Methods
The expression of Glra3 in the nervous system was investigated in the Zeisel et al. (2018) scRNA-seq dataset [ 22 ]. The dataset ‘l5_all.loom’ was acquired from http://linnarssonlab.org/ and contains expression data of 27,998 genes in 160,796 single-cells from Vgat-Cre; tdTomato mice (with CD-1 and C57BL/6J background) to target inhibitory neurons and Wnt1-Cre; R26Tomato mice (with C57BL/6J background) to isolate neurons in the peripheral and enteric nervous systems. The scRNA-seq data was obtained using the 10X Genomics method. The dataset was analyzed using SCANPY 1.9.1 [ 36 ] in Python 3.8.8 in similarity as described before [ 37 ] and the full code can be found at https://github.com/HannahMWeman/glra3-expression-analysis-in-the-nervous-system . Firstly, all annotated neurons were isolated from the dataset to be used for basic preprocessing, resulting in 74,539 neurons and 27,998 genes. For gene filtering, all genes that were expressed in less than 3 cells (sc.pp.filter_genes) and all cells expressing less than 200 genes (sc.pp.filter_cells) were excluded, resulting in 74,529 neurons and 21,194 genes. Subsequently, for basic preprocessing, the metrics of the general gene expression and mitochondrial genes were calculated (SCANPY, pp.calculate_gc_metrics) [ 38 ]. By visualizing the distribution of the calculated metrics (SCANPY, pl.violin; Seaborn, jointplot), the cells with lower mitochondrial gene expression (SCANPY, ‘pct_counts_mt’ 6.5), and distributed gene counts and broad gene capture (SCANPY, ‘logp_n_genes_by_counts’ > 6.0, ‘pct_counts_in_top_50_genes’ < 50) were isolated. The dataset did not contain External RNA Controls Consortium (ERCC) genes since the 10 × Genomics method does not include ERCC sequences, thus cells were not filtered based on expression criteria of these sequences. All the inclusion criteria resulted in 72,020 neurons and 21,194 genes to be used for the scRNA-seq analysis. Finally, the counts per cell was normalized to the medium number of counts (SCANPY, pp.normalize_per_cell) followed by normalization (SCANPY, pp.log1p).
The expressions of Glra3 , as well as excitatory Slc17a6 ( Vglut2 ) and inhibitory Slc32a1 ( Viaat ) markers, were visualized in the respective nervous system area (SCANPY, pl.DotPlot). Moreover, the prevalence of Glra3 expression ( Glra3 considered expressed if log1p > 0.1) was calculated for the respective nervous system area. The expression patterns of Slc17a6 and Slc32a1 were more extensively examined in all of the Glra3 neurons (a total of 628 neurons expressed Glra3 ) in the different nervous system areas by visualization (SCANPY, pl.DotPlot) and occurrence calculations.
Protocols related to animal use in this study were approved by the local animal research ethical committee (Uppsala djurförsöksetiska nämnd) and followed the Swedish Animal Welfare Act [Svensk författningssamling (SFS) 2018:1192], The Swedish Animal Welfare Ordinance (SFS 2019:66) and the Regulations and General Advice for Laboratory Animals (SJVFS 2019:9, Saknr L 150). Both female and male C57BL/6J mice (Taconic, Denmark) were included in the analysis. The mice were housed with littermates in approximately 501 cm 2 cages (maximum 5 mice in per cage), in room temperature ranging between 20 and 24 °C and humidity of 45–65% on a 12-h light:dark cycle with lights on at 6 am. All animals were provided food (Diet Pellets, Scanbur, Sweden) and tap water ad libitum . All procedures were planned and executed to minimize stress, and euthanasia was performed during the light period of the light:dark cycle.
Tissues from five adult male C57BL/6J mice (10–14 weeks) had previously been collected and prepared as specified in [ 34 , 35 ], where the striatum samples comprised of the caudate putamen and nucleus accumbens. The gDNA was previous collected and was a gift from Prof. Robert Fredriksson [ 39 ]. To add to this tissue mRNA panel, five adult female (14 weeks old) and five adult male (10–11 weeks old) C57BL/6J mice were euthanized via cervical dislocation, without prior treatment, during the light period. All tissues were collected on ice. The following tissues/areas were collected from the five females. The whole brain was scooped out leaving the majority of the main olfactory bulb in the scull. The pituitary gland was collected from sella turcica and the hypothalamus was collected from the brain using forceps. The brain was then placed in a mouse brain matrix (Activational Systems Inc., Warren, MI, USA; 1 mm) and sliced manually using matrices blades (ALTO Matrix Cutting Blades, AgnTho’s, Lidingö, Sweden). From coronal sections, the most frontal part of the cortex (herein cortex; containing main olfactory bulb, accessory olfactory bulb, anterior olfactory nucleus, orbital cortex, and frontal association cortex), caudate putamen (herein striatum), thalamus, hippocampus and amygdala were manually dissected with guidance from a mouse brain atlas [ 40 ] and collected. The whole cerebellum and brainstem were collected. Moreover, the following tissues were collected: spinal cord (late thoracic to sacral divisions), heart, small intestine, kidney, liver, lung, spleen, testes, thymus, and uterus. For the additional five male mice dissected for this paper, only amygdala, pituitary gland, and thalamus were dissected, as described for the females, to complement the other male panel [ 34 , 35 ].
All tissues were collected within 10–15 min after sacrifice and stored in RNAprotect© Tissue Reagent (Qiagen, Germany) for 2 h at room temperature. All samples were then frozen at -80 °C before further processing.
Total RNA was extracted using Absolutely RNA Mini kit (Qiagen, Germany) according to the manufacturer’s protocol. RNA concentrations were measured using ND-1000 spectrophotometer (NanoDrop Technologies, USA). The cDNA synthesis was performed using the Applied Biosystems High Capacity RNA-to-cDNA kit (Invitrogen, USA) following manufacturer’s instructions. 2 μg RNA template was used for the reaction and the cDNA samples were diluted to 10 ng/μl.
Primers were designed using Primer3 ( Glra3 ) [ 41 ] or Beacon Design 8 (Premier Biosoft) (reference housekeeping genes). The primers were screened using BLAST and global alignments [ 42 ] to avoid primer pairs that can cause non-specific amplification. Glra3 primers: forward 5′- cggaagcttttgcactggag -3′, reverse 5′- tggaaccacaccatccttgg -3′ . Reference housekeeping genes: ribosomal protein L19 ( Rpl19 ) forward 5′- aatcgccaatgccaactc -3′, reverse 5′- ggaatggacagtcacagg -3′, Peptidylprolyl isomeras A ( Cyclo ) forward 5′- tttgggaaggtgaaagaagg -3′, reverse 5′- acagaaggaatggtttgatgg -3′, glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) forward 5′- gccttccgtgttcctacc -3′, reverse 5′- gcctgcttcaccaccttc -3′ and actin-related protein 1B ( Actb ) forward 5′- ccttcttgggtatggaatcctgtg -3′, reverse 5′- cagcactgtgttggcatagagg -3′.
Glra3 expression was determined using qRT-PCR. Final volume for each reaction was 20 μl containing 3.6 μl 10 × DreamTaq Buffer (Thermo Fisher Scientific, USA), 0.2 μl of 20 mM dNTP mix (Invitrogen, USA), 1 μl DMSO, 0.5 μl SYBR Green (1:10,000, Invitrogen, USA) in 1 × TE buffer (pH 7.8), 0.08 μl DreamTaq polymerase (5 U/μl, Thermo Fisher Scientific, USA), 0.05 μl of forward and reverse primer (100 pmol/μl) and 5 μl cDNA (10 ng/μl). The volume was adjusted with sterile water. An iCycler real-time detection instrument (Bio-Rad, USA) was used with the following settings: initial denaturation for 30 s at 95 °C, 45 cycles of 10 s at 95 °C, 30 s at 55 °C for housekeeping genes or 55.7 °C for Glra3 and 30 s at 72 °C. A melting curve was generated by heating from 55 to 95 °C with 0.5 °C increments at 10 s dwell time and a plate read at each temperature. All qRT-PCR were run in triplicates and a negative control and genomic DNA (10 ng/ul) were included on each plate. Cycle threshold (Ct) values were collected via the CFX Maestro (Bio-Rad, USA) and primer efficiencies were calculated via LinRegPCR software. The melting curves were compared with the negative control to verify that only one product was amplified. The delta Ct method for multiple reference genes (according to [ 23 ]) was used to calculate the normalized and relative mRNA expression of Glra3, and differences in primer efficiency were accounted for. Biological outliers in nervous system tissues (one for hippocampus and one for cerebellum from male mice) were removed using the Grubbs outlier test with α = 0.05 before proceeding and 45 cycles were set as cut-off. The same settings for the Grubbs outlier test and cycle threshold cut-off were used for the identification of biological outliers in the visceral organs. The following biological outliers were consequently removed; heart (two females and two males), lung (two males), liver (one female and one male), spleen (one female) and kidney (one female). The log2 fold difference to the genomic DNA expression of Glra3 was calculated for all tissues and presented in the combined scatter-bar-plot graph (mean log2 difference against gDNA expression of Glra3 ± SEM).
Two adult female (13 weeks old) and two adult male (11–13 weeks old) C57BL/6J mice were intraperitoneally injected with 0.6 ml (1:1) Ketamin (Ketalar, 10 mg/ml, Pfizer, Sweden) and Medetomidine (Domitor, 1 mg/ml, Orion Pharma, Sweden) and subsequently perfused with autoclaved ice-cold 1 × PBS. To minimize the risk of contamination and altered gene expression, the following steps were performed as quickly as possible in autoclaved ice-cold 1 × PBS; the whole brains and all divisions of the spinal cord were dissected and cleaned from meninges, followed by embedding in optimal cutting temperature (OCT) medium (Bio-Optica, Italy) and snap-frozen on dry ice in -80 °C isopentane (Sigma-Aldrich, Germany). The tissues were stored in -80 °C until sectioning. The brains were cryo-sectioned (Leica Cryocut 1800, Leica, Germany) into 18 µm and the spinal cords into 14 µm sections and collected onto Superfrost Plus (Thermo Scientific, USA) slides. To prevent mRNA degradation and contamination, the completed series were stored at -21 °C until sectioning was completed. The slides were thereafter stored at -80 °C until the RNAscope Fluorescent Multiplex kit (Advanced Cell Diagnostics (ACD), USA, cat # 320850) protocol commenced.
Fluorescent in situ hybridization was performed to target the expression of Glra3 in various tissues using the RNAscope Fluorescent Multiplex kit (cat#: 320850, ACD, USA) in accordance with ACD guidelines for fresh frozen tissues with minor modifications [ 24 ] and as described previously [ 37 ]. In brief: the slides to be used were taken from -80 °C and immediately fixated in room temperature 4% PFA in 1 × PBS (Histolab, Sweden) for 15 min before being washed in autoclaved 1 × PBS for 2 min. The tissues were thereafter dehydrated in a step-wise increase of EtOH concentration; 3 min in 50%, 3 min in 70% and two times for 5 min in 100% (Merck KGaA, Damstadt, Germany). The slides were placed at room temperature for 5 min to dry whereafter a hydrophobic barrier was made around the slide area of interest (2 females and 2 males; brain: 2 sections/brain area of interest (Bregma 0.98, -1.34 and -6.84 mm [ 20 ] https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas ) from each animal; spinal cord: 4 sections/spinal cord division (cervical, thoracic, lumbar and sacral) from each animal [ 9 ] https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas ) using an ImmeEdge pen (Vector Laboratories, USA). The sections were thereafter incubated in Protease IV for 40 min at room temperature, followed by washing three times for 5 min in autoclaved 1 × PBS. The treatment was followed by incubation with the target probes; Glra3 : 490591-C2 and Slc17a6 (Vglut2) : 319171-C3 or Slc32a1 (Viaat) : 319191-C3 (1:50 in probe diluent, cat#: 300041) for 2 h at 40 °C in a hybridization oven (HybEZ™ II Oven, ACD, USA) (brain: 1 section/area from each animal per assay (Bregma 0.98, -1.34 and -6.84 mm [ 20 ] https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas ); spinal cord: 2 sections/division (cervical, thoracic, lumbar and sacral [ 9 ] https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas ) from each animal per assay). The following amplification steps were performed at 40 °C in an oven and the sections were washed two times for 2 min in room temperature washing buffer between each amplification step; AMP 1-FL for 30 min, AMP 2-FL for 15 min, AMP 3-FL for 30 min and AMP 4-FL for 15 min. Lastly, the slides were washed two times for 2 min in washing buffer before 30 s incubation in DAPI and mounting in Anti-Fade Fluorescence Mounting Medium (Abcam, UK). The slides were covered with glass slides (Menzel-Gläser, Germany) and were left at 4 °C to dry. The slides were stored at this temperature until imaging.
Images of the RNAscope treated sections were acquired with wide field 20 × magnification using an Axio Imager.Z2 (Zeiss, Germany). Whole section images were acquired as tiles in the DAPI (150 ms), Cy3 ( Glra3 detection, 4000 ms) and Cy5 ( Slc17a6 or Slc32a1 detection, 900 ms) channels. The images were handled for figure representation using the ZEISS ZEN 3.3 (blue edition) software, where the area outliners of the targeted brain structures were determined using the Allen mouse brain atlas ( https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas ).
The obtained relative mRNA values for female and male mice were checked for normality using the Shapiro-Wilk test before proceeding with the appropriate analysis. Kruskal-Wallis test and Mann-Whitney U-test were used to determine expressional differences against the background and tissues/areas of the nervous system of both females and males (Additional file 1 : Table S1). Furthermore, two-tailed Mann-Whitney U-test or unpaired t-test were used to calculate the difference between female and male mice for each tissue. Comparisons were considered significant at p < 0.05.
Results
Expression of Glra3 mRNA can be detected in several areas of the brain and spinal cord [ 4 , 5 , 8 ]. To further investigate the expression of Glra3 in the central and peripheral nervous system, its expression alongside expression of the excitatory marker Slc17a6 (Vglut2) and the inhibitory marker Slc32a1 (Viaat) were examined in neuronal cells from distinct nervous system areas in the Zeisel et al. (2018) scRNA-seq dataset [ 22 ]. Glra3 in the central and peripheral nervous system showed low levels of expression (as indicated by the light-blue colored dots) and was found to be aberrantly expressed throughout cells of a given group (as indicated by the size of the dots’ diameter) (Fig. 1 A, Table 1 ). In the brain, the highest occurrence (> 1.0%) of Glra3 expression was found in the amygdala (3.0% expressed Glra3 ) (Fig. 1 A, Table 1 ). Said brain region showed a small overlap between Glra3 and Slc17a6 expression, but no expression of Slc32a1 was detected (Fig. 1 B). Other telencephalic areas with more than 1.0% of neurons expressing Glra3 were the cortex and some striatal regions. Expression of Glra3 was less than 0.5% in the olfactory bulb, striatum ventral, hippocampus, and dentate gyrus (Fig. 1 A, Table 1 ). In the cortex, the Glra3 -expressing cells displayed low co-localization with Slc17a6 and no overlap with Slc32a1 . In contrast, in the striatum, both Glra3 and Slc32a1 were expressed, but no expression of Slc17a6 was observed (Fig. 1 B). In the diencephalon, Glra3 expression was detected in the hypothalamus (1.1% of the neurons expressed the targeted gene in this area), where both inhibitory and excitatory neurons displayed some levels of expression (Fig. 1 B). Expression of Glra3 (0.4%) was also found in thalamic neurons, but mainly in excitatory neurons (Fig. 1 B). In the brainstem, Glra3 was found in the dorsal, dorsal–ventral and ventral midbrain neurons, with dorsal–ventral midbrain Glra3 neurons being Slc32a1 -expressing, and dorsal and ventral midbrain Glra3 neurons being mainly Slc17a6 -expressing (dorsal midbrain: 3.5%, dorsal–ventral midbrain: 1.3%; ventral midbrain: 1.9% of neurons expressed Glra3 ) (Fig. 1 B, Table 1 ). Glra3 was detected in 1.5% of the pons neurons and 3.4% of the medulla neurons (Fig. 1 A, Table 1 ). In both areas, Glra3 -positive neurons showed partial overlap with Slc17a6 and Slc32a1 expression (Fig. 1 B). Expression of Glra3 was not detected in the cerebellum (Fig. 1 A). In the spinal cord, 3.2% of neurons were Glra3 -positive and co-expression with both Slc17a6 and Slc32a1 was identified. In the peripheral nervous system, Glra3 expression was detected in one neuron of the enteric nervous system (0.1%), and not detected in the DRG, as described in previous studies [ 8 , 10 , 11 ], nor in sympathetic ganglion neurons (Fig. 1 A, B). Fig. 1 Low expression of Glra3 was detected in the central nervous system. The expression of Glra3 and its co-expression with excitatory marker Slc17a6 ( Vglut2 ) and inhibitory marker Slc32a1 ( Viaat ) were examined in distinct areas in the central and peripheral nervous system in the Zeisel et al. (2018) dataset, which contained scRNA-seq data of 27,998 genes in 74,539 neurons [ 22 ]. A Dot plot of the expressions of the targeted genes in all neurons in the areas annotated in the Zeisel et al. (2018) dataset. Glra3 was generally expressed in low levels, as indicated by light blue colored dots, and in a small number of cells, as indicated by the dots’ small diameters. The highest expression was found in Zeisel et al. (2018) defined central nervous system areas, namely the amygdala, dorsal midbrain, medulla and the spinal cord (more than 3.0% of neurons in these areas expressed Glra3 ). B The occurrence of Glra3 neurons ( Glra3 was considered expressed if log1p > 0.1) and the co-expression of Slc17a6 and Slc32a1 in the respective areas visualized with a dot plot. Glra3 was expressed in both excitatory and inhibitory neurons, with some areas displaying either excitatory or inhibitory Glra3 neurons, while other areas contained Glra3 neurons of both molecular properties. Table 1 Expression of Glra3 in the distinct nervous system areas defined in the Zeisel et al. (2018) single-cell RNA sequencing dataset Nervous system area Total number of cells Number of Glra3 expressing cells* Relative abundance of Glra3 expression in area (%) Olfactory bulb 7763 4 0.1 Cortex 15,205 176 1.2 Amygdala 956 29 3.0 Pallidum 832 5 0.6 Striatum dorsal 1962 ND ND Striatum dorsal–ventral, Amygdala 121 2 1.7 Striatum dorsal–ventral 1332 14 1.1 Striatum ventral 3676 14 0.4 Striatum dorsal–ventral, Dentate gyrus 933 ND ND Hypothalamus 1981 21 1.1 Thalamus 3029 13 0.4 Hippocampus, Cortex 7507 20 0.3 Hippocampus 3210 7 0.2 Dentate gyrus 6177 1 0.01 Midbrain dorsal 5204 181 3.5 Midbrain dorsal–ventral 460 6 1.3 Midbrain ventral 313 6 1.9 Pons, Medullae, Cerebellum 158 ND ND Cerebellum 3240 ND ND Pons 1196 18 1.5 Medulla 1566 53 3.4 Spinal Cord 1790 57 3.2 Sympathetic ganglion 886 ND ND Dorsal root ganglion 1580 ND ND Enteric nervous system 943 1 0.1 ND not detected. * Glra3 considered expressed if log1p < 0.1
Low expression of Glra3 was detected in the central nervous system. The expression of Glra3 and its co-expression with excitatory marker Slc17a6 ( Vglut2 ) and inhibitory marker Slc32a1 ( Viaat ) were examined in distinct areas in the central and peripheral nervous system in the Zeisel et al. (2018) dataset, which contained scRNA-seq data of 27,998 genes in 74,539 neurons [ 22 ]. A Dot plot of the expressions of the targeted genes in all neurons in the areas annotated in the Zeisel et al. (2018) dataset. Glra3 was generally expressed in low levels, as indicated by light blue colored dots, and in a small number of cells, as indicated by the dots’ small diameters. The highest expression was found in Zeisel et al. (2018) defined central nervous system areas, namely the amygdala, dorsal midbrain, medulla and the spinal cord (more than 3.0% of neurons in these areas expressed Glra3 ). B The occurrence of Glra3 neurons ( Glra3 was considered expressed if log1p > 0.1) and the co-expression of Slc17a6 and Slc32a1 in the respective areas visualized with a dot plot. Glra3 was expressed in both excitatory and inhibitory neurons, with some areas displaying either excitatory or inhibitory Glra3 neurons, while other areas contained Glra3 neurons of both molecular properties.
Expression of Glra3 in the distinct nervous system areas defined in the Zeisel et al. (2018) single-cell RNA sequencing dataset
ND not detected. * Glra3 considered expressed if log1p < 0.1
In conclusion, the scRNA-seq analysis of the Zeisel et al. (2018) dataset revealed that Glra3 was expressed in low levels in both excitatory and inhibitory neurons in several brain areas, as well as in the spinal cord. For more detailed information about the expression pattern of Glra3 , see Table 1 .
Analysis on the single-cell level revealed that Glra3 was predominantly expressed in the cortex, amygdala, striatum, hypothalamus, brainstem and spinal cord, where Glra3 was expressed in more than 1.0% of the neurons in each area. To broaden the analysis, we studied the relative mRNA expression of Glra3 in both sexes of C57BL/6J mice using qRT-PCR. Glra3 was expressed widespread in the central nervous system in both females and males(Additional file 1 : Table S1). In females, highest Glra3 expression levels were identified in the amygdala, hypothalamus, thalamus and spinal cord (top 4 areas). In comparison, male mice showed highest Glra3 expression levels in the amygdala, hypothalamus, thalamus and brainstem (Fig. 2 ). Furthermore, raw cycle threshold (Ct) values (indicating expression) of Glra3 could be detected in a few visceral organs, namely the heart and spleen, for both females and males, as well as the lung, kidney and testis tissues for male mice only. However, the measured Ct values of Glra3 in the heart, lung, kidney, spleen and testes should be carefully reviewed, as Glra3 was difficult to measure in the visceral organs compared with the tissues collected from the central nervous system. The relative fluorescence unit (RFU) was low, and many cycles (40–45 cycles) were needed to obtain a Ct-value, making it difficult to separate the amplification of Glra3 in the visceral organs from background noise and non-specific amplification (Additional file 1 : Fig. S1). Compared with females, males generally had higher expression of Glra3 in the cortex (p = 0.0256), amygdala (p = 0.0009), striatum (p = 0.0118), hypothalamus (p = 0.0144), thalamus (p = 0.0317), hippocampus [p = 0.0051 (without outlier), p = 0.0079 (with outlier)], cerebellum [p = 0.0027 (without outlier), p = 0.0079 (with outlier)] and brainstem (p = 0.0010), but not in the pituitary gland (p > 0.9999) and spinal cord (p = 0.1495) (Fig. 2 ). In conclusion, male mice displayed higher Glra3 mRNA levels compared with female mice in all brain areas, whereas peripheral organs expressed low to no expression of Glra3 regardless of sex. Fig. 2 qRT-PCR revealed Glra3 to be mainly found in the central nervous system. Glra3 expression in adult female (n = 5, red) and adult male (n = 5, blue) C57BL/6J mice was measured using qRT-PCR, with a cutoff of 45 cycles. The relative mRNA expression was calculated using the delta Ct method with three stable reference genes (female and male body: Actβ , Rpl19 , Gapdh ; female brain: Actβ , Rpl19 , Gapdh ; male brain: Actβ , Rpl19 , Cyclo ). Stable reference genes were found using the GeNorm protocol [ 23 ]. Biological outliers (in total two outliers from male mice, one for the hippocampus and one for the cerebellum) were removed using the Grubbs outlier test with α = 0.05 before proceeding. The log2 fold mean difference (± SEM) against the genomic Glra3 DNA expression is illustrated in the combined scatter-bar plot. Glra3 was measured in heart (n = 3), lung (n = 3–5), spleen (n = 4–5), kidney (n = 4–5) and testes (n = 5) however these findings should be considered with caution (see Additional file 1: Fig. S1). Glra3 was expressed in most tissues collected for the central nervous system, with highest expression in the amygdala, hypothalamus, thalamus, brainstem and spinal cord. Two-tailed Mann–Whitney U-test (thalamus p = 0.0317; hippocampus p = 0.0079 (with outlier); cerebellum p = 0.0079 (with outlier); pituitary gland p > 0.9999) or unpaired t-test (prefrontal cortex p = 0.0256; amygdala p = 0.0009; striatum (females caudate putamen, males caudate putamen and nucleus accumbens); p = 0.0118; hypothalamus p = 0.0144; hippocampus p = 0.0051 (without outlier); cerebellum p = 0.0027 (without outlier); brainstem p = 0.0010; spinal cord p = 0.1495) were used to calculate the difference between female and male mice for each tissue where *p < 0.05, **p < 0.01, ***p < 0.001
qRT-PCR revealed Glra3 to be mainly found in the central nervous system. Glra3 expression in adult female (n = 5, red) and adult male (n = 5, blue) C57BL/6J mice was measured using qRT-PCR, with a cutoff of 45 cycles. The relative mRNA expression was calculated using the delta Ct method with three stable reference genes (female and male body: Actβ , Rpl19 , Gapdh ; female brain: Actβ , Rpl19 , Gapdh ; male brain: Actβ , Rpl19 , Cyclo ). Stable reference genes were found using the GeNorm protocol [ 23 ]. Biological outliers (in total two outliers from male mice, one for the hippocampus and one for the cerebellum) were removed using the Grubbs outlier test with α = 0.05 before proceeding. The log2 fold mean difference (± SEM) against the genomic Glra3 DNA expression is illustrated in the combined scatter-bar plot. Glra3 was measured in heart (n = 3), lung (n = 3–5), spleen (n = 4–5), kidney (n = 4–5) and testes (n = 5) however these findings should be considered with caution (see Additional file 1: Fig. S1). Glra3 was expressed in most tissues collected for the central nervous system, with highest expression in the amygdala, hypothalamus, thalamus, brainstem and spinal cord. Two-tailed Mann–Whitney U-test (thalamus p = 0.0317; hippocampus p = 0.0079 (with outlier); cerebellum p = 0.0079 (with outlier); pituitary gland p > 0.9999) or unpaired t-test (prefrontal cortex p = 0.0256; amygdala p = 0.0009; striatum (females caudate putamen, males caudate putamen and nucleus accumbens); p = 0.0118; hypothalamus p = 0.0144; hippocampus p = 0.0051 (without outlier); cerebellum p = 0.0027 (without outlier); brainstem p = 0.0010; spinal cord p = 0.1495) were used to calculate the difference between female and male mice for each tissue where *p < 0.05, **p < 0.01, ***p < 0.001
Following Glra3 detection in the cortex, amygdala, striatum, hypothalamus, thalamus, hippocampus, brainstem and spinal cord based on single-cell and bulk analyses, with the latter analysis revealing a sex-dependent expression pattern in several brain areas, we sought to investigate the spatial Glra3 expression in these areas. The analysis was conducted using fluorescent in situ hybridization with the RNAscope approach [ 24 ] in female and male C57BL/6J mice, with the aim of verifying the expression of Glra3 . The analysis was not set out to quantify Glra3 expression and thus, no expression level comparison was performed between females and males. In both female and male brains (Figs. 3 , 4 ), expression of Glra3 was found in the cortex (Figs. 3 A-a1, 4 A-a1, somatosensory cortex displayed in the image), amygdala (Figs. 3 B-b1, 4 B-b1), pallidum (Additional file 1 : Fig. S2A and S2a1-3), hypothalamus (Figs. 3 B-b2, 4 B-b2), thalamus (Figs. 3 B-b3, 4 B-b3), hippocampus (Figs. 3 B-b 4 , 4B-b4) and brainstem (Figs. 3 C-c1, 4 C-c1) areas. Expression of Glra3 was detected in striatum of male mice, but not in females (Additional file 1 : Fig. S2B). No Glra3 probe signal could be detected in cerebellum regardless of sex (Additional file 1 : Figure S2C). In all areas, except for the hippocampus, Glra3 co-expressed with Slc17a6 , while co-localization with Slc32a1 was found in all brain areas except for the female thalamus (Figs. 3 a1–c1, 4 a1–c1, Additional file 1 : Fig. S2). Fig. 3 Analysis of the spatial expression of Glra3 in the female brain. The spatial Glra3 mRNA expression was detected with RNAscope using probes against Glra3 (teal) , Slc17a6 (red) and Slc32a1 (red) . Expression was detected at ( A ) Bregma 0.98 mm in the (a1) cortex, and both co-localization of Glra3 with Slc17a6 or Slc32a1 was observed. B At Bregma -1.34 mm, Glra3 expression was found in the (b1) amygdala, (b2) hypothalamus, (b3) thalamus and (b4) hippocampus. b1–b4 Overlap with Slc17a6 expression was observed in all areas, except in the hippocampus, while overlap with Slc32a1 was seen in all areas, except in the thalamus. C At Bregma -6.84 mm, Glra3 expression and overlap with Slc17a6 or Slc32a1 expression was observed in the (c1) brainstem. Illustrations of the Bregma sections in A–C are adapted from https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas . The red dashed squares in A–C indicate approximately the area displayed in a1–c1. The dashed squares were consistently placed on the right side of the schematic image in order to maximize the readability of the abbreviations, regardless of the position of the representative images. White arrows denote examples of co-expression. Scale bars: 200 µm, enlargements 100 µm. Abbreviated areas in a1–c1: Aco = anterior cortical amygdaloid nucleus, AHP = anterior hypothalamic area, posterior part, BLA = basolateral amygdaloid nucleus, anterior part, BMA = basomedial amygdaloid nucleus, anterior part, DG = dentate gyrus, DM = dorsomedial hypothalamic nucleus, Gi = gigantocellular reticular nucleus, ME = medial amygdaloid nucleus, PLCo = posterolateral cortical amygdaloid nucleus, Rt = reticular thalamic nucleus, S1FL = primary somatosensory cortex, forelimb region, S1J = primary somatosensory cortex, jaw region, Sol = solitary tract, VL = ventrolateral thalamic nucleus, VMH = ventromedial hypothalamic nucleus, VPL = ventral posterolateral thalamic nucleus, VPM = ventral posteromedial thalamic nucleus. For all other abbreviations, please see https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas Fig. 4 Analysis of the spatial expression of Glra3 in the male brain. The spatial Glra3 mRNA expression was detected with RNAscope using probes against Glra3 (teal), Slc17a6 (red) and Slc32a1 (red) . Expression was detected at ( A ) Bregma 0.98 mm in the (a1) cortex, and both co-localization of Glra3 with Slc17a6 or Slc32a1 was observed. B At Bregma -1.34 mm, Glra3 expression was found in the (b1) amygdala, (b2) hypothalamus, (b3) thalamus and the (b4) hippocampus (for Slc32a1 the representative image is from a section between Bregma -1.06 and -1.22 mm). b1–b4 Overlap with Slc17a6 expression was observed in all areas, except for the hippocampus, while overlap with Slc32a1 expression was seen in all areas. C At Bregma -6.84 mm Glra3 expression and overlap with Slc17a6 or Slc32a1 expressions was observed in the (c1) brainstem. Illustrations of the Bregma sections in A–C are adapted from https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas . The red dashed squares in A–C indicate approximately the area displayed in a1–c1. The dashed squares were consistently placed on the right side of the schematic image in order to maximize the readability of the abbreviations, regardless of the position of the representative images. White arrows denote examples of co-expression. Scale bars: 200 µm, enlargements 100 µm. Abbreviated areas in a1–c1: Aco = anterior cortical amygdaloid nucleus, AHP = anterior hypothalamic area, posterior part, BLA = basolateral amygdaloid nucleus, anterior part, BMA = basomedial amygdaloid nucleus, anterior part, DG = dentate gyrus, DM = dorsomedial hypothalamic nucleus, Gi = gigantocellular reticular nucleus, IRt = intermediate reticular nucleus, ME = medial amygdaloid nucleus, MVeMC = medial vestibular nucleus, magnocellular part, MVePC = medial vestibular nucleus, parvicellular part, PLCo = posterolateral cortical amygdaloid nucleus, Pr = prepositus nucleus, Rt = reticular thalamic nucleus, S1J = primary somatosensory cortex, jaw region, S1ULP = primary somatosensory cortex, upper lip region, S2 = secondary somatosensory cortex, Sol = solitary tract, VL = ventrolateral thalamic nucleus, VMH = ventromedial hypothalamic nucleus, VPL = ventral posterolateral thalamic nucleus, VPM = ventral posteromedial thalamic nucleus, 3V = 3rd ventricle, 4V = 4th ventricle. For all other abbreviations, please see https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas
Analysis of the spatial expression of Glra3 in the female brain. The spatial Glra3 mRNA expression was detected with RNAscope using probes against Glra3 (teal) , Slc17a6 (red) and Slc32a1 (red) . Expression was detected at ( A ) Bregma 0.98 mm in the (a1) cortex, and both co-localization of Glra3 with Slc17a6 or Slc32a1 was observed. B At Bregma -1.34 mm, Glra3 expression was found in the (b1) amygdala, (b2) hypothalamus, (b3) thalamus and (b4) hippocampus. b1–b4 Overlap with Slc17a6 expression was observed in all areas, except in the hippocampus, while overlap with Slc32a1 was seen in all areas, except in the thalamus. C At Bregma -6.84 mm, Glra3 expression and overlap with Slc17a6 or Slc32a1 expression was observed in the (c1) brainstem. Illustrations of the Bregma sections in A–C are adapted from https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas . The red dashed squares in A–C indicate approximately the area displayed in a1–c1. The dashed squares were consistently placed on the right side of the schematic image in order to maximize the readability of the abbreviations, regardless of the position of the representative images. White arrows denote examples of co-expression. Scale bars: 200 µm, enlargements 100 µm. Abbreviated areas in a1–c1: Aco = anterior cortical amygdaloid nucleus, AHP = anterior hypothalamic area, posterior part, BLA = basolateral amygdaloid nucleus, anterior part, BMA = basomedial amygdaloid nucleus, anterior part, DG = dentate gyrus, DM = dorsomedial hypothalamic nucleus, Gi = gigantocellular reticular nucleus, ME = medial amygdaloid nucleus, PLCo = posterolateral cortical amygdaloid nucleus, Rt = reticular thalamic nucleus, S1FL = primary somatosensory cortex, forelimb region, S1J = primary somatosensory cortex, jaw region, Sol = solitary tract, VL = ventrolateral thalamic nucleus, VMH = ventromedial hypothalamic nucleus, VPL = ventral posterolateral thalamic nucleus, VPM = ventral posteromedial thalamic nucleus. For all other abbreviations, please see https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas
Analysis of the spatial expression of Glra3 in the male brain. The spatial Glra3 mRNA expression was detected with RNAscope using probes against Glra3 (teal), Slc17a6 (red) and Slc32a1 (red) . Expression was detected at ( A ) Bregma 0.98 mm in the (a1) cortex, and both co-localization of Glra3 with Slc17a6 or Slc32a1 was observed. B At Bregma -1.34 mm, Glra3 expression was found in the (b1) amygdala, (b2) hypothalamus, (b3) thalamus and the (b4) hippocampus (for Slc32a1 the representative image is from a section between Bregma -1.06 and -1.22 mm). b1–b4 Overlap with Slc17a6 expression was observed in all areas, except for the hippocampus, while overlap with Slc32a1 expression was seen in all areas. C At Bregma -6.84 mm Glra3 expression and overlap with Slc17a6 or Slc32a1 expressions was observed in the (c1) brainstem. Illustrations of the Bregma sections in A–C are adapted from https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas . The red dashed squares in A–C indicate approximately the area displayed in a1–c1. The dashed squares were consistently placed on the right side of the schematic image in order to maximize the readability of the abbreviations, regardless of the position of the representative images. White arrows denote examples of co-expression. Scale bars: 200 µm, enlargements 100 µm. Abbreviated areas in a1–c1: Aco = anterior cortical amygdaloid nucleus, AHP = anterior hypothalamic area, posterior part, BLA = basolateral amygdaloid nucleus, anterior part, BMA = basomedial amygdaloid nucleus, anterior part, DG = dentate gyrus, DM = dorsomedial hypothalamic nucleus, Gi = gigantocellular reticular nucleus, IRt = intermediate reticular nucleus, ME = medial amygdaloid nucleus, MVeMC = medial vestibular nucleus, magnocellular part, MVePC = medial vestibular nucleus, parvicellular part, PLCo = posterolateral cortical amygdaloid nucleus, Pr = prepositus nucleus, Rt = reticular thalamic nucleus, S1J = primary somatosensory cortex, jaw region, S1ULP = primary somatosensory cortex, upper lip region, S2 = secondary somatosensory cortex, Sol = solitary tract, VL = ventrolateral thalamic nucleus, VMH = ventromedial hypothalamic nucleus, VPL = ventral posterolateral thalamic nucleus, VPM = ventral posteromedial thalamic nucleus, 3V = 3rd ventricle, 4V = 4th ventricle. For all other abbreviations, please see https://mouse.brain-map.org/experiment/thumbnails/100048576?image_type=atlas
In the spinal cord of both females and males (Figs. 5 , 6 ), Glra3 was found in the dorsal horn of cervical (Figs. 5 A, 6 A), thoracic (Figs. 5 B, 6 B), lumbar (Figs. 5 C, 6 C) and sacral (Figs. 5 D, 6 D) divisions, with co-expressions of Slc17a6 and Slc32a1 detected in all divisions. Lastly, in the cervical, lumbar and sacral divisions, Glra3 expression was detected in the ventral horn (Figs. 5 C, D, 6 C, D). In conclusion, spatial validations of Glra3 expression verified that Glra3 is expressed in all areas identified from the single-cell and bulk analyses. Co-localization of Glra3 with Slc17a6 was identified in all brain and spinal cord areas, except for the hippocampus, and with Slc32a1 in all areas, except for the female thalamus. Fig. 5 Spatial expression analysis of Glra3 in the female spinal cord. The spatial Glra3 mRNA expression was examined with RNAscope using probes for Glra3 (teal), Slc17a6 (red) and Slc32a1 (red). Glra3 was expressed in the ( A )cervical (C7), ( B ) thoracic (T11), ( C ) lumbar (L5) and ( D ) sacral (S2) divisions of the spinal cord ( A – D ). Overlap with Slc17a6 and Slc32a1 expressions could be observed in all divisions (a1, a2, b1, b2, c1, c2, d1, d2). Expression was found in the dorsal and ventral horns in all divisions. Glra3 could be detected in the ventral horn in the cervical, lumbar and sacral divisions. Illustrations of the spinal cord divisions in A – D are modified from https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas . The red dashed squares in A – D indicate approximately the enlarged images in a1-d2 (labelled with white text). No overview images are shown for the enlarged images labeled with red text. A – D Scale bars: 500 µm, a1–d2: scale bars 100 µm. White arrows denote examples of co-expression. Grey line in a1-d2 indicates boarder for lamina II outer and lamina II inner . 5Sp = lamina 5, 7Sp = lamina 7, 8Sp = lamina 8. For all other abbreviations, please see https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas Fig. 6 Spatial expression analysis of Glra3 in the male spinal cord. The spatial Glra3 mRNA expression was examined with RNAscope using probes for Glra3 (teal), Slc17a6 (red) and Slc32a1 (red). Glra3 was expressed in the ( A ) cervical (C7), ( B ) thoracic (T11), ( C ) lumbar (L5) and ( D ) sacral (S2) divisions of the spinal cord ( A – D ). Overlap with Slc17a6 and Slc32a1 expressions could be observed in all divisions (a1, a2, b1, b2, c1, c2, d1, d2). Glra3 expression was found in the dorsal and ventral horns in all divisions. Glra3 could be detected in the ventral horn in the cervical, lumbar and sacral divisions. Illustrations of the spinal cord divisions in A – D are modified from https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas . The red dashed squares in A – D indicate approximately the area displayed in a1–d2 (labelled with white text). No overview images are shown for the enlarged images labeled with red text. A – D Scale bars: 500 µm, a1–d2: scale bars 100 µm. White arrows denote examples of co-expression. Grey line in a1-d2 indicates boarder for lamina II outer and lamina II inner . 5Sp = lamina 5, 6Sp = lamina 6, 7Sp = lamina 7, 8Sp = lamina 8. For all other abbreviations, please see https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas
Spatial expression analysis of Glra3 in the female spinal cord. The spatial Glra3 mRNA expression was examined with RNAscope using probes for Glra3 (teal), Slc17a6 (red) and Slc32a1 (red). Glra3 was expressed in the ( A )cervical (C7), ( B ) thoracic (T11), ( C ) lumbar (L5) and ( D ) sacral (S2) divisions of the spinal cord ( A – D ). Overlap with Slc17a6 and Slc32a1 expressions could be observed in all divisions (a1, a2, b1, b2, c1, c2, d1, d2). Expression was found in the dorsal and ventral horns in all divisions. Glra3 could be detected in the ventral horn in the cervical, lumbar and sacral divisions. Illustrations of the spinal cord divisions in A – D are modified from https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas . The red dashed squares in A – D indicate approximately the enlarged images in a1-d2 (labelled with white text). No overview images are shown for the enlarged images labeled with red text. A – D Scale bars: 500 µm, a1–d2: scale bars 100 µm. White arrows denote examples of co-expression. Grey line in a1-d2 indicates boarder for lamina II outer and lamina II inner . 5Sp = lamina 5, 7Sp = lamina 7, 8Sp = lamina 8. For all other abbreviations, please see https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas
Spatial expression analysis of Glra3 in the male spinal cord. The spatial Glra3 mRNA expression was examined with RNAscope using probes for Glra3 (teal), Slc17a6 (red) and Slc32a1 (red). Glra3 was expressed in the ( A ) cervical (C7), ( B ) thoracic (T11), ( C ) lumbar (L5) and ( D ) sacral (S2) divisions of the spinal cord ( A – D ). Overlap with Slc17a6 and Slc32a1 expressions could be observed in all divisions (a1, a2, b1, b2, c1, c2, d1, d2). Glra3 expression was found in the dorsal and ventral horns in all divisions. Glra3 could be detected in the ventral horn in the cervical, lumbar and sacral divisions. Illustrations of the spinal cord divisions in A – D are modified from https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas . The red dashed squares in A – D indicate approximately the area displayed in a1–d2 (labelled with white text). No overview images are shown for the enlarged images labeled with red text. A – D Scale bars: 500 µm, a1–d2: scale bars 100 µm. White arrows denote examples of co-expression. Grey line in a1-d2 indicates boarder for lamina II outer and lamina II inner . 5Sp = lamina 5, 6Sp = lamina 6, 7Sp = lamina 7, 8Sp = lamina 8. For all other abbreviations, please see https://mouse.brain-map.org/experiment/siv?id=100050402&imageId=101006525&imageType=atlas
Discussion
Using three different mRNA-based methods, we here report that the glycinergic receptor unit Glra3 is expressed in central nervous system areas such as the cortex, amygdala, striatum, hypothalamus, thalamus, hippocampus, brainstem, and spinal cord. Furthermore, we identified that male mice display higher levels of Glra3 in the above listed areas, with the exception of the spinal cord. In all central nervous system areas, except for the hippocampus, Glra3 expression overlapped with Slc17a6 expression, whereas co-expression of Glra3 and Slc32a1 was found in all of the targeted areas except for the female thalamus.
In the brain, GLRA3 exists as two isomers, namely the shorter GLRA3K and the longer GLRA3L (additional 8A exon), with the latter being the dominant variant in the mouse brain [ 25 ]. In our analyses, the Glra3 qRT-PCR primers and the RNAscope probes targeted the nucleotide sequence outside the splicing area (primers: exon 9–10; probes: exon 1–8), meaning our analyses captured the expression of both isomers.
The Human Protein Atlas project has mapped human GLRA3 [ 26 ] and mouse Glra3 [ 27 ] ( https://www.proteinatlas.org/ENSG00000145451-GLRA3/brain ) to several areas in the central nervous system. In humans, GLRA3 has been detected in the cerebral cortex, amygdala, hypothalamus, thalamus, hippocampal formation, midbrain, basal ganglia and the brainstem (pons and medulla oblongata) [ 26 ]. In mice, the Human Protein Atlas project could locate Glra3 to the olfactory bulb, cerebral cortex, amygdala, hypothalamus, thalamus, hippocampal formation, midbrain, basal ganglia, brainstem (pons and medulla) and the cerebellum [ 27 ], similar to the expression pattern displayed in the Allen Mouse Brain Atlas ( https://mouse.brain-map.org/experiment/show/73788474 ). These previous findings are coherent with our results (Table 2 ). Table 2 Summary of Glra3 expression in the central and peripheral nervous system Areas scRNA-seq £ qRT-PCR RNAscope Cortex + + + Amygdala + + + Striatum + + + (males) Pallidum + NA + Hypothalamus + + + Pituitary gland NA + NA Hippocampus + + + Brainstem + + + Cerebellum ND + ND Spinal cord + + + Dorsal root ganglia ND NA NA + expression, NA not analyzed, ND not detected. £ Zeisel et al. (2018) dataset [ 22 ]
Summary of Glra3 expression in the central and peripheral nervous system
+ expression, NA not analyzed, ND not detected. £ Zeisel et al. (2018) dataset [ 22 ]
Previous GLRA3 studies have mainly focused on what function the subunit has in the brain, i.e. in the cortex [ 19 ], striatum, nucleus accumbens [ 15 , 19 ], hippocampus [ 19 , 25 , 28 ] and the brainstem [ 17 , 29 ]. For instance, McCracken et al. (2017) showed that GLRA3-containing GlyRs are found in various areas of the forebrain. Additionally, when performing whole-cell recordings on Glra3 −/− mice, it was reported that these mice lacked tonic inhibition in the forebrain. These findings indicate that Glra3 participates in tonic inhibition in the prefrontal cortex and in both the dorsal striatum and nucleus accumbens [ 19 ]. San Martin et al. (2021) investigated the potential role of the GLRA3 subunit in ethanol sensitivity by focusing on the nucleus accumbens [ 15 ]. They concluded that GLRA3 is expressed in low levels in the mouse nucleus accumbens [ 15 ]. Our qRT-PCR analysis detected Glra3 in both the cortex and striatum, with higher levels found in male mice compared with female mice. Importantly, the dissected female striatum samples only contained caudate putamen, while the male striatum samples contained both caudate putamen and nucleus accumbens. This discrepancy could explain the difference in expression levels in male and female striatum. However, our RNAscope analysis identified a few Glra3 positive cells in males but none in females, suggesting that Glra3 expression may show a sex-dependent difference in striatum.
Earlier findings reported by Eichler et al. (2009) demonstrate that the expression of the GLRA3L splice variant is dominant in mice [ 25 ], but in temporal lobe epilepsy, the shorter splice variant (GLRA3K) was upregulated. Through these findings, Eichler et al. (2009) concluded that both splice variants are located on glutamatergic (3L) and GABAergic (3K) synaptic terminals [ 25 ]. Two of our transcriptional analyses, where the excitatory and inhibitory characteristics were examined, also disclosed that Glra3 co-expresses with both an excitatory and an inhibitory marker. Schaefermeier and Heinze (2017) have also reported expression of murine Glra3 in the hippocampus [ 28 ], in a similar expression pattern as was observed herein in female and male mice (Figs. 3 and 4 ).
All our transcriptional Glra3 analyses mapped expression in the caudal brainstem (medulla and pons). This is consistent with previous immunostainings performed by Manzke et al. (2010), in which ubiquitous GLRA3 expression was detected in the brainstem [ 17 ]. The GLRA3 subunit has also been suggested to have a potential mechanism in mediating the presynaptic modulation of glycine release in the hypoglossal nucleus [ 29 ].
Previous PCR expressional analysis of Glra3 in the spinal cord reported that the gene is detected in the dorsal, but not in the ventral spinal horn [ 8 ]. In addition to the dense expression of Glra3 seen in the dorsal horn, our RNAscope analysis revealed that Glra3 was also detected in the ventral (with a majority medioventrally) horns of the cervical, lumbar and sacral divisions. Therefore, a broader expression pattern of the Glra3 gene was displayed when compared to an earlier report [ 8 ]. In Groemer et al. (2022), the division of the spinal cord that was being analyzed was unspecified, suggesting that the ventral Glra3 expression might have been missed. Expression of Glra3 in the ventral horn has been shown by the Allen Institute, which is consistent with our findings. The spatial Glra3 analyses also showed that Glra3 overlaps with sub-populations expressing Slc17a6 or Slc32a1 . Using the Zeisel et al. (2018) and Häring et al. (2018) datasets [ 22 , 30 ], we also found Glra3 expression in both the excitatory SCGLU10 and Glut9, as well as the inhibitory Gaba8-9 clusters, further demonstrating the broad expression pattern of Glra3 . Other studies have instead investigated GLRA3 expression in the spinal cord using immunostaining [ 12 , 13 ], where its detection was restricted to the dorsal horn. The differences in the subunit’s protein expression, exhibited by immunostaining, compared to our RNAscope analysis may have been a result of not all Glra3 units being translated into protein [ 31 ].
In this study, the Glra3 expression in visceral organs was investigated with bulk qRT-PCR. Raw Ct-values (indicating expression) of Glra3 could be detected in a few visceral organs, namely the heart, lung, spleen, kidney and testes. However, Glra3 expression in these organs was difficult to detect using qRT-PCR compared with tissues collected from the central nervous system. The RFU was low, unstable amplification and melting curves were obtained, and many cycles (40–45 cycles) were needed to obtain a Ct-value, making it difficult to separate the proper amplification of Glra3 in the visceral organs from background noise and non-specific amplification (e.g. primer-dimer). As a result, we cannot confidently conclude that Glra3 is expressed in these visceral organs. Furthermore, chemical contamination, cycle-to-cycle variability and random noise are systematic errors that have been reported to affect results obtained with qRT-PCR [ 32 ]. These interferences could possibly explain the variability in detection levels in some of the tested tissues. However, our findings in mice are reasonably consistent with what the Human Protein Atlas project and Genotype-Tissue Expression project have reported on the GLRA3 mRNA in humans [ 26 ]. The Human Protein Atlas project reports low levels of GLRA3 mRNA in adrenal gland, pancreas, testes, female breast tissue, smooth muscle tissue, thymus, lymph nodes and tonsil tissue. Meanwhile the Genotype-Tissue Expression project reports GLRA3 expression in the small intestine, testes and female breast tissue in 20–69 years old females and males using RNA sequencing ( https://www.proteinatlas.org/ENSG00000145451-GLRA3/tissue ), indicating inconsistencies in mRNA levels in the visceral organs. This inconsistency could be due to low levels of Glra3, the rate of mRNA turnover, or the point of transcription in which the tissues were harvested [ 33 ]. Therefore, what role Glra3 has in visceral organs remains unknown.
In Zeisel et al. [ 22 ] the specific regions included in what was labelled as cortex were not clearly specified, making it unclear if the entire cortex was included or merely substructures. Herein, in the bulk qRT-PCR, the cortex includes the main olfactory bulb, accessory olfactory bulb, anterior olfactory nucleus, orbital cortex and the frontal association cortex. Direct comparisons to the dataset of Zeisel et al. [ 22 ] are therefore limited. Moreover, in contrast to the males’ striatum samples, the dissected female striatum only contained caudate putamen and not nucleus accumbens, which could likely explain the differences in expression level in the striatum between females and males. Finally, amygdala, thalamus and pituitary gland were dissected from animals with the same housing and background, whereas the other qRT-PCR analyzed specimens were dissected from two different cohorts [ 34 , 35 ]. However, the same expression pattern between females and males was revealed independent of this.