Total flavonoids from Carthamus tinctorius L inhibits the liver fibrosis progression via Hippo/YAP pathway

Total flavonoids from Carthamus tinctorius L inhibits the liver fibrosis progression via Hippo/YAP pathway | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 2 January 2025 V1 Latest version Share on Total flavonoids from Carthamus tinctorius L inhibits the liver fibrosis progression via Hippo/YAP pathway Authors : Xiaomei Bao , Xiaolu Zhao , Haisheng Wang , Hongwei Yuan , Rong Jin , Mingqi Li , Yinghe Wang , and Yuehong Ma 0000-0003-1414-0066 [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.173582730.06826224/v1 Published Journal of Natural Medicines Version of record Peer review timeline 205 views 110 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Background and Purpose: The incidence of liver fibrosis has remained high worldwide, posing a serious threat to human health. Carthamus tinctorius L is a traditional medicine for treating liver disease, and flavonoids, as the main active ingredients, have a wide range of pharmacological activities. This study investigated the pharmacodynamic effects and mechanism of action of total flavonoids from Carthamus tinc torius L (TFCTL) on hepatic fibrosis mice and TGF-β1 induced activated hepatic stellate cells (HSC). Methods: LC-MS/MS technique was used to identify the chemical constituents of TFCTL. We established an animal model of liver fibrosis and simultaneously induced the activation of HSC-T6 cells in vitro and CCK-8, Western blot, flow cytometry, RT-qPCR, immunofluorescence technology were applied to investigate the anti-hepatic fibrosis effect and mechanism of TFCTL. Results: TFCTL can promote YAP phosphorylation and degradation by inhibiting the activation and proliferation of HSC-T6 cells in vitro , increasing the expression of MST1 and LATS1, and then inhibiting the expression of downstream target genes in the Hippo signaling pathway. TFCTL can significantly improve the pathological conditions of liver fibrosis mice and the mechanism of action is mainly related to the Hippo/YAP pathway. Implications: TFCTL has significant anti-fibrotic effects which may be recognized as a prospective drug candidate for the therapy of liver fibrosis. 1. Introduction The global incidence of liver fibrosis remains high, posing a significant threat to human health. Understanding the pathogenesis and clinical significance of liver fibrosis is crucial for the development of novel anti-fibrotic therapies. Inhibiting hepatic stellate cell (HSC) proliferation and activation, as well as reducing extracellular matrix (ECM) deposition, are key priorities in anti-fibrotic research. 1 Despite continuous advancements in understanding the pathological mechanisms and clinical prognosis of liver fibrosis in recent years, there remains a dearth of approved effective drugs targeting fibrosis. Hence, there is an urgent need to elucidate the cellular and molecular mechanisms underlying fibrosis reversal and develop novel therapeutic agents. In recent years, targeted formulations of traditional Chinese medicine have emerged as a precise therapeutic modality for hepatic fibrosis treatment, offering enhanced bioavailability while mitigating potential toxicities on other organs. 1 As a traditional Chinese medicine for liver protection, Carthamus tinctorius L is also one of the characteristic Mongolian medicinal herbs for the treatment of liver diseases, however, the pharmacological effects of its active chemical components have not been sufficiently studied. 2-4 In a previous study, the research group identified and analyzed the chemical constituents of total flavonoids from Carthamus tinctorius L (TFCTL) extracted by using LC-MS/MS technique, and a total of 267 chemical constituents were identified, and it was found that flavonoids accounted for a large proportion of the constituents. It has been shown in the literature that flavonoids have anti-hepatic fibrosis effects, and their mechanisms of action may involve anti-inflammatory, anti-apoptotic, and inhibition of the abnormal accumulation of extracellular matrix and other pathways and targets to reduce or reverse the progression of cirrhosis. And modern pharmacological studies show that the main active components of Carthamus tinctorius L belong to flavonoids. 5 More studies have been conducted to investigate the mechanism of action of anti-hepatic fibrosis from the perspective of total flavonoids extracted from single drugs. 6-7 The total flavonoids of Carthamus tinctorius L have rarely been reported in the anti-hepatic fibrosis effect, so based on the group’s previous research results and the review of existing literature, it can be speculated that TFCTL may have some therapeutic effects on hepatic fibrosis. Therefore, in the present study, LC-MS/MS technique was used to identify the chemical constituents of TFCTL and to investigate the effects of TFCTL on liver fibrosis and its mechanism. In order to investigate the anti-hepatic fibrosis effect and mechanism of TFCTL, we constructed an animal model of hepatic fibrosis in mice and simultaneously induced the activation of HSC-T6 cells in vitro . This study is the first to investigate the protective effect of TFCTL against liver fibrosis, which provides a useful basis for the development and utilization of the medicinal effective parts of Carthamus tinctorius L. 2 Materials and methods The study was conducted in accordance with the Basic & Clinical Pharmacology & Toxicology policy for experimental and clinical studies. 8 2.1 Extraction of total flavonoids from Carthamus tinctorius L Carthamus tinctorius L herbal medicine was purchased from Anguo Ronghua Herbal Medicine Co. Ltd (C294220505) and identified by Professor Qu bi (School of Pharmacy, Inner Mongolia Medical University). Extraction of total flavonoids from Carthamus tinctorius L: After grinding the Carthamus tinctorius L herb into powder form, the ethanol reflux extraction technique was employed and the material was prepared in the ratio of 1:10. Two rounds of reflux extraction were carried out using 80% ethanol. After combining and concentrating the filtrates of the two rounds, the final extract was obtained, and the saffron extract was suspended with water, adsorbed with AB-8 microporous resin, eluted with 50% ethanol and the filtrate was collected, concentrated and dried to obtain the safflower total flavonoids powder. Using rutin as the standard, the absorbance was measured at 510 nm by UV spectrophotometer and the standard curve was plotted (regression equation: Y=32.45x-0.0034), and the content of total flavonoids was measured to be 70% by the standard curve method. The total flavonoids from Carthamus tinctorius L be stored in Laboratory of School of Pharmacy, Inner Mongolia Medical University (specimen number: 20230030). 2.2 Identification of the chemical composition of TFCTL by LC-MS/MS An appropriate amount of TFCTLL extract sample was taken and placed in a 2 mL centrifuge tube. Then 2 mL of methanol was added, ultrasonication-assisted dissolution, centrifugation (12000 rpm) for 5 min, and the supernatant was taken for LC-MS/MS analysis. Pharmacological experimental validation 2.3 Pharmacodynamic effects of TFCTL on CCl 4 -induced liver fibrosis and TGF-β1 induced HSC-T6 cells in mice Animal modelling and administration Seventy-two male Kunming mice (6-8 weeks old, weighing approximately 18-20 g) were procured from the Animal Centre of Inner Mongolia Medical University. They were housed in a controlled environment with appropriate temperature and humidity levels (45%-55%), alternating light-dark cycles, and provided with water ad libitum. The mice were randomly divided into six groups consisting of 12 mice per group: blank group, CCl 4 model group (20% CCl 4 -peanut oil solution), TFCTL low, medium, high dose groups (75 mg/kg, 150 mg/kg, 300 mg/kg), and silymarin positive control group (100 mg/kg). Both the model and dosing groups received 20% CCl 4 for eight weeks while the blank group was administered an equivalent volume of solvent (CMC-Na solution). Anesthesia was induced by intraperitoneal injection of tribromoethanol at a dosage of 0.2 mL/10g body weight. Subsequently, livers were dissected and perfused with saline to observe gross morphological characteristics using standard rulers for comparison; photographs were taken for documentation purposes. A portion of liver tissue was fixed in 4% paraformaldehyde for pathological examination following a fixation period of 48 hours. All animal care and experimental procedures adhered to ethical guidelines approved by the Inner Mongolia Medical University Animal Centre and Use Committee. Cell culture and viability assays The HSC-T6 cell line was purchased from Starfish Biotechnology Co. The cells were incubated at 37°C with 5% CO 2 and cultured in DMEM supplemented with 10% fontal bovine serum (FBS) and 1% penicillin-streptomycin. HSC-T6 cells (1 × 10 4 cells/well) were inoculated in 96-well plates and treated with TFCTL (10ug/mL, 20ug/mL, 40ug/mL, 60ug/mL, 80ug/mL, 120ug/mL) for 24 h. CCK8 reagent was added to each well and incubated at 37°C for 2 hours. The experiment was performed in triplicate. The optical density at 450 nm was measured. Pathological testing by HE staining of liver tissue Liver tissues were fixed in 10% formalin at 4°C for 24 h, then rinsed with tap water and dehydrated with a series of alcohol solutions of increasing concentrations (70%, 90%, 95%, 100%), then immersed in xylene and poured into paraffin blocks. Tissue sections of 5 μ m thickness were prepared on a ”Leica SM 2000R” sled slicer. Sections were rinsed three times in tap water and stained with hematoxylin for 40 s. Sections were deparaffinized in xylene, then dehydrated in a series of alcohols at decreasing concentrations (100%, 96% and 70%) and then stained with eosin. Finally, the sections were treated with xylene and fixed with a sealer. By Masson collagen staining of liver tissue Consistent with the dewaxing operation in above, the wax block is first subjected to a conventional dewaxing operation as described in the HE step above. Weigert iron hematoxylin staining solution was prepared in the ratio of A:B=1:1, stained for 8min, and distilled water rinsed to remove discolorations. 1% acidic ethanol differentiation for 3-5s, distilled water rinse to terminate differentiation. Masson blue solution infiltration 5min, distilled water rinse 1min. Lichun red magenta staining solution staining 7min, glacial acetic acid wash 2min. Phosphomolybdic acid solution infiltration for 3min, glacial acetic acid wash for 2min. Aniline blue staining for 3min, glacial acetic acid wash for 2min. 95% ethanol dehydration 30s, 100% ethanol dehydration 2 times, 10s each time. Xylene Ⅰ and Ⅱ transparent each 3min.Finally, the film was sealed with neutral gum. 2.4 Effect of TFCTL on CCl 4 -induced liver tissue and TGF-β1 induced HSC-T6 cells Quantitative real-time PCR (qRT-PCR) Total RNA was extracted from liver tissues and HSC-T6 cells using centrifugal column extraction. Then, first-strand cDNA was synthesized using 2μg of total RNA and detected by qRT-PCR. The designed primer sequences are shown in Table 1. The amplification conditions were 95°C for 30 s, 95°C for 10 s, 45 cycles, and 60°C for 30 s. The data were calculated by the ΔΔCT method using GAPDH as the internal reference gene.The primer sequences used in the text are listed in Table 1 . Table 1. Corresponding sequences Name Forward primers Reverse Primers Rat α-SMA CATCCACGAAACCACCTA GGGCAGGAATGATTTGGA Collagen І TGTTGGTCCTGCTGGCAAGAATG GTCACCTTGTTCGCCTGTCTCAC YAP GGCAGTTCCAACCAGCAGCAG TCAACCGCAGTCTCTCCTTCTCC MST1 ACGGCTCAGGTGAACAGTATCG TGGCTTGTGCGGTGTCTCAG LATS1 CTCACAGGCGGATGTAGGAAGAC TCGGAGGTGGTGGAGGAGTAAC Mouse α-SMA TGTGCTGGACTCTGGAGATG GATCACCTGCCCATCAGG Collagen І TGTTGGTCCTGCTGGCAAGAATG GTCACCTTGTTCGCCTGTCTCAC YAP CCCTTTCTTAACAGTGGCACCTATC TGCTCTGGCTGATGGTGTCTC MST1 GAACAGTATCGTGGCTCAGTCAG ATTGTGGCTTATGTGGTGTCTCTG LATS1 TGCACTGGCTTCAGATGGAC CACACCGACAGTTGGAAGGA Western blotting Liver tissue and HSC-T6 cells were lysed with RIPA buffer containing protease inhibitors. After quantification, mixing and heating with 5× upsampling buffer, groups of liver tissue proteins or HSC-T6 cell proteins were separated by SDS-PAGE and transferred to NC membranes, sealed with skimmed milk powder and incubated overnight with primary antibodies, and the following day with fluorescently labelled secondary antibodies, and visualized using the Oddisy imaging system. For quantification, the grey scale values of the bands were counted using Image J software. Immunofluorescence HSC-T6 cells were rinsed with cold PBS and then fixed with 4% paraformaldehyde for 10 min and punched with 0.5% Triton X-100. Subsequently, cells were blocked using BSA to reduce the interference of nonspecific binding and incubated overnight with primary antibodies. Cells were incubated with the matching secondary antibodies for 1 h at room temperature the next day. The nuclei were stained using DAPI. Fluorescence microscope was used to observe the staining, and the desired field of view was photographed and preserved. Statistical analysis GraphPad Prism software (version 8) was used for data analysis. The statistically significant difference was determined by Student’s t -test (unpaired, two-tailed) for two groups or one-way ANOVA for multi-group samples. The data were expressed as mean ± SD and p < 0.05 was considered statistically significant. 3 Results 3.1 Chemical composition identification results The analytical methods for the total flavonoid content can be seen in the above Materials and Methods. 18 flavonoid monomers were identified from total flavonoid extracts ( Table 2). Table 2. Chemical Composition Identification No Name Molecular Formula Adduction Weight- to-charge ratio MS/MS Min 1 Kaempferol C 15 H 10 O 6 [M+H]+ 287.0789 286.72015 291.77768 7.075583 2 Kaempferol-3-O-β-rutinoside C 27 H 30 O 15 [M-H]- 593.244 593.1748 597.49261 8.6996 3 hydroxykaempferol-3-O-β- D-glucoside C 21 H 20 O 12 [M-H]- 463.1774 463.04971 467.75095 7.069867 4 Alpha-Naphthoflavone C 19 H 12 O 2 [M+H]+ 295.0695 294.94568 300.05295 5.073283 5 Kaempferol-3-O-β-sophorose C 27 H 30 O 16 [M-H]- 609.2495 608.81036 613.40845 8.581117 6 Safflor yellow B C 48 H 54 O 27 [M-H]- 1061.476 1061.39734 1065.59778 5.118967 7 Cartorimine C 15 H 14 O 6 [M-H]- 289.1364 289.02115 293.62775 6.78905 8 6-hydroxykaempferol C 15 H 10 O 7 [M+H]+ 303.0722 303.05988 307.22101 8.091766 9 3-Hydroxyflavone C 15 H 10 O 3 [M+H]+ 239.0994 238.62172 244.09938 6.567983 10 Hydroxysafflor yellow A C 27 H 32 O 16 [M+H]+ 613.2916 613.22168 618.28479 7.817717 11 5-O-Methylgenistein C 16 H 12 O 5 [M-H]- 283.3201 103.99519 302.642 17.41922 12 Desmethoxyyangonin C 22 H 26 O 5 [M+H]+ 371.1949 370.73801 376.1929 4.89655 13 Kaempferol-3-O-β-D-glucoside C 21 H 19 O 11 [M-H]- 446.2375 446.22571 451.21588 1.216017 14 hydroxykaempferol-3-O-β-D- rutinoside-6-O-β-D-glucoside C 33 H 40 O 21 [M+H]+ 773.3624 773.11902 778.34967 8.091766 15 3,5,6,7,8,3’,4’-Heptamethoxyflavone C 22 H 24 O 9 [M+H]+ 433.147 433.11765 438.14557 6.922417 16 saffloquinoside B C 34 H 38 O 17 [M-H]- 717.4498 717.17743 722.4444 10.60617 17 Loureirin A C 17 H 18 O 4 [M+H]+ 309.1162 308.65442 314.11371 7.752383 18 Glabridin C 20 H 20 O 4 [M+H]+ 325.143 325.0463 330.14243 6.245317 3.3 TFCTL attenuates fibrosis progression and severity in liver fibrosis mice The grouping and administration of animals are depicted in Fig. 1A. Compared to the model group, both the TFCTL dose groups and the silymarin group exhibited a significant reduction in fibrous septum formation and collagen fiber accumulation. As shown in Fig. 1B, the area of the blue collagen region was quantitatively analyzed using Image J software and found to be significantly increased in the model group compared to the blank group ( P <0.01). The collagen area was significantly decreased in the TFCTL medium-dose group compared to the model group ( P <0.05), while it was markedly reduced in both the TFCTL high-dose group ( P <0.01) and silymarin group ( P <0.01). The HE staining results revealed aberrant hepatocyte structure in the model group, characterized by disordered hepatic cords, necrotic and degenerated hepatocytes with increased lipid vacuoles. Additionally, the normal hepatic lobule structure was disrupted with the appearance of fibrous septa, accompanied by a significant accumulation of inflammatory cells around the confluent area. In contrast, both TFCTL dose groups and the silymarin group exhibited a more organized arrangement of hepatic cords, reduced swelling degree, decreased infiltration of inflammatory cells within the confluent area and fibrous septa (Fig. 1C). Masson staining (Fig. 1D) demonstrated minimal deposition of collagen fibers in the confluent area and central vein in the blank group; however, an extensive deposition of blue collagen fibers was observed surrounding the periphery of the confluent area in liver tissues from mice in the model group. This was associated with clustering aggregation of hepatocytes and a substantial increase in fibrous septa formation. 3.4 TFCTL inhibits TGF-β1-induced HSC-T6 cells proliferation and reduces α-SMA and Collagen I expression in both liver fibrosis mice and HSC-T6 cells As depicted in Figure 2A, the inhibitory rate of TFCTL on HSC-T6 cells exhibited a noticeable upward trend with increasing administration concentration. Particularly at concentrations of 20μg/mL, 40μg/mL, and 60μg/mL, the inhibition rate significantly increased ( P <0.01), indicating statistical significance. Western blot analysis presented in Figure 2(B, E) demonstrated reduced protein expression levels of α-SMA and collagen I in both liver tissues and TGF-β1-induced activated HSC-T6 cells following TFCTL intervention compared to the CCL 4 model group and the TGF-β group (Fig.2B, C). Similar results were observed for mRNA detection as shown in Fig.2D. These findings suggest that administration of TFCTL effectively attenuates liver fibrosis. As depicted in Figure 2E, the fluorescence results revealed a significant upregulation of α-SMA, a fibrosis factor located in the cytoplasm, in the TGF-β group compared to the blank group. This finding suggests that TGF-β1 promotes fibrosis. Conversely, after TFCTL intervention, a notable reduction in α-SMA protein expression was observed across all concentrations of TFCTL groups. These observations indicate that TFCTL effectively inhibits liver fibrosis development in vitro. Collectively, these findings highlight the potential of TFCTL as an inhibitor for liver fibrosis. 3.5 TFCTL inhibits activation of the Hippo/YAP pathway in liver fibrosis mice and HSC-T6 cells The above findings demonstrate the potential protective effects of TFCTL on liver fibrosis, however, further research is needed to fully understand the underlying mechanism. Based on preliminary network pharmacological analysis and literature examination, it was discovered that the Hippo/YAP pathway is closely associated with liver fibrosis. Therefore, this pathway was selected for verification and TFCTL was confirmed to have an impact on CCl 4 -induced HF and in vitro TGF-β1 stimulation of HSC-T6 cells through modulation of all kinases in the Hippo pathway. To evaluate its effect on protein expression of MST1, LATS1 and p-YAP/YAP in fibrotic liver tissues and HSCs, we examined the effect of TFCTL on the Hippo/YAP pathway in TGF-β1-stimulated HSC-T6 cells as well since TGF-β1 has been recognized as a potent substance to stimulate HSC activation and proliferation. Using Western blotting and qPCR techniques, we found that TFCTL induces increased mRNA and protein expression of core kinases MST1 and LATS1 while reducing YAP mRNA expression but increasing phosphorylated YAP protein expression after intervention ( Fig.3 A-D ). Discussion In recent years, the global incidence of hepatic fibrosis has remained high, a disease that poses a significant threat to human health due to the accumulation of extracellular matrix (ECM) caused by various chronic liver injuries, ultimately leading to the disruption of normal physiological liver structure. 9-10 Initially considered irreversible, it was later discovered in an animal model induced by CCl 4 that fibrogenesis could be reversed almost completely upon removal of the causative pathogen, resulting in normal histological findings. This finding emphasizes the necessity for early intervention in hepatic fibrosis for its reversal. 11-13 The pathogenesis of hepatic fibrosis is highly complex and involves a key role played by hepatic stellate cells (HSCs), whose activation leads to loss of vitamin A storage capacity and transformation into myofibroblasts. This process triggers an increase in fibrosis marker factors such as α-SMA and Collagen I, as well as release of various chemokines and inflammatory factors. 14-16 Carthamus tinctorius L, a traditional medicinal herb utilized in the treatment of liver diseases and featured prominently in various Chinese and Mongolian medicine formulations, has garnered significant attention from scientific researchers due to its extensive pharmacological activities and notable clinical efficacy. 17-19 This botanical remedy exhibits therapeutic properties such as hepatic heat clearance, blood circulation enhancement, edema reduction, as well as the ability to alleviate blood stasis in practical medical applications. 20 The chemical composition and pharmacological effects of flavonoids, the main active components in Carthamus tinctorius L, have broad research prospects. 21 Therefore, this study primarily focuses on investigating the anti-hepatic fibrosis effects and potential mechanisms of total flavonoids from Carthamus tinctorius L. Previous liquid mass spectrometry and network pharmacological analysis conducted by our group revealed that the flavonoid compounds present in TFCTL share common targets with liver fibrosis. Additionally, KEGG enrichment analysis indicated a close association with the Hippo/YAP pathway. Building upon these findings, we established a hepatic fibrosis model to explore the inhibitory role of saffron total flavonoids in hepatic fibrosis through both in vitro and in vivo pharmacological interventions. Conclusion The present study demonstrates that TFCTL effectively mitigates CCl 4 -induced liver fibrosis and suppresses TGF-β1-induced activation and proliferation of HSC-T6 cells in mice. This outcome can be attributed to the regulation of the Hippo/YAP pathway, as evidenced by enhanced expression of MST1 and LATS1 kinases, leading to YAP phosphorylation. Consequently, this inhibits HSC activation into myofibroblasts and reduces collagen deposition (Fig. 4). Therefore, TFCTL holds promise as a novel therapeutic candidate for liver fibrosis. References 1. Li Y, Lu Y, Nian M, Sheng Q, Zhang C, Han C, Dou X, Ding Y. Therapeutic potential and mechanism of Chinese herbal medicines in treating fibrotic liver disease. Chin J Nat Med 2023; 21(9): 643-657. doi:10.1016/S1875-5364(23)60443-1 PMID:37777315 2. Guo YX, Dong HJ, Liu T, Yao YH, Ye QY, Zhao J. Preventive and curative effects of total flavonoids from Lotus japonicus on carbon tetrachloride-induced hepatic fibrosis in rats. Chinese Herbal Medicine 2020; 51(19): 4983-4990. 3. Wang S, Li W, Liu W, Yu L, Peng F, Qin J, Pu L, Tang Y, Xie X, Peng C. Total flavonoids extracted from Penthorum chinense Pursh mitigates CCl 4 -induced hepatic fibrosis in rats via inactivation of TLR4-MyD88-mediated NF-κB pathways and regulation of liver metabolism. Front Pharmacol 2023; 14: 1253013. 4. Liang CY, Tang Y, Sima Ling, Luo WS. Study on the mechanism of action of total flavonoids from lychee nucleus on rats with liver fibrosis based on MAPK signalling pathway. Chinese Materia Medica 2023; 11: 2856-2860. 5. Li MQ, Zhao XL, Gao XY, Ma YH. Pharmacological mechanism and application progress of total flavonoids in botanicals. Chinese Journal of Traditional Chinese Medicine 2024; 42(01): 200-204. 6. He K, Wang Z, Liu M, Du W, Yin T, Bai R, Duan Q, Wang Y, Lei H, Zheng Y. Exploring the Effect of Xiao-Chai-Hu Decoction on Treating Psoriasis Based on Network Pharmacology and Experiment Validation. Curr Pharm Des 2024; 30(3): 215-229. doi:10.2174/0113816128288527240108110844 PMID:38532341 7. Gravandi MM, Fakhri S, Zarneshan SN, Yarmohammadi A, Khan H. Flavonoids modulate AMPK/PGC-1α and interconnected pathways toward potential neuroprotective activities. Metab Brain Dis 2021; 36(7): 1501-1521. doi:10.1007/s11011-021-00750-3 PMID:33988807 8. Tveden-Nyborg P, Bergmann TK, Jessen N, Simonsen U, Lykkesfeldt J. BCPT 2023 policy for experimental and clinical studies. Basic Clin Pharmacol Toxicol. 2023;133:391-396 9. Kim HY, Sakane S, Eguileor A, Carvalho Gontijo Weber R, Lee W, Liu X, Lam K, Ishizuka K, Rosenthal SB, Diggle K, Brenner DA, Kisseleva T. The Origin and Fate of Liver Myofibroblasts. Cell Mol Gastroenterol Hepatol 2023; 17(1): 93-106. doi:10.1016/j.jcmgh.2023.09.008 PMID:37743012 10. Tan Z, Sun H, Xue T, Gan C, Liu H, Xie Y, Yao Y, Ye T. Liver Fibrosis: Therapeutic Targets and Advances in Drug Therapy. Front Cell Dev Biol 2021; 9: 730176. doi:10.3389/fcell.2021.730176 PMID:34621747 11. Novo E, Bocca C, Foglia B, Protopapa F, Maggiora M, Parola M, Cannito S. Liver fibrogenesis: un update on established and emerging basic concepts. Arch Biochem Biophys 2020; 689: 108445. doi:10.1016/j.abb.2020.108445 PMID:32524998 12. Zhang B, Lai L, Tan Y, Liang Q, Bai F, Mai W, Huang Q, Ye Y. Hepatoprotective effect of total flavonoids of Mallotus apelta (Lour.) Muell.Arg. leaf against carbon tetrachloride-induced liver fibrosis in rats via modulation of TGF-β1/Smad and NF-κB signaling pathways. J Ethnopharmacol 2020; 254: 112714. doi:10.1016/j.jep.2020.112714 PMID:32105750 13. Zhou L, Liang Q, Li Y, Cao Y, Li J, Yang J, Liu J, Bi J, Liu Y. Collagenase-I decorated co-delivery micelles potentiate extracellular matrix degradation and hepatic stellate cell targeting for liver fibrosis therapy. Acta Biomater 2022; 152: 235-254. doi:10.1016/j.actbio.2022.08.065 PMID:36087869 14. Fenlon M, Short C, Xu J, Malkoff N, Mahdi E, Hough M, Glazier A, Lee C, Asahina K, Wang KS. Prominin-1-expressing hepatic progenitor cells induce fibrogenesis in murine cholestatic liver injury. Physiol Rep 2020; 8(14): e14508. doi:10.14814/phy2.14508 PMID:32686913 15. Nakano Y, Kamiya A, Sumiyoshi H, Tsuruya K, Kagawa T, Inagaki Y. A Deactivation Factor of Fibrogenic Hepatic Stellate Cells Induces Regression of Liver Fibrosis in Mice. Hepatology 2020; 71(4): 1437-1452. doi:10.1002/hep.30965 PMID:31549421 16. Fu Y, Zhou X, Wang L, Fan W, Gao S, Zhang D, Ling Z, Zhang Y, Ma L, Bai F, Chen J, Sun B, Liu P. Salvianolic acid B attenuates liver fibrosis by targeting Ecm1 and inhibiting hepatocyte ferroptosis. Redox Biol 2024; 69: 103029. doi:10.1016/j.redox.2024.103029 PMID:38184998 17. Shen Huge jiltu. Discussion on the pharmacological effects of saffron and its application in Mongolian herbal formulas. Chinese ethnic folk medicine 2013; 22(13): 5. 18. Batu Deli G, Xue L, Muren, Xu YH, Chen HM, AN Da, Na RS, Han ZQ. Effects of Dedu Safflower-7 flavour powder on apoptotic protein expression in rats with carbon tetrachloride-induced chronic liver injury. Chinese Journal of Clinical Pharmacology 2022; 38(11): 1215-1218. 19. Ashktorab H, Soleimani A, Singh G, Amin A, Tabtabaei S, Latella G, Stein U, Akhondzadeh S, Solanki N, Marjorie C.Gondre-Lewis, Habtezion A, Brim H. Saffron: The Golden Spice with Therapeutic Properties on Digestive Diseases. Nutrients 2019; 11(5): 943. doi:10.3390/nu11050943 PMID:31027364 20. Mykhailenko O, Petrikaite V, Korinek M, Chang FR, El-Shazly M, Yen CH, Bezruk I, Chen BH, Hsieh CF, Lytkin D, Ivanauskas L, Georgiyants V, Hwang TL. Pharmacological Potential and Chemical Composition of Crocus sativus Leaf Extracts. Molecules 2021; 27(1): 10. doi:10.3390/molecules27010010 PMID:35011243 21. Maqbool Z, Arshad MS, Ali A, Aziz A, Khalid W, Afzal MF, Bangar SP, Addi M., Hano C., Lorenzo JM. Potential Role of Phytochemical Extract from Saffron in Development of Functional Foods and Protection of Brain-Related Disorders. Oxid Med Cell Longev 2022; 6480590. doi:10.1155/2022/6480590 PMID:36193081 ETHICS DECLARATION: The study protocol was approved by the Biomedical Research Ethics Committee of Inner Mongolia Medical University on March 7, 2019, with the approval number: YKD2019144, in accordance with the guidelines for the management and use of laboratory animals. Conflict of Interest Declaration: There are no conflicts of interest for the investigators, ethics committee members, or related to the public research results in this study. Author Contribution Statement: Xiaolu Zhao and Mingqi Li were responsible for the subject design, data analysis, and writing the paper; Xiaomei Bao, Yinghe Wang, and Rong Jin were involved in collecting data and revising the paper; Yuehong Ma were responsible for formulating the writing ideas, guiding the writing of the article and finalizing it. Acknowledgements: This work was supported by grants from National Natural Science Foundation of China(81960759, 81560706), Natural Science Foundation of Inner Mongolia Autonomous Region (2024LHMS08029, 2019MS08010), Inner Mongolia Autonomous Region grassland talent training program, Zhiyuan Talent Project of Inner Mongolia Medical University- Zhixue, Inner Mongolia Talent Development Fund (22056), Key Project of Inner Mongolia Medical University (YKD2022ZD019), Scientific and Technological Innovation Team of Inner Mongolia Medical University on the Anti-Liver Fibrosis Effect of Mongolian Medicine (YKD2022TD039), Natural Science Foundation of Inner Mongolia Autonomous Region of China ( 2023MS08043) and General Project of Inner Mongolia Medical University （ YKD2023MS072. Ethics Statement: The animal study was reviewed and approved by the Animal Care and Use Committee of Inner Mongolia Medical University. Figure legends Fig.1 TFCTL attenuates fibrosis progression and severity in liver fibrosis mice. (A) Animal treatments. (B) Statistics on collagen area. (C) H&E staining. (D) Masson staining. Fig.2 TFCTL reduces α-SMA and Collagen I expression in liver fibrosis mice and TGF-β1-induced HSC-T6 cells. (A) CCK-8 detects proliferation of HSC-T6 cells. (B, C) Effect of TFCTL on protein expression of fibrosis markers in mouse liver tissue and HSC-T6 cells. (D) Effect of TFCTL on mRNA expression of fibrosis markers in mouse liver tissue and HSC-T6 cells. (E) IF assays were employed to determine the protein abundance of α-SMA of HSC-T6 cells treated with TFCTL. Data were presented as means ± s,（n=3); Compared with Control group # P <0.05, ## P <0.01; Compared with model group (CCL 4 group) * P <0.05, ** P <0.01, *** P <0.001. Fig.3 TFCTL inhibits activation of the Hippo/YAP pathway in liver fibrosis mice and HSC-T6 cells. (A, B) Effect of TFCTL on mRNA expression of key factors of the Hippo/YAP pathway in mouse liver tissue and HSC-T6 cells. (C, D) Effect of TFCTL on protein expression of key factors of the Hippo/YAP pathway in mouse liver tissue and HSC-T6 cells. Data were presented as means ± s,（n=3); Compared with Control group # P <0.05, ## P <0.01; Compared with model group (CCL 4 group) * P <0.05, ** P <0.01, *** P <0.001. Fig.4 The mechanism diagram of TFCTL against liver fibrosis through Hippo/YAP pathway. Supplementary Material File (figure 4.tif) Download 35.56 MB Information & Authors Information Version history V1 Version 1 02 January 2025 Peer review timeline Published Journal of Natural Medicines Version of Record 6 Feb 2026 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Authors Affiliations Xiaomei Bao Inner Mongolia Medical University School of Pharmacy View all articles by this author Xiaolu Zhao Inner Mongolia Medical University Basic Medical School View all articles by this author Haisheng Wang Inner Mongolia Medical University Basic Medical School View all articles by this author Hongwei Yuan Inner Mongolia Medical University Basic Medical School View all articles by this author Rong Jin Inner Mongolia Medical University Basic Medical School View all articles by this author Mingqi Li Inner Mongolia Medical University Basic Medical School View all articles by this author Yinghe Wang Inner Mongolia Medical University Basic Medical School View all articles by this author Yuehong Ma 0000-0003-1414-0066 [email protected] Inner Mongolia Medical University Basic Medical School View all articles by this author Metrics & Citations Metrics Article Usage 205 views 110 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Xiaomei Bao, Xiaolu Zhao, Haisheng Wang, et al. Total flavonoids from Carthamus tinctorius L inhibits the liver fibrosis progression via Hippo/YAP pathway. Authorea . 02 January 2025. DOI: https://doi.org/10.22541/au.173582730.06826224/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.173582730.06826224/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fea774ea98e8650',t:'MTc3OTI3MDkyOQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();