damaged due to the mutation. Phylogenetics, protein sequence alignment and motif identification of CAX family members in \u003cem\u003eArabidopsis\u003c/em\u003e and rice indicated that this mutation site was highly conserved and might play an essential role in Ca\u003csup\u003e2+\u003c/sup\u003e transportation. Moreover, the \u003cem\u003eOsCAX1a\u003c/em\u003e expression pattern was analyzed in rice. qRT-PCR and GUS (β-glucuronidase) staining experiments showed that \u003cem\u003eOsCAX1a \u003c/em\u003ewas highly expressed in roots, stems and panicles and that its expression increased with panicle development. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e: These results demonstrated that \u003cem\u003eOsCAX1a\u003c/em\u003e played an essential role in the regulation of panicle development for the first time and mutation of \u003cem\u003eOsCAX1a\u003c/em\u003e would generate the panicle degeneration in rice. This study provided a new view point to explore the mechanism of panicle development and degeneration in rice.\u003c/p\u003e","manuscriptTitle":"Mutation of OsCAX1a Results in Panicle Degeneration in Rice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-12-09 15:38:48","doi":"10.21203/rs.3.rs-1147067/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"56fa0d6a-192a-4e03-b37b-6dcd84ce0b9f","owner":[],"postedDate":"December 9th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":9046470,"name":"Agronomy"}],"tags":[],"updatedAt":"2021-12-19T15:44:08+00:00","versionOfRecord":[],"versionCreatedAt":"2021-12-09 15:38:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1147067","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1147067","identity":"rs-1147067","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}