The Impact of Promoter Variants in Interleukin-18... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/14-1399" }, "headline": "The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of...", "datePublished": "2025-12-15T13:25:38", "dateModified": "2026-05-14T12:49:02", "author": [ { "@type": "Person", "name": "Ibtehal Kadhim Jasim" }, { "@type": "Person", "name": "Asmaa Mohammed Saud" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Ankylosing spondylitis (AS) is a chronic inflammatory illness mainly influencing the axial skeleton. It is a multifactorial illness in which environmental and genetic parameters contribute to its cause, one of which is interleukins, including interleukin-18 (IL-18). Therefore, this study aimed to investigate the relations among single nucleotide polymorphism (SNP) rs549908 and serum levels of IL-18 in Iraqi patients with AS. Methods During the period of November 2024 and January 2025, a total of 100 individuals were enrolled in the present work, including 50 patients with AS and 50 healthy controls (HC), were obtained from Baghdad Teaching Hospital. Using enzyme-linked immunosorbent assay (ELISA) and TaqMan real-time polymerase chain reaction (PCR), serum levels and rs549908 genotyping of IL-18 were estimated. Results Significantly, levels of IL-18 in serum were raised in patients with AS in compared to HC (235.7060 vs. 151.10 pg/mL, p < 0.001). Genetically, T allele frequency (69.0% vs. 49.0%, p = 0.006) and TT genotype frequency (53.1% vs. 23.5%, p = 0.004) were significantly greater in patients with AS compared to HC. Analysis under the model of dominant (TG + GG vs. TT) demonstrated significant relations among status of illness and genotype (OR = 0.29, p = 0.007). Conclusions These outcomes suggest rs549908 SNP and serum levels of IL-18, are related with raised susceptibilities to AS in the Iraqi population. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/14-1399/v1", "name": "The Impact of Promoter Variants in Interleukin-18 on Susceptibility..." } } ] } Home Browse The Impact of Promoter Variants in Interleukin-18 on Susceptibility... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Jasim IK and Saud AM. The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.12688/f1000research.172631.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] Ibtehal Kadhim Jasim https://orcid.org/0009-0008-7264-4899 1 , Asmaa Mohammed Saud 1 Ibtehal Kadhim Jasim https://orcid.org/0009-0008-7264-4899 1 , Asmaa Mohammed Saud 1 PUBLISHED 15 Dec 2025 Author details Author details 1 Biotechnology, University of Baghdad, Baghdad, Baghdad Governorate, Iraq Ibtehal Kadhim Jasim Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Validation, Visualization, Writing – Original Draft Preparation Asmaa Mohammed Saud Roles: Conceptualization, Methodology, Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Fallujah Multidisciplinary Science and Innovation gateway. Abstract Background Ankylosing spondylitis (AS) is a chronic inflammatory illness mainly influencing the axial skeleton. It is a multifactorial illness in which environmental and genetic parameters contribute to its cause, one of which is interleukins, including interleukin-18 (IL-18). Therefore, this study aimed to investigate the relations among single nucleotide polymorphism (SNP) rs549908 and serum levels of IL-18 in Iraqi patients with AS. Methods During the period of November 2024 and January 2025, a total of 100 individuals were enrolled in the present work, including 50 patients with AS and 50 healthy controls (HC), were obtained from Baghdad Teaching Hospital. Using enzyme-linked immunosorbent assay (ELISA) and TaqMan real-time polymerase chain reaction (PCR), serum levels and rs549908 genotyping of IL-18 were estimated. Results Significantly, levels of IL-18 in serum were raised in patients with AS in compared to HC (235.7060 vs. 151.10 pg/mL, p < 0.001). Genetically, T allele frequency (69.0% vs. 49.0%, p = 0.006) and TT genotype frequency (53.1% vs. 23.5%, p = 0.004) were significantly greater in patients with AS compared to HC. Analysis under the model of dominant (TG + GG vs. TT) demonstrated significant relations among status of illness and genotype (OR = 0.29, p = 0.007). Conclusions These outcomes suggest rs549908 SNP and serum levels of IL-18, are related with raised susceptibilities to AS in the Iraqi population. READ ALL READ LESS Keywords Keywords: Ankylosing spondylitis, Interleukin-18, rs549908 Polymorphism, IL-18 serum levels, Genetic Susceptibilities. Corresponding Author(s) Ibtehal Kadhim Jasim ( [email protected] ) Asmaa Mohammed Saud ( [email protected] ) Close Corresponding authors: Ibtehal Kadhim Jasim, Asmaa Mohammed Saud Competing interests: No competing interests were disclosed. Grant information: The author(s) declared that no grants were involved in supporting this work. Copyright: © 2025 Jasim IK and Saud AM. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Jasim IK and Saud AM. The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.12688/f1000research.172631.1 ) First published: 15 Dec 2025, 14 :1399 ( https://doi.org/10.12688/f1000research.172631.1 ) Latest published: 14 May 2026, 14 :1399 ( https://doi.org/10.12688/f1000research.172631.2 ) There is a newer version of this article available. Suppress this message for one day. Introduction Ankylosing spondylitis (AS) is a chronic, inflammatory illness that largely impacts the axial joints, like the peripheral joints, sacroiliac joints, entheses and spine. 1 In AS, ankylosis, or the growth of new bone, causes long-term impairment, decreased mobility and spinal fusion. 2 It's still unclear what exactly causes AS. It has been proposed that the interplay among genetic and environmental factors serves a vital purpose. 3 , 4 Proinflammatory cytokines such as TNF-alpha and other interleukins mediate a variety of inflammatory illnesses and are important modulators of inflammatory processes in the setting of AS. 5 Adaptive and innate immune responses are regulated by the pleiotropic, pro-inflammatory cytokine interleukin-18. 6 Interleukin-18 is primarily produced by neutrophils, dendritic cells, chondrocytes, keratinocytes, osteoblasts, and macrophages. It is a member of the interleukin 1 (IL-1) family. Through the caspase-1 proteolytic enzyme actions, the 23 kDa protein is transformed into the 18 kDa protein. 7 Depending on the inflammatory setting, IL-18 have an effective function in both Th1 and Th2 immune responses. Together with IL-12, IL-18 induces the formation of interferon-gamma, which strengthens the Th1-mediated immune response. When IL-12 is absent, IL-18 activates Th2 immune responses. 8 IL-18, as a pleiotropic and pro-inflammatory cytokine, can be generated in substantial amounts following infection and involved in innate and acquired immunity, inflammatory responses, and tumorigenesis. 9 Dysregulation of IL-18 has the potential to precipitate inflammatory or autoimmune pathologies that pertain to host defense mechanisms, oncogenesis, allergic reactions, immune responses, and arthritic conditions, among others. 10 Furthermore, IL-18 may serve as a pivotal relation among systemic inflammation and aberrant bone remodeling in arthritic conditions, by promoting osteoclast production and accelerating bone resorption. 11 It may have an effective function in the initiation of AS. With the advancement of molecular biological methodologies, single nucleotide polymorphisms (SNPs) within genes have increasingly become prevalent method for investigating illness susceptibilities. 12 Production of IL-18 protein is controlled via the IL-18 gene. 13 The human IL-18 gene, carried on chromosome 11q22.2–q22.3, comprises six exons and contains various single nucleotide polymorphisms (SNPs). Among these, the rs549908 polymorphism is the focus of the current study. 14 Several IL-18 gene polymorphisms have been demonstrated to be related to raised IL-18 levels in immune-mediated disorders. 15 This study aimed to investigate the relations among IL-18 rs549908 and the concentrations of IL-18 in the Iraqi patients with AS, and to assess their potential functions as genetic and inflammatory indicators in this population. Methods Subjects In the work, 50 patients diagnosed with AS and 50 HC were chosen and obtained from Baghdad Teaching Hospital, Medical City, Baghdad, Iraq, between November 2024 and January 2025. Information on lifestyles, particularly smoking habits, clinical diagnoses, and histories of administered therapy, was obtained from patients with AS. The AS diagnosis was confirmed in accordance with the criteria of spondylarthritis International Society (ASAS) 2009 classification for axial spondylarthritis. 16 Patients with AS measured their activity of illness through the Bath AS Disease activity index (BASDAI). 17 Included criteria The range of age of patients with AS was 20 to 63 years. The HC were age- and sex-matched to the cases, with no previous history of autoimmune or inflammatory disorders. Excluded criteria Individuals younger than 20 years or older than 63 years were excluded. Patients or controls with comorbidities, as well as those with autoimmune or inflammatory diseases such as inflammatory bowel disease, psoriasis, or rheumatoid arthritis, were also excluded. Collection of blood samples A volume of 3 mL of peripheral blood was obtained from each participant into 5 mL EDTA tubes for extraction of DNA. In addition, 3 mL of blood was collected into gel tubes and placed in centrifuge for 15 minutes at 3000 rpm. The resultant serum were aliquoted and preserved at −20°C till the time of immunological analysis. Immunological assay Serum levels of IL-18 were measured using ELISA kit (FineTest, Wuhan Fine Biotech Co., Ltd., China; Cat. No. EH0011), in accordance with the manufacturer's instructions. Optical density was assessed at 450 nm with a microplate reader (HumaReader HS, Human GmbH, Germany). Genotyping determination DNA extraction From peripheral blood, genomic DNA was isolated and collected in EDTA-containing tubes utilizing the EasyPureBlood Genomic DNA Kit (TransGen Biotech, Beijing, China; Cat. No. EE121), depending to the manufacturer's guidelines. The purified DNA was eluted in 50 μL of elution buffer and stored at −20 °C until further analysis. SNP genotyping To amplify IL-18 SNPs (rs549908), TaqMan real-time polymerase chain reaction (RT-PCR) was utilised. Single reverse and single forward primers in addition to couple of probes were utilised and listed in Table 1 . The primers and probes were custom-synthesized by Synbio Technologies (China). PCR mix (total volume: 20 μL) consisted of 5 μL nuclease-free water, 6 μL SuperMix, 1.5 μL forward primer, 1 μL of each probe, 4 μL DNA, and 1.5 μL reverse primer. The mix was transferred to a PCR program (TransGen Biotech SuperMix/China). Amplification was performed under standard conditions: an initial denaturation cycle 95°C for 2 min, followed by 30 cycles of of denaturation 95°C for 30 sec, annealing 58°C for 1 min and extension 72°C for 30 sec. Amplification products were additionally verified by 1.5% agarose gel electrophoresis. Table 1. Primer and probe sequences used for genotyping IL-18 gene rs549908 SNP. Name Sequence (5′→3′) Length (base) Dye Forward Primer CTTATGACTGATAATTTAGATTCAAG 26 - Reverse Primer ATTGTAGCTACTTCTGGAACAG 23 - Probe 1 TTGCCAAAGTAATCTGATTCCAGGTTTTCT 30 FAM Probe 2 TTGCCAAAGTAATCGGATTCCAGGTTTTCT 30 HEX Statistical analysis Statistical analyses were carried out utilising SPSS software, version 20.0 (IBM Corp., Armonk, NY, USA). Descriptive statistics, including median, standard deviation, mean, percentage, and frequency were utilised to describe clinical and demographic data. The Shapiro-Wilk test was utilised for the distribution of continuous variables. Body mass index (BMI) and age followed a normal distribution and were compared among groups utilising the independent samples t-test, while erythrocyte sedimentation rate (ESR), Bath AS Disease activity index (BASDAI), and interleukin-18 (IL-18) levels displayed non-normal distributions and were examined utilising the Mann-Whitney U test. Frequencies of genotypic and allelic were estimated utilising the chi-square test, and deviations from Hardy-Weinberg equilibrium were also evaluated utilising chi-square analysis. 95% confidence intervals (CIs) and odds ratios (ORs) for relations of allele and genotype were detected utilising WinPepi software. Values p < 0.01 were regarded as extremely significant, and a p-value < 0.05 as statistically significant. Results Based on the results in Table 2 , the mean age of patients with AS was greater (39.9000 ± 11.23815 years) than that of the control group (31.0600 ± 10.46356 years), though the variation did not reach statistical significance (p = 0.059). Similarly, there was no significant variation in body mass index (BMI) among the AS group (28.2360 ± 5.18683 kg/m 2 ) and HC (26.7920 ± 3.80541 kg/m 2 ; p = 0.060). Sex distribution revealed a greater proportion of males among patients with AS (72%) compared to controls (60%), which was statistically significant (p < 0.001). A notable finding was the presence of a family history of AS in 22% of patients, while none of the controls reported a positive family history (p < 0.001), indicating a potential genetic predisposition in the patient group. Regarding inflammatory markers, erythrocyte sedimentation rate (ESR) was significantly elevated in patients with AS (18.62 ± 16.52937 mm/hr) compared to controls (8.28 ± 5.05092 mm/hr; p < 0.001), supporting an ongoing inflammatory state. C-reactive protein (CRP) was positive in 28% of patients with AS and negative in all control subjects (p < 0.001), further corroborating the presence of systemic inflammation in the AS group. Assessment of illness activity using the Bath Ankylosing Spondylitis Disease activity index (BASDAI) showed a mean score of 4.90 ± 1.00 in patients, while all healthy controls had a BASDAI of 0.00 (p < 0.001). Among patients with AS, 80% were classified as having moderate illness activity, and 20% had severe illness, whereas no illness activity was reported in the control group (p < 0.001). Table 2. Demographic and clinical characteristics of AS and HC. Parameter AS (n = 50) HC (n = 50) p- value Age (mean ± S.D.) year 39.9000 ± 11.23815 31.0600 ± 10.46356 0.059 NS Sex N (%) Male 36 (72%) 30 (60.0%) <0.001 ** Female 14 (28%) 20 (40.0%) Family history N (%) Yes 11 (22%) 0 (0.0%) <0.001 ** No 39 (78%) 50 (100.0%) Activity of illness N (%) Moderate 40 (80.0%) 0 (0.0%) <0.001 ** Severe 10 (20.0%) 0 (0.0%) CRP N (%) Negative 36 (72%) 50 (100.0%) <0.001 ** Positive 14 (28%) 0 (0.0%) ESR (Mean ± S.D.) mm/hr 18.6200 ± 16.52937 8.2800 ± 5.05092 <0.001 ** BMI (mean ± S. D.) kg/m 2 28.2360 ± 5.18683 26.7920 ± 3.80541 0.060 NS BASDAI Mean ± S.D. 4.90 ± 1.00 0.00 ± 0.000 <0.001 ** ** Highly significant. As displayed in Table 3 , serum IL-18 levels were significantly greater in patients with AS (median of 235.7060, range (23-485.78)) compared to HC (median 151.10, range (102.04-250.19)), with highly significant variations (p < 0.001). Table 3. Interleukin-18 level of patients with AS in comparisons with HC. Group No. of subject IL-18 (pg/ml) Median (min-max) P-value AS 50 235.7060 (23-485.78) <0.001** HC 50 151.10 (102.04-250.19) Table 4 illustrates the correlation analysis between serum IL-18 levels with clinical and inflammatory parameters in patients with ankylosing spondylitis. In particular, IL-18 revealed no significant correlation with BASDAI (p = 0.843), ESR (p = 0.915) or BMI (p = 0.884). Table 4. Correlations of interleukin-18 levels with clinical and inflammatory parameters in patients with Ankylosing Spondylitis. BASDAI ESR IL-18 BMI BASDAI 1 0.255 0.029 -0.086 P-value 0.074 0.843 0.553 ESR 0.255 1 -0.015 0.254 P-value 0.074 0.915 0.075 IL-18 0.029 -0.015 1 -0.021 P-value 0.843 0.915 0.884 BMI -0.086 0.254 -0.021 1 P-value 0.553 0.075 0.884 To evaluate the diagnostic value of IL-18, a ROC curve was generated ( Figure 1 ). The analysis showed an AUC of 0.923 (95% CI: 0.859–0.988, p < 0.001), which reflected excellent diagnostic accuracy. These results suggested that IL-18 has strong potential as a biomarker for differentiating AS patients from healthy individuals. Figure 1. Receiver Operating Characteristic (ROC) curve of IL-18 for predicting susceptibility to ankylosing spondylitis. Table 5 , showed the frequencies of alleles and genotype of the IL-18 rs549908 polymorphism for both patients and HC. The results revealed that there was a significant relation among TT genotype and patients compared to HC (OR = 3.52, p = 0.004). In contrast, the TG and GG genotypes showed no statistically significant variations among groups (p = 0.15 and p = 0.21). The study found that the T allele was significantly more prevalent among patients with AS than in HC (OR = 2.32, p = 0.006). Conversely, G exhibited a relatively low frequency in patients, compared to HC (OR = 0.43, p = 0.006). Table 5. Frequencies of alleles and genotype of the rs549908 of gene in AS and HC. Genotype and Allele Frequencies AS (n= 50) HC (n= 50) OR 95%CI P-value N (%) N (%) TT 26 (0.531) 12 (0.235) 3.52 1.51-8.19 0.004 TG 17 (0.347) 25 (0.490) 0.54 0.24-1.19 0.15 GG 7 (0.140) 13 (0.275) 0.46 0.17-1.27 0.21 T 69 (0.69) 49 (0.49) 2.32 1.36-4.27 0.006 G 31 (0.31) 51 (0.51) 0.43 0.24-0.77 0.006 The amplification plot illustrates the fluorescence intensity versus the PCR cycles for all samples in Figure 2 . Each curve represents a single sample, showing successful amplification of IL-18 rs549908. The exponential phase was clearly visible after cycle 20, confirming the validity of the genotyping assay. Figure 2. SNPs genotyping amplification plots of IL-18 rs549908. In Figure 3 , the dual-color scatter plot displayed distinct separation of the genotypes. Samples were clearly distributed into three well-defined clusters corresponding to the TT, TG, and GG genotypes. Each point represented an individual sample, and the separation of the clusters provided clear discrimination between homozygous and heterozygous alleles. Figure 3. SNPs genotyping amplification plots showing fluorescence signals that indicate the alleles A and B in homozygous and heterozygous genotypes of IL-18 rs549908. To test Hardy-Weinberg equilibrium (HWE) for the IL-18 rs549908 polymorphism, a chi-squared test was conducted. As presented in Table 6 , the genotype distribution in both the AS patient group (χ 2 = 2.10, p = 0.14) and the control group (χ 2 = 8.006, p = 0.99) showed no significant deviation from HWE. These outcomes demonstrated that genotype distributions were consistent with Hardy-Weinberg in both groups. Table 6. Hardy-Weinberg equilibrium of the rs549908 of gene in the patients and HC. HWE AS (n = 50) HC (n = 50) Genotypes Observed Expected Observed Expected TT 26 23.8 12 12.0 TG 17 21.4 25 25.0 GG 7 4.8 13 13.0 X 2 value 2.10 8.006 p- value 0.14 0.99 Based on the analysis of the genetic model provided in Table 7 , the possible mode of inheritance of the polymorphism rs549908 regarding illness risk was assessed. In the dominant model, the combination of the TG and GG genotypes demonstrated a significant relationship with a protective effect against the illness (OR = 0.29, p = 0.007) in comparison to the TT genotype. On the contrary, the recessive model, which compared the GG genotype with the combined TG and TT genotypes, showed no statistically significant relation (OR = 0.46, p = 0.21). Likewise, the over-dominant model that compared TG genotypes with the combined TT and GG genotypes showed no significant relation (OR = 0.49, p = 0.10). Table 7. Genetic model action of the IL-18 gene. Genetic model Genotypes Patients (n = 50) HC (n = 50) OR 95% C.I. P-value Dominant TG+GG 17/7 25/13 0.29 0.13-0.68 0.007 TT (Ref.) 26 12 1 Recessive TG+TT (Ref.) 17/26 25/12 1 GG 7 13 0.46 0.17-1.27 0.21 Over-dominant TT+GG (Ref.) 26/7 12/13 1 TG 17 25 0.49 0.22-1.09 0.1 The relationship among IL-18 levels and rs549908 genotypes in both patients and HC with different illness activity was presented in Table 8 . According to the outcomes, in the control group, IL-18 levels exhibited a significant level of consistency for different genotypes. In individuals with moderate illness activity, IL-18 concentration was elevated across all the genotypes, with GG (268.42 pg/mL), TT (239.06 pg/mL), and TG (222.26 pg/mL) genotypes having mean values that were greater when compared to the control group. Likewise, IL-18 was elevated in individuals with severe illness activity GG (251.52 pg/mL), TG (249.25 pg/mL), TT (231.03 pg/mL). There were statistically significant variations in the IL-18 levels in serum among the genotypes and activity of the illness (p = 0.001). Table 8. Relationship among rs549908 genotypes and serum IL-18 levels according to illness activity in patients and HC. Activity rs549908 n IL-18 HC GG 13 153.218 (134.11-185.97) TG 25 142.7650 (131.00-175.10) TT 12 162.7315 (150.39-185.32) AS Moderate GG 5 268.4210 (169.55-279.02) TG 11 222.2640 (187.09-391.88) TT 23 239.0620 (178.77-485.78) severe GG 2 251.5230 (245.45-257.59) TG 6 249.2480 (205.66-333.46) TT 3 231.0290 (216.31-249.57) p- value 0.001 Discussion This study investigated the relation among the IL-18 rs549908 polymorphism and susceptibilities to ankylosing spondylitis (AS) in an Iraqi population by analyzing the distribution of genotypes and alleles, as well as evaluating serum IL-18 levels as a potential inflammatory biomarker. The IL-18 rs549908 polymorphism appeared to have a genetic component to since susceptibilities, since the investigation found significant variations in frequencies of alleles and genotype among patients with AS and healthy controls. Serum IL-18 levels were also noticeably greater in patients with AS, confirming the substance's function as an important inflammatory marker in the illness. 18 In this investigation, ankylosing spondylitis patients had considerably greater serum IL-18 concentrations (235.7060 pg/mL) than healthy controls (151.10 pg/mL; p = 0.001). Furthermore, the correlation between the serum IL-18 and clinical parameters, such as BASDAI, ESR, and BMI in the patients with AS, was examined and no statistically significant correlations were observed. These findings were consistent with previous reports, which indicated that although IL-18 levels were increased in AS patients, they did not significantly associate with clinical activity measures, suggesting that IL-18 may reflect disease susceptibility rather than activity. 19 Chromosome 11q22.2–22.3 contains the IL18 gene, and a number of variants in its promoter area have been linked to a raised risk of developing a number of inflammatory and autoimmune illnesses. 15 There was a strong correlation among the TT genotype and heightened vulnerability to ankylosing spondylitis (AS), according to the study of the IL-18 rs549908 genotype distribution. With an odds ratio (OR) of 3.52 (p = 0.004), 53.1% of patients with AS and 23.5% of healthy controls were found to have the TT genotype. On the other hand, the frequency of the G allele was 31.0% in individuals and 51.0% in controls (OR = 0.43, p = 0.006), suggesting a possible protective impact. In the Iraqi population under study, these results imply that the TT genotype could operate as a genetic predisposing factor for AS. A synonymous polymorphism found in the IL18 gene's exon region, the rs549908 variation had been linked in the past to a number of autoimmune disorders, such as atrophic conditions, systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA). 20 In line with these outcomes, Abdulridha et al. found that immune-regulatory gene polymorphisms were substantially linked to a greater risk of autoimmune illnesses. 21 These results provide more credence to the theory that rs549908 played a role in the genetic vulnerability that underlies AS. Although this study focused specifically on the IL-18 rs549908 polymorphism. The outcomes aligned with broader research emphasizing the role of genetic variation in immune-regulatory pathways underlying autoimmune illness susceptibilities. Genetic model analysis indicated a significant dominant inheritance pattern, where individuals carrying TG or GG genotypes exhibited a markedly reduced risk of developing ankylosing spondylitis compared to TT homozygotes (OR = 0.29, p = 0.007). This suggested that the presence of the G allele might have conferred a protective effect against AS. Comparable relations were observed in studies of other immune-related disorders, where variants within immune-modulating genes were similarly linked to illness risk under dominant genetic models. These outcomes reinforced the notion that polymorphisms influencing immune function contributed to immune dysregulation and supported the multifactorial etiology of autoimmune illnesses. 22 , 23 Serum IL-18 levels were further analyzed in relation to IL-18 rs549908 genotypes and illness activity scores in individuals with ankylosing spondylitis. Across all genotypes, patients with AS exhibited significantly greater IL-18 concentrations compared to healthy controls (p = 0.001). Among individuals with moderate illness activity, the highest serum IL-18 levels were observed in individuals with the GG genotype (268.42 pg/mL), followed by those with TT and TG genotypes. A similar trend was noted in patients with severe illness activity, although the absolute IL-18 values were slightly lower than in the moderate group. These outcomes suggest that while the TT genotype was associated with raised susceptibilities to AS, serum IL-18 levels did not correlate directly with genotype. This indicates that IL-18 levels may be regulated by additional factors beyond genetic variation at rs549908. Similar observations were reported by Doss et al. , who found no significant variations in serum IL-18 concentrations among different IL-18 genotypes in individuals with cutaneous lichen planus. 24 The markedly elevated serum IL-18 levels in AS patients, it was crucial to account for potential confounding factors such as biologic therapy, disease duration, and co-infections, which may affect IL-18 concentrations independently of genotype, demonstrating the need for caution in the interpretation of these elevated cytokine levels. The limited sample size within the GG subgroup, the immune system might vary among individuals and severity of illness which might have affected the cytokine levels rather than genotype. Although Limited sample size in our study reduces the ability to generalise study results, this remains the first study to correlate this polymorphism with AS development among Iraqi individuals. Additional research is necessary to examine rs549908 in autoimmune illnesses in Middle Eastern populations to improve regional comprehension of immune-related genetic variables. The present study demonstrated that specific IL-18 polymorphisms were significantly associated with reduced risk of ankylosing spondylitis (AS). The GT genotype, together with the corresponding protective allele, exhibited reduced susceptibility even after controlling for potential confounders. This observation aligns with findings from earlier research that have associated the genotypes GC (rs187238) and AG (rs360719) with a diminished risk of inflammatory disorders. These findings suggest a protective role of these IL-18 variants against AS, pointing toward a potential immunomodulatory mechanism whereby IL-18 genetic diversity influences inflammatory disease outcomes. This results align with and expand upon previous investigations of IL-18 polymorphisms in immune-mediated and inflammatory conditions. For example, Liang et al. reported associations of rs187238 and rs1946518 with biliary atresia, supporting the concept that IL-18 variants can alter disease risk in diverse contexts. 25 Similarly, Lando et al and Aboraia et al. identified rs549908 as a variant associated with total IgE levels in asthma patients across European populations, further reinforcing its involvement in immune dysregulation. 26 , 27 The consistent implication of these polymorphisms across different inflammatory and immune-related conditions highlights their functional relevance. Interestingly, some studies reported divergent findings depending on population and disease phenotype, which may reflect genetic heterogeneity and environmental interactions. For instance, Eitan et al. found no association of rs187238, rs1946518, or rs549908 with alopecia areata in a Korean cohort, although associations were evident in Turkish populations. 28 Likewise, Mazurek-Mochol et al. observed no significant link between rs187238 and periodontitis risk but noted altered IL-18 expression and clinical periodontal measures among carriers of other genotypes. 13 These discrepancies emphasized the complex role of IL-18 as both a pro-inflammatory cytokine and, in some contexts, a potential protective factor. The findings were particularly notable because they suggested that IL-18 polymorphisms might have reduced the likelihood of AS. This contrasts with reports in other diseases where risk alleles contribute to pathology. This could indicate that in AS, specific allelic variants downregulate pro-inflammatory pathways or alter cytokine signaling in a manner that mitigates disease onset. Supporting this, de Almeida Viana et al. showed that rs187238 influenced lipid metabolism in COVID-19 patients, suggesting pleiotropic effects of IL-18 polymorphisms beyond classical inflammation. 29 Taken together, these findings imply that the biological effect of IL-18 variants may be disease and tissue-specific. Conclusion This pilot study demonstrated that serum levels of IL-18 were significantly elevated in patients with ankylosing spondylitis (AS), suggesting a potential role of this cytokine in disease pathogenesis. Moreover, the T allele and TT genotype of the IL-18 rs549908 SNP were associated with an increased susceptibility to AS in the Iraqi population, whereas the G allele, particularly in the GG and TG genotypes, appeared to confer a protective effect under a dominant genetic model. However, these findings should be interpreted with caution. The relatively small study population limits the generalizability of the results, and the observed associations must therefore be considered preliminary and exploratory in nature. Larger studies across diverse populations are required to validate these findings and to clarify the functional impact of IL-18 gene polymorphisms in the onset and progression of AS. Ethical considerations Ethical approval was obtained from the Biotechnology Department Ethics Committee at the College of Science, University of Baghdad (No. CSEC/0725/0086 on July 12, 2025). Every participant gave written informed consent before they enrolled. Data availability Zenodo. The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients https://doi.org/10.5281/zenodo.17716124 (Ibtehal et al., 2025). 30 This project comprises the following underlying data: • STROBE_checklist.pdf (Completed STROBE checklist for this study). • Raw_Data.xlsx (Individual raw data underlying all means, standard deviations, figures, and tables reported in the article). The data is available under the Creative Commons Attribution 4.0 International (CC-BY 4.0) license. The assay kits utilized in this investigation are commercially available. The manufacturer procedures are accessible via the following links: • EasyPure ® Blood Genomic DNA Kit (TransGen Biotech): https://www.transgenbiotech.com/genomic_dna_purification/easypure_blood_genomic_dna_kit.html • Human IL-18 ELISA Kit (Cat. No. EH0011, FineTest): https://www.fn-test.com/product/eh0011 Reporting guidelines This observational study was conducted in accordance with the STROBE (Strengthening the Reporting of Observational Studies in Epidemiology) reporting guidelines. Acknowledgments Appreciation is expressed to the University of Baghdad, College of Sciences, Department of Biotechnology, and the Rheumatology Unit of Baghdad Teaching Hospital. References 1. Pishgahi A, Abolhasan R, Danaii S, et al. : Immunological and oxidative stress biomarkers in ankylosing spondylitis patients with or without metabolic syndrome. Cytokine. 2020; 128 : 155002. Publisher Full Text 2. Voruganti A, Bowness P: New developments in our understanding of ankylosing spondylitis pathogenesis. Immunology. 2020; 161 (2): 94–102. PubMed Abstract | Publisher Full Text | Free Full Text 3. Salem IA, Al-Najar AF, Joda AT: Evaluation of Apelin and Tartrate-Resistant Acid Phosphatase-5b in Ankylosing Spondylitis Male Patients With and Without Osteoporosis. Iraqi J. Sci. 2019; 60 (3): 426–431. 4. Sharip A, Kunz J: Understanding the pathogenesis of spondyloarthritis. Biomolecules. 2020; 10 (10): 1461. PubMed Abstract | Publisher Full Text | Free Full Text 5. Kany S, Vollrath JT, Relja B: Cytokines in inflammatory disease. Int. J. Mol. Sci. 2019; 20 (23): 6008. PubMed Abstract | Publisher Full Text | Free Full Text 6. Zheng B, Yu P, Liu H, et al. : Anti-osteoporosis is imperative in prevention of progress of ankylosing spondylitis. Int. J. Gen. Med. 2025; 18 : 291–297. PubMed Abstract | Publisher Full Text | Free Full Text 7. Waszczykowski M, Bednarski I, Narbutt J, et al. : Interleukin-18, interleukin-20, and matrix metalloproteinases (MMP-1, MMP-3) as markers of psoriatic arthritis disease severity and their correlations with biomarkers of inflammation and turnover of joint cartilage. Postepy Dermatol. Alergol. 2020; 37 (6): 823–831. 8. Said EM, Soliman MS, Shousha HI, et al. : Interleukin-18 and its gene single nucleotide polymorphisms (SNPs) influence chronic hepatitis C progression. J. Infect. Dev. Ctries. 2018; 12 (4): 257–264. PubMed Abstract | Publisher Full Text 9. Ju J, Li Z, Jia X, et al. : Interleukin-18 in chronic pain: Focus on pathogenic mechanisms and potential therapeutic targets. Pharmacol. Res. 2024; 201 : 107089. PubMed Abstract | Publisher Full Text 10. Wu J, Zhang X, Wu D, et al. : Evaluation of causal associations between interleukin-18 levels and immune-mediated inflammatory diseases: a Mendelian randomization study. BMC Med. Genet. 2023; 16 : 306. PubMed Abstract | Publisher Full Text | Free Full Text 11. Shimizu M, Takei S, Mori M, et al. : Pathogenic roles and diagnostic utility of interleukin-18 in autoinflammatory diseases. Front. Immunol. 2022; 13 : 951535. PubMed Abstract | Publisher Full Text | Free Full Text 12. Buraczynska M, Ksiazek P, Baranowicz-Gaszczyk I, et al. : Interleukin-18 gene polymorphism and risk of cardiovascular disease in older patients with type 2 diabetes mellitus. Diabetes Res. Clin. Pract. 2016; 121 : 178–183. PubMed Abstract | Publisher Full Text 13. Mazurek-Mochol M, Brzeska M, Serwin K, et al. : IL-18 gene rs187238 and rs1946518 polymorphisms and expression in gingival tissue in individuals with periodontitis. Biomedicine. 2022; 10 (10): 2367. 14. Wang WY, Fu FL, Wang WB, et al. : Genetic variants of interleukin-18 are associated with reduced risk of atrial fibrillation in a population from Northeast China. Gene. 2017; 626 : 269–274. PubMed Abstract | Publisher Full Text 15. Jung JH, Jeong HS, Choi SJ, et al. : Associations between interleukin-18 gene polymorphisms and susceptibility to vasculitis: A meta-analysis. Sarcoidosis Vasc. Diffuse Lung Dis. 2020; 37 (2): 203–209. 16. Rudwaleit M, Van Der Heijde D, Landewé R, et al. : The development of Assessment of SpondyloArthritis international Society classification criteria for axial spondyloarthritis (part II): validation and final selection. Ann. Rheum. Dis. 2009; 68 (6): 777–783. PubMed Abstract | Publisher Full Text 17. Popescu C, Trandafir M, Bădică AM, et al. : Ankylosing spondylitis functional and activity indices in clinical practice. J. Med. Life. 2014; 7 (1): 78–83. PubMed Abstract 18. Rex DAB, Agarwal N, Prasad TSK, et al. : A comprehensive pathway map of IL-18-mediated signalling. J. Cell Commun. Signal. 2020; 14 (2): 257–266. PubMed Abstract | Publisher Full Text | Free Full Text 19. Przepiera-Będzak H, Fischer K, Brzosko M: Serum interleukin-18, fetuin-A, soluble intercellular adhesion molecule-1, and endothelin-1 in ankylosing spondylitis, psoriatic arthritis, and SAPHO syndrome. Int. J. Mol. Sci. 2016; 17 (8): 1255. PubMed Abstract | Publisher Full Text | Free Full Text 20. Kang K, Jeong P, Woo K, et al. : Association between interleukin-18 polymorphisms and alopecia areata in Koreans. J. Interf. Cytokine Res. 2014; 34 (9): 704–709. 21. Abdulridha RH, Saud AM, Alosami MH, et al. : Assessment of miR-146a Gene Polymorphisms in individuals with Systemic Lupus Erythematosus. Iraqi J. Sci. 2023; 64 (3): 573–582. Publisher Full Text 22. Saud AM, Jebur MS, et al. : Strong Association of STIP1 Gene rs2236647 Polymorphism and Serum Magnesium Level with Bronchial Asthma in a Population from Iraq. J. Biosci. Appl. Res. 2024; (3): 328–337. Publisher Full Text 23. Ratib BA, Saud AM, et al. : Relationship between Toll-like Receptors and pathogenesis of Systemic Lupus Erythematosus. Revis Bionatura. 2023; 8 (2): 1–35. Publisher Full Text 24. Doss RW, El-Rifaie AA, Roshdy AN, et al. : Assessment of interleukin-18 gene polymorphism and serum levels in cutaneous lichen planus. Eur. J. Med. Res. 2024; 29 (1): 345. PubMed Abstract | Publisher Full Text | Free Full Text 25. Liang J, Wen Z, Zhao J, et al. : Association of IL18 genetic polymorphisms with increased risk of biliary atresia susceptibility in Southern Chinese children. Gene. 2018; 677 : 228–231. PubMed Abstract | Publisher Full Text 26. Lando V, Calciano L, Minelli C, et al. : IL18 gene polymorphism is associated with total IgE in adult subjects with asthma. J. Clin. Med. 2023; 12 (12): 3963. PubMed Abstract | Publisher Full Text | Free Full Text 27. Aboraia N, Abdelaleem OO, Abd El-Rahman AT, et al. : Interleukins gene polymorphism in alopecia areata patients: a systematic review. Fayoum Univ. Med. J. 2025; 15 (1): 34–44. Publisher Full Text 28. Eitan LN, Alghamdi MA, Al Momani RO, et al. : Genetic association between interleukin genes and alopecia areata in Jordanian patients. Oman Med. J. 2022; 37 (5): e421. PubMed Abstract | Publisher Full Text | Free Full Text 29. de Almeida VG , da Silva ME , Duque BR, et al. : Serum IL-18 and rs187238 single nucleotide polymorphism are associated with high-density lipoprotein changes in COVID-19 outpatients. Int. Immunopharmacol. 2023; 122 : 110645. 30. Jasim IK, Saud AM: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients. [Dataset]. Zenodo. 2025. Publisher Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 15 Dec 2025 ADD YOUR COMMENT Comment Author details Author details 1 Biotechnology, University of Baghdad, Baghdad, Baghdad Governorate, Iraq Ibtehal Kadhim Jasim Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Validation, Visualization, Writing – Original Draft Preparation Asmaa Mohammed Saud Roles: Conceptualization, Methodology, Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information The author(s) declared that no grants were involved in supporting this work. Article Versions (2) version 2 Revised Published: 14 May 2026, 14:1399 https://doi.org/10.12688/f1000research.172631.2 version 1 Published: 15 Dec 2025, 14:1399 https://doi.org/10.12688/f1000research.172631.1 Copyright © 2025 Jasim IK and Saud AM. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Jasim IK and Saud AM. The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.12688/f1000research.172631.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 15 Dec 2025 Views 0 Cite How to cite this report: Hussein Sm. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r475867 ) The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-475867 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 30 Apr 2026 Sahar m Hussein , Al-Nahrain University, Baghdad, Iraq Approved VIEWS 0 https://doi.org/10.5256/f1000research.190371.r475867 The study contributed suitable and methodical information on the correlation between IL-18 rs549908 polymorphism and serum IL-18 expression levels with susceptibility to ankylosing spondylitis in Iraqi subjects. The incorporation of genetic and immunological analysis is an evident strength and ... Continue reading READ ALL The study contributed suitable and methodical information on the correlation between IL-18 rs549908 polymorphism and serum IL-18 expression levels with susceptibility to ankylosing spondylitis in Iraqi subjects. The incorporation of genetic and immunological analysis is an evident strength and adds to the biological significance of the results. This study is well suited for its research objectives, and the methodologies used are appropriate and adequately described to ensure reproducibility. Results are clearly presented and show statistically significant differences that validate the proposed role of IL-18 in inflammatory and immune pathways. ROC analysis was found to also reinforce the possible diagnostic potential of IL-18. The study also adds, regionally, useful data that add to the known genetic vulnerability of ankylosing spondylitis, and to more generalized findings of this disease, particularly among underrepresented populations. A Few points for Improvement. 1- Style: Language and scientific style: Some other language modifications could streamline the paper so that it is easier to read simply by removing the complex or repetitive structures. 2- Statistical clarity: The statistical quality is ok, however, slight improvement in the consistency of the terms and reporting would provide greater clarity. 3- ROC curve: This clinical association, such as it is in ROC, can be improved through diagnostic metrics (specific cut-off, sensitivity, and specificity) and these outcomes can also be integrated into that evaluation in the clinical literature. 4- Discussion enhancement: A few studies of immune-related genetic polymorphisms among individuals with ankylosing spondylitis from different populations would slightly supplement the discussion. Although the reported findings are strong and well-described, future studies with larger cohorts and multivariate analytical techniques would be instrumental to successful generalizability, including advancing a broader perspective regarding the independent role of IL-18 genetic variants to disease susceptibility. Finally: The manuscript is scientifically sound, and the conclusions are supported by the presented data. The suggested points are minor and intended to further enhance clarity and presentation. The work is suitable for indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: molecular biology, molecular genetics , genetics , bioinformatics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Hussein Sm. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r475867 ) The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-475867 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 14 May 2026 Ibtehal kadhim , Biotechnology, University of Baghdad, Baghdad, Iraq 14 May 2026 Author Response Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for ... Continue reading Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for better consistency. The ROC analysis has been clarified, and the discussion has been strengthened by incorporating additional relevant studies. We believe these revisions have improved the manuscript. Sincerely, The Authors Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for better consistency. The ROC analysis has been clarified, and the discussion has been strengthened by incorporating additional relevant studies. We believe these revisions have improved the manuscript. Sincerely, The Authors Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 14 May 2026 Ibtehal kadhim , Biotechnology, University of Baghdad, Baghdad, Iraq 14 May 2026 Author Response Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for ... Continue reading Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for better consistency. The ROC analysis has been clarified, and the discussion has been strengthened by incorporating additional relevant studies. We believe these revisions have improved the manuscript. Sincerely, The Authors Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for better consistency. The ROC analysis has been clarified, and the discussion has been strengthened by incorporating additional relevant studies. We believe these revisions have improved the manuscript. Sincerely, The Authors Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Hassan Hussein R. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r475866 ) The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-475866 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 25 Apr 2026 Raghad Hassan Hussein , Department of Medical laboratory Techniques, College of health and medical techniques, Middle Technical University, Baghdad, Iraq Approved VIEWS 0 https://doi.org/10.5256/f1000research.190371.r475866 This manuscript presents an investigation into the association between the I L-18 rs549908 polymorphism and ankylosing spondylitis (AS) in an Iraqi population. The study addresses an important gap in the literature by providing population-specific genetic and immunological data, which are ... Continue reading READ ALL This manuscript presents an investigation into the association between the I L-18 rs549908 polymorphism and ankylosing spondylitis (AS) in an Iraqi population. The study addresses an important gap in the literature by providing population-specific genetic and immunological data, which are currently underrepresented in this field. The integration of molecular genetic analysis with serum cytokine quantification (ELISA) is a notable strength, offering a more comprehensive understanding of both genetic susceptibility and inflammatory status in AS. In conclusion, This study provides meaningful insights into the genetic and immunological factors underlying ankylosing spondylitis and represents a valuable contribution to the field, particularly in the context of Middle Eastern populations. .The manuscript would benefit from minor English editing to improve clarity and readability. For example: Replace “relations among” with “association between” Replace “illness activity” with “disease activity” These are minor issues and do not affect scientific content. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Immunity and inflammation, immunogenetics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Hassan Hussein R. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r475866 ) The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-475866 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 14 May 2026 Ibtehal kadhim , Biotechnology, University of Baghdad, Baghdad, Iraq 14 May 2026 Author Response Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including ... Continue reading Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including replacing “relations among” with “association between” and “illness activity” with “disease activity”. These revisions have improved the overall quality of the manuscript. Sincerely, The Authors Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including replacing “relations among” with “association between” and “illness activity” with “disease activity”. These revisions have improved the overall quality of the manuscript. Sincerely, The Authors Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 14 May 2026 Ibtehal kadhim , Biotechnology, University of Baghdad, Baghdad, Iraq 14 May 2026 Author Response Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including ... Continue reading Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including replacing “relations among” with “association between” and “illness activity” with “disease activity”. These revisions have improved the overall quality of the manuscript. Sincerely, The Authors Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including replacing “relations among” with “association between” and “illness activity” with “disease activity”. These revisions have improved the overall quality of the manuscript. Sincerely, The Authors Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Kırkık D. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r445404 ) The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-445404 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 21 Jan 2026 Duygu Kırkık , Hamidiye Faculty of Medicine, University of Health Sciences, Istanbul, Turkey Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.190371.r445404 This study presents a unique and regionally valuable contribution by addressing the association between the IL-18 rs549908 polymorphism and serum IL-18 levels with ankylosing spondylitis (AS) in an Iraqi population. The combined evaluation of genetic analysis and biochemical measurements is ... Continue reading READ ALL This study presents a unique and regionally valuable contribution by addressing the association between the IL-18 rs549908 polymorphism and serum IL-18 levels with ankylosing spondylitis (AS) in an Iraqi population. The combined evaluation of genetic analysis and biochemical measurements is a strength of the study. However, as it stands, the article requires significant revision in terms of language, methodological clarity, statistical consistency, and interpretation. The text contains significant problems with English language and style. Frequently used expressions: “relations among” → “association between” “raised susceptibilities” → “increased susceptibility” “illness activity” → “disease activity” Many sentences are grammatically incorrect, long, and repetitive. Between the AS and control groups: Age difference was borderline significant (p = 0.059) Gender distribution was significantly different (p < 0.001) However: Logistic regression or multivariate analysis was not performed ORs were not adjusted. HWE results: For the control group, χ² = 8.006 and p = 0.99 are statistically inconsistent. Expressions such as “extremely significant” for p < 0.01 are not recommended in scientific writing. ROC analysis: AUC = 0.923 → very high However, cut-off, sensitivity, specificity, PPV/NPV are not provided The statistical analysis section should be restructured and the results simplified. The discussion could be further strengthened by incorporating recent population-based evidence supporting the role of innate immune–related genetic variants in ankylosing spondylitis. In line with the present findings, growing evidence suggests that genetic variations in immune signaling pathways contribute not only to disease susceptibility but also to clinical heterogeneity and disease activity in AS. Notably, Kirkik et al. demonstrated a significant association between the TLR4 rs41426344 polymorphism and disease activity in Turkish patients with ankylosing spondylitis , emphasizing the importance of immune-regulatory gene variants in AS pathogenesis across different populations ( International Journal of Immunogenetics , 2026) (Ref 1). Including this reference would provide valuable contextual support and reinforce the biological plausibility of the current genetic findings. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Kirkik D, Kalkanli Tas S, Dogantekin B, Kariksiz M, et al.: The Impact of TLR4 rs41426344 Polymorphism on Ankylosing Spondylitis Disease Activity: A Study in Turkish Patients. International Journal of Immunogenetics . 2026; 53 (1): 54-62 Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: immunogenetics, anklosing spondilitis, polymorphisms, vaccine I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Kırkık D. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r445404 ) The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-445404 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 14 May 2026 Ibtehal kadhim , Biotechnology, University of Baghdad, Baghdad, Iraq 14 May 2026 Author Response Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” ... Continue reading Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” and “illness activity” have been corrected, and repetitive and complex sentences have been simplified. The statistical analysis section has been revised for clarity and consistency. The use of inappropriate terms such as “extremely significant” has been removed, and Hardy–Weinberg equilibrium calculations have been rechecked. The ROC analysis has been clarified to better reflect its diagnostic relevance. As suggested, the discussion has been strengthened by incorporating recent evidence on immune-related genetic variants, including the study by Kirkik et al. (2026). We believe these revisions have substantially improved the manuscript and addressed all concerns raised. Sincerely, The Authors Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” and “illness activity” have been corrected, and repetitive and complex sentences have been simplified. The statistical analysis section has been revised for clarity and consistency. The use of inappropriate terms such as “extremely significant” has been removed, and Hardy–Weinberg equilibrium calculations have been rechecked. The ROC analysis has been clarified to better reflect its diagnostic relevance. As suggested, the discussion has been strengthened by incorporating recent evidence on immune-related genetic variants, including the study by Kirkik et al. (2026). We believe these revisions have substantially improved the manuscript and addressed all concerns raised. Sincerely, The Authors Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 14 May 2026 Ibtehal kadhim , Biotechnology, University of Baghdad, Baghdad, Iraq 14 May 2026 Author Response Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” ... Continue reading Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” and “illness activity” have been corrected, and repetitive and complex sentences have been simplified. The statistical analysis section has been revised for clarity and consistency. The use of inappropriate terms such as “extremely significant” has been removed, and Hardy–Weinberg equilibrium calculations have been rechecked. The ROC analysis has been clarified to better reflect its diagnostic relevance. As suggested, the discussion has been strengthened by incorporating recent evidence on immune-related genetic variants, including the study by Kirkik et al. (2026). We believe these revisions have substantially improved the manuscript and addressed all concerns raised. Sincerely, The Authors Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” and “illness activity” have been corrected, and repetitive and complex sentences have been simplified. The statistical analysis section has been revised for clarity and consistency. The use of inappropriate terms such as “extremely significant” has been removed, and Hardy–Weinberg equilibrium calculations have been rechecked. The ROC analysis has been clarified to better reflect its diagnostic relevance. As suggested, the discussion has been strengthened by incorporating recent evidence on immune-related genetic variants, including the study by Kirkik et al. (2026). We believe these revisions have substantially improved the manuscript and addressed all concerns raised. Sincerely, The Authors Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 15 Dec 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 14 May 26 Version 1 15 Dec 25 read read read Duygu Kırkık , Hamidiye Faculty of Medicine, University of Health Sciences, Istanbul, Turkey Raghad Hassan Hussein , College of health and medical techniques, Middle Technical University, Baghdad, Iraq Sahar m Hussein , Al-Nahrain University, Baghdad, Iraq Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Hussein S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 30 Apr 2026 | for Version 1 Sahar m Hussein , Al-Nahrain University, Baghdad, Iraq 0 Views copyright © 2026 Hussein S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The study contributed suitable and methodical information on the correlation between IL-18 rs549908 polymorphism and serum IL-18 expression levels with susceptibility to ankylosing spondylitis in Iraqi subjects. The incorporation of genetic and immunological analysis is an evident strength and adds to the biological significance of the results. This study is well suited for its research objectives, and the methodologies used are appropriate and adequately described to ensure reproducibility. Results are clearly presented and show statistically significant differences that validate the proposed role of IL-18 in inflammatory and immune pathways. ROC analysis was found to also reinforce the possible diagnostic potential of IL-18. The study also adds, regionally, useful data that add to the known genetic vulnerability of ankylosing spondylitis, and to more generalized findings of this disease, particularly among underrepresented populations. A Few points for Improvement. 1- Style: Language and scientific style: Some other language modifications could streamline the paper so that it is easier to read simply by removing the complex or repetitive structures. 2- Statistical clarity: The statistical quality is ok, however, slight improvement in the consistency of the terms and reporting would provide greater clarity. 3- ROC curve: This clinical association, such as it is in ROC, can be improved through diagnostic metrics (specific cut-off, sensitivity, and specificity) and these outcomes can also be integrated into that evaluation in the clinical literature. 4- Discussion enhancement: A few studies of immune-related genetic polymorphisms among individuals with ankylosing spondylitis from different populations would slightly supplement the discussion. Although the reported findings are strong and well-described, future studies with larger cohorts and multivariate analytical techniques would be instrumental to successful generalizability, including advancing a broader perspective regarding the independent role of IL-18 genetic variants to disease susceptibility. Finally: The manuscript is scientifically sound, and the conclusions are supported by the presented data. The suggested points are minor and intended to further enhance clarity and presentation. The work is suitable for indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise molecular biology, molecular genetics , genetics , bioinformatics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (1) Author Response 14 May 2026 Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq Dear Reviewer, We sincerely thank you for your constructive and encouraging comments. The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for better consistency. The ROC analysis has been clarified, and the discussion has been strengthened by incorporating additional relevant studies. We believe these revisions have improved the manuscript. Sincerely, The Authors View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Hussein Sm. Peer Review Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r475867) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-475867 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Hassan Hussein R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 25 Apr 2026 | for Version 1 Raghad Hassan Hussein , Department of Medical laboratory Techniques, College of health and medical techniques, Middle Technical University, Baghdad, Iraq 0 Views copyright © 2026 Hassan Hussein R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This manuscript presents an investigation into the association between the I L-18 rs549908 polymorphism and ankylosing spondylitis (AS) in an Iraqi population. The study addresses an important gap in the literature by providing population-specific genetic and immunological data, which are currently underrepresented in this field. The integration of molecular genetic analysis with serum cytokine quantification (ELISA) is a notable strength, offering a more comprehensive understanding of both genetic susceptibility and inflammatory status in AS. In conclusion, This study provides meaningful insights into the genetic and immunological factors underlying ankylosing spondylitis and represents a valuable contribution to the field, particularly in the context of Middle Eastern populations. .The manuscript would benefit from minor English editing to improve clarity and readability. For example: Replace “relations among” with “association between” Replace “illness activity” with “disease activity” These are minor issues and do not affect scientific content. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Immunity and inflammation, immunogenetics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (1) Author Response 14 May 2026 Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq Dear Reviewer, We thank you for your positive evaluation and helpful comments. The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including replacing “relations among” with “association between” and “illness activity” with “disease activity”. These revisions have improved the overall quality of the manuscript. Sincerely, The Authors View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Hassan Hussein R. Peer Review Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r475866) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-475866 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Kırkık D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 21 Jan 2026 | for Version 1 Duygu Kırkık , Hamidiye Faculty of Medicine, University of Health Sciences, Istanbul, Turkey 0 Views copyright © 2026 Kırkık D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This study presents a unique and regionally valuable contribution by addressing the association between the IL-18 rs549908 polymorphism and serum IL-18 levels with ankylosing spondylitis (AS) in an Iraqi population. The combined evaluation of genetic analysis and biochemical measurements is a strength of the study. However, as it stands, the article requires significant revision in terms of language, methodological clarity, statistical consistency, and interpretation. The text contains significant problems with English language and style. Frequently used expressions: “relations among” → “association between” “raised susceptibilities” → “increased susceptibility” “illness activity” → “disease activity” Many sentences are grammatically incorrect, long, and repetitive. Between the AS and control groups: Age difference was borderline significant (p = 0.059) Gender distribution was significantly different (p < 0.001) However: Logistic regression or multivariate analysis was not performed ORs were not adjusted. HWE results: For the control group, χ² = 8.006 and p = 0.99 are statistically inconsistent. Expressions such as “extremely significant” for p < 0.01 are not recommended in scientific writing. ROC analysis: AUC = 0.923 → very high However, cut-off, sensitivity, specificity, PPV/NPV are not provided The statistical analysis section should be restructured and the results simplified. The discussion could be further strengthened by incorporating recent population-based evidence supporting the role of innate immune–related genetic variants in ankylosing spondylitis. In line with the present findings, growing evidence suggests that genetic variations in immune signaling pathways contribute not only to disease susceptibility but also to clinical heterogeneity and disease activity in AS. Notably, Kirkik et al. demonstrated a significant association between the TLR4 rs41426344 polymorphism and disease activity in Turkish patients with ankylosing spondylitis , emphasizing the importance of immune-regulatory gene variants in AS pathogenesis across different populations ( International Journal of Immunogenetics , 2026) (Ref 1). Including this reference would provide valuable contextual support and reinforce the biological plausibility of the current genetic findings. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Kirkik D, Kalkanli Tas S, Dogantekin B, Kariksiz M, et al.: The Impact of TLR4 rs41426344 Polymorphism on Ankylosing Spondylitis Disease Activity: A Study in Turkish Patients. International Journal of Immunogenetics . 2026; 53 (1): 54-62 Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise immunogenetics, anklosing spondilitis, polymorphisms, vaccine I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 14 May 2026 Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq Dear Reviewer, We sincerely thank you for your careful evaluation and valuable comments. The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” and “illness activity” have been corrected, and repetitive and complex sentences have been simplified. The statistical analysis section has been revised for clarity and consistency. The use of inappropriate terms such as “extremely significant” has been removed, and Hardy–Weinberg equilibrium calculations have been rechecked. The ROC analysis has been clarified to better reflect its diagnostic relevance. As suggested, the discussion has been strengthened by incorporating recent evidence on immune-related genetic variants, including the study by Kirkik et al. (2026). We believe these revisions have substantially improved the manuscript and addressed all concerns raised. Sincerely, The Authors View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Kırkık D. Peer Review Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients [version 1; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :1399 ( https://doi.org/10.5256/f1000research.190371.r445404) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1399/v1#referee-response-445404 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "The Impact of Promoter Variants in Interleukin-18...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-1399/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/14-1399/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/14-1399/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Jasim IK and Saud AM'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-1399/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/14-1399", templates : { twitter : "The Impact of Promoter Variants in Interleukin-18 on Susceptibility.... Jasim IK and Saud AM, published by " + "@F1000Research" + ", https://f1000research.com/articles/14-1399/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/172631/190371") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "190371"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "457230": 0, "457231": 0, "479374": 0, "457228": 0, "479373": 0, "457229": 0, "457227": 0, "451094": 0, "451095": 0, "457236": 0, "457234": 0, "457235": 0, "457232": 0, "457233": 0, "451102": 0, "451103": 0, "451100": 0, "451101": 0, "451098": 0, "451099": 0, "451096": 0, "451097": 0, "452534": 0, "452535": 0, "442551": 0, "452533": 0, "452542": 0, "448190": 0, "442558": 0, "448191": 0, "442559": 0, "452540": 0, "448188": 0, "442556": 0, "452541": 0, "448189": 0, "442557": 0, "452538": 0, "448186": 0, "442554": 0, "452539": 0, "448187": 0, "442555": 0, "452536": 0, "442552": 0, "452537": 0, "442553": 0, "448194": 0, "448195": 0, "448192": 0, "442560": 0, "448193": 0, "472271": 0, "472270": 0, "472269": 0, "472268": 0, "472267": 0, "472276": 0, "472275": 0, "472274": 0, "472273": 0, "472272": 0, "445406": 0, "445407": 0, "475869": 0, "445404": 22, "445405": 0, "475868": 0, "475867": 10, "445403": 0, "475866": 13, "461286": 0, "461285": 0, "445412": 0, "461284": 0, "445410": 0, "445411": 0, "445408": 0, "445409": 0, "484858": 0, "484857": 0, "484856": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "a9c8a664-a3cf-4563-9423-cd894715984b"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.