The carRS-ompV-virK operon of Vibrio cholerae senses antimicrobial peptides and activates the expression of multiple resistance systems | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The carRS-ompV-virK operon of Vibrio cholerae senses antimicrobial peptides and activates the expression of multiple resistance systems Annabelle Mathieu-Denoncourt, Gregory B. Whitfield, Antony T. Vincent, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5220433/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted 7 You are reading this latest preprint version Abstract Antimicrobial peptides are small cationic molecules produced by eukaryotic cells to combat infection, as well as by bacteria for niche competition. Polymyxin B (PmB), a cyclic antimicrobial peptide, is used prophylactically in livestock and as a last-resort treatment for multidrug-resistant bacterial infections in humans. In this study, a transcriptomic analysis in Vibrio cholerae showed that expression of the uncharacterized gene ompV is stimulated in response to PmB. We found that ompV is organized in a conserved four-gene operon with the two-component system carRS and virK in V. cholerae . A virK deletion mutant and an ompV deletion mutant were more sensitive to antimicrobials, suggesting that both OmpV and VirK contribute to antimicrobial resistance. Our transcriptomic analysis showed that the efflux pump vexAB , a known effector of PmB resistance, was upregulated in an ompV -dependent manner in the presence of PmB. The predicted structure of OmpV revealed a lateral opening in the β-barrel wall with access to an electronegative pocket in the barrel lumen that can accommodate PmB. Such an interaction could facilitate intracellular signaling through a conformational change in OmpV. This provides the first evidence of a specialized operon governing multiple systems for antimicrobial resistance in V. cholerae . Biological sciences/Microbiology Biological sciences/Microbiology/Antimicrobials Biological sciences/Microbiology/Bacteria Biological sciences/Microbiology/Bacteriology Biological sciences/Microbiology/Pathogens Biological sciences/Molecular biology Biological sciences/Molecular biology/Transcriptomics Vibrio cholerae OmpV polymyxin B antimicrobial peptides antimicrobial resistance resistance operon Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Antimicrobial peptides (AMPs) are cationic molecules of low molecular weight with activity against bacteria, viruses, and fungi 1 . They are produced by eukaryotes for immune regulation and to maintain the homeostasis of the microbiota, and by bacteria for competition for environmental niches 2 – 4 . The ionic interaction of cationic AMPs with the negatively charged bacterial membrane leads to pore formation, leaking of intracellular content, and eventually death 5 . AMPs can also have many intracellular targets. Polymyxin B (PmB) is a non-ribosomal cyclic antimicrobial peptide produced by Paenibacillus polymyxa that is used as a last resort treatment for multidrug resistant Gram-negative bacterial infections 6 . Polymyxins are poorly absorbed during treatment and can thus be excreted and accumulate in the environment, which could lead to the development of resistance 7 , 8 . Vibrio cholerae is a Gram-negative bacterium that resides in aquatic environments 9 . It is responsible for the disease cholera, caused by consumption of contaminated water or food. V. cholerae is divided into 200 serogroups, of which only O1 and O139 cause cholera 10 . The O1 serogroup is further divided into 2 biotypes, Classical, responsible for the first six cholera pandemics, and El Tor, which is responsible for the 7th ongoing pandemic 10 . The α-helical cathelicidin LL-37 and several α and β-defensins are produced by intestinal cells in response to V. cholerae infection 11 . Unlike the Classical strains, El Tor strains can resist PmB by decreasing the negative charge of their outer membrane through almEFG , thus reducing interactions with cationic AMPs. AlmG is a glycyl transferase responsible for aminoacylation of the lipopolysaccharide (LPS) and represents the main mechanism of resistance to PmB in those strains 6 . The expression of almG in response to PmB is regulated by the two-component system CarRS, also called VprAB, in which CarS/VprB is the sensor histidine kinase activated by periplasmic AMPs and CarR/VprA is the response regulator 12 – 15 . Other mechanisms, such as efflux pumps, also contribute to AMP resistance in V. cholerae 16 . The efflux pumps belonging to the resistance-nodulation-division (RND) transporter family are tripartite drug-ion antiporters spanning both the inner and outer membranes, facilitating the transport of substrates from the cytoplasmic membrane or periplasm to the extracellular milieu 17 , 18 . Six RND transporters are encoded in V. cholerae with different substrate specificity 19 , of which VexAB is associated with resistance to detergents and antimicrobials such as PmB 16 . In this study, a transcriptomic analysis of V. cholerae grown in the presence of a subinhibitory concentration of PmB showed that the expression of the uncharacterized outer-membrane protein OmpV is increased by PmB. OmpV is a protein of 28 kDa, which matures into a 26 kDa protein after the removal of a 19 AA signal sequence 20 , 21 . Based on its sequence, OmpV was proposed to share properties with porins 22 . Depending on the culture conditions, OmpV can be the most abundant protein in the outer membrane 21 , 23 – 25 . Although very little is known about the function of OmpV, a role in pathogenesis has been suggested and antibodies against it can be found in convalescent human sera 21 , 26 . OmpV is upregulated in V. parahaemolyticus in the presence of PmB and in V. cholerae in response to human α-defensin 5, while it has a role in osmoregulation in other Vibrio species 15 , 27 . However, its role in resistance to AMPs in V. cholerae is yet to be described. We showed that carRS ( vprAB ), ompV , and virK are organized as a conserved operon in V. cholerae , and that its expression is modulated by PmB. VC1317 (VirK) is a 35.9 kDa protein belonging to the VirK/YbjX family, with an as-yet-unknown function in V. cholerae . The VirK protein was first identified in Shigella flexneri as a critical factor for efficient intercellular dissemination 28 . In other bacteria, such as Salmonella enterica and Campylobacter jejuni , VirK has been shown to play a role in virulence and resistance to AMPs 29 , 30 . The deletion of ompV and virK led to a higher sensitivity to AMPs, suggesting a role for OmpV and VirK in AMP resistance. The deletion of ompV does not lead to membrane destabilization or a reduced sequestration by membrane vesicles. Our results showed that PmB leads to the expression of the RND multi-drug efflux system vexAB in an ompV -dependent manner. Structural predictions suggest that OmpV is a β-barrel with an unusual membrane-accessible lateral opening that provides entry into a highly electronegative barrel lumen, which could accommodate PmB, as determined by docking simulations. This interaction could induce an OmpV conformational change, leading to an intracellular signal event inducing the expression of vexAB . We identify OmpV as a new effector for AMP resistance, and the carRS-ompV-virK operon represents the first specialized locus, aside from two-component systems, that activates multiple systems for antimicrobial resistance in V. cholerae . Results A transcriptomic analysis reveals that ompV is upregulated in the presence of PmB To identify new effectors of PmB resistance in V. cholerae , a global transcriptomic analysis of the A1552 El Tor strain grown with and without PmB was performed. Cells were grown in the presence or absence of subinhibitory concentrations of PmB. RNA was isolated, then reverse transcribed, and the cDNA was sequenced. Data were analysed for differential expression using the variance analysis package DESeq2. An average number of 70,010,813 reads were identified per sample with an average of 30,597,139 reads being assigned to a gene, and a Q20 > 6.6 representing a base calling accuracy of > 98% (see Supplementary Table S2 ). A total of 3715 genes were identified (Fig. 1 ). Genes with a p-adj < 0.05 were considered as significantly modulated by the presence of PmB (colored dots in Fig. 1 ) and are listed in Supplementary Table S1 . Of the 280 modulated genes, 211 and 69 had a significantly increased or decreased abundance of transcripts in the presence of PmB, respectively (see Supplementary Table S1 , Fig. 1 ). After the removal of pseudogenes, the identified genes (n = 262) with differential expression were submitted for an analysis of network clusters enrichment using STRING (Fig. 2 ) 31 . Several clusters were significantly enriched (False Discovery Rate < 0.05) in the presence of PmB, including 14 genes out of 57 (KEGG pathway: map01503) involved in cationic AMP resistance (Fig. 2 , Supplementary Table S3) 32 – 34 . The almEFG lipid A modification system operon was upregulated in the presence of PmB, as well as the two-component system activating this LPS modification system, carRS ( vprAB ), and the RND-transporter vexAB (see Supplementary Tables S1 and S3). The two-component system response regulator VxrB, which contributes to biofilm formation and upregulates the type VI secretion system in response to PmB, also exhibited elevated expression in the presence of PmB 35 (see Supplementary Table S3). Genes from the type II secretion system cluster, the iron-sulfur binding cluster, multi-drug efflux complex clusters, and the Von Willebrand factor A-like domain superfamily cluster were also significatively enriched (Fig. 2 ). Amongst the genes that were upregulated in the presence of PmB (see Supplementary Table S1 ), ompV stood out because we previously demonstrated that it is also more abundant in the membrane vesicles (MVs) isolated from V. cholerae grown in the presence of PmB and the human cathelicidin LL-37 36 . Quantitative RT-PCR confirmed that the expression of ompV was increased in the presence of PmB by 2.92-fold (Fig. 3 ). Since expression and abundance is elevated in the presence of AMPs, we wondered if ompV could be implicated in AMP resistance. The loss of ompV increases V. cholerae ’s susceptibility to antimicrobials To determine whether the uncharacterized protein OmpV plays a role in resistance to AMPs, an ompV isogenic deletion mutant was used (A1552D ompV ). The deletion of ompV did not interfere with bacterial growth, as we observed no growth difference between the strains (Supplementary Figure S1 ). The susceptibility of A1552D ompV and A1552 to AMPs was compared by determination of their minimal inhibitory concentrations (MICs) to PmB and LL-37 (Table 1 & Supplementary Figure S1 ). For A1552, the MICs of PmB and LL-37 were 200 µg/ml. The deletion of ompV increased the susceptibility to both AMPs, with a MIC of 100 µg/ml and 12 µg/ml for PmB and LL-37, respectively (Table 1 & Supplementary Figure S1 ). Table 1 Minimal inhibitory concentrations (MICs) of polymyxin B and LL-37 Strain MIC (µg/ml) Polymyxin B LL-37 A1552 pBAD24 200 200 A1552 pBAD24- ompV -153 > 250 200 A1552Δ ompV pBAD24 100 12 A1552Δ ompV pBAD24- ompV 100 12 A1552Δ ompV pBAD24- ompV -153 250 200 A1552Δ virK pBAD24 200 50 A1552Δ virK pBAD24- virK 200 100 A1552Δ ompV Δ virK pBAD24 100 12 A1552Δ ompV Δ virK pBAD24- virK 100 12 A1552Δ ompV Δ virK pBAD24- ompV -153 250 200 A1552Δ ompV Δ virK pBAD24- ompV -153 -virK 250 200 In the presence of 25 to 100 µg/ml of PmB, a premature decline in OD 600nm was observed for all the strains (Supplementary Figure S1 ). The stationary phase is typically a balance between cell death and division, during which a general stress response is observed 37 . It is possible that the addition of PmB could accelerate cell lysis, as cationic AMPs, unlike most conventional antibiotics, are active against non-dividing bacteria 38 . Complementation of the ompV deletion was first carried out using the pBAD24 vector containing the complete annotated ompV (pBAD24- ompV ). However, the MICs (Table 1 ) were not restored to the wild-type level. Since the presence of OmpV was first observed in the isolated MVs of A1552 grown with PmB 36 , the presence of OmpV in the MVs of A1552 pBAD24, A1552Δ ompV pBAD24 and A1552Δ ompV pBAD24- ompV grown with PmB was assessed to confirm complementation (see Supplementary Figure S2 ). MV crude extracts in denaturing buffer were migrated on SDS-PAGE gels, which were further stained with Coomassie blue (see Supplementary Figure S2 ). The band corresponding to OmpV is clearly visible in the MVs from A1552 pBAD24 and, as expected, is absent in A1552Δ ompV pBAD24. However, it was not restored by the pBAD24- ompV construct (see Supplementary Figure S2 ). To investigate potential pBAD24-linked expression issues, the native regulatory region of ompV (153 nucleotides upstream of the ompV start site) in addition to the entire ompV open reading frame (ORF) was cloned into pBAD24 (pBAD24- ompV -153). Using this construct, a band corresponding to OmpV was observed in MV preparations (see Supplementary Figure S2 ), suggesting that the native regulatory context of ompV is important for its expression, as has been observed previously 22 . Furthermore, the complementation with pBAD24- ompV -153 not only restored the MIC to wild-type levels, but further elevated it for PmB to 250 µg/ml (Table 1 ). Similarly, overexpression of ompV in A1552 also resulted in resistance to much higher PmB concentrations, with growth at every tested concentration (Table 1 ). The survival of each strain to a 30 min shock with 500 µg/ml PmB was also assessed and showed that the wild-type strain is nearly 2 times more tolerant to this exposure than A1552Δ ompV (Fig. 5 e). Altogether, these results suggest that ompV is involved in AMP resistance in V. cholerae . The integrity of the membrane is not altered by the loss of OmpV The integrity of the membrane might be impaired by the loss of ompV , one of the most abundant proteins in the outer membrane 22 . To determine if the susceptibility of A1552Δ ompV to AMPs is due to the destabilisation of the outer membrane, a fluorescent assay was used. N -phenyl-1-napthylamine (NPN) is a small molecule that cannot cross the intact outer membrane, but, upon membrane damage, binds to phospholipids and emits fluorescence 39 . Propidium iodide (PI) fluoresces once bound to the DNA of bacteria with envelope damage induced by PmB. A1552 and A1552Δ ompV were grown to midlog phase, washed, and permeabilized with increasing concentrations of PmB, up to 50 µg/ml. The bacteria were then labelled with NPN and PI. The relative fluorescence was quantified in comparison to the non-treated wild-type strain in a SpectraMax iD3 plate reader (Fig. 4 ). The fluorescence for NPN increased with PmB concentration, with a maximum fluorescence at 50 µg/ml of PmB for both tested strains (Fig. 4 a). For PI, the fluorescence was similar at 0, 3, 10 and 25 µg/ml PmB, but was significantly increased for A1552 at 50 µg/ml in comparison to the non-treated bacteria (Fig. 4 b). This is in agreement with our previous study that showed that PmB treatment does not lead to inner membrane permeabilization, up to 50 µg/ml 40 . For both markers, the fluorescence was similar between the strains for a given PmB concentration (Fig. 4 ). These results suggest that PmB produces pores in the membrane similarly for both strains and that the loss of ompV has no impact on the integrity of the membrane. Thus, the sensitivity of A1552Δ ompV to PmB is not due to permeabilization of the outer membrane. The role of OmpV in antimicrobial resistance is not linked to MVs When V. cholerae is grown with AMPs, the protein content of MVs is modified and greatly enriched in OmpV 36 . MVs contribute to antimicrobial resistance by titration and degradation of antimicrobial peptides in the environment 41 . We hypothesized that the presence of OmpV in MVs could enhance the titration of antimicrobial peptides, thereby increasing bacterial resistance. If more or bigger MVs were produced in A1552 in comparison to A1552Δ ompV , or if the presence of OmpV modified the affinity of the MVs for PmB, then the protection conferred by the MVs of A1552Δ ompV would differ from the MVs of A1552. To assess MV production, the isolated MVs from A1552 and A1552Δ ompV were quantified using a Bradford assay (Fig. 5 a) and FM4-64 (Fig. 5 b), as described previously 42 . Both strains produced a similar MV quantity (Fig. 5 a,b), since no significant differences in protein and lipid quantification were observed. The MVs were observed using atomic force microscopy (AFM) (Fig. 5 c), which showed that they were similar in size (Fig. 5 d) and concentration, and of comparable purity. This suggests that the sensitivity to PmB upon ompV mutation is not due to a decreased MV production. To determine if the affinity of the MVs for antimicrobial peptides is altered upon ompV deletion, the effect of the addition of isolated MVs on bacterial survival after a short incubation with 500 µg/ml PmB was then assessed (Fig. 5 f,g). The surviving bacteria were counted on agar plates. As expected, without MVs, the wild-type strain is more tolerant than A1552Δ ompV , as more bacteria were retrieved after the incubation (Fig. 5 e). When MVs from the different strains were added, there was no significant effect on bacterial survival for both strains (Fig. 5 f,g), even though there was a slight increase in survival, suggesting that the presence of OmpV has no or low impact on the capture of PmB by the MVs. ompV is co-transcribed with the two-component system carRS ( vprAB ) and virK , and the whole operon is upregulated by PmB While looking at the genomic context of ompV , we noticed that it is located on the minus strand of the large chromosome, clustered with 3 other genes, carR ( vprA ), carS ( vprB ), and virK. In V. cholerae , VirK is an uncharacterized protein, while the two component-system CarRS is responsible for the activation of the LPS modification system alm in the presence of PmB 12 , 13 . The organization of the cluster is highly conserved among V. cholerae O1 pre-pandemic, El Tor, and Classical strains, O139 strains, non-O1/non-O139 strains, and some other Vibrio species, as determined with PATRIC ( https://www.patricbrc.org ) 43 , 44 (see Supplementary Figure S3). A synteny analysis of the 161 available genomes of V. cholerae using SyntTax 45 showed that only 2 strains did not have this cluster arrangement (See supplementary file). Although it was found in V. mimicus and V. paracholerae , this synteny was not found in V. parahaemolyticus , V. vulnificus and V. alginolyticus . To verify if the genes are co-transcribed as an operon on the same mRNA, the intergenic regions between carS and ompV , and between ompV and virK , were amplified by PCR from the cDNA of A1552 using primers inside of the ORF (Fig. 6 a). Bands corresponding to the expected length were visible on agarose gel, indicating that carS , ompV , and virK are transcribed on the same mRNA and that they are organized as an operon. The amplification of an intergenic region outside of an operon on genomic DNA, but not on cDNA, confirmed the absence of genomic DNA in the samples (Fig. 6 b). The expression of the genes of the carRS-ompV-virK cluster in the presence of PmB was then measured by RT-qPCR (Fig. 6 c). The expression of ompV in A1552 grown in the presence of PmB was 2.787 times higher than in the non-treated cells (Fig. 6 c). The expression of carS and virK was 2.788 and 2.265 times higher in the presence of PmB than in the non-treated cells, respectively (Fig. 6 c). These results suggest that carRS , ompV , and virK are organized as an operon, and that their transcription is increased by PmB exposure. The role of carRS ( vprAB ) in resistance is already known 13 , 46 and we have demonstrated here that ompV plays a role in antimicrobial resistance. To determine if virK is also implicated in AMP resistance, a knock-out mutant (A1552D virK ) and a complemented strain (A1552Δ virK pBAD24- virK ) were constructed. Their MIC to AMPs was determined, which showed that A1552Δ virK was more sensitive to LL-37, and that complementation partially restored the phenotype (Table 1 ). Although the MICs for PmB were similar for the wild-type strain and A1552Δ virK (Table 1 ) the growth of A1552Δ virK with 100 µg/mL of PmB clearly showed a defect in comparison to A1552 (see Supplementary Figure S1 ). These results indicate that A1552Δ virK is also more sensitive to AMPs. To determine if there is an additive effect of ompV and virK deletion on antimicrobial resistance, a A1552Δ ompV Δ virK double mutant and a complemented strain (A1552Δ ompV Δ virK pBAD24 -ompV-virK ) were constructed. The MICs of PmB and LL-37 of the double mutant were similar to that of A1552Δ ompV (Table 1 ), which were lower than those of A1552Δ virK . A single ompV or a double ompV-virK complementation, but not a single virK complementation, led to a total restoration of the MIC in A1552Δ ompV Δ virK (Table 1 ). These results suggest that there is no additive effect of the double mutation on the sensitivity of the strains to AMPs. The deletion of ompV modified the expression of the antimicrobial resistance related gene vexB Previous studies have demonstrated that outer membrane proteins, such as OmpU in V. cholerae , can sense and signal for the presence of AMPs 47 . This ability allows the bacteria to trigger resistance mechanisms by modifying the LPS and its electrostatic affinity for cationic molecules 48 . OmpV may play a similar sensing role for AMPs. In the transcriptomic analysis, we observed that several known resistance effectors of V. cholerae were upregulated in the presence of PmB (see Supplementary Tables S1 and S3). They include the two-component system carRS ( vprAB ) responsible for activating transcription of the alm operon 13 , the glycyltransferase almG that modifies lipid A 6 , the RND efflux pump vexAB 16 , and the alternative sigma factor rpoE 47 (see Supplementary Table S1 ). To determine if OmpV is involved in the regulation of these effectors, a quantitative RT-PCR analysis was conducted in the absence and presence of PmB in both A1552 and A1552D ompV (Fig. 7 ). As expected, a strong and significant upregulation of almG , carS , rpoE , and vexB in the presence of PmB in A1552 was observed (Fig. 7 ). While carS expression was increased in the presence of PmB in the A1552Δ ompV strain, its upregulation was lower than in A1552 (Fig. 7 a). This suggests that carRS over-expression in the presence of PmB is partly dependent on ompV , although it had no effect on the expression of almG , part of the CarR regulon (Fig. 7 b). The expression of vexB was not increased by the presence of PmB in A1552Δ ompV (Fig. 7 d). This suggests that the upregulation of the efflux-pump vexAB depends on the presence of ompV , and that the increased sensitivity of the A1552Δ ompV strain could be due to the lack of vexAB upregulation. Taken together, these results suggest a role for OmpV in the transcriptional regulation of PmB resistance genes. OmpV has a membrane-accessible lateral opening into an electronegative pocket in the β-barrel lumen To gain further insight into how OmpV may function in the process of AMP resistance, we predicted the structure of OmpV, without its predicted signal sequence (residues 1–19) using Alphafold2 as implemented within ColabFold 49 . This suggested that OmpV adopts a 12-stranded β-barrel fold (Fig. 8 a and Supplementary Figure S4). However, β-strands five and six, which form part of the lateral wall of the barrel, do not fully span the membrane-embedded region of the protein (Fig. 8 a). These short β-strands leave a gap in the barrel wall that provides lateral access to the β-barrel lumen of OmpV (Fig. 8 a,b). Submission of the predicted structure of OmpV to the Foldseek 50 and DALI 51 servers suggested that there are no experimentally determined structures of β-barrels in the Protein Data Bank with a similar lateral opening. However, this feature is observed in the predicted structure of MipA from Pseudomonas aeruginosa 52 , which is a structural ortholog of OmpV (See Supplementary Figure S4b). The opening in the lateral wall of the OmpV barrel leads to a pocket in the lumen that is isolated from both the extracellular and periplasmic spaces due to the presence of several extracellular loops and a periplasmic plug region, respectively (Fig. 8 a,c). This pocket is highly electronegative (Fig. 8 b) and has a volume of 1623 Å 3 as determined by CASTpFold 53 (Fig. 8 c), therefore it could accommodate cationic AMPs such as PmB, which has an approximate volume of 1047 Å 3 based on its structure in complex with human lysine-specific demethylase 1 (PDB 5L3F). Indeed, docking of PmB into the electronegative barrel lumen of OmpV using Autodock Vina 54 produced a top pose with an affinity of -8.936 kcal/mol (Fig. 8 d and see Supplementary Figure S5a). Furthermore, de novo prediction of the OmpV structure in complex with PmB using Boltz-1 55 yielded confident models with PmB located within the OmpV barrel lumen (See Supplementary Figure S5b), comparable to the docking results. Such an interaction could induce conformational changes in OmpV that serve as a signal to initiate cellular processes that protect against cationic AMPs. These observations are similar to what was recently reported for P. aeruginosa MipA, which is thought to function as an outer membrane PmB sensor 52 . Discussion In this study, we identified the outer-membrane protein OmpV as a new effector of antimicrobial resistance in V. cholerae by coupling transcriptomic analyses of knockout mutants with AMP susceptibility assays. We showed that ompV is part of a specialized 4-gene operon that activates multiple resistance factors in response to PmB, i.e . the LPS modification system almEFG and the efflux pump vexAB . A structural analysis also determined that OmpV could act as a sensor for PmB in the outer membrane. This operon is widespread in V. cholerae , suggesting that this may represent a generalizable strategy for AMP resistance in this species. Even at a concentration well below the MIC, PmB significantly impacted the transcriptome of V. cholerae , with more than 280 genes whose expression was significantly modulated by the presence of PmB. The PmB concentration used (3 µg/ml) is below that required for pore formation and is 1.5% of the MIC 40 . In our previous proteomic analyses, a similar number of proteins (n = 241) with a modified abundance in the presence of this PmB concentration were identified 35 , 36 , 56 . This included many genes involved in antimicrobial resistance, such as the main locus responsible for resistance in El Tor strains, almEFG , in addition to vxrB, carS ( vprB ), vexAB , and the σ E regulatory protein RseB 35 , 56 . Both analyses also identified that the type II and VI secretion systems were upregulated in the presence of PmB, as well as components of the flagellum. Many RND-transporters and efflux systems were upregulated in the presence of PmB, as would be expected since RND-transporters are responsible for basal resistance to antibiotics and antimicrobials, and because they are regulated by the presence of their substrates 57 – 59 . Other transcriptomic analyses of V. cholerae El Tor strains C6706 and El2382 grown in the presence of AMPs have been performed 15 , 60 . In those analyses, components from the alm operon were also upregulated, as well as carRS ( vprAB ), transporters, and efflux systems. Interestingly, the studies in strains C6706 and El2382 showed that ompV was upregulated in the presence of AMPs 15 , 60 , but without attributing a role for it in antimicrobial resistance. The fact that ompV is highly expressed and abundant in V. cholerae in the presence of multiple AMPs from different families caught our attention and made us wonder about its role in antimicrobial resistance. OmpV is a major protein of the outer membrane of V. cholerae 22 . OmpV plays a role in adhesion and invasion of enteric epithelial cells in Salmonella 61 , 62 , and is an osmotic stress responsive protein in the marine bacteria Photobacterium damselae , V. alginolyticus , and V. parahaemolyticus 63 – 65 . In those Vibrio species, ompV has a different genomic context, and is not clustered with carRS and virK . OmpV is annotated as a protein of the MltA-interacting protein (MipA) family 66 , which is implicated in antimicrobial resistance in E. coli 67 and in P. aeruginosa 52 . Although a role for OmpV in pathogenesis has been suggested in V. cholerae 21 , 22 , 26 , its function has not been identified so far in this bacterium. We previously showed that OmpV is found in abundance in MVs of V. cholerae A1552 grown with AMPs 36 . Here, a transcriptomic analysis and quantitative RT-PCR confirmed that ompV is indeed upregulated in the presence of PmB. MIC values and relative survival to a short incubation time with a high PmB concentration showed an increased sensitivity to AMPs upon ompV mutation, demonstrating a role for OmpV in resistance to antimicrobials. The deletion of OmpV did not affect MV production, suggesting that it does not play a role in this process. The MV protection assay suggests that OmpV has little to no impact on the capture of PmB by the MVs. The release of MVs by bacteria protects them from antimicrobials by acting as a decoy to capture and prevent AMP binding to the bacterial envelope 68 , 69 . It is possible that the high-affinity binding of PmB to LPS 70 , which covers the entire MV, masks any OmpV-dependent effect. Moreover, OmpV is more abundant in MVs isolated from A1552 grown with PmB 36 . However, to avoid cumulative effects, the MVs used in our assay were prepared from overnight cultures without PmB, likely resulting in a low abundance of OmpV on their surface. The genomic context of ompV in V. cholerae showed that it is part of a four-genes cluster ( carR-carS-ompV-virK ) on the large chromosome, and that the synteny of this cluster is conserved amongst some Vibrio . We demonstrated that these genes were transcribed as an operon, and that the whole operon is upregulated by the presence of PmB. It has previously been demonstrated that the expression of ompV and carS increased in the presence of human α-defensin 5 15 and PmB 60 . CarRS (VprAB) is a two-component system in which CarS is a sensor histidine kinase, sensing AMPs in the periplasm, and CarR is the response regulator that activates the almEFG mediated LPS modification system in the presence of PmB to decrease its interaction with the membrane 12 , 13 , 15 . In this study, we showed that OmpV and VirK are also implicated in antimicrobial resistance. Our RT-qPCR analysis of known PmB-resistance factors demonstrated that ompV is important for the upregulation of the RND-transporter vexAB in the presence of PmB. There are six RND-transporter systems encoded in the V. cholerae genome that work synergically to provide resistance to various toxic substrates such as bile, detergents, and antimicrobials 16 , 19 , 71 , 72 . All of them form a complex with the outer-membrane pore protein TolC to span both the inner and outer-membrane 19 , 73 . A knock-out mutant of all the RND systems led to a reduction in cholera toxin and toxin-coregulated pilus production, and was attenuated in an infant-mouse model of infection 19 , 74 . The VexAB RND-system (VC_0164, VC_0165), in which VexA is the membrane fusion component and VexB is the RND pump-protein, is regulated by bile acids and is induced during mammalian intestinal colonisation 16 , 75 . This system is very similar to AcrAB-TolC of E. coli 76 . Together with VexCD, VexAB contributes to bile resistance, while the deletion of vexB alone leads to a higher susceptibility to SDS, Triton X-100, erythromycin, novobiocin, and PmB, but not to other antibiotics such as β-lactams, aminoglycosides, fluoroquinolones, and tetracyclines, amongst others 16 , 19 . VexAB requires the tetR -family transcriptional regulator vexR , which is located upstream of vexAB in the same operon, for activation upon substrate exposure 58 . vexR was upregulated 1.28-times in the presence of PmB in our transcriptomic analysis, although this was not significant (p-adj = 0.1145). There are five TolC homologues in V. cholerae ’s genome (VC_1409, VC_1565, VC_1606, VC_1621, VC_2436), with VC_2436 exhibiting the highest similarity to E. coli TolC 73 . In vitro , only the deletion of VC_2436 affected antimicrobial resistance, including to PmB, which was similar to a mutant in which the six RND-systems were deleted. Therefore, VC_2436 is likely to be the outer-membrane pore used by RND-transporters in V. cholerae 19 , 73 , 77 . In our transcriptomic analysis, tolC (VC_2436) was not upregulated by the presence of PmB. However, because the inner membrane components of RND-systems are generally regulated by their efflux substrate concentrations, the expression of vexB , but not of tolC , was increased by the presence of PmB, which could explain why the expression of tolC was not modified by PmB in our analysis 57 , 77 . Although VC_1565 was upregulated by PmB in C6706 and in our analysis, VC_2436 was not upregulated either in the presence of AMPs in EL2382 and C6706 in the transcriptomic analyses 15 , 60 , suggesting that tolC might be regulated differently than the inner components of the RND systems. Since the modulation of vexAB upon PmB stimulation is ompV -dependent and OmpV is an outer membrane protein, we wondered how this response could occur. Previous studies have shown that some outer-membrane proteins can sense extracellular signals and induce bacterial adaptation to stresses via gene regulation. One example of this is OmpA which is involved in the activation of the Cpx envelope-stress response pathway in conjunction with the outer membrane lipoprotein NlpE. OmpA-NlpE stimulates the CpxAR two-component system trough an unknown mechanism to activate the expression of genes involved in the envelope-stress response 78 . In V. cholerae , previous studies have demonstrated a similar sensor role for OmpU 47 , 48 , 79 . OmpU signaling is dependent on the action of the envelope-stress response mediated by the alternative σ E factor (RpoE) and the proteases DegS, RseA, and RseP 48 , 80 . In the absence of stress conditions, σ E is segregated at the inner membrane by the anti-sigma factor RseA, preventing its activity on RNA-polymerase 81 . The accumulation of misfolded OmpU containing the C-terminal YxF motif leads to the activation of DegS 80 , 82 . The activated DegS cleaves RseA, which is further cleaved by RseP located in the inner membrane, leading to the release of σ E and to the transcription of the envelope-stress response genes 83 , 84 . In the presence of AMPs, the disruption of the outer membrane could block the insertion of OmpU in the membrane, leading to the accumulation of mislocalized OmpU in the periplasm, or the binding of AMPs to OmpU could induce a conformational change, promoting exposure of the YxF motif, thus leading to the release of σ E and transcription of membrane-repair genes 48 . OmpV has the OMP-periplasmic-stress associated YxF motif. It is thus possible that OmpV also acts as a sensor of AMPs and signals their presence at the outer membrane to activate a transcriptomic regulator inside the cell and the expression of resistance genes including vexAB . A study using deletion mutants of different OMPs showed that the outer-membrane activation of σ E by YxF is OmpU-dependant 85 . Our qPCR results show that σ E is still activated upon PmB stimulation in a A1552Δ ompV mutant, suggesting that another signal is used. A possible explanation for the modulation of vexAB in the presence of PmB is that it could be part of the carR regulon, especially because ompV and carRS belong to the same operon. Our quantitative RT-PCR analysis showed that the expression of carS was significantly upregulated in A1552Δ ompV in the presence of PmB, but that this increase was also significantly lower than in A1552. In V. vulnificus , upon PmB stimulation, CarR (VprA) activates the expression of eptA and tolCV2 , a LPS modification system and a tripartite efflux-pump, respectively 46 , 86 . However, the expression of almG , which is a known effector of the carR regulon 12 , is not reduced in A1552Δ ompV . The transcription of carRS ( vprAB ) in the presence of PmB could be activated by multiple pathways, and thus only partly depend on ompV . It could also mean that lower expression levels of carRS are sufficient to strongly activate the transcription of the alm operon, but not vexAB , as the affinity of CarR to their respective promotors could be different. We wondered how OmpV could act as a sensor for PmB and so examined its predicted structure. This revealed that it adopts a β-barrel architecture where both its periplasmic and extracellular openings are occluded. Instead, two short β-strands in the lateral wall of the OmpV barrel create an opening into an electronegative pocket in the lumen of the barrel that is accessible only through the membrane. The proposed porin function of OmpV is questioned 64 , 87 . We propose that, instead of functioning as a porin, OmpV may directly bind PmB via this electronegative pocket, thus serving as a sensor. According to the structure prediction and electrostatic surface potential calculations, we propose a model in which OmpV, a MipA structural ortholog (see Supplementary Figure S4), can sense PmB when it integrates into the outer-membrane via direct interaction with the electronegative barrel lumen, accessible through a membrane-integral gap in the β-barrel wall, and activate the expression of the efflux-pump VexAB through an unknown mechanism (Fig. 9 ). While VirK is predicted to be a cytoplasmic protein, an E. coli ortholog similarly predicted to localize to the cytoplasm has been shown experimentally to localize to the periplasm 88 . It is therefore possible that VirK could be a periplasmic mediator involved in signal propagation of PmB-sensing by OmpV, especially since they are co-transcribed as part of the same operon. An OmpV conformational change upon PmB binding could thus signal intracellularly using VirK as an intermediary. This signalling might occur through the CarRS system to activate the expression of the vexAB efflux pump (Fig. 9 ). CarS is known to respond to cationic AMPs, but the direct interaction between PmB and CarS is yet to be confirmed. During the preparation of this manuscript, a similar system was identified in Pseudomonas aeruginosa in which the OmpV ortholog MipA functions as a PmB-sensor, inducing a MipA conformational change that releases the periplasmic mediator MipB 52 . This leads to the expression of the efflux pump MexXY through the ParRS two-component system 52 , suggesting a conserved mechanism of AMP signaling and resistance. However, in P. aeruginosa , the system is not encoded as a single operon and is present in the bacterial genome only in the absence of the arn operon, responsible for LPS modification 52 . In V. cholerae , we have identified a single conserved operon that regulates multiple antimicrobial resistance mechanisms, specifically the efflux pump VexAB and the LPS modification system alm . To our knowledge, no other operon encoding multiple resistance system regulators, aside from two-component systems, has been identified so far. Future studies are necessary to dissect the role of VirK in antimicrobial resistance, as well as to confirm the involvement of CarRS in vexAB regulation or to identify the regulators of the OmpV-mediated response. Material & methods Strains Vibrio cholerae O1 El Tor strain A1552, an Inaba clinical strain isolated in 1992 from a Peruvian tourist, was used for this study 89 . Bacterial strains and plasmids used in this study are listed in Table 2 . V. cholerae strains were grown on LB (10 mg/mL tryptone (Termo Fisher™), 5 mg/mL yeast extract (Thermo Fisher™), 5 mg/mL NaCl) agar plates at 37°C, and cultivated in LB broth at 37°C for 16 h prior to experiments. When needed, L-arabinose (0.2% w/v) (Thermo Fisher™) or carbenicillin (50 µg/mL) (VWR) were added to the media. Polymyxin B solution, a mixture of B1 and B2 sulfate, at 20 mg/ml in water from Sigma-Aldrich was used for the experiments. Table 2 Bacterial strains and plasmids used in this study Strain General characteristics Reference V. cholerae A1552 Wild-type strain, O1 El Tor, pathogenic strain isolated from human cholera infection 89 A1552Δ ompV Δ virK A1552 derived strain in which ompV has been replaced by a chloramphenicol resistance cassette, with promoter and terminator, from pKD3, with a knocked down expression of virK as determined by qPCR. This study A1552Δ virK A1552 derived strain in which virK has been removed This study A1552Δ ompV A1552 derived strain in which ompV has been removed Kindly provided by Dr S.N. Wai E. coli DH5α F– φ80 lacZ ΔM15 Δ( lacZYA-argF ) U169 recA 1 endA 1 hsdR 17(r K – , m K + ) phoA supE 44 λ– thi -1 gyrA 96 relA 1 94 Plasmids pBAD24 Expression vector. Arabinose inducible promoter, resistance cassette to carbenicillin ( https://www.addgene.org/vector-database/1845/ ) 103 pBAD24- ompV pBAD24 vector with the complete annotated ompV open reading frame from A1552 under the ara promotor This study pBAD24- ompV -153 pBAD24 vector with the complete annotated ompV open reading frame, starting from the ATG in position − 153, under the ara promotor This study pBAD24- virK pBAD24 vector with the complete annotated virK open reading frame from A1552 under the ara promotor This study pBAD24- ompV -153- virK pBAD24 vector with the complete annotated ompV open reading frame, starting from the ATG in position − 153, annotated virK open reading frame and the intergenic region from A1552 under the ara promotor This study pKD3 Template plasmid for FRT-flanked chloramphenicol resistance cassette ( https://www.addgene.org/45604/ ) 90 pE-FLP Vector carrying the flippase FLP used to remove the chloramphenicol cassette flanked by FRT regions ( https://www.addgene.org/45978/ ) 93 Mutant construction and complementation using pBAD24 The virK and ompV-virK mutants were obtained as described before using natural competence and PCR products 35 . Briefly, the chloramphenicol cassette flanked by FRT regions and P1 and P2 was amplified by PCR from pKD3 using primers adding 50 nt homology (CmR ompV F/R; CmR virK F/R) (Table 3 ) to the up- and downstream regions of the target genes 90 . Homologous regions of 1000 nt up- and downstream of the target genes were also amplified by PCR using different primers ( ompV up F/R; ompV down F/R; virK up F/R; virK down F/R) (Table 3 ), then linked to the cassette by two-step PCR using ompV up F and ompV down R, or virK up F and virK down R 91 . Two hundred nanograms of the final amplicon were added to A1552 grown for 24 h at 30°C with chitin, in M9 supplemented medium 92 . The cells were further incubated for 24 h at 30°C. The mutants were selected on LB agar plates supplemented with 2 µg/ml of chloramphenicol. To remove the resistance cassette, pE-FLP was used as described in 93 . The final constructions were verified by PCR and sequencing using verif primers (Table 3 ). Table 3 Primers used in this study Mutant construction and complementation Forward Reverse CmR ompV acaggaggagctcctgtctgaaggcggtatcgttcagaagtgctagccga catatgaatatcctccttag ttttgtacagtgttcacatccaaacataagctcttaattggaaggacat agtgtaggctggagctgcttc ompV up ccgaactgcgttttgagcc ggcacttatctgactggcag ompV down taggtcaaccgtggctttg cgccatcgcacatgatttac CmR virK tgctttcccgactgcgtggttgaagtcgggaaaggcgatgttaggtgagc catatgaatatcctccttag tgtctgatttttctgcttgaactgccctgcgctaccgaaatggctttgat gtgtaggctggagctgcttc virK up aaagtgacttacgtcgtgtgtc tggtgtgactaatgagggg virK down gcccatttcttgccataactcg atcgcaggcaacgctctagc ompV – cloning agct GGTAC Catgaaaaagatcgcactattta agct ctgcag ctagaagtggtaagcgacgg ompV – 153 – cloning agct GGTAC Catgatttcagcttcaattagaaaa agct ctgcag ctagaagtggtaagcgacgg virK – cloning agct GGTACC atgaacccacgcattgattat agct ctgcag ttagtggtgaatctcgttatccc ompV – verif gaatctcgttatcccaaggct ctcctgtctatcaagccatag virK – verif gagatttgcatgacttgcga ccgcacatgatttcagcttc pBAD24 – verif TTGCCGTCACTGCGTCTTT CCGCTTCTGCGTTCTGATTTA qPCR Gene Forward Reverse ompV (VC1318) taggtcaaccgtggctttg ggcacttatctgactggcag virK (VC1317) gcccatttcttgccataactcg tggtgtgactaatgagggg rpoE (VC2467) catcaacatcacttgcgggt gtgcgttttacacttggttgt almG (VC1577) aacgccgataaagccagat tgaggggatgacgcaga vexB (VC0164) ctcaactctgccaccgtt ccaagaagatgatcgccagc carS (VC1319) gaggtagccatagcgagaaaca agtcagggtttgggcttg recA (VC0092) * ATTGAAGGCGAAATGGGCGATAG TACACATACAGTTGGATTGCTTGAG CmR: chloramphenicol resistance cassette; Up: 1000 nt upstream region; Down: 1000 nt downstream region; nt : restriction sites; nt , homologous regions added to the amplicon; *, housekeeping gene used for normalization. The complementation of ompV using pBAD24 was carried as described before 35 . Briefly, the complete open reading frames (ORF) of ompV (VC_1318), from the annotated ATG or the ATG in position − 153 pb, and virK (VC_1317), were amplified by PCR from A1552 genomic DNA using the primers adding restriction sites listed in Table 3 . The amplicons and purified pBAD24 vector were digested with PstI and KpnI from New England Biolabs® according to the manufacturer’s instructions, and purified from agarose gel using Monarch Gel purification kit (New England Biolabs®). They were ligated using T4 ligase from New England Biolabs®. The constructions were amplified in thermocompetent E. coli DH5α 94 , extracted using Pure Yield™ Plasmid Miniprep System (Promega) and electroporated in V. cholerae at 1.275 kV, 25 Ω in 1 mm electroporation cuvettes (Thermo Fisher). The vector was maintained with 50 µg/ml carbenicillin. The ompV ORF and its – 153 bp region from other V. cholerae strains were compared to those of A1552 using the basic alignment tool nucleotides BLAST® from the National Center for Biotechnology Information 95 . The genomes from N16961 (AE003852.1), C6706 (CP046844.1) and MO10 (CP072849.1) were used for comparison. The synteny of the ompV region was analysed with PATRIC, using the Compare Region Viewer of the Features section 43 , 44 and with SyntTax 45 . Growth curves and minimal inhibitory concentrations V. cholerae was grown for 16 h at 37°C with agitation in LB, with carbenicillin when needed. A 1:50 dilution in fresh media was done, and the bacteria were grown at 37°C to an optical density at 600 nm (OD 600nm ) of 0.3. They were further diluted 1:3000 in LB distributed in 96 wells plates with decreasing concentrations of AMP. The bacterial growth was followed by reading the OD 600nm every 30 min, at 37°C with agitation. The minimal inhibitory concentration (MIC) was defined as the lowest AMP concentration that inhibits bacterial growth. Data were obtained from at least three independent experiments, in technical triplicates. Vesicles extraction, quantification, and visualization on SDS gel Membrane vesicles (MVs) were isolated from 25 mL cell-free supernatant from 16h cultures in LB, with or without 3 µg/ml of PmB, as described before 42 . MVs were suspended in 100 µl of phosphate buffered saline (PBS) and quantified using i) a Bradford assay (Bio-Rad 500-0006) and a bovine serum albumin (BSA) standard curve, as directed by the manufacturer and ii) a fluorescent lipid-labelling FM4-64. Briefly, 2 µL of MVs were incubated with the FM™ 4–64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermofisher) at 2 µg/mL in a final volume of 100 µL in a 96-well black plate. The fluorescence was measured at 515/640 nm using a SpectraMax iD3 reader (Molecular devices). To visualize the MV proteins, 10 µl of the MV preparations were suspended in 20 µl of Laemmli buffer 2X and boiled for 10 min at 100°C. Then, 10 µl of the samples migrated on a 13% sodium dodecyl sulfate gel. Gels were further colored with Coomassie blue. Atomic force microscopy imaging The vesicle samples were prepared as described before. A volume of 10 µL was spotted onto a freshly cleaved mica surface coverslip and allowed to dry at room temperature. AFM imaging was carried out in air at room temperature using a Bioscope resolve AFM (Bruker) in the peak-force tapping mode, silicon cantilevers with a nominal spring constant of around 0.4 N/m, and a nominal tip radius of 2 nm (ScanAsyst-Air, Bruker). Vesicle height was determined from AFM images (height channel) using the grain analysis functions in the open source Gwyddion software 96 . Survival in the presence of lethal concentrations of PmB Ninety microliters of midlog cultures were incubated for 30 min with 500 µg/ml of PmB at 37°C, with or without 5 µl of MV preparations (final concentration 10 X), as described before 42 . Ten microliters of ten-fold dilutions were spotted on LB agar plates, then incubated at 37°C for 16 h and numbered. The relative survival was calculated using the number of colony forming units per ml recovered in the presence of PmB in comparison to the non-treated cells. Data were obtained from at least three independent experiments. Detection of outer membrane pore formation by fluorescence Midlog cultures were stained using the fluorescent probes N-phenyl-1-naphthylamine (NPN) and propidium iodide (PI) as described before 97 , with modifications. Briefly, NPN and PI were used for the detection of outer membrane and outer/inner membrane damages, respectively. V. cholerae was grown to an OD 600nm of 1 in LB at 37°C. Bacteria were washed in PBS. Then, PmB at concentration of 50, 25, 10 and 3 µg/ml, or none as control, was added. NPN (20 µM) and PI (20 µM) were added, followed by an incubation of 30 min at room temperature, in the dark. A hundred microliters of each sample were added to a 96-well plate. The fluorescence was acquired with the SpectraMax iD3 reader (Molecular devices) at 350/420 nm and 535/615 nm, respectively. PBS with NPN and PI was used a negative control for autofluorescence to blank the values. The relative fluorescence of each condition was measured in comparison to the wild-type strain without PmB. Data were obtained from at least three independent experiments in technical duplicates. RNA extraction, cDNA construction and qPCR analysis V. cholerae was grown to an OD 600nm of 0.5 at 37°C in LB, with or without 3 µg/mL of PmB. The bacterial pellets from 10 ml cultures were suspended in 1 mL TRIzol solution (Invitrogen). The total RNA was extracted according to the manufacturer’s instructions and retrotranscribed to cDNA using QuantiTect Reverse Transcription Kit (QIAGEN). Their purity and quality were assessed by nanodrop and migration on 2% agarose gel, respectively. Quantitative PCR analysis was done as described before 42 with primers listed in Table 3 and using PerfeCTa SYBR® Green FastMix Low ROX (Quantabio). The amplification cycle constitutes of an initial activation step of 30 s at 95°C, followed by 40 cycles of denaturation at 95°C for 5 s, annealing/elongation at 57°C for 17 s and data collection for 12 s at 70°C. The normalized relative expression of various AMP resistance genes was calculated in PmB treated bacteria in comparison to non-treated cells using QuantStudio™ Design and Analysis Software (Thermo Fisher) v1.5.1 and normalized using recA . The results were obtained from 8 independent experiments, in technical triplicates. The genomic context of ompV was determined using the qPCR primers (Table 3 ) and cDNA of A1552 grown with and without PmB. The intergenic regions between carS and ompV and between ompV and virK were amplified from cDNA by PCR using carS -R and ompV -F, and ompV -R and virK -F. The absence of genomic DNA in the cDNA samples was assessed by PCR amplifying intergenic regions about lacZ using primers F- intergen : 5’-acaggcgatgactaacctac-3’ and R- intergen : 5’-ggagagtcaaagcgcagaac-3’ with DNA Taq Polymerase from New England Biolabs. The cycle consisted of an initial denaturation step of 30 s at 95°C, followed by 35 cycles of amplification consisting of a denaturation step of 15 s at 95°C, primer annealing at 49°C for 15 s, and extension at 68°C for 210 s. A final extension step of 5 min at 68°C was added. The amplicons migrated on 1% agarose gel and were visualized with RedSafe™ Nucleic Acid Staining Solution under ultraviolet light. RNAseq of total RNA Total RNA from A1552 grown with or without 3 µg/ml of PmB to an OD 600nm of 0.5 was isolated as described in the previous section. The ribosomal RNA depleted RNA was sequenced at the Génome Québec Innovation Center (Centre Hospitalier Universitaire Sainte-Justine, Montréal, QC, Canada). Total RNA was quantified and its integrity was assessed using a LabChip GXII (PerkinElmer) instrument. rRNA was depleted from 125 ng of total RNA using QIAseq FastSelect (-5S/16S/23S Kit 96rxns). cDNA synthesis was achieved with the NEBNext RNA First Strand Synthesis and NEBNext Ultra Directional RNA Second Strand Synthesis Modules (New England BioLabs). The remaining steps of library preparation were done using and the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers were purchased from New England BioLabs. Libraries were quantified using the KAPA Library Quantification Kits - Complete kit (Universal) (Kapa Biosystems). Average size fragment was determined using a LabChip GXII (PerkinElmer) instrument. The libraries were normalized and pooled and then denatured in 0.02N NaOH and neutralized using HT1 buffer. The pool was loaded at 175pM on a Illumina NovaSeq S4 lane using Xp protocol as per the manufacturer’s recommendations. The run was performed for 2x100 cycles (paired-end mode). A phiX library was used as a control and mixed with libraries at 1% level. Base calling was performed with RTA v3. Program bcl2fastq2 v2.20 was then used to demultiplex samples and generate fastq reads. Sequencing reads were cleaned with fastp version 0.23.4 and then mapped onto the genomic sequence of V. cholerae O1 biovar El Tor strain N16961 (RefSeq GCF_000006745.1) with Bowtie version 2.5.1. After sorting with SAMtools version 1.17, gene-mapping reads were counted with featureCounts version 2.0.1. Finally, differential gene expression was calculated with DESeq2 version 1.40.1 using R version 4.3.0. The output consisted of base mean values, fold change values (Log2(Fold Change)) of genes expression in PmB-treated cells in comparison to non-treated cells, standard error of the estimated fold change values (IfcSE), statistic values (Stat), P values (p-value) and adjusted P values (p-adj) (see Supplementary Table S1 ). Transcripts with a Log2(Fold Change) 0.4, and with a p-adj < 0.05 were considered as significantly modulated by the presence of PmB. The experiment was conducted in biological duplicate. The genes with a modified expression were submitted to the STRING database for network cluster enrichment 31 . Sequencing reads from the present project have been deposited in the public SRA database under accession number PRJNA1152934. Protein structure prediction and analysis The signal sequence of OmpV was predicted using SignalP 6.0 98 . The structure of OmpV without its signal sequence was predicted using AlphaFold2 99 as implemented through ColabFold 49 . Protein structure models were visualized using ChimeraX 100 . The predicted structure of OmpV was submitted to the Foldseek 50 and DALI 51 servers for comparison to experimentally-determined structures deposited in the Protein Data Bank. Structural alignment of OmpV and MipA was performed using the Protein Data Bank pairwise structural alignment tool. The electrostatic surface potential of OmpV was calculated using APBS tools 101 and visualized using ChimeraX. The volume of the putative binding pocket in the lumen of the OmpV barrel was calculated using CASTpFold 53 and visualized using Chimera 102 . Docking of PmB into the AlphaFold2-predicted structure of OmpV was performed using Autodock Vina 1.2.0 54 with an exhaustiveness of eight. The structure of PmB used for docking was obtained from PDB 5L3F. The structure of OmpV in complex with PmB was predicted de novo using Boltz-1 55 . Statistical Analysis All data are expressed as mean ± SD and were analyzed for significance using the GraphPad Prism version 10.2.2 for Windows (GraphPad Software, Boston, Massachusetts USA, www.graphpad.com). Student’s t -tests were used to compare conditions between 2 groups. Single way ANOVA was used for multiple groups comparison. A result was considered as significant when p value < 0.05 (*). Declarations Competing Interests Statement The authors declare no competing interests. Funding acquisition: M.D. Author Contribution Conceptualization: A.M.D., M.D.Methodology: A.M.D., G.B.W., A.T.V., C.B., J.P.F., F.M.Validation: All authors.Formal analysis: A.M.D., G.B.W., A.T.V., J.P.F., M.D.Investigation: A.M.D., G.B.W., A.T.V., C.B., J.P.F., M.D.Resources: A.T.V., Y.V.B., M.D.Data Curation: A.M.D., G.B.W., A.T.V., C.B., J.P.F., M.D.Writing – Original Draft: A.M.D., G.B.W., M.D.Writing – Review & Editing: All authors. Visualization: A.M.D., G.B.W., C.B., M.D.Supervision: M.D.Project administration: A.M.D., M.D.Funding acquisition: M.D. All authors reviewed the manuscript Acknowledgement The authors would like to thank Dre Wai from the Laboratory for Molecular Infection Medicine Sweden (MIMS) at Umeå University for bacterial strains. This work was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC; http://www.nserc-crsng.gc.ca/index_eng.asp) Discovery grant number RGPIN-2017-05322 to MD. AM-D received financial support from the NSERC scholarship program (BESC D3 – 558624 – 2021). JP-F received financial support from the FRQNT Scholarship Program, the NSERC's Canada Graduate Scholarships Master's program (CGS M) and the J.A. DeSève Scholarship from the Graduate and Postdoctoral Studies of the University of Montreal (ESP). AM-D and MD received financial support from the RAQ (Ressources Aquatiques Québec), an inter-institutional group supported financially by the Fonds de recherche du Québec – Nature et technologies (FRQNT) (Programme regroupements stratégiques). GBW received financial support from a FRQNT postdoctoral fellowship and is financially supported by YVB through a Canada 150 Research Chair in Bacterial Cell Biology and Project Grant PJT-169053 from the Canadian Institutes of Health Research (CIHR). Data Availability The datasets generated during and/or analysed during the current study are available in the SRA repository, under accession number PRJNA1152934. References Boparai, J. K. & Sharma, P. K. Mini Review on Antimicrobial Peptides, Sources, Mechanism and Recent Applications. Protein Pept Lett 27 , 4-16 (2020). https://doi.org:10.2174/0929866526666190822165812 Li, J. et al. Colistin: the re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections. Lancet Infect Dis 6 , 589-601 (2006). https://doi.org:10.1016/S1473-3099(06)70580-1 Velkov, T., Thompson, P. E., Nation, R. L. & Li, J. Structure--activity relationships of polymyxin antibiotics. J Med Chem 53 , 1898-1916 (2010). https://doi.org:10.1021/jm900999h Bialvaei, A. Z. & Samadi Kafil, H. Colistin, mechanisms and prevalence of resistance. Curr Med Res Opin 31 , 707-721 (2015). https://doi.org:10.1185/03007995.2015.1018989 Brogden, K. A. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol 3 , 238-250 (2005). https://doi.org:10.1038/nrmicro1098 Henderson, J. C., Herrera, C. M. & Trent, M. S. AlmG, responsible for polymyxin resistance in pandemic Vibrio cholerae , is a glycyltransferase distantly related to lipid A late acyltransferases. J Biol Chem 292 , 21205-21215 (2017). https://doi.org:10.1074/jbc.RA117.000131 Avedissian, S. N. et al. A Review of the Clinical Pharmacokinetics of Polymyxin B. Antibiotics (Basel) 8 (2019). https://doi.org:10.3390/antibiotics8010031 Abdelraouf, K., He, J., Ledesma, K. R., Hu, M. & Tam, V. H. Pharmacokinetics and renal disposition of polymyxin B in an animal model. Antimicrob Agents Chemother 56 , 5724-5727 (2012). https://doi.org:10.1128/AAC.01333-12 Clemens, J. D., Nair, G. B., Ahmed, T., Qadri, F. & Holmgren, J. Cholera. Lancet 390 , 1539-1549 (2017). https://doi.org:10.1016/S0140-6736(17)30559-7 Deen, J., Mengel, M. A. & Clemens, J. D. Epidemiology of cholera. Vaccine 38 Suppl 1 , A31-A40 (2020). https://doi.org:10.1016/j.vaccine.2019.07.078 Shirin, T. et al. Antimicrobial peptides in the duodenum at the acute and convalescent stages in patients with diarrhea due to Vibrio cholerae O1 or enterotoxigenic Escherichia coli infection. Microbes Infect 13 , 1111-1120 (2011). https://doi.org:10.1016/j.micinf.2011.06.014 Herrera, C. M. et al. The Vibrio cholerae VprA-VprB two-component system controls virulence through endotoxin modification. mBio 5 (2014). https://doi.org:10.1128/mBio.02283-14 Bilecen, K. et al. Polymyxin B resistance and biofilm formation in Vibrio cholerae are controlled by the response regulator CarR. Infect Immun 83 , 1199-1209 (2015). https://doi.org:10.1128/IAI.02700-14 Baron, S., Hadjadj, L., Rolain, J. M. & Olaitan, A. O. Molecular mechanisms of polymyxin resistance: knowns and unknowns. Int J Antimicrob Agents 48 , 583-591 (2016). https://doi.org:10.1016/j.ijantimicag.2016.06.023 Liu, Y. et al. Vibrio cholerae senses human enteric alpha-defensin 5 through a CarSR two-component system to promote bacterial pathogenicity. Commun Biol 5 , 559 (2022). https://doi.org:10.1038/s42003-022-03525-3 Bina, J. E., Provenzano, D., Wang, C., Bina, X. R. & Mekalanos, J. J. Characterization of the Vibrio cholerae vexAB and vexCD efflux systems. Arch Microbiol 186 , 171-181 (2006). https://doi.org:10.1007/s00203-006-0133-5 Klenotic, P. A. & Yu, E. W. Structural analysis of resistance-nodulation cell division transporters. Microbiol Mol Biol Rev 88 , e0019823 (2024). https://doi.org:10.1128/mmbr.00198-23 Fernandez-Recio, J. et al. A model of a transmembrane drug-efflux pump from Gram-negative bacteria. FEBS Lett 578 , 5-9 (2004). https://doi.org:10.1016/j.febslet.2004.10.097 Bina, X. R., Provenzano, D., Nguyen, N. & Bina, J. E. Vibrio cholerae RND family efflux systems are required for antimicrobial resistance, optimal virulence factor production, and colonization of the infant mouse small intestine. Infect Immun 76 , 3595-3605 (2008). https://doi.org:10.1128/IAI.01620-07 Taylor, R. K., Manoil, C. & Mekalanos, J. J. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae . J Bacteriol 171 , 1870-1878 (1989). https://doi.org:10.1128/jb.171.4.1870-1878.1989 Pohlner, J., Meyer, T. F., Jalajakumari, M. B. & Manning, P. A. Nucleotide sequence of ompV , the gene for a major Vibrio cholerae outer membrane protein. Mol Gen Genet 205 , 494-500 (1986). https://doi.org:10.1007/BF00338088 Stevenson, G., Leavesley, D. I., Lagnado, C. A., Heuzenroeder, M. W. & Manning, P. A. Purification of the 25-kDa Vibrio cholerae major outer-membrane protein and the molecular cloning of its gene: ompV . Eur J Biochem 148 , 385-390 (1985). https://doi.org:10.1111/j.1432-1033.1985.tb08850.x Kabir, S. Composition and immunochemical properties of outer membrane proteins of Vibrio cholerae . J Bacteriol 144 , 382-389 (1980). https://doi.org:10.1128/jb.144.1.382-389.1980 Kelley, J. T. & Parker, C. D. Identification and preliminary characterization of Vibrio cholerae outer membrane proteins. J Bacteriol 145 , 1018-1024 (1981). https://doi.org:10.1128/jb.145.2.1018-1024.1981 Manning, P. A. & Haynes, D. R. A common-immunogenic Vibrio outer membrane protein. FEMS Microbiology Letters 24 , 297-302 (1984). Pohlner, J., Meyer, T. F. & Manning, P. A. Serological properties and processing in Escherichia coli K12 of OmpV fusion proteins of Vibrio cholerae . Mol Gen Genet 205 , 501-506 (1986). https://doi.org:10.1007/BF00338089 Chiu, Y., Kuo, T. Y., Lin, C. C. & Chen, W. J. Proteomic analysis reveals responsive proteins of Vibrio parahaemolyticus on exposure to cationic antimicrobial peptides. J Appl Microbiol 110 , 80-89 (2011). https://doi.org:10.1111/j.1365-2672.2010.04856.x Nakata, N. et al. Identification and characterization of virK , a virulence-associated large plasmid gene essential for intercellular spreading of Shigella flexneri . Mol Microbiol 6 , 2387-2395 (1992). https://doi.org:10.1111/j.1365-2958.1992.tb01413.x Detweiler, C. S., Monack, D. M., Brodsky, I. E., Mathew, H. & Falkow, S. virK, somA and rcsC are important for systemic Salmonella enterica serovar Typhimurium infection and cationic peptide resistance. Mol Microbiol 48 , 385-400 (2003). https://doi.org:10.1046/j.1365-2958.2003.03455.x Novik, V., Hofreuter, D. & Galán, J. E. Characterization of a Campylobacter jejuni VirK protein homolog as a novel virulence determinant. Infect Immun 77 , 5428-5436 (2009). https://doi.org:10.1128/iai.00528-09 Szklarczyk, D. et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res 51 , D638-d646 (2023). https://doi.org:10.1093/nar/gkac1000 Kanehisa, M., Furumichi, M., Sato, Y., Matsuura, Y. & Ishiguro-Watanabe, M. KEGG: biological systems database as a model of the real world. Nucleic Acids Res 53 , D672-d677 (2025). https://doi.org:10.1093/nar/gkae909 Kanehisa, M. & Goto, S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 28 , 27-30 (2000). https://doi.org:10.1093/nar/28.1.27 Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci 28 , 1947-1951 (2019). https://doi.org:10.1002/pro.3715 Mathieu-Denoncourt, A. & Duperthuy, M. The VxrAB Two-component system is important for the Polymyxin B dependent activation of the type VI secretion system in Vibrio cholerae O1 strain A1552. Can J Microbiol (2023). https://doi.org:10.1139/cjm-2023-0026 Duperthuy, M. et al. Role of the Vibrio cholerae matrix protein Bap1 in cross-resistance to antimicrobial peptides. PLoS Pathog 9 , e1003620 (2013). https://doi.org:10.1371/journal.ppat.1003620 Bouillet, S., Bauer Taran, S. & Gottesman, S. RpoS and the bacterial general stress response. Microbiology and Molecular Biology Reviews 88 , e00151-00122 (2024). https://doi.org:10.1128/mmbr.00151-22 Rodríguez-Rojas, A. & Rolff, J. Antimicrobial activity of cationic antimicrobial peptides against stationary phase bacteria. Frontiers in Microbiology 13 (2022). Muheim, C. et al. Increasing the permeability of Escherichia coli using MAC13243. Sci Rep 7 , 17629 (2017). https://doi.org:10.1038/s41598-017-17772-6 Giacomucci, S., Cros, C. D., Perron, X., Mathieu-Denoncourt, A. & Duperthuy, M. Flagella-dependent inhibition of biofilm formation by sub-inhibitory concentration of polymyxin B in Vibrio cholerae . PLoS One 14 , e0221431 (2019). https://doi.org:10.1371/journal.pone.0221431 Magana, G., Harvey, C., Taggart, C. C. & Rodgers, A. M. Bacterial outer membrane vesicles: Role in pathogenesis and host-cell interactions. Antibiotics (Basel) 13 (2023). https://doi.org:10.3390/antibiotics13010032 Giacomucci, S., Mathieu-Denoncourt, A., Vincent, A. T., Jannadi, H. & Duperthuy, M. Experimental evolution of Vibrio cholerae identifies hypervesiculation as a way to increase motility in the presence of polymyxin B. Front Microbiol (2022). https://doi.org:https://doi.org/10.3389/fmicb.2022.932165 Assaf, R., Xia, F. & Stevens, R. Detecting operons in bacterial genomes via visual representation learning. Scientific Reports 11 , 2124 (2021). https://doi.org:10.1038/s41598-021-81169-9 Wattam, A. R. et al. Improvements to PATRIC, the all-bacterial Bioinformatics Database and Analysis Resource Center. Nucleic Acids Res 45 , D535-d542 (2017). https://doi.org:10.1093/nar/gkw1017 Oberto, J. SyntTax: a web server linking synteny to prokaryotic taxonomy. BMC Bioinformatics 14 , 4 (2013). https://doi.org:10.1186/1471-2105-14-4 Ko, D. et al. CarRS two-component system essential for Polymyxin B resistance of Vibrio vulnificus responds to multiple host environmental signals. Microbiol Spectr 11 , e0030523 (2023). https://doi.org:10.1128/spectrum.00305-23 Mathur, J. & Waldor, M. K. The Vibrio cholerae ToxR-regulated porin OmpU confers resistance to antimicrobial peptides. Infect Immun 72 , 3577-3583 (2004). https://doi.org:10.1128/IAI.72.6.3577-3583.2004 Mathur, J., Davis, B. M. & Waldor, M. K. Antimicrobial peptides activate the Vibrio cholerae sigmaE regulon through an OmpU-dependent signalling pathway. Mol Microbiol 63 , 848-858 (2007). https://doi.org:10.1111/j.1365-2958.2006.05544.x Mirdita, M. et al. ColabFold: making protein folding accessible to all. Nat Methods 19 , 679-682 (2022). https://doi.org:10.1038/s41592-022-01488-1 van Kempen, M. et al. Fast and accurate protein structure search with Foldseek. Nat Biotechnol 42 , 243-246 (2024). https://doi.org:10.1038/s41587-023-01773-0 Holm, L., Laiho, A., Toronen, P. & Salgado, M. DALI shines a light on remote homologs: One hundred discoveries. Protein Sci 32 , e4519 (2023). https://doi.org:10.1002/pro.4519 Janet-Maitre, M. et al. Pseudomonas aeruginos a MipA-MipB envelope proteins act as new sensors of polymyxins. mBio 15 , e0221123 (2024). https://doi.org:10.1128/mbio.02211-23 Ye, B., Tian, W., Wang, B. & Liang, J. CASTpFold: Computed Atlas of Surface Topography of the universe of protein Folds. Nucleic Acids Res 52 , W194-W199 (2024). https://doi.org:10.1093/nar/gkae415 Eberhardt, J., Santos-Martins, D., Tillack, A. F. & Forli, S. AutoDock Vina 1.2.0: new docking methods, expanded force field, and python bindings. J Chem Inf Model 61 , 3891-3898 (2021). https://doi.org:10.1021/acs.jcim.1c00203 Wohlwend, J. et al. Boltz-1 democratizing biomolecular interaction modeling. bioRxiv (2024). https://doi.org:10.1101/2024.11.19.624167 Mathieu-Denoncourt, A. & Duperthuy, M. Secretome analysis reveals a role of subinhibitory concentrations of polymyxin B in the survival of Vibrio cholerae mediated by the type VI secretion system. Environ Microbiol 24 , 1133-1149 (2022). https://doi.org:10.1111/1462-2920.15762 Bina, X. R. et al. The Vibrio cholerae RND efflux systems impact virulence factor production and adaptive responses via periplasmic sensor proteins. PLoS Pathog 14 , e1006804 (2018). https://doi.org:10.1371/journal.ppat.1006804 Taylor, D. L., Ante, V. M., Bina, X. R., Howard, M. F. & Bina, J. E. Substrate-dependent activation of the Vibrio cholerae vexAB RND efflux system requires vexR . PLoS One 10 , e0117890 (2015). https://doi.org:10.1371/journal.pone.0117890 Destoumieux-Garzon, D., Duperthuy, M., Vanhove, A. S., Schmitt, P. & Wai, S. N. Resistance to antimicrobial peptides in Vibrios. Antibiotics (Basel) 3 , 540-563 (2014). https://doi.org:10.3390/antibiotics3040540 Matson, J. S., Livny, J. & DiRita, V. J. A putative Vibrio cholerae two-component system controls a conserved periplasmic protein in response to the antimicrobial peptide polymyxin B. PLoS One 12 , e0186199 (2017). https://doi.org:10.1371/journal.pone.0186199 Kaur, D., Gandhi, S. & Mukhopadhaya, A. Salmonella Typhimurium adhesin OmpV activates host immunity to confer protection against systemic and gastrointestinal infection in mice. Infect Immun 89 , e0012121 (2021). https://doi.org:10.1128/IAI.00121-21 Kaur, D. & Mukhopadhaya, A. Outer membrane protein OmpV mediates Salmonella enterica serovar typhimurium adhesion to intestinal epithelial cells via fibronectin and alpha1beta1 integrin. Cell Microbiol 22 , e13172 (2020). https://doi.org:10.1111/cmi.13172 Xu, C. et al. Proteomic analysis on the expression of outer membrane proteins of Vibrio alginolyticus at different sodium concentrations. Proteomics 5 , 3142-3152 (2005). https://doi.org:10.1002/pmic.200401128 Xu, C., Ren, H., Wang, S. & Peng, X. Proteomic analysis of salt-sensitive outer membrane proteins of Vibrio parahaemolyticus . Res Microbiol 155 , 835-842 (2004). https://doi.org:10.1016/j.resmic.2004.07.001 Wu, L. et al. OmpW and OmpV are required for NaCl regulation in Photobacterium damsela. J Proteome Res 5 , 2250-2257 (2006). https://doi.org:10.1021/pr060046c Vollmer, W., von Rechenberg, M. & Holtje, J. V. Demonstration of molecular interactions between the murein polymerase PBP1B, the lytic transglycosylase MltA, and the scaffolding protein MipA of Escherichia coli . J Biol Chem 274 , 6726-6734 (1999). https://doi.org:10.1074/jbc.274.10.6726 Li, H., Zhang, D. F., Lin, X. M. & Peng, X. X. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein. FEMS Microbiol Lett 362 (2015). https://doi.org:10.1093/femsle/fnv074 Giacomucci, S., Mathieu-Denoncourt, A., Vincent, A. T., Jannadi, H. & Duperthuy, M. Experimental evolution of Vibrio cholerae identifies hypervesiculation as a way to increase motility in the presence of polymyxin B. Front Microbiol 13 , 932165 (2022). https://doi.org:10.3389/fmicb.2022.932165 Manning, A. J. & Kuehn, M. J. Contribution of bacterial outer membrane vesicles to innate bacterial defense. BMC Microbiol 11 , 258 (2011). https://doi.org:10.1186/1471-2180-11-258 Li, Z. & Velkov, T. in Polymyxin antibiotics: From laboratory bench to bedside (eds Jian Li, Roger L. Nation, & Keith S. Kaye) 37-54 (Springer International Publishing, 2019). Cerda-Maira, F. A., Ringelberg, C. S. & Taylor, R. K. The bile response repressor BreR regulates expression of the Vibrio cholerae breAB efflux system operon. J Bacteriol 190 , 7441-7452 (2008). https://doi.org:10.1128/JB.00584-08 Chung, I. Y., Choi, S. Y., Bae, H. W. & Cho, Y. H. A TetR family regulator of an RND efflux system that directs artemisinin resistance in Vibrio cholerae . mSystems 9 , e0085123 (2024). https://doi.org:10.1128/msystems.00851-23 Bina, J. E. & Mekalanos, J. J. Vibrio cholerae tolC is required for bile resistance and colonization. Infect Immun 69 , 4681-4685 (2001). https://doi.org:10.1128/IAI.69.7.4681-4685.2001 Taylor, D. L., Bina, X. R. & Bina, J. E. Vibrio cholerae VexH encodes a multiple drug efflux pump that contributes to the production of cholera toxin and the toxin co-regulated pilus. PLoS One 7 , e38208 (2012). https://doi.org:10.1371/journal.pone.0038208 Bina, J. et al. ToxR regulon of Vibrio cholerae and its expression in vibrios shed by cholera patients. Proc Natl Acad Sci U S A 100 , 2801-2806 (2003). https://doi.org:10.1073/pnas.2628026100 Ma, D. et al. Genes acrA and acrB encode a stress-induced efflux system of Escherichia coli . Mol Microbiol 16 , 45-55 (1995). https://doi.org:10.1111/j.1365-2958.1995.tb02390.x Weng, Y. et al. Vibrio cholerae TolC Is required for expression of the ToxR regulon. Infect Immun 89 , e0024221 (2021). https://doi.org:10.1128/IAI.00242-21 Cho, T. H. S., Wang, J. & Raivio, T. L. NlpE is an OmpA-associated outer membrane sensor of the Cpx envelope stress response. J Bacteriol 205 , e0040722 (2023). https://doi.org:10.1128/jb.00407-22 Duperthuy, M. et al. The major outer membrane protein OmpU of Vibrio splendidus contributes to host antimicrobial peptide resistance and is required for virulence in the oyster Crassostrea gigas . Environ Microbiol 12 , 951-963 (2010). https://doi.org:10.1111/j.1462-2920.2009.02138.x Walsh, N. P., Alba, B. M., Bose, B., Gross, C. A. & Sauer, R. T. OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain. Cell 113 , 61-71 (2003). https://doi.org:10.1016/s0092-8674(03)00203-4 Missiakas, D., Mayer, M. P., Lemaire, M., Georgopoulos, C. & Raina, S. Modulation of the Escherichia coli sigmaE (RpoE) heat-shock transcription-factor activity by the RseA, RseB and RseC proteins. Mol Microbiol 24 , 355-371 (1997). https://doi.org:10.1046/j.1365-2958.1997.3601713.x Wilken, C., Kitzing, K., Kurzbauer, R., Ehrmann, M. & Clausen, T. Crystal structure of the DegS stress sensor: How a PDZ domain recognizes misfolded protein and activates a protease. Cell 117 , 483-494 (2004). https://doi.org:10.1016/s0092-8674(04)00454-4 Ades, S. E., Connolly, L. E., Alba, B. M. & Gross, C. A. The Escherichia coli sigma(E)-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13 , 2449-2461 (1999). https://doi.org:10.1101/gad.13.18.2449 Kanehara, K., Ito, K. & Akiyama, Y. YaeL (EcfE) activates the sigma(E) pathway of stress response through a site-2 cleavage of anti-sigma(E), RseA. Genes Dev 16 , 2147-2155 (2002). https://doi.org:10.1101/gad.1002302 Davis, B. M. & Waldor, M. K. High-throughput sequencing reveals suppressors of Vibrio cholerae rpoE mutations: one fewer porin is enough. Nucleic Acids Res 37 , 5757-5767 (2009). https://doi.org:10.1093/nar/gkp568 Zhang, H., Srinivas, S., Xu, Y., Wei, W. & Feng, Y. Genetic and biochemical mechanisms for bacterial lipid A modifiers associated with polymyxin resistance. Trends Biochem Sci 44 , 973-988 (2019). https://doi.org:10.1016/j.tibs.2019.06.002 Benz, R., Maier, E. & Chakraborty, T. Purification of OmpU from Vibrio cholerae classical strain 569B: evidence for the formation of large cation-selective ion-permeable channels by OmpU. Microbiologia 13 , 321-330 (1997). Tapia-Pastrana, G., Chavez-Duenas, L., Lanz-Mendoza, H., Teter, K. & Navarro-Garcia, F. VirK is a periplasmic protein required for efficient secretion of plasmid-encoded toxin from enteroaggregative Escherichia coli . Infect Immun 80 , 2276-2285 (2012). https://doi.org:10.1128/IAI.00167-12 Allue-Guardia, A., Echazarreta, M., Koenig, S. S. K., Klose, K. E. & Eppinger, M. Closed genome sequence of Vibrio cholerae O1 El Tor Inaba strain A1552. Genome Announc 6 (2018). https://doi.org:10.1128/genomeA.00098-18 Datsenko, K. A. & Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97 , 6640-6645 (2000). https://doi.org:10.1073/pnas.120163297 Yamamoto, S., Izumiya, H., Morita, M., Arakawa, E. & Watanabe, H. Application of lambda Red recombination system to Vibrio cholerae genetics: simple methods for inactivation and modification of chromosomal genes. Gene 438 , 57-64 (2009). https://doi.org:10.1016/j.gene.2009.02.015 Marvig, R. L. & Blokesch, M. Natural transformation of Vibrio cholerae as a tool--optimizing the procedure. BMC Microbiol 10 , 155 (2010). https://doi.org:10.1186/1471-2180-10-155 St-Pierre, F. et al. One-step cloning and chromosomal integration of DNA. ACS Synth Biol 2 , 537-541 (2013). https://doi.org:10.1021/sb400021j Liu, J. et al. An Improved Method of Preparing High Efficiency Transformation Escherichia coli with Both Plasmids and Larger DNA Fragments. Indian J Microbiol 58 , 448-456 (2018). https://doi.org:10.1007/s12088-018-0743-z Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J Mol Biol 215 , 403-410 (1990). https://doi.org:10.1016/S0022-2836(05)80360-2 Nečas, D. & Klapetek, P. Gwyddion: an open-source software for SPM data analysis. 10 , 181-188 (2012). https://doi.org:doi:10.2478/s11534-011-0096-2 Ma, B. et al. Contemporaneous measurement of outer and inner membrane permeability in Gram-negative bacteria. Bio Protoc 10 , e3548 (2020). https://doi.org:10.21769/BioProtoc.3548 Teufel, F. et al. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol 40 , 1023-1025 (2022). https://doi.org:10.1038/s41587-021-01156-3 Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596 , 583-589 (2021). https://doi.org:10.1038/s41586-021-03819-2 Meng, E. C. et al. UCSF ChimeraX: Tools for structure building and analysis. Protein Sci 32 , e4792 (2023). https://doi.org:10.1002/pro.4792 Jurrus, E. et al. Improvements to the APBS biomolecular solvation software suite. Protein Sci 27 , 112-128 (2018). https://doi.org:10.1002/pro.3280 Pettersen, E. F. et al. UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25 , 1605-1612 (2004). https://doi.org:10.1002/jcc.20084 Guzman, L. M., Belin, D., Carson, M. J. & Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177 , 4121-4130 (1995). https://doi.org:10.1128/jb.177.14.4121-4130.1995 The Gene Ontology, C. et al. The Gene Ontology knowledgebase in 2023. Genetics 224 , iyad031 (2023). https://doi.org:10.1093/genetics/iyad031 Ashburner, M. et al. Gene Ontology: tool for the unification of biology. Nature Genetics 25 , 25-29 (2000). https://doi.org:10.1038/75556 Additional Declarations No competing interests reported. Supplementary Files MathieuDenoncourtetalsupp.matRevision.docx SyntTaxsyntenyvibrioallstrainsinsynttax.pdf Cite Share Download PDF Status: Published Journal Publication published 21 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Accepted 10 Apr, 2025 Reviews received at journal 26 Mar, 2025 Reviewers agreed at journal 24 Mar, 2025 Reviewers agreed at journal 24 Mar, 2025 Reviewers invited by journal 24 Mar, 2025 Submission checks completed at journal 21 Mar, 2025 First submitted to journal 11 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5220433","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":433337642,"identity":"f8b537eb-31aa-4e92-bc39-be4c575bc646","order_by":0,"name":"Annabelle Mathieu-Denoncourt","email":"","orcid":"","institution":"Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Annabelle","middleName":"","lastName":"Mathieu-Denoncourt","suffix":""},{"id":433337643,"identity":"ebde684d-2c14-4c38-8f2b-ecbe4c1fff19","order_by":1,"name":"Gregory B. Whitfield","email":"","orcid":"","institution":"Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Gregory","middleName":"B.","lastName":"Whitfield","suffix":""},{"id":433337646,"identity":"d9daa240-1805-4044-b629-f8a0da11653a","order_by":2,"name":"Antony T. Vincent","email":"","orcid":"","institution":"Université Laval","correspondingAuthor":false,"prefix":"","firstName":"Antony","middleName":"T.","lastName":"Vincent","suffix":""},{"id":433337650,"identity":"a42d4ef1-4972-44c5-826a-5cc3e2d7dbda","order_by":3,"name":"Cécile Berne","email":"","orcid":"","institution":"Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Cécile","middleName":"","lastName":"Berne","suffix":""},{"id":433337651,"identity":"3cd9ce5e-ee65-4028-8964-c8f21c179243","order_by":4,"name":"Julien Pauzé-Foixet","email":"","orcid":"","institution":"Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Julien","middleName":"","lastName":"Pauzé-Foixet","suffix":""},{"id":433337653,"identity":"d5655044-5d00-4ed8-adc8-b873b7f53f2f","order_by":5,"name":"Feriel C. Mahieddine","email":"","orcid":"","institution":"Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Feriel","middleName":"C.","lastName":"Mahieddine","suffix":""},{"id":433337657,"identity":"ee453f28-7cf8-4243-b07a-1c87dfec8e53","order_by":6,"name":"Yves V. Brun","email":"","orcid":"","institution":"Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Yves","middleName":"V.","lastName":"Brun","suffix":""},{"id":433337658,"identity":"0baee15c-8b16-4f68-b043-48a6b57edbb3","order_by":7,"name":"Marylise Duperthuy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABO0lEQVRIiWNgGAWjYLCCBwYgMoEBSjIfgEkwHsCiGqIMocUASLKBWRIgArcWBAnSwmOAV4tu+9lnEgkFdXIM7DlmDz7u+ZNncCPnm9SNijt15u3NDw4w1NihazE7k24mkWBw2JiB54254YxnBsUGN3K3SeeceSYhc+aYwQGGY8kYWg6ksQG1HEhskMgxk+Y5YJC4AaQlt+2whARInLGBGUPL+WcgLXX1YC1/wFpynkG0yD//ANRSj6HlBtgW5gQGkBYGiBY2qC08IFsOY2p5xmwB9IthG8+zcsOeA8aJM888M7bOOXNYcgZPTsGBhGPHMR2Wxnjjw586eX725G0PfhyQS+w7nvzwdk7FYX4J9uMbH3yoqcYSzizgGGADIxAQSECSTMBQDgLMH6AMqBb+A1iVjYJRMApGwcgFACtqdhA+2ZjCAAAAAElFTkSuQmCC","orcid":"","institution":"Université de Montréal","correspondingAuthor":true,"prefix":"","firstName":"Marylise","middleName":"","lastName":"Duperthuy","suffix":""}],"badges":[],"createdAt":"2024-10-07 20:08:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5220433/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5220433/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-98217-3","type":"published","date":"2025-04-21T15:57:47+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":79157827,"identity":"254df614-c8ae-46c5-b7a7-04ad8912a0d8","added_by":"auto","created_at":"2025-03-25 06:42:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":31850,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential gene expression in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eV. cholerae \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eA1552 in the presence of subinhibitory concentrations of polymyxin B\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eV. cholerae\u003c/em\u003e O1 El Tor strain A1552 was grown to midlog phase in LB supplemented with 3 µg/ml of polymyxin B (PmB). The differential gene expression in A1552 treated with PmB in comparison to non-treated cells was analysed using the variance analysis package DESeq2. The expression (Log\u003csub\u003e2\u003c/sub\u003e(Fold Change)) and adjusted P-value (-Log\u003csub\u003e10\u003c/sub\u003e\u003cem\u003ePadj\u003c/em\u003e) for each identified gene were plotted. A total of 3715 genes were identified. Genes with Padj \u0026lt; 0.05 and Log\u003csub\u003e2\u003c/sub\u003e(Fold Change) \u0026lt; -0.4 or \u0026gt; 0.4 were considered as significantly modulated by the presence of PmB. Black dots represent genes with unmodified expression. Red and green dots represent genes with decreased or increased expression, respectively. Pink dots are genes with increased expression that are the object of this study.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/16fc0edd80aeed13f5fd735b.png"},{"id":79157836,"identity":"9366a251-4de4-4ff5-98e4-b25beb8f319c","added_by":"auto","created_at":"2025-03-25 06:42:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":486686,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTRING analysis of the genes with modulated expression in the presence of subinhibitory concentrations of polymyxin B.\u003c/strong\u003e A1552 was grown to midlog phase in LB supplemented with 3 µg/ml of polymyxin B (PmB). The identified genes with significantly modulated expression in the presence of PmB were submitted to STRING for gene cluster enrichment analysis \u003csup\u003e31-34,104,105\u003c/sup\u003e. Colored dots represent significantly enriched (FDR\u0026lt;0.5) clusters of genes with modified expression in the presence of PmB. Edges represent protein-protein associations.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/85fc47be3d579eed9b3e985d.png"},{"id":79158122,"identity":"d94e80a3-2348-4765-845d-cce56d6e5470","added_by":"auto","created_at":"2025-03-25 06:50:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6859,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eompV\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eis increased in the presence of polymyxin B in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eV. cholerae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003cem\u003eV. cholerae\u003c/em\u003e A1552 was grown to midlog phase in LB with or without 3 µg/ml of polymyxin B (PmB). The relative normalized expression of \u003cem\u003eompV \u003c/em\u003ewas determined by quantitative RT-PCR in comparison to untreated A1552 cells, and normalized using \u003cem\u003erecA\u003c/em\u003e. Data are presented as the mean ± SD from 8 independent experiments conducted in technical triplicates. Asterisks represent a significant difference in expression between treated and non-treated cells, as determined by a student \u003cem\u003et\u003c/em\u003e-test (****, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/16531398cca1ac099dbbc516.png"},{"id":79157831,"identity":"9bba53ce-bb16-4ecf-807c-5840fac9c8fe","added_by":"auto","created_at":"2025-03-25 06:42:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":24371,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased polymyxin B sensitivity of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eompV\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mutant is not due to destabilization of the cellular envelope\u003c/strong\u003e. Midlog cultures of A1552 and A1552Δ\u003cem\u003eompV \u003c/em\u003ewere washed in PBS. Then, polymyxin B (PmB) (50, 25, 10 and 3 µg/ml, or none as a control) was added, and the bacteria were incubated for 30 min at 37°C. The bacteria were stained with \u003cstrong\u003ea)\u003c/strong\u003e \u003cem\u003eN\u003c/em\u003e-phenyl-1-napthylamine (NPN, 20 µM) and \u003cstrong\u003eb)\u003c/strong\u003e propidium iodide (PI, 20 µM). A hundred microliters of each sample were added to a 96-well plate and absolute fluorescence was quantified with a SpectraMax iD3 plate reader at 350/420 nm and 535/615 nm for NPN and PI, respectively. The relative fluorescence in each condition was calculated in comparison to A1552 non-treated cells. Data are presented as mean ± SD from 4 independent experiments conducted in triplicates. Asterisks represent a significant difference compared to the non-treated condition within a strain as determined by a single way ANOVA (*, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.005; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0005; ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/ad08697fa2facd5f8d5649e9.png"},{"id":79159264,"identity":"386fc231-8236-4c56-becc-75857ab7a945","added_by":"auto","created_at":"2025-03-25 07:06:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":67563,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProduction of membrane vesicles and their contribution to survival of a 500 µg/ml polymyxin B treatment for A1552 and A1552Δ\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eompV\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e The membrane vesicles (MV) of A1552 and A1552Δ\u003cem\u003eompV\u003c/em\u003e were extracted by ultracentrifugation of the cell-free supernatant from overnight cultures. \u003cstrong\u003ea)\u003c/strong\u003eThe protein content and \u003cstrong\u003eb)\u003c/strong\u003e lipid fraction were quantified in the MV preparations using a Bradford assay and the fluorescent probe FM4-64, respectively. \u003cstrong\u003ec)\u003c/strong\u003e Representative atomic force microscopy images (peak-force error) of A1552 and A1552∆\u003cem\u003eompV\u003c/em\u003e MVs deposited on a mica surface (scale bar = 1 µm). \u003cstrong\u003ed)\u003c/strong\u003e The size of the MVs from A1552 and A1552∆\u003cem\u003eompV\u003c/em\u003e (n = 123 and 100 respectively) samples was determined in the AFM images using Gwyddion software. \u003cstrong\u003ee)\u003c/strong\u003e The survival of A1552 and A1552Δ\u003cem\u003eompV\u003c/em\u003e after a 30 min incubation with 500 µg/ml PmB without MV was assessed. The protective effect of the MVs from A1552 and A1552Δ\u003cem\u003eompV\u003c/em\u003e on \u003cstrong\u003ef)\u003c/strong\u003e A1552 and \u003cstrong\u003eg)\u003c/strong\u003e A1552Δ\u003cem\u003eompV\u003c/em\u003e survival to PmBwas then determined. The strains were incubated 30 min with 500 µg/ml PmB and MV preparation. The surviving bacteria were counted on LB agar. The relative survival was calculated compared to the number of non-treated bacteria retrieved after the incubation. Data are presented as mean ± SD from 4 independent experiments. The asterisk represents a significant difference in survival, as determined by a student \u003cem\u003et\u003c/em\u003e-test (\u003cstrong\u003ea, b, d, e\u003c/strong\u003e) or single way ANOVA (\u003cstrong\u003ef, g\u003c/strong\u003e) (*, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/ff2d733ac68ef3064205c4c9.png"},{"id":79157828,"identity":"3e1b36d1-e472-430d-b604-91507d65d035","added_by":"auto","created_at":"2025-03-25 06:42:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":156620,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSubinhibitory concentrations of polymyxin B increase the expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eompV\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, which is organized in an operon with the two-component system \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ecarRS\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evirK\u003c/strong\u003e\u003c/em\u003e. A1552 was grown in LB to midlog phase, with and without the addition of a subinhibitory concentration of polymyxin B. Total RNA was extracted and reverse transcribed to cDNA. \u003cstrong\u003ea)\u003c/strong\u003e Intergenic regions (amplicons A and B) were amplified by PCR using primers (blue and green arrows) in the\u003cem\u003e carS\u003c/em\u003e, \u003cem\u003eompV,\u003c/em\u003eand \u003cem\u003evirK \u003c/em\u003eopen reading frames, and migrated on a 1 % agarose gel. cDNA was replaced with water in PCR reactions as a negative control (-). The results are representative of 3 independent experiments. \u003cstrong\u003eb)\u003c/strong\u003e Amplification of an intergenic region about \u003cem\u003elacZ\u003c/em\u003e on genomic DNA (gDNA) and cDNA of A1552 to confirm the absence of genomic DNA in the sample. Cropped from original picture (see supplementary figure S6). \u003cstrong\u003ec) \u003c/strong\u003eThe normalized relative expression of \u003cem\u003ecarS\u003c/em\u003e, \u003cem\u003eompV,\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e was measured in polymyxin B treated bacteria in comparison to non-treated cells by quantitative PCR. The expression was normalized using \u003cem\u003erecA\u003c/em\u003e. The results are presented as mean ± SD and were obtained from 8 independent experiments, in technical triplicates.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/cac9dc03f662a35d862c0c8b.png"},{"id":79158125,"identity":"a6f5fe59-b944-4677-98e9-6dbd9d11e7ce","added_by":"auto","created_at":"2025-03-25 06:50:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":32474,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eompV\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e deletion modifies the expression of antimicrobial resistance related genes in the presence of polymyxin B. \u003c/strong\u003eA1552 and A1552Δ\u003cem\u003eompV\u003c/em\u003e were grown to midlog phase in LB with or without 3 µg/ml of polymyxin B (PmB). The relative normalized expression of \u003cstrong\u003ea)\u003c/strong\u003e \u003cem\u003ecarS,\u003c/em\u003e \u003cstrong\u003eb)\u003c/strong\u003e \u003cem\u003ealmG\u003c/em\u003e, \u003cstrong\u003ec)\u003c/strong\u003e \u003cem\u003erpoE,\u003c/em\u003eand \u003cstrong\u003ed)\u003c/strong\u003e \u003cem\u003evexB\u003c/em\u003e was determined by quantitative RT-PCR in comparison to the A1552 non-treated cells and normalized using \u003cem\u003erecA\u003c/em\u003e. Data are presented as mean ± SD from 8 independent experiments conducted in technical triplicates. Asterisk represents a significant difference in expression between treated and non-treated cells, as determined by a single way ANOVA (*, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.005; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0005; ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/872e1ad1c7484eede9188b61.png"},{"id":79159265,"identity":"6d274a84-8eef-4f16-9506-3607520a85ab","added_by":"auto","created_at":"2025-03-25 07:06:53","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":172982,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOmpV has a membrane-accessible lateral opening into an electronegative pocket in the β-barrel lumen that can accommodate polymyxin B. a) \u003c/strong\u003eThe structure of OmpV without its signal sequence (residues 1-19), predicted by Alphafold2 as implemented within ColabFold. The side of OmpV that faces the periplasmic or extracellular space is indicated. β-strands five and six (β5 and β6), which are shorter than the other strands that comprise the barrel, are indicated in blue. The N-terminal plug region, which occludes access to the barrel lumen from the periplasmic side, is indicated in yellow.\u003cstrong\u003e b) (left) \u003c/strong\u003eSpace-filling model of the predicted structure of OmpV, highlighting the lateral opening in the side of the barrel. The model is oriented similar to the leftmost structure of panel A.\u003cstrong\u003e (right) \u003c/strong\u003eMagnified view of the lateral opening, looking directly into the pocket in the barrel lumen. The surface is colored according to electrostatic potential calculated using APBS; contoured from -10 kT/e (red) to 10 kT/e (blue). \u003cstrong\u003ec) \u003c/strong\u003eThe pocket in the lumen of the OmpV barrel as determined by CASTpFold, depicted as a negative space-filling surface in pink. The dashed lines indicate the approximate location of the membrane-solvent boundary. \u003cstrong\u003ed) \u003c/strong\u003eThe top pose of polymyxin B docked into the Alphafold2-predicted structure of OmpV, as determined by Autodock Vina. Polymyxin B is represented in stick configuration, with carbon atoms depicted in yellow, nitrogen atoms in blue, oxygen atoms in red, and hydrogen atoms in white.\u003c/p\u003e","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/8fba75af4da806f13b55c3d9.png"},{"id":79157835,"identity":"60a62cf5-bc45-4a05-b15e-60c0172723f1","added_by":"auto","created_at":"2025-03-25 06:42:53","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":44401,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical summary of the proposed mechanism of resistance to polymyxin B mediated by the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ecarR-carS-ompV-virK\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eoperon.\u003c/strong\u003e OmpV (blue) at the outer membrane (OM) serves as sensor for polymyxin B (pink). Once polymyxin B integrates into the OM, it can access the electronegative lumen of OmpV through a lateral gap in the barrel wall. This interaction could induce a conformational change, leading to an intracellular signaling event. Using unknown mediators in the periplasm (P) and cytosol (C), or through the two-component system CarRS, the expression of the \u003cem\u003ealmEFG,\u003c/em\u003e \u003cem\u003ecarRS-ompV-virK,\u003c/em\u003e and \u003cem\u003evexAB\u003c/em\u003eloci is induced. VexAB, together with TolC, forms an efflux-system implicated in resistance to polymyxin B. Known activation pathways are identified using solid black arrows. Hypothesized pathways are represented with dashed grey arrows. IM, Inner membrane.\u003c/p\u003e","description":"","filename":"Onlinefloatimage9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/a24d346171772685ea86023a.jpg"},{"id":81569670,"identity":"f6447185-b05f-429b-bd78-1ba79af08fbf","added_by":"auto","created_at":"2025-04-28 16:09:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3588550,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/991ac887-cd1d-4ca3-97cc-4a998473d091.pdf"},{"id":79159266,"identity":"bb4c18a3-0bd9-4fbe-8a7a-7a0f2aec6be0","added_by":"auto","created_at":"2025-03-25 07:06:54","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4000851,"visible":true,"origin":"","legend":"","description":"","filename":"MathieuDenoncourtetalsupp.matRevision.docx","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/f0494e5788bfbc7c81afc9ee.docx"},{"id":79157829,"identity":"63406618-a1c6-4dfd-99a3-54221835b350","added_by":"auto","created_at":"2025-03-25 06:42:53","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":918056,"visible":true,"origin":"","legend":"","description":"","filename":"SyntTaxsyntenyvibrioallstrainsinsynttax.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5220433/v1/57b32feb559b248e89335565.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The carRS-ompV-virK operon of Vibrio cholerae senses antimicrobial peptides and activates the expression of multiple resistance systems","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAntimicrobial peptides (AMPs) are cationic molecules of low molecular weight with activity against bacteria, viruses, and fungi \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. They are produced by eukaryotes for immune regulation and to maintain the homeostasis of the microbiota, and by bacteria for competition for environmental niches \u003csup\u003e\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. The ionic interaction of cationic AMPs with the negatively charged bacterial membrane leads to pore formation, leaking of intracellular content, and eventually death \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. AMPs can also have many intracellular targets. Polymyxin B (PmB) is a non-ribosomal cyclic antimicrobial peptide produced by \u003cem\u003ePaenibacillus polymyxa\u003c/em\u003e that is used as a last resort treatment for multidrug resistant Gram-negative bacterial infections \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Polymyxins are poorly absorbed during treatment and can thus be excreted and accumulate in the environment, which could lead to the development of resistance \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eVibrio cholerae\u003c/em\u003e is a Gram-negative bacterium that resides in aquatic environments \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. It is responsible for the disease cholera, caused by consumption of contaminated water or food. \u003cem\u003eV. cholerae\u003c/em\u003e is divided into 200 serogroups, of which only O1 and O139 cause cholera \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The O1 serogroup is further divided into 2 biotypes, Classical, responsible for the first six cholera pandemics, and El Tor, which is responsible for the 7th ongoing pandemic \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The α-helical cathelicidin LL-37 and several α and β-defensins are produced by intestinal cells in response to \u003cem\u003eV. cholerae\u003c/em\u003e infection \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Unlike the Classical strains, El Tor strains can resist PmB by decreasing the negative charge of their outer membrane through \u003cem\u003ealmEFG\u003c/em\u003e, thus reducing interactions with cationic AMPs. AlmG is a glycyl transferase responsible for aminoacylation of the lipopolysaccharide (LPS) and represents the main mechanism of resistance to PmB in those strains \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The expression of \u003cem\u003ealmG\u003c/em\u003e in response to PmB is regulated by the two-component system CarRS, also called VprAB, in which CarS/VprB is the sensor histidine kinase activated by periplasmic AMPs and CarR/VprA is the response regulator \u003csup\u003e\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Other mechanisms, such as efflux pumps, also contribute to AMP resistance in \u003cem\u003eV. cholerae\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. The efflux pumps belonging to the resistance-nodulation-division (RND) transporter family are tripartite drug-ion antiporters spanning both the inner and outer membranes, facilitating the transport of substrates from the cytoplasmic membrane or periplasm to the extracellular milieu \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Six RND transporters are encoded in \u003cem\u003eV. cholerae\u003c/em\u003e with different substrate specificity \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, of which VexAB is associated with resistance to detergents and antimicrobials such as PmB \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, a transcriptomic analysis of \u003cem\u003eV. cholerae\u003c/em\u003e grown in the presence of a subinhibitory concentration of PmB showed that the expression of the uncharacterized outer-membrane protein OmpV is increased by PmB. OmpV is a protein of 28 kDa, which matures into a 26 kDa protein after the removal of a 19 AA signal sequence \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Based on its sequence, OmpV was proposed to share properties with porins \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Depending on the culture conditions, OmpV can be the most abundant protein in the outer membrane \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Although very little is known about the function of OmpV, a role in pathogenesis has been suggested and antibodies against it can be found in convalescent human sera \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. OmpV is upregulated in \u003cem\u003eV. parahaemolyticus\u003c/em\u003e in the presence of PmB and in \u003cem\u003eV. cholerae\u003c/em\u003e in response to human α-defensin 5, while it has a role in osmoregulation in other \u003cem\u003eVibrio\u003c/em\u003e species \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. However, its role in resistance to AMPs in \u003cem\u003eV. cholerae\u003c/em\u003e is yet to be described.\u003c/p\u003e \u003cp\u003eWe showed that \u003cem\u003ecarRS\u003c/em\u003e (\u003cem\u003evprAB\u003c/em\u003e), \u003cem\u003eompV\u003c/em\u003e, and \u003cem\u003evirK\u003c/em\u003e are organized as a conserved operon in \u003cem\u003eV. cholerae\u003c/em\u003e, and that its expression is modulated by PmB. VC1317 (VirK) is a 35.9 kDa protein belonging to the VirK/YbjX family, with an as-yet-unknown function in \u003cem\u003eV. cholerae\u003c/em\u003e. The VirK protein was first identified in \u003cem\u003eShigella flexneri\u003c/em\u003e as a critical factor for efficient intercellular dissemination\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. In other bacteria, such as \u003cem\u003eSalmonella enterica\u003c/em\u003e and \u003cem\u003eCampylobacter jejuni\u003c/em\u003e, VirK has been shown to play a role in virulence and resistance to AMPs \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe deletion of \u003cem\u003eompV\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e led to a higher sensitivity to AMPs, suggesting a role for OmpV and VirK in AMP resistance. The deletion of \u003cem\u003eompV\u003c/em\u003e does not lead to membrane destabilization or a reduced sequestration by membrane vesicles. Our results showed that PmB leads to the expression of the RND multi-drug efflux system \u003cem\u003evexAB\u003c/em\u003e in an \u003cem\u003eompV\u003c/em\u003e-dependent manner. Structural predictions suggest that OmpV is a β-barrel with an unusual membrane-accessible lateral opening that provides entry into a highly electronegative barrel lumen, which could accommodate PmB, as determined by docking simulations. This interaction could induce an OmpV conformational change, leading to an intracellular signal event inducing the expression of \u003cem\u003evexAB\u003c/em\u003e. We identify OmpV as a new effector for AMP resistance, and the \u003cem\u003ecarRS-ompV-virK\u003c/em\u003e operon represents the first specialized locus, aside from two-component systems, that activates multiple systems for antimicrobial resistance in \u003cem\u003eV. cholerae\u003c/em\u003e.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eA transcriptomic analysis reveals that\u003c/b\u003e \u003cb\u003eompV\u003c/b\u003e \u003cb\u003eis upregulated in the presence of PmB\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo identify new effectors of PmB resistance in \u003cem\u003eV. cholerae\u003c/em\u003e, a global transcriptomic analysis of the A1552 El Tor strain grown with and without PmB was performed. Cells were grown in the presence or absence of subinhibitory concentrations of PmB. RNA was isolated, then reverse transcribed, and the cDNA was sequenced. Data were analysed for differential expression using the variance analysis package DESeq2. An average number of 70,010,813 reads were identified per sample with an average of 30,597,139 reads being assigned to a gene, and a Q20\u0026thinsp;\u0026gt;\u0026thinsp;6.6 representing a base calling accuracy of \u0026gt;\u0026thinsp;98% (see Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). A total of 3715 genes were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Genes with a p-adj\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered as significantly modulated by the presence of PmB (colored dots in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and are listed in Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. Of the 280 modulated genes, 211 and 69 had a significantly increased or decreased abundance of transcripts in the presence of PmB, respectively (see Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After the removal of pseudogenes, the identified genes (n\u0026thinsp;=\u0026thinsp;262) with differential expression were submitted for an analysis of network clusters enrichment using STRING (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Several clusters were significantly enriched (False Discovery Rate\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the presence of PmB, including 14 genes out of 57 (KEGG pathway: map01503) involved in cationic AMP resistance (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table S3) \u003csup\u003e\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003ealmEFG\u003c/em\u003e lipid A modification system operon was upregulated in the presence of PmB, as well as the two-component system activating this LPS modification system, \u003cem\u003ecarRS\u003c/em\u003e (\u003cem\u003evprAB\u003c/em\u003e), and the RND-transporter \u003cem\u003evexAB\u003c/em\u003e (see Supplementary Tables S1 and S3). The two-component system response regulator VxrB, which contributes to biofilm formation and upregulates the type VI secretion system in response to PmB, also exhibited elevated expression in the presence of PmB \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e (see Supplementary Table S3). Genes from the type II secretion system cluster, the iron-sulfur binding cluster, multi-drug efflux complex clusters, and the Von Willebrand factor A-like domain superfamily cluster were also significatively enriched (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Amongst the genes that were upregulated in the presence of PmB (see Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), \u003cem\u003eompV\u003c/em\u003e stood out because we previously demonstrated that it is also more abundant in the membrane vesicles (MVs) isolated from \u003cem\u003eV. cholerae\u003c/em\u003e grown in the presence of PmB and the human cathelicidin LL-37 \u003csup\u003e36\u003c/sup\u003e. Quantitative RT-PCR confirmed that the expression of \u003cem\u003eompV\u003c/em\u003e was increased in the presence of PmB by 2.92-fold (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Since expression and abundance is elevated in the presence of AMPs, we wondered if \u003cem\u003eompV\u003c/em\u003e could be implicated in AMP resistance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe loss of\u003c/b\u003e \u003cb\u003eompV\u003c/b\u003e \u003cb\u003eincreases\u003c/b\u003e \u003cb\u003eV. cholerae\u003c/b\u003e\u003cb\u003e\u0026rsquo;s susceptibility to antimicrobials\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo determine whether the uncharacterized protein OmpV plays a role in resistance to AMPs, an \u003cem\u003eompV\u003c/em\u003e isogenic deletion mutant was used (A1552D\u003cem\u003eompV\u003c/em\u003e). The deletion of \u003cem\u003eompV\u003c/em\u003e did not interfere with bacterial growth, as we observed no growth difference between the strains (Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The susceptibility of A1552D\u003cem\u003eompV\u003c/em\u003e and A1552 to AMPs was compared by determination of their minimal inhibitory concentrations (MICs) to PmB and LL-37 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u0026amp; Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). For A1552, the MICs of PmB and LL-37 were 200 \u0026micro;g/ml. The deletion of \u003cem\u003eompV\u003c/em\u003e increased the susceptibility to both AMPs, with a MIC of 100 \u0026micro;g/ml and 12 \u0026micro;g/ml for PmB and LL-37, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u0026amp; Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMinimal inhibitory concentrations (MICs) of polymyxin B and LL-37\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eMIC (\u0026micro;g/ml)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePolymyxin B\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eLL-37\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552 pBAD24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552 pBAD24-\u003cem\u003eompV\u003c/em\u003e-153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003e pBAD24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003e pBAD24-\u003cem\u003eompV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003e pBAD24-\u003cem\u003eompV\u003c/em\u003e-153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003evirK\u003c/em\u003e pBAD24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003evirK\u003c/em\u003e pBAD24-\u003cem\u003evirK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e pBAD24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e pBAD24-\u003cem\u003evirK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e pBAD24-\u003cem\u003eompV\u003c/em\u003e-153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e pBAD24-\u003cem\u003eompV\u003c/em\u003e-153\u003cem\u003e-virK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIn the presence of 25 to 100 \u0026micro;g/ml of PmB, a premature decline in OD\u003csub\u003e600nm\u003c/sub\u003e was observed for all the strains (Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The stationary phase is typically a balance between cell death and division, during which a general stress response is observed \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. It is possible that the addition of PmB could accelerate cell lysis, as cationic AMPs, unlike most conventional antibiotics, are active against non-dividing bacteria \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eComplementation of the \u003cem\u003eompV\u003c/em\u003e deletion was first carried out using the pBAD24 vector containing the complete annotated \u003cem\u003eompV\u003c/em\u003e (pBAD24-\u003cem\u003eompV\u003c/em\u003e). However, the MICs (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were not restored to the wild-type level. Since the presence of OmpV was first observed in the isolated MVs of A1552 grown with PmB \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, the presence of OmpV in the MVs of A1552 pBAD24, A1552Δ\u003cem\u003eompV\u003c/em\u003e pBAD24 and A1552Δ\u003cem\u003eompV\u003c/em\u003e pBAD24-\u003cem\u003eompV\u003c/em\u003e grown with PmB was assessed to confirm complementation (see Supplementary Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). MV crude extracts in denaturing buffer were migrated on SDS-PAGE gels, which were further stained with Coomassie blue (see Supplementary Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). The band corresponding to OmpV is clearly visible in the MVs from A1552 pBAD24 and, as expected, is absent in A1552Δ\u003cem\u003eompV\u003c/em\u003e pBAD24. However, it was not restored by the pBAD24-\u003cem\u003eompV\u003c/em\u003e construct (see Supplementary Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). To investigate potential pBAD24-linked expression issues, the native regulatory region of \u003cem\u003eompV\u003c/em\u003e (153 nucleotides upstream of the \u003cem\u003eompV\u003c/em\u003e start site) in addition to the entire \u003cem\u003eompV\u003c/em\u003e open reading frame (ORF) was cloned into pBAD24 (pBAD24-\u003cem\u003eompV\u003c/em\u003e-153). Using this construct, a band corresponding to OmpV was observed in MV preparations (see Supplementary Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e), suggesting that the native regulatory context of \u003cem\u003eompV\u003c/em\u003e is important for its expression, as has been observed previously \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Furthermore, the complementation with pBAD24-\u003cem\u003eompV\u003c/em\u003e-153 not only restored the MIC to wild-type levels, but further elevated it for PmB to 250 \u0026micro;g/ml (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Similarly, overexpression of \u003cem\u003eompV\u003c/em\u003e in A1552 also resulted in resistance to much higher PmB concentrations, with growth at every tested concentration (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The survival of each strain to a 30 min shock with 500 \u0026micro;g/ml PmB was also assessed and showed that the wild-type strain is nearly 2 times more tolerant to this exposure than A1552Δ\u003cem\u003eompV\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). Altogether, these results suggest that \u003cem\u003eompV\u003c/em\u003e is involved in AMP resistance in \u003cem\u003eV. cholerae\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eThe integrity of the membrane is not altered by the loss of OmpV\u003c/h2\u003e \u003cp\u003eThe integrity of the membrane might be impaired by the loss of \u003cem\u003eompV\u003c/em\u003e, one of the most abundant proteins in the outer membrane \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. To determine if the susceptibility of A1552Δ\u003cem\u003eompV\u003c/em\u003e to AMPs is due to the destabilisation of the outer membrane, a fluorescent assay was used. \u003cem\u003eN\u003c/em\u003e-phenyl-1-napthylamine (NPN) is a small molecule that cannot cross the intact outer membrane, but, upon membrane damage, binds to phospholipids and emits fluorescence \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Propidium iodide (PI) fluoresces once bound to the DNA of bacteria with envelope damage induced by PmB. A1552 and A1552Δ\u003cem\u003eompV\u003c/em\u003e were grown to midlog phase, washed, and permeabilized with increasing concentrations of PmB, up to 50 \u0026micro;g/ml. The bacteria were then labelled with NPN and PI. The relative fluorescence was quantified in comparison to the non-treated wild-type strain in a SpectraMax iD3 plate reader (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The fluorescence for NPN increased with PmB concentration, with a maximum fluorescence at 50 \u0026micro;g/ml of PmB for both tested strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). For PI, the fluorescence was similar at 0, 3, 10 and 25 \u0026micro;g/ml PmB, but was significantly increased for A1552 at 50 \u0026micro;g/ml in comparison to the non-treated bacteria (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). This is in agreement with our previous study that showed that PmB treatment does not lead to inner membrane permeabilization, up to 50 \u0026micro;g/ml \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. For both markers, the fluorescence was similar between the strains for a given PmB concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These results suggest that PmB produces pores in the membrane similarly for both strains and that the loss of \u003cem\u003eompV\u003c/em\u003e has no impact on the integrity of the membrane. Thus, the sensitivity of A1552Δ\u003cem\u003eompV\u003c/em\u003e to PmB is not due to permeabilization of the outer membrane.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eThe role of OmpV in antimicrobial resistance is not linked to MVs\u003c/h3\u003e\n\u003cp\u003eWhen \u003cem\u003eV. cholerae\u003c/em\u003e is grown with AMPs, the protein content of MVs is modified and greatly enriched in OmpV \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. MVs contribute to antimicrobial resistance by titration and degradation of antimicrobial peptides in the environment \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. We hypothesized that the presence of OmpV in MVs could enhance the titration of antimicrobial peptides, thereby increasing bacterial resistance. If more or bigger MVs were produced in A1552 in comparison to A1552Δ\u003cem\u003eompV\u003c/em\u003e, or if the presence of OmpV modified the affinity of the MVs for PmB, then the protection conferred by the MVs of A1552Δ\u003cem\u003eompV\u003c/em\u003e would differ from the MVs of A1552. To assess MV production, the isolated MVs from A1552 and A1552Δ\u003cem\u003eompV\u003c/em\u003e were quantified using a Bradford assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ea) and FM4-64 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eb), as described previously \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Both strains produced a similar MV quantity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ea,b), since no significant differences in protein and lipid quantification were observed. The MVs were observed using atomic force microscopy (AFM) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ec), which showed that they were similar in size (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ed) and concentration, and of comparable purity. This suggests that the sensitivity to PmB upon \u003cem\u003eompV\u003c/em\u003e mutation is not due to a decreased MV production.\u003c/p\u003e \u003cp\u003eTo determine if the affinity of the MVs for antimicrobial peptides is altered upon \u003cem\u003eompV\u003c/em\u003e deletion, the effect of the addition of isolated MVs on bacterial survival after a short incubation with 500 \u0026micro;g/ml PmB was then assessed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ef,g). The surviving bacteria were counted on agar plates. As expected, without MVs, the wild-type strain is more tolerant than A1552Δ\u003cem\u003eompV\u003c/em\u003e, as more bacteria were retrieved after the incubation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). When MVs from the different strains were added, there was no significant effect on bacterial survival for both strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ef,g), even though there was a slight increase in survival, suggesting that the presence of OmpV has no or low impact on the capture of PmB by the MVs.\u003c/p\u003e \u003cp\u003e \u003cb\u003eompV\u003c/b\u003e \u003cb\u003eis co-transcribed with the two-component system\u003c/b\u003e \u003cb\u003ecarRS\u003c/b\u003e \u003cb\u003e(\u003c/b\u003e\u003cb\u003evprAB\u003c/b\u003e\u003cb\u003e) and\u003c/b\u003e \u003cb\u003evirK\u003c/b\u003e, \u003cb\u003eand the whole operon is upregulated by PmB\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWhile looking at the genomic context of \u003cem\u003eompV\u003c/em\u003e, we noticed that it is located on the minus strand of the large chromosome, clustered with 3 other genes, \u003cem\u003ecarR\u003c/em\u003e (\u003cem\u003evprA\u003c/em\u003e), \u003cem\u003ecarS\u003c/em\u003e (\u003cem\u003evprB\u003c/em\u003e), and \u003cem\u003evirK.\u003c/em\u003e In \u003cem\u003eV. cholerae\u003c/em\u003e, VirK is an uncharacterized protein, while the two component-system CarRS is responsible for the activation of the LPS modification system \u003cem\u003ealm\u003c/em\u003e in the presence of PmB \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. The organization of the cluster is highly conserved among \u003cem\u003eV. cholerae\u003c/em\u003e O1 pre-pandemic, El Tor, and Classical strains, O139 strains, non-O1/non-O139 strains, and some other \u003cem\u003eVibrio\u003c/em\u003e species, as determined with PATRIC (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.patricbrc.org\u003c/span\u003e\u003cspan address=\"https://www.patricbrc.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e (see Supplementary Figure S3). A synteny analysis of the 161 available genomes of \u003cem\u003eV. cholerae\u003c/em\u003e using SyntTax \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e showed that only 2 strains did not have this cluster arrangement (See supplementary file). Although it was found in \u003cem\u003eV. mimicus\u003c/em\u003e and \u003cem\u003eV. paracholerae\u003c/em\u003e, this synteny was not found in \u003cem\u003eV. parahaemolyticus\u003c/em\u003e, \u003cem\u003eV. vulnificus\u003c/em\u003e and \u003cem\u003eV. alginolyticus\u003c/em\u003e. To verify if the genes are co-transcribed as an operon on the same mRNA, the intergenic regions between \u003cem\u003ecarS\u003c/em\u003e and \u003cem\u003eompV\u003c/em\u003e, and between \u003cem\u003eompV\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e, were amplified by PCR from the cDNA of A1552 using primers inside of the ORF (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Bands corresponding to the expected length were visible on agarose gel, indicating that \u003cem\u003ecarS\u003c/em\u003e, \u003cem\u003eompV\u003c/em\u003e, and \u003cem\u003evirK\u003c/em\u003e are transcribed on the same mRNA and that they are organized as an operon. The amplification of an intergenic region outside of an operon on genomic DNA, but not on cDNA, confirmed the absence of genomic DNA in the samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). The expression of the genes of the \u003cem\u003ecarRS-ompV-virK\u003c/em\u003e cluster in the presence of PmB was then measured by RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). The expression of \u003cem\u003eompV\u003c/em\u003e in A1552 grown in the presence of PmB was 2.787 times higher than in the non-treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). The expression of \u003cem\u003ecarS\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e was 2.788 and 2.265 times higher in the presence of PmB than in the non-treated cells, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). These results suggest that \u003cem\u003ecarRS\u003c/em\u003e, \u003cem\u003eompV\u003c/em\u003e, and \u003cem\u003evirK\u003c/em\u003e are organized as an operon, and that their transcription is increased by PmB exposure.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe role of \u003cem\u003ecarRS\u003c/em\u003e (\u003cem\u003evprAB\u003c/em\u003e) in resistance is already known \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e and we have demonstrated here that \u003cem\u003eompV\u003c/em\u003e plays a role in antimicrobial resistance. To determine if \u003cem\u003evirK\u003c/em\u003e is also implicated in AMP resistance, a knock-out mutant (A1552D\u003cem\u003evirK\u003c/em\u003e) and a complemented strain (A1552Δ\u003cem\u003evirK\u003c/em\u003e pBAD24-\u003cem\u003evirK\u003c/em\u003e) were constructed. Their MIC to AMPs was determined, which showed that A1552Δ\u003cem\u003evirK\u003c/em\u003e was more sensitive to LL-37, and that complementation partially restored the phenotype (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Although the MICs for PmB were similar for the wild-type strain and A1552Δ\u003cem\u003evirK\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) the growth of A1552Δ\u003cem\u003evirK\u003c/em\u003e with 100 \u0026micro;g/mL of PmB clearly showed a defect in comparison to A1552 (see Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). These results indicate that A1552Δ\u003cem\u003evirK\u003c/em\u003e is also more sensitive to AMPs. To determine if there is an additive effect of \u003cem\u003eompV\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e deletion on antimicrobial resistance, a A1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e double mutant and a complemented strain (A1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e pBAD24\u003cem\u003e-ompV-virK\u003c/em\u003e) were constructed. The MICs of PmB and LL-37 of the double mutant were similar to that of A1552Δ\u003cem\u003eompV\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), which were lower than those of A1552Δ\u003cem\u003evirK\u003c/em\u003e. A single \u003cem\u003eompV\u003c/em\u003e or a double \u003cem\u003eompV-virK\u003c/em\u003e complementation, but not a single \u003cem\u003evirK\u003c/em\u003e complementation, led to a total restoration of the MIC in A1552Δ\u003cem\u003eompV\u003c/em\u003eΔ\u003cem\u003evirK\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These results suggest that there is no additive effect of the double mutation on the sensitivity of the strains to AMPs.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe deletion of\u003c/b\u003e \u003cb\u003eompV\u003c/b\u003e \u003cb\u003emodified the expression of the antimicrobial resistance related gene\u003c/b\u003e \u003cb\u003evexB\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePrevious studies have demonstrated that outer membrane proteins, such as OmpU in \u003cem\u003eV. cholerae\u003c/em\u003e, can sense and signal for the presence of AMPs \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. This ability allows the bacteria to trigger resistance mechanisms by modifying the LPS and its electrostatic affinity for cationic molecules \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. OmpV may play a similar sensing role for AMPs. In the transcriptomic analysis, we observed that several known resistance effectors of \u003cem\u003eV. cholerae\u003c/em\u003e were upregulated in the presence of PmB (see Supplementary Tables S1 and S3). They include the two-component system \u003cem\u003ecarRS\u003c/em\u003e (\u003cem\u003evprAB\u003c/em\u003e) responsible for activating transcription of the \u003cem\u003ealm\u003c/em\u003e operon \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, the glycyltransferase \u003cem\u003ealmG\u003c/em\u003e that modifies lipid A \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e, the RND efflux pump \u003cem\u003evexAB\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, and the alternative sigma factor \u003cem\u003erpoE\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e (see Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). To determine if OmpV is involved in the regulation of these effectors, a quantitative RT-PCR analysis was conducted in the absence and presence of PmB in both A1552 and A1552D\u003cem\u003eompV\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). As expected, a strong and significant upregulation of \u003cem\u003ealmG\u003c/em\u003e, \u003cem\u003ecarS\u003c/em\u003e, \u003cem\u003erpoE\u003c/em\u003e, and \u003cem\u003evexB\u003c/em\u003e in the presence of PmB in A1552 was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). While \u003cem\u003ecarS\u003c/em\u003e expression was increased in the presence of PmB in the A1552Δ\u003cem\u003eompV\u003c/em\u003e strain, its upregulation was lower than in A1552 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea). This suggests that \u003cem\u003ecarRS\u003c/em\u003e over-expression in the presence of PmB is partly dependent on \u003cem\u003eompV\u003c/em\u003e, although it had no effect on the expression of \u003cem\u003ealmG\u003c/em\u003e, part of the CarR regulon (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb). The expression of \u003cem\u003evexB\u003c/em\u003e was not increased by the presence of PmB in A1552Δ\u003cem\u003eompV\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed). This suggests that the upregulation of the efflux-pump \u003cem\u003evexAB\u003c/em\u003e depends on the presence of \u003cem\u003eompV\u003c/em\u003e, and that the increased sensitivity of the A1552Δ\u003cem\u003eompV\u003c/em\u003e strain could be due to the lack of \u003cem\u003evexAB\u003c/em\u003e upregulation. Taken together, these results suggest a role for OmpV in the transcriptional regulation of PmB resistance genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eOmpV has a membrane-accessible lateral opening into an electronegative pocket in the β-barrel lumen\u003c/h3\u003e\n\u003cp\u003eTo gain further insight into how OmpV may function in the process of AMP resistance, we predicted the structure of OmpV, without its predicted signal sequence (residues 1\u0026ndash;19) using Alphafold2 as implemented within ColabFold \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. This suggested that OmpV adopts a 12-stranded β-barrel fold (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea and Supplementary Figure S4). However, β-strands five and six, which form part of the lateral wall of the barrel, do not fully span the membrane-embedded region of the protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). These short β-strands leave a gap in the barrel wall that provides lateral access to the β-barrel lumen of OmpV (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea,b). Submission of the predicted structure of OmpV to the Foldseek \u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e and DALI \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e servers suggested that there are no experimentally determined structures of β-barrels in the Protein Data Bank with a similar lateral opening. However, this feature is observed in the predicted structure of MipA from \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e, which is a structural ortholog of OmpV (See Supplementary Figure S4b).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe opening in the lateral wall of the OmpV barrel leads to a pocket in the lumen that is isolated from both the extracellular and periplasmic spaces due to the presence of several extracellular loops and a periplasmic plug region, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea,c). This pocket is highly electronegative (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb) and has a volume of 1623 \u0026Aring;\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e as determined by CASTpFold \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ec), therefore it could accommodate cationic AMPs such as PmB, which has an approximate volume of 1047 \u0026Aring;\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e based on its structure in complex with human lysine-specific demethylase 1 (PDB 5L3F). Indeed, docking of PmB into the electronegative barrel lumen of OmpV using Autodock Vina \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e produced a top pose with an affinity of -8.936 kcal/mol (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ed and see Supplementary Figure S5a). Furthermore, \u003cem\u003ede novo\u003c/em\u003e prediction of the OmpV structure in complex with PmB using Boltz-1 \u003csup\u003e55\u003c/sup\u003e yielded confident models with PmB located within the OmpV barrel lumen (See Supplementary Figure S5b), comparable to the docking results. Such an interaction could induce conformational changes in OmpV that serve as a signal to initiate cellular processes that protect against cationic AMPs. These observations are similar to what was recently reported for \u003cem\u003eP. aeruginosa\u003c/em\u003e MipA, which is thought to function as an outer membrane PmB sensor \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we identified the outer-membrane protein OmpV as a new effector of antimicrobial resistance in \u003cem\u003eV. cholerae\u003c/em\u003e by coupling transcriptomic analyses of knockout mutants with AMP susceptibility assays. We showed that \u003cem\u003eompV\u003c/em\u003e is part of a specialized 4-gene operon that activates multiple resistance factors in response to PmB, \u003cem\u003ei.e\u003c/em\u003e. the LPS modification system \u003cem\u003ealmEFG\u003c/em\u003e and the efflux pump \u003cem\u003evexAB\u003c/em\u003e. A structural analysis also determined that OmpV could act as a sensor for PmB in the outer membrane. This operon is widespread in \u003cem\u003eV. cholerae\u003c/em\u003e, suggesting that this may represent a generalizable strategy for AMP resistance in this species.\u003c/p\u003e \u003cp\u003eEven at a concentration well below the MIC, PmB significantly impacted the transcriptome of \u003cem\u003eV. cholerae\u003c/em\u003e, with more than 280 genes whose expression was significantly modulated by the presence of PmB. The PmB concentration used (3 \u0026micro;g/ml) is below that required for pore formation and is 1.5% of the MIC \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In our previous proteomic analyses, a similar number of proteins (n\u0026thinsp;=\u0026thinsp;241) with a modified abundance in the presence of this PmB concentration were identified \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. This included many genes involved in antimicrobial resistance, such as the main locus responsible for resistance in El Tor strains, \u003cem\u003ealmEFG\u003c/em\u003e, in addition to \u003cem\u003evxrB, carS\u003c/em\u003e (\u003cem\u003evprB\u003c/em\u003e), \u003cem\u003evexAB\u003c/em\u003e, and the σ\u003csup\u003eE\u003c/sup\u003e regulatory protein RseB \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Both analyses also identified that the type II and VI secretion systems were upregulated in the presence of PmB, as well as components of the flagellum. Many RND-transporters and efflux systems were upregulated in the presence of PmB, as would be expected since RND-transporters are responsible for basal resistance to antibiotics and antimicrobials, and because they are regulated by the presence of their substrates \u003csup\u003e\u003cspan additionalcitationids=\"CR58\" citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e. Other transcriptomic analyses of \u003cem\u003eV. cholerae\u003c/em\u003e El Tor strains C6706 and El2382 grown in the presence of AMPs have been performed \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. In those analyses, components from the \u003cem\u003ealm\u003c/em\u003e operon were also upregulated, as well as \u003cem\u003ecarRS\u003c/em\u003e (\u003cem\u003evprAB\u003c/em\u003e), transporters, and efflux systems. Interestingly, the studies in strains C6706 and El2382 showed that \u003cem\u003eompV\u003c/em\u003e was upregulated in the presence of AMPs \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e, but without attributing a role for it in antimicrobial resistance. The fact that \u003cem\u003eompV\u003c/em\u003e is highly expressed and abundant in \u003cem\u003eV. cholerae\u003c/em\u003e in the presence of multiple AMPs from different families caught our attention and made us wonder about its role in antimicrobial resistance.\u003c/p\u003e \u003cp\u003eOmpV is a major protein of the outer membrane of \u003cem\u003eV. cholerae\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. OmpV plays a role in adhesion and invasion of enteric epithelial cells in \u003cem\u003eSalmonella\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e,\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e, and is an osmotic stress responsive protein in the marine bacteria \u003cem\u003ePhotobacterium damselae\u003c/em\u003e, \u003cem\u003eV. alginolyticus\u003c/em\u003e, and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e \u003csup\u003e\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e. In those \u003cem\u003eVibrio\u003c/em\u003e species, \u003cem\u003eompV\u003c/em\u003e has a different genomic context, and is not clustered with \u003cem\u003ecarRS\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e. OmpV is annotated as a protein of the MltA-interacting protein (MipA) family \u003csup\u003e\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e, which is implicated in antimicrobial resistance in \u003cem\u003eE. coli\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e and in \u003cem\u003eP. aeruginosa\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Although a role for OmpV in pathogenesis has been suggested in \u003cem\u003eV. cholerae\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, its function has not been identified so far in this bacterium. We previously showed that OmpV is found in abundance in MVs of \u003cem\u003eV. cholerae\u003c/em\u003e A1552 grown with AMPs \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Here, a transcriptomic analysis and quantitative RT-PCR confirmed that \u003cem\u003eompV\u003c/em\u003e is indeed upregulated in the presence of PmB. MIC values and relative survival to a short incubation time with a high PmB concentration showed an increased sensitivity to AMPs upon \u003cem\u003eompV\u003c/em\u003e mutation, demonstrating a role for OmpV in resistance to antimicrobials.\u003c/p\u003e \u003cp\u003eThe deletion of OmpV did not affect MV production, suggesting that it does not play a role in this process. The MV protection assay suggests that OmpV has little to no impact on the capture of PmB by the MVs. The release of MVs by bacteria protects them from antimicrobials by acting as a decoy to capture and prevent AMP binding to the bacterial envelope \u003csup\u003e\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e,\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e. It is possible that the high-affinity binding of PmB to LPS\u003csup\u003e\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e, which covers the entire MV, masks any OmpV-dependent effect. Moreover, OmpV is more abundant in MVs isolated from A1552 grown with PmB \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. However, to avoid cumulative effects, the MVs used in our assay were prepared from overnight cultures without PmB, likely resulting in a low abundance of OmpV on their surface.\u003c/p\u003e \u003cp\u003eThe genomic context of \u003cem\u003eompV\u003c/em\u003e in \u003cem\u003eV. cholerae\u003c/em\u003e showed that it is part of a four-genes cluster (\u003cem\u003ecarR-carS-ompV-virK\u003c/em\u003e) on the large chromosome, and that the synteny of this cluster is conserved amongst some \u003cem\u003eVibrio\u003c/em\u003e. We demonstrated that these genes were transcribed as an operon, and that the whole operon is upregulated by the presence of PmB. It has previously been demonstrated that the expression of \u003cem\u003eompV\u003c/em\u003e and \u003cem\u003ecarS\u003c/em\u003e increased in the presence of human α-defensin 5 \u003csup\u003e15\u003c/sup\u003e and PmB \u003csup\u003e\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. CarRS (VprAB) is a two-component system in which CarS is a sensor histidine kinase, sensing AMPs in the periplasm, and CarR is the response regulator that activates the \u003cem\u003ealmEFG\u003c/em\u003e mediated LPS modification system in the presence of PmB to decrease its interaction with the membrane \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. In this study, we showed that OmpV and VirK are also implicated in antimicrobial resistance.\u003c/p\u003e \u003cp\u003eOur RT-qPCR analysis of known PmB-resistance factors demonstrated that \u003cem\u003eompV\u003c/em\u003e is important for the upregulation of the RND-transporter \u003cem\u003evexAB\u003c/em\u003e in the presence of PmB. There are six RND-transporter systems encoded in the \u003cem\u003eV. cholerae\u003c/em\u003e genome that work synergically to provide resistance to various toxic substrates such as bile, detergents, and antimicrobials \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e,\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e. All of them form a complex with the outer-membrane pore protein TolC to span both the inner and outer-membrane \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u003c/sup\u003e. A knock-out mutant of all the RND systems led to a reduction in cholera toxin and toxin-coregulated pilus production, and was attenuated in an infant-mouse model of infection \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e. The VexAB RND-system (VC_0164, VC_0165), in which VexA is the membrane fusion component and VexB is the RND pump-protein, is regulated by bile acids and is induced during mammalian intestinal colonisation \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u003c/sup\u003e. This system is very similar to AcrAB-TolC of \u003cem\u003eE. coli\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e\u003c/sup\u003e. Together with VexCD, VexAB contributes to bile resistance, while the deletion of \u003cem\u003evexB\u003c/em\u003e alone leads to a higher susceptibility to SDS, Triton X-100, erythromycin, novobiocin, and PmB, but not to other antibiotics such as β-lactams, aminoglycosides, fluoroquinolones, and tetracyclines, amongst others \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. VexAB requires the \u003cem\u003etetR\u003c/em\u003e-family transcriptional regulator \u003cem\u003evexR\u003c/em\u003e, which is located upstream of \u003cem\u003evexAB\u003c/em\u003e in the same operon, for activation upon substrate exposure \u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003evexR\u003c/em\u003e was upregulated 1.28-times in the presence of PmB in our transcriptomic analysis, although this was not significant (p-adj\u0026thinsp;=\u0026thinsp;0.1145).\u003c/p\u003e \u003cp\u003eThere are five TolC homologues in \u003cem\u003eV. cholerae\u003c/em\u003e\u0026rsquo;s genome (VC_1409, VC_1565, VC_1606, VC_1621, VC_2436), with VC_2436 exhibiting the highest similarity to \u003cem\u003eE. coli\u003c/em\u003e TolC \u003csup\u003e\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eIn vitro\u003c/em\u003e, only the deletion of VC_2436 affected antimicrobial resistance, including to PmB, which was similar to a mutant in which the six RND-systems were deleted. Therefore, VC_2436 is likely to be the outer-membrane pore used by RND-transporters in \u003cem\u003eV. cholerae\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e,\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e\u003c/sup\u003e. In our transcriptomic analysis, \u003cem\u003etolC\u003c/em\u003e (VC_2436) was not upregulated by the presence of PmB. However, because the inner membrane components of RND-systems are generally regulated by their efflux substrate concentrations, the expression of \u003cem\u003evexB\u003c/em\u003e, but not of \u003cem\u003etolC\u003c/em\u003e, was increased by the presence of PmB, which could explain why the expression of \u003cem\u003etolC\u003c/em\u003e was not modified by PmB in our analysis \u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e,\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e\u003c/sup\u003e. Although VC_1565 was upregulated by PmB in C6706 and in our analysis, VC_2436 was not upregulated either in the presence of AMPs in EL2382 and C6706 in the transcriptomic analyses \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e, suggesting that \u003cem\u003etolC\u003c/em\u003e might be regulated differently than the inner components of the RND systems.\u003c/p\u003e \u003cp\u003eSince the modulation of \u003cem\u003evexAB\u003c/em\u003e upon PmB stimulation is \u003cem\u003eompV\u003c/em\u003e-dependent and OmpV is an outer membrane protein, we wondered how this response could occur. Previous studies have shown that some outer-membrane proteins can sense extracellular signals and induce bacterial adaptation to stresses \u003cem\u003evia\u003c/em\u003e gene regulation. One example of this is OmpA which is involved in the activation of the Cpx envelope-stress response pathway in conjunction with the outer membrane lipoprotein NlpE. OmpA-NlpE stimulates the CpxAR two-component system trough an unknown mechanism to activate the expression of genes involved in the envelope-stress response \u003csup\u003e\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eV. cholerae\u003c/em\u003e, previous studies have demonstrated a similar sensor role for OmpU\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u003c/sup\u003e. OmpU signaling is dependent on the action of the envelope-stress response mediated by the alternative σ\u003csup\u003eE\u003c/sup\u003e factor (RpoE) and the proteases DegS, RseA, and RseP \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e\u003c/sup\u003e. In the absence of stress conditions, σ\u003csup\u003eE\u003c/sup\u003e is segregated at the inner membrane by the anti-sigma factor RseA, preventing its activity on RNA-polymerase \u003csup\u003e\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e\u003c/sup\u003e. The accumulation of misfolded OmpU containing the C-terminal YxF motif leads to the activation of DegS \u003csup\u003e\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e,\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e\u003c/sup\u003e. The activated DegS cleaves RseA, which is further cleaved by RseP located in the inner membrane, leading to the release of σ\u003csup\u003eE\u003c/sup\u003e and to the transcription of the envelope-stress response genes \u003csup\u003e\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e,\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e. In the presence of AMPs, the disruption of the outer membrane could block the insertion of OmpU in the membrane, leading to the accumulation of mislocalized OmpU in the periplasm, or the binding of AMPs to OmpU could induce a conformational change, promoting exposure of the YxF motif, thus leading to the release of σ\u003csup\u003eE\u003c/sup\u003e and transcription of membrane-repair genes \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. OmpV has the OMP-periplasmic-stress associated YxF motif. It is thus possible that OmpV also acts as a sensor of AMPs and signals their presence at the outer membrane to activate a transcriptomic regulator inside the cell and the expression of resistance genes including \u003cem\u003evexAB\u003c/em\u003e. A study using deletion mutants of different OMPs showed that the outer-membrane activation of σ\u003csup\u003eE\u003c/sup\u003e by YxF is OmpU-dependant \u003csup\u003e\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e\u003c/sup\u003e. Our qPCR results show that σ\u003csup\u003eE\u003c/sup\u003e is still activated upon PmB stimulation in a A1552Δ\u003cem\u003eompV\u003c/em\u003e mutant, suggesting that another signal is used. A possible explanation for the modulation of \u003cem\u003evexAB\u003c/em\u003e in the presence of PmB is that it could be part of the \u003cem\u003ecarR\u003c/em\u003e regulon, especially because \u003cem\u003eompV\u003c/em\u003e and \u003cem\u003ecarRS\u003c/em\u003e belong to the same operon. Our quantitative RT-PCR analysis showed that the expression of \u003cem\u003ecarS\u003c/em\u003e was significantly upregulated in A1552Δ\u003cem\u003eompV\u003c/em\u003e in the presence of PmB, but that this increase was also significantly lower than in A1552. In \u003cem\u003eV. vulnificus\u003c/em\u003e, upon PmB stimulation, CarR (VprA) activates the expression of \u003cem\u003eeptA\u003c/em\u003e and \u003cem\u003etolCV2\u003c/em\u003e, a LPS modification system and a tripartite efflux-pump, respectively \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e\u003c/sup\u003e. However, the expression of \u003cem\u003ealmG\u003c/em\u003e, which is a known effector of the \u003cem\u003ecarR\u003c/em\u003e regulon \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, is not reduced in A1552Δ\u003cem\u003eompV\u003c/em\u003e. The transcription of \u003cem\u003ecarRS\u003c/em\u003e (\u003cem\u003evprAB\u003c/em\u003e) in the presence of PmB could be activated by multiple pathways, and thus only partly depend on \u003cem\u003eompV\u003c/em\u003e. It could also mean that lower expression levels of \u003cem\u003ecarRS\u003c/em\u003e are sufficient to strongly activate the transcription of the \u003cem\u003ealm\u003c/em\u003e operon, but not \u003cem\u003evexAB\u003c/em\u003e, as the affinity of CarR to their respective promotors could be different.\u003c/p\u003e \u003cp\u003eWe wondered how OmpV could act as a sensor for PmB and so examined its predicted structure. This revealed that it adopts a β-barrel architecture where both its periplasmic and extracellular openings are occluded. Instead, two short β-strands in the lateral wall of the OmpV barrel create an opening into an electronegative pocket in the lumen of the barrel that is accessible only through the membrane. The proposed porin function of OmpV is questioned \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e,\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e\u003c/sup\u003e. We propose that, instead of functioning as a porin, OmpV may directly bind PmB via this electronegative pocket, thus serving as a sensor.\u003c/p\u003e \u003cp\u003eAccording to the structure prediction and electrostatic surface potential calculations, we propose a model in which OmpV, a MipA structural ortholog (see Supplementary Figure S4), can sense PmB when it integrates into the outer-membrane via direct interaction with the electronegative barrel lumen, accessible through a membrane-integral gap in the β-barrel wall, and activate the expression of the efflux-pump VexAB through an unknown mechanism (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). While VirK is predicted to be a cytoplasmic protein, an \u003cem\u003eE. coli\u003c/em\u003e ortholog similarly predicted to localize to the cytoplasm has been shown experimentally to localize to the periplasm \u003csup\u003e\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e\u003c/sup\u003e. It is therefore possible that VirK could be a periplasmic mediator involved in signal propagation of PmB-sensing by OmpV, especially since they are co-transcribed as part of the same operon. An OmpV conformational change upon PmB binding could thus signal intracellularly using VirK as an intermediary. This signalling might occur through the CarRS system to activate the expression of the \u003cem\u003evexAB\u003c/em\u003e efflux pump (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). CarS is known to respond to cationic AMPs, but the direct interaction between PmB and CarS is yet to be confirmed. During the preparation of this manuscript, a similar system was identified in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e in which the OmpV ortholog MipA functions as a PmB-sensor, inducing a MipA conformational change that releases the periplasmic mediator MipB \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. This leads to the expression of the efflux pump MexXY through the ParRS two-component system \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e, suggesting a conserved mechanism of AMP signaling and resistance. However, in \u003cem\u003eP. aeruginosa\u003c/em\u003e, the system is not encoded as a single operon and is present in the bacterial genome only in the absence of the \u003cem\u003earn\u003c/em\u003e operon, responsible for LPS modification \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eV. cholerae\u003c/em\u003e, we have identified a single conserved operon that regulates multiple antimicrobial resistance mechanisms, specifically the efflux pump VexAB and the LPS modification system \u003cem\u003ealm\u003c/em\u003e. To our knowledge, no other operon encoding multiple resistance system regulators, aside from two-component systems, has been identified so far. Future studies are necessary to dissect the role of VirK in antimicrobial resistance, as well as to confirm the involvement of CarRS in \u003cem\u003evexAB\u003c/em\u003e regulation or to identify the regulators of the OmpV-mediated response.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Material \u0026 methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStrains\u003c/h2\u003e \u003cp\u003e \u003cem\u003eVibrio cholerae\u003c/em\u003e O1 El Tor strain A1552, an Inaba clinical strain isolated in 1992 from a Peruvian tourist, was used for this study \u003csup\u003e\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e\u003c/sup\u003e. Bacterial strains and plasmids used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. \u003cem\u003eV. cholerae\u003c/em\u003e strains were grown on LB (10 mg/mL tryptone (Termo Fisher\u0026trade;), 5 mg/mL yeast extract (Thermo Fisher\u0026trade;), 5 mg/mL NaCl) agar plates at 37\u0026deg;C, and cultivated in LB broth at 37\u0026deg;C for 16 h prior to experiments. When needed, L-arabinose (0.2% w/v) (Thermo Fisher\u0026trade;) or carbenicillin (50 \u0026micro;g/mL) (VWR) were added to the media. Polymyxin B solution, a mixture of B1 and B2 sulfate, at 20 mg/ml in water from Sigma-Aldrich was used for the experiments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBacterial strains and plasmids used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGeneral characteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eV. cholerae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA1552\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWild-type strain, O1 El Tor, pathogenic strain isolated from human cholera infection\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003e Δ\u003cem\u003evirK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA1552 derived strain in which \u003cem\u003eompV\u003c/em\u003e has been replaced by a chloramphenicol resistance cassette, with promoter and terminator, from pKD3, with a knocked down expression of \u003cem\u003evirK\u003c/em\u003e as determined by qPCR.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA1552Δ\u003cem\u003evirK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA1552 derived strain in which \u003cem\u003evirK\u003c/em\u003e has been removed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA1552Δ\u003cem\u003eompV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA1552 derived strain in which \u003cem\u003eompV\u003c/em\u003e has been removed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKindly provided by Dr S.N. Wai\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDH5α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u0026ndash; φ80\u003cem\u003elacZ\u003c/em\u003eΔM15 Δ(\u003cem\u003elacZYA-argF\u003c/em\u003e) U169 \u003cem\u003erecA\u003c/em\u003e1 \u003cem\u003eendA\u003c/em\u003e1 \u003cem\u003ehsdR\u003c/em\u003e17(r\u003csub\u003eK\u003c/sub\u003e\u003csup\u003e\u0026ndash;\u003c/sup\u003e, m\u003csub\u003eK\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e) \u003cem\u003ephoA supE\u003c/em\u003e44 λ\u0026ndash;\u003cem\u003ethi\u003c/em\u003e-1 \u003cem\u003egyrA\u003c/em\u003e96 \u003cem\u003erelA\u003c/em\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e\u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003ePlasmids\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epBAD24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eExpression vector. Arabinose inducible promoter, resistance cassette to carbenicillin (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.addgene.org/vector-database/1845/\u003c/span\u003e\u003cspan address=\"https://www.addgene.org/vector-database/1845/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e\u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e103\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epBAD24-\u003cem\u003eompV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epBAD24 vector with the complete annotated \u003cem\u003eompV\u003c/em\u003e open reading frame from A1552 under the \u003cem\u003eara\u003c/em\u003e promotor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epBAD24-\u003cem\u003eompV\u003c/em\u003e-153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epBAD24 vector with the complete annotated \u003cem\u003eompV\u003c/em\u003e open reading frame, starting from the ATG in position \u0026minus;\u0026thinsp;153, under the \u003cem\u003eara\u003c/em\u003e promotor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epBAD24-\u003cem\u003evirK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epBAD24 vector with the complete annotated \u003cem\u003evirK\u003c/em\u003e open reading frame from A1552 under the \u003cem\u003eara\u003c/em\u003e promotor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epBAD24-\u003cem\u003eompV\u003c/em\u003e-153-\u003cem\u003evirK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003epBAD24 vector with the complete annotated \u003cem\u003eompV\u003c/em\u003e open reading frame, starting from the ATG in position \u0026minus;\u0026thinsp;153, annotated \u003cem\u003evirK\u003c/em\u003e open reading frame and the intergenic region from A1552 under the \u003cem\u003eara\u003c/em\u003e promotor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epKD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTemplate plasmid for FRT-flanked chloramphenicol resistance cassette (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.addgene.org/45604/\u003c/span\u003e\u003cspan address=\"https://www.addgene.org/45604/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epE-FLP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVector carrying the flippase FLP used to remove the chloramphenicol cassette flanked by FRT regions (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.addgene.org/45978/\u003c/span\u003e\u003cspan address=\"https://www.addgene.org/45978/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMutant construction and complementation using pBAD24\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003evirK\u003c/em\u003e and \u003cem\u003eompV-virK\u003c/em\u003e mutants were obtained as described before using natural competence and PCR products \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Briefly, the chloramphenicol cassette flanked by FRT regions and P1 and P2 was amplified by PCR from pKD3 using primers adding 50 nt homology (CmR\u003csub\u003e\u003cem\u003eompV\u003c/em\u003e\u003c/sub\u003e F/R; CmR\u003csub\u003e\u003cem\u003evirK\u003c/em\u003e\u003c/sub\u003e F/R) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) to the up- and downstream regions of the target genes \u003csup\u003e\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e\u003c/sup\u003e. Homologous regions of 1000 nt up- and downstream of the target genes were also amplified by PCR using different primers (\u003cem\u003eompV\u003c/em\u003e\u003csub\u003eup\u003c/sub\u003eF/R; \u003cem\u003eompV\u003c/em\u003e\u003csub\u003edown\u003c/sub\u003eF/R; \u003cem\u003evirK\u003c/em\u003e\u003csub\u003eup\u003c/sub\u003eF/R; \u003cem\u003evirK\u003c/em\u003e\u003csub\u003edown\u003c/sub\u003eF/R) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), then linked to the cassette by two-step PCR using \u003cem\u003eompV\u003c/em\u003e\u003csub\u003eup\u003c/sub\u003eF and \u003cem\u003eompV\u003c/em\u003e\u003csub\u003edown\u003c/sub\u003eR, or \u003cem\u003evirK\u003c/em\u003e\u003csub\u003eup\u003c/sub\u003eF and \u003cem\u003evirK\u003c/em\u003e\u003csub\u003edown\u003c/sub\u003eR \u003csup\u003e\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e\u003c/sup\u003e. Two hundred nanograms of the final amplicon were added to A1552 grown for 24 h at 30\u0026deg;C with chitin, in M9 supplemented medium \u003csup\u003e\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e\u003c/sup\u003e. The cells were further incubated for 24 h at 30\u0026deg;C. The mutants were selected on LB agar plates supplemented with 2 \u0026micro;g/ml of chloramphenicol. To remove the resistance cassette, pE-FLP was used as described in \u003csup\u003e\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e\u003c/sup\u003e. The final constructions were verified by PCR and sequencing using \u003cem\u003everif\u003c/em\u003e primers (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eMutant construction and complementation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCmR\u003csub\u003e\u003cem\u003eompV\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eacaggaggagctcctgtctgaaggcggtatcgttcagaagtgctagccga\u003c/em\u003ecatatgaatatcctccttag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003ettttgtacagtgttcacatccaaacataagctcttaattggaaggacat\u003c/em\u003eagtgtaggctggagctgcttc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eompV\u003c/em\u003e\u003csub\u003eup\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eccgaactgcgttttgagcc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eggcacttatctgactggcag\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eompV\u003c/em\u003e\u003csub\u003edown\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etaggtcaaccgtggctttg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003ecgccatcgcacatgatttac\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCmR\u003csub\u003e\u003cem\u003evirK\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003etgctttcccgactgcgtggttgaagtcgggaaaggcgatgttaggtgagc\u003c/em\u003ecatatgaatatcctccttag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003etgtctgatttttctgcttgaactgccctgcgctaccgaaatggctttgat\u003c/em\u003egtgtaggctggagctgcttc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003evirK\u003c/em\u003e\u003csub\u003eup\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaaagtgacttacgtcgtgtgtc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003etggtgtgactaatgagggg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003evirK\u003c/em\u003e\u003csub\u003edown\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egcccatttcttgccataactcg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eatcgcaggcaacgctctagc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eompV \u0026ndash;\u003c/em\u003e cloning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eagct\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTAC\u003c/span\u003eCatgaaaaagatcgcactattta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eagct\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ectgcag\u003c/span\u003ectagaagtggtaagcgacgg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eompV \u0026ndash;\u003c/em\u003e 153 \u003cem\u003e\u0026ndash;\u003c/em\u003e cloning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eagct\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTAC\u003c/span\u003eCatgatttcagcttcaattagaaaa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eagct\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ectgcag\u003c/span\u003ectagaagtggtaagcgacgg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evirK\u003c/em\u003e \u0026ndash; cloning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eagct\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eatgaacccacgcattgattat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eagct\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ectgcag\u003c/span\u003ettagtggtgaatctcgttatccc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eompV \u0026ndash;\u003c/em\u003e verif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egaatctcgttatcccaaggct\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003ectcctgtctatcaagccatag\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003evirK\u003c/em\u003e \u0026ndash; verif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egagatttgcatgacttgcga\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eccgcacatgatttcagcttc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epBAD24 \u0026ndash; verif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eTTGCCGTCACTGCGTCTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eCCGCTTCTGCGTTCTGATTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eqPCR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGene\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eForward\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cb\u003eReverse\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eompV\u003c/em\u003e (VC1318)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etaggtcaaccgtggctttg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eggcacttatctgactggcag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003evirK\u003c/em\u003e (VC1317)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egcccatttcttgccataactcg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003etggtgtgactaatgagggg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erpoE\u003c/em\u003e (VC2467)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ecatcaacatcacttgcgggt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003egtgcgttttacacttggttgt\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ealmG\u003c/em\u003e (VC1577)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eaacgccgataaagccagat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003etgaggggatgacgcaga\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003evexB\u003c/em\u003e (VC0164)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ectcaactctgccaccgtt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eccaagaagatgatcgccagc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecarS\u003c/em\u003e (VC1319)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003egaggtagccatagcgagaaaca\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eagtcagggtttgggcttg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erecA\u003c/em\u003e (VC0092) *\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eATTGAAGGCGAAATGGGCGATAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eTACACATACAGTTGGATTGCTTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eCmR: chloramphenicol resistance cassette; Up: 1000 nt upstream region; Down: 1000 nt downstream region; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ent\u003c/span\u003e: restriction sites; \u003cem\u003ent\u003c/em\u003e, homologous regions added to the amplicon; *, housekeeping gene used for normalization.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe complementation of \u003cem\u003eompV\u003c/em\u003e using pBAD24 was carried as described before \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Briefly, the complete open reading frames (ORF) of \u003cem\u003eompV\u003c/em\u003e (VC_1318), from the annotated ATG or the ATG in position \u0026minus;\u0026thinsp;153 pb, and \u003cem\u003evirK\u003c/em\u003e (VC_1317), were amplified by PCR from A1552 genomic DNA using the primers adding restriction sites listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The amplicons and purified pBAD24 vector were digested with PstI and KpnI from New England Biolabs\u0026reg; according to the manufacturer\u0026rsquo;s instructions, and purified from agarose gel using Monarch Gel purification kit (New England Biolabs\u0026reg;). They were ligated using T4 ligase from New England Biolabs\u0026reg;. The constructions were amplified in thermocompetent \u003cem\u003eE. coli\u003c/em\u003e DH5α \u003csup\u003e\u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e\u003c/sup\u003e, extracted using Pure Yield\u0026trade; Plasmid Miniprep System (Promega) and electroporated in \u003cem\u003eV. cholerae\u003c/em\u003e at 1.275 kV, 25 Ω in 1 mm electroporation cuvettes (Thermo Fisher). The vector was maintained with 50 \u0026micro;g/ml carbenicillin.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eompV\u003c/em\u003e ORF and its \u0026ndash; 153 bp region from other \u003cem\u003eV. cholerae\u003c/em\u003e strains were compared to those of A1552 using the basic alignment tool nucleotides BLAST\u0026reg; from the National Center for Biotechnology Information \u003csup\u003e\u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e\u003c/sup\u003e. The genomes from N16961 (AE003852.1), C6706 (CP046844.1) and MO10 (CP072849.1) were used for comparison. The synteny of the \u003cem\u003eompV\u003c/em\u003e region was analysed with PATRIC, using the Compare Region Viewer of the Features section \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e and with SyntTax \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eGrowth curves and minimal inhibitory concentrations\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eV. cholerae\u003c/em\u003e was grown for 16 h at 37\u0026deg;C with agitation in LB, with carbenicillin when needed. A 1:50 dilution in fresh media was done, and the bacteria were grown at 37\u0026deg;C to an optical density at 600 nm (OD\u003csub\u003e600nm\u003c/sub\u003e) of 0.3. They were further diluted 1:3000 in LB distributed in 96 wells plates with decreasing concentrations of AMP. The bacterial growth was followed by reading the OD\u003csub\u003e600nm\u003c/sub\u003e every 30 min, at 37\u0026deg;C with agitation. The minimal inhibitory concentration (MIC) was defined as the lowest AMP concentration that inhibits bacterial growth. Data were obtained from at least three independent experiments, in technical triplicates.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eVesicles extraction, quantification, and visualization on SDS gel\u003c/h2\u003e \u003cp\u003eMembrane vesicles (MVs) were isolated from 25 mL cell-free supernatant from 16h cultures in LB, with or without 3 \u0026micro;g/ml of PmB, as described before \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. MVs were suspended in 100 \u0026micro;l of phosphate buffered saline (PBS) and quantified using i) a Bradford assay (Bio-Rad 500-0006) and a bovine serum albumin (BSA) standard curve, as directed by the manufacturer and ii) a fluorescent lipid-labelling FM4-64. Briefly, 2 \u0026micro;L of MVs were incubated with the FM\u0026trade; 4\u0026ndash;64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermofisher) at 2 \u0026micro;g/mL in a final volume of 100 \u0026micro;L in a 96-well black plate. The fluorescence was measured at 515/640 nm using a SpectraMax iD3 reader (Molecular devices).\u003c/p\u003e \u003cp\u003eTo visualize the MV proteins, 10 \u0026micro;l of the MV preparations were suspended in 20 \u0026micro;l of Laemmli buffer 2X and boiled for 10 min at 100\u0026deg;C. Then, 10 \u0026micro;l of the samples migrated on a 13% sodium dodecyl sulfate gel. Gels were further colored with Coomassie blue.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAtomic force microscopy imaging\u003c/h2\u003e \u003cp\u003eThe vesicle samples were prepared as described before. A volume of 10 \u0026micro;L was spotted onto a freshly cleaved mica surface coverslip and allowed to dry at room temperature. AFM imaging was carried out in air at room temperature using a Bioscope resolve AFM (Bruker) in the peak-force tapping mode, silicon cantilevers with a nominal spring constant of around 0.4 N/m, and a nominal tip radius of 2 nm (ScanAsyst-Air, Bruker). Vesicle height was determined from AFM images (height channel) using the grain analysis functions in the open source Gwyddion software \u003csup\u003e\u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e96\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSurvival in the presence of lethal concentrations of PmB\u003c/h2\u003e \u003cp\u003eNinety microliters of midlog cultures were incubated for 30 min with 500 \u0026micro;g/ml of PmB at 37\u0026deg;C, with or without 5 \u0026micro;l of MV preparations (final concentration 10 X), as described before \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Ten microliters of ten-fold dilutions were spotted on LB agar plates, then incubated at 37\u0026deg;C for 16 h and numbered. The relative survival was calculated using the number of colony forming units per ml recovered in the presence of PmB in comparison to the non-treated cells. Data were obtained from at least three independent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eDetection of outer membrane pore formation by fluorescence\u003c/h2\u003e \u003cp\u003eMidlog cultures were stained using the fluorescent probes N-phenyl-1-naphthylamine (NPN) and propidium iodide (PI) as described before \u003csup\u003e\u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e\u003c/sup\u003e, with modifications. Briefly, NPN and PI were used for the detection of outer membrane and outer/inner membrane damages, respectively. \u003cem\u003eV. cholerae\u003c/em\u003e was grown to an OD\u003csub\u003e600nm\u003c/sub\u003e of 1 in LB at 37\u0026deg;C. Bacteria were washed in PBS. Then, PmB at concentration of 50, 25, 10 and 3 \u0026micro;g/ml, or none as control, was added. NPN (20 \u0026micro;M) and PI (20 \u0026micro;M) were added, followed by an incubation of 30 min at room temperature, in the dark. A hundred microliters of each sample were added to a 96-well plate. The fluorescence was acquired with the SpectraMax iD3 reader (Molecular devices) at 350/420 nm and 535/615 nm, respectively. PBS with NPN and PI was used a negative control for autofluorescence to blank the values. The relative fluorescence of each condition was measured in comparison to the wild-type strain without PmB. Data were obtained from at least three independent experiments in technical duplicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction, cDNA construction and qPCR analysis\u003c/h2\u003e \u003cp\u003e \u003cem\u003eV. cholerae\u003c/em\u003e was grown to an OD\u003csub\u003e600nm\u003c/sub\u003e of 0.5 at 37\u0026deg;C in LB, with or without 3 \u0026micro;g/mL of PmB. The bacterial pellets from 10 ml cultures were suspended in 1 mL TRIzol solution (Invitrogen). The total RNA was extracted according to the manufacturer\u0026rsquo;s instructions and retrotranscribed to cDNA using QuantiTect Reverse Transcription Kit (QIAGEN). Their purity and quality were assessed by nanodrop and migration on 2% agarose gel, respectively. Quantitative PCR analysis was done as described before \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e with primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and using PerfeCTa SYBR\u0026reg; Green FastMix Low ROX (Quantabio). The amplification cycle constitutes of an initial activation step of 30 s at 95\u0026deg;C, followed by 40 cycles of denaturation at 95\u0026deg;C for 5 s, annealing/elongation at 57\u0026deg;C for 17 s and data collection for 12 s at 70\u0026deg;C. The normalized relative expression of various AMP resistance genes was calculated in PmB treated bacteria in comparison to non-treated cells using QuantStudio\u0026trade; Design and Analysis Software (Thermo Fisher) v1.5.1 and normalized using \u003cem\u003erecA\u003c/em\u003e. The results were obtained from 8 independent experiments, in technical triplicates.\u003c/p\u003e \u003cp\u003eThe genomic context of \u003cem\u003eompV\u003c/em\u003e was determined using the qPCR primers (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) and cDNA of A1552 grown with and without PmB. The intergenic regions between \u003cem\u003ecarS\u003c/em\u003e and \u003cem\u003eompV\u003c/em\u003e and between \u003cem\u003eompV\u003c/em\u003e and \u003cem\u003evirK\u003c/em\u003e were amplified from cDNA by PCR using \u003cem\u003ecarS\u003c/em\u003e-R and \u003cem\u003eompV\u003c/em\u003e-F, and \u003cem\u003eompV\u003c/em\u003e-R and \u003cem\u003evirK\u003c/em\u003e-F. The absence of genomic DNA in the cDNA samples was assessed by PCR amplifying intergenic regions about \u003cem\u003elacZ\u003c/em\u003e using primers F-\u003cem\u003eintergen\u003c/em\u003e: 5\u0026rsquo;-acaggcgatgactaacctac-3\u0026rsquo; and R-\u003cem\u003eintergen\u003c/em\u003e: 5\u0026rsquo;-ggagagtcaaagcgcagaac-3\u0026rsquo; with DNA Taq Polymerase from New England Biolabs. The cycle consisted of an initial denaturation step of 30 s at 95\u0026deg;C, followed by 35 cycles of amplification consisting of a denaturation step of 15 s at 95\u0026deg;C, primer annealing at 49\u0026deg;C for 15 s, and extension at 68\u0026deg;C for 210 s. A final extension step of 5 min at 68\u0026deg;C was added. The amplicons migrated on 1% agarose gel and were visualized with RedSafe\u0026trade; Nucleic Acid Staining Solution under ultraviolet light.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eRNAseq of total RNA\u003c/h2\u003e \u003cp\u003eTotal RNA from A1552 grown with or without 3 \u0026micro;g/ml of PmB to an OD\u003csub\u003e600nm\u003c/sub\u003e of 0.5 was isolated as described in the previous section. The ribosomal RNA depleted RNA was sequenced at the G\u0026eacute;nome Qu\u0026eacute;bec Innovation Center (Centre Hospitalier Universitaire Sainte-Justine, Montr\u0026eacute;al, QC, Canada). Total RNA was quantified and its integrity was assessed using a LabChip GXII (PerkinElmer) instrument. rRNA was depleted from 125 ng of total RNA using QIAseq FastSelect (-5S/16S/23S Kit 96rxns). cDNA synthesis was achieved with the NEBNext RNA First Strand Synthesis and NEBNext Ultra Directional RNA Second Strand Synthesis Modules (New England BioLabs). The remaining steps of library preparation were done using and the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers were purchased from New England BioLabs. Libraries were quantified using the KAPA Library Quantification Kits - Complete kit (Universal) (Kapa Biosystems). Average size fragment was determined using a LabChip GXII (PerkinElmer) instrument. The libraries were normalized and pooled and then denatured in 0.02N NaOH and neutralized using HT1 buffer. The pool was loaded at 175pM on a Illumina NovaSeq S4 lane using Xp protocol as per the manufacturer\u0026rsquo;s recommendations. The run was performed for 2x100 cycles (paired-end mode). A phiX library was used as a control and mixed with libraries at 1% level. Base calling was performed with RTA v3. Program bcl2fastq2 v2.20 was then used to demultiplex samples and generate fastq reads. Sequencing reads were cleaned with fastp version 0.23.4 and then mapped onto the genomic sequence of \u003cem\u003eV. cholerae\u003c/em\u003e O1 biovar El Tor strain N16961 (RefSeq GCF_000006745.1) with Bowtie version 2.5.1. After sorting with SAMtools version 1.17, gene-mapping reads were counted with featureCounts version 2.0.1. Finally, differential gene expression was calculated with DESeq2 version 1.40.1 using R version 4.3.0. The output consisted of base mean values, fold change values (Log2(Fold Change)) of genes expression in PmB-treated cells in comparison to non-treated cells, standard error of the estimated fold change values (IfcSE), statistic values (Stat), P values (p-value) and adjusted P values (p-adj) (see Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Transcripts with a Log2(Fold Change) \u0026lt; -0.4 or \u0026gt;\u0026thinsp;0.4, and with a p-adj\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered as significantly modulated by the presence of PmB. The experiment was conducted in biological duplicate. The genes with a modified expression were submitted to the STRING database for network cluster enrichment \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Sequencing reads from the present project have been deposited in the public SRA database under accession number PRJNA1152934.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eProtein structure prediction and analysis\u003c/h2\u003e \u003cp\u003eThe signal sequence of OmpV was predicted using SignalP 6.0 \u003csup\u003e98\u003c/sup\u003e. The structure of OmpV without its signal sequence was predicted using AlphaFold2 \u003csup\u003e99\u003c/sup\u003e as implemented through ColabFold \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Protein structure models were visualized using ChimeraX \u003csup\u003e\u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e100\u003c/span\u003e\u003c/sup\u003e. The predicted structure of OmpV was submitted to the Foldseek \u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e and DALI \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e servers for comparison to experimentally-determined structures deposited in the Protein Data Bank. Structural alignment of OmpV and MipA was performed using the Protein Data Bank pairwise structural alignment tool. The electrostatic surface potential of OmpV was calculated using APBS tools \u003csup\u003e\u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e101\u003c/span\u003e\u003c/sup\u003e and visualized using ChimeraX. The volume of the putative binding pocket in the lumen of the OmpV barrel was calculated using CASTpFold \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e and visualized using Chimera \u003csup\u003e\u003cspan citationid=\"CR102\" class=\"CitationRef\"\u003e102\u003c/span\u003e\u003c/sup\u003e. Docking of PmB into the AlphaFold2-predicted structure of OmpV was performed using Autodock Vina 1.2.0 \u003csup\u003e54\u003c/sup\u003e with an exhaustiveness of eight. The structure of PmB used for docking was obtained from PDB 5L3F. The structure of OmpV in complex with PmB was predicted \u003cem\u003ede novo\u003c/em\u003e using Boltz-1 \u003csup\u003e55\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and were analyzed for significance using the GraphPad Prism version 10.2.2 for Windows (GraphPad Software, Boston, Massachusetts USA, www.graphpad.com). Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-tests were used to compare conditions between 2 groups. Single way ANOVA was used for multiple groups comparison. A result was considered as significant when \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests Statement\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eacquisition: M.D.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: A.M.D., M.D.Methodology: A.M.D., G.B.W., A.T.V., C.B., J.P.F., F.M.Validation: All authors.Formal analysis: A.M.D., G.B.W., A.T.V., J.P.F., M.D.Investigation: A.M.D., G.B.W., A.T.V., C.B., J.P.F., M.D.Resources: A.T.V., Y.V.B., M.D.Data Curation: A.M.D., G.B.W., A.T.V., C.B., J.P.F., M.D.Writing \u0026ndash; Original Draft: A.M.D., G.B.W., M.D.Writing \u0026ndash; Review \u0026amp; Editing: All authors. Visualization: A.M.D., G.B.W., C.B., M.D.Supervision: M.D.Project administration: A.M.D., M.D.Funding acquisition: M.D. All authors reviewed the manuscript\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank Dre Wai from the Laboratory for Molecular Infection Medicine Sweden (MIMS) at Ume\u0026aring; University for bacterial strains. This work was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC; http://www.nserc-crsng.gc.ca/index_eng.asp) Discovery grant number RGPIN-2017-05322 to MD. AM-D received financial support from the NSERC scholarship program (BESC D3 \u0026ndash; 558624 \u0026ndash; 2021). JP-F received financial support from the FRQNT Scholarship Program, the NSERC's Canada Graduate Scholarships Master's program (CGS M) and the J.A. DeS\u0026egrave;ve Scholarship from the Graduate and Postdoctoral Studies of the University of Montreal (ESP). AM-D and MD received financial support from the RAQ (Ressources Aquatiques Qu\u0026eacute;bec), an inter-institutional group supported financially by the Fonds de recherche du Qu\u0026eacute;bec \u0026ndash; Nature et technologies (FRQNT) (Programme regroupements strat\u0026eacute;giques). GBW received financial support from a FRQNT postdoctoral fellowship and is financially supported by YVB through a Canada 150 Research Chair in Bacterial Cell Biology and Project Grant PJT-169053 from the Canadian Institutes of Health Research (CIHR).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during and/or analysed during the current study are available in the SRA repository, under accession number PRJNA1152934.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBoparai, J. K. \u0026amp; Sharma, P. K. Mini Review on Antimicrobial Peptides, Sources, Mechanism and Recent Applications. \u003cem\u003eProtein Pept Lett\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 4-16 (2020). https://doi.org:10.2174/0929866526666190822165812\u003c/li\u003e\n\u003cli\u003eLi, J.\u003cem\u003e et al.\u003c/em\u003e Colistin: the re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections. \u003cem\u003eLancet Infect Dis\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 589-601 (2006). https://doi.org:10.1016/S1473-3099(06)70580-1\u003c/li\u003e\n\u003cli\u003eVelkov, T., Thompson, P. E., Nation, R. L. \u0026amp; Li, J. Structure--activity relationships of polymyxin antibiotics. \u003cem\u003eJ Med Chem\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 1898-1916 (2010). https://doi.org:10.1021/jm900999h\u003c/li\u003e\n\u003cli\u003eBialvaei, A. Z. \u0026amp; Samadi Kafil, H. Colistin, mechanisms and prevalence of resistance. \u003cem\u003eCurr Med Res Opin\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 707-721 (2015). https://doi.org:10.1185/03007995.2015.1018989\u003c/li\u003e\n\u003cli\u003eBrogden, K. A. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? \u003cem\u003eNat Rev Microbiol\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 238-250 (2005). https://doi.org:10.1038/nrmicro1098\u003c/li\u003e\n\u003cli\u003eHenderson, J. C., Herrera, C. M. \u0026amp; Trent, M. S. AlmG, responsible for polymyxin resistance in pandemic \u003cem\u003eVibrio cholerae\u003c/em\u003e, is a glycyltransferase distantly related to lipid A late acyltransferases. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e292\u003c/strong\u003e, 21205-21215 (2017). https://doi.org:10.1074/jbc.RA117.000131\u003c/li\u003e\n\u003cli\u003eAvedissian, S. N.\u003cem\u003e et al.\u003c/em\u003e A Review of the Clinical Pharmacokinetics of Polymyxin B. \u003cem\u003eAntibiotics (Basel)\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e (2019). https://doi.org:10.3390/antibiotics8010031\u003c/li\u003e\n\u003cli\u003eAbdelraouf, K., He, J., Ledesma, K. R., Hu, M. \u0026amp; Tam, V. H. Pharmacokinetics and renal disposition of polymyxin B in an animal model. \u003cem\u003eAntimicrob Agents Chemother\u003c/em\u003e \u003cstrong\u003e56\u003c/strong\u003e, 5724-5727 (2012). https://doi.org:10.1128/AAC.01333-12\u003c/li\u003e\n\u003cli\u003eClemens, J. D., Nair, G. B., Ahmed, T., Qadri, F. \u0026amp; Holmgren, J. Cholera. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e390\u003c/strong\u003e, 1539-1549 (2017). https://doi.org:10.1016/S0140-6736(17)30559-7\u003c/li\u003e\n\u003cli\u003eDeen, J., Mengel, M. A. \u0026amp; Clemens, J. D. Epidemiology of cholera. \u003cem\u003eVaccine\u003c/em\u003e \u003cstrong\u003e38 Suppl 1\u003c/strong\u003e, A31-A40 (2020). https://doi.org:10.1016/j.vaccine.2019.07.078\u003c/li\u003e\n\u003cli\u003eShirin, T.\u003cem\u003e et al.\u003c/em\u003e Antimicrobial peptides in the duodenum at the acute and convalescent stages in patients with diarrhea due to \u003cem\u003eVibrio cholerae\u003c/em\u003e O1 or enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e infection. \u003cem\u003eMicrobes Infect\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1111-1120 (2011). https://doi.org:10.1016/j.micinf.2011.06.014\u003c/li\u003e\n\u003cli\u003eHerrera, C. M.\u003cem\u003e et al.\u003c/em\u003e The \u003cem\u003eVibrio cholerae \u003c/em\u003eVprA-VprB two-component system controls virulence through endotoxin modification. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e (2014). https://doi.org:10.1128/mBio.02283-14\u003c/li\u003e\n\u003cli\u003eBilecen, K.\u003cem\u003e et al.\u003c/em\u003e Polymyxin B resistance and biofilm formation in \u003cem\u003eVibrio cholerae\u003c/em\u003e are controlled by the response regulator CarR. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e83\u003c/strong\u003e, 1199-1209 (2015). https://doi.org:10.1128/IAI.02700-14\u003c/li\u003e\n\u003cli\u003eBaron, S., Hadjadj, L., Rolain, J. M. \u0026amp; Olaitan, A. O. Molecular mechanisms of polymyxin resistance: knowns and unknowns. \u003cem\u003eInt J Antimicrob Agents\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 583-591 (2016). https://doi.org:10.1016/j.ijantimicag.2016.06.023\u003c/li\u003e\n\u003cli\u003eLiu, Y.\u003cem\u003e et al.\u003c/em\u003e \u003cem\u003eVibrio cholerae \u003c/em\u003esenses human enteric alpha-defensin 5 through a CarSR two-component system to promote bacterial pathogenicity. \u003cem\u003eCommun Biol\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 559 (2022). https://doi.org:10.1038/s42003-022-03525-3\u003c/li\u003e\n\u003cli\u003eBina, J. E., Provenzano, D., Wang, C., Bina, X. R. \u0026amp; Mekalanos, J. J. Characterization of the \u003cem\u003eVibrio cholerae vexAB\u003c/em\u003e and \u003cem\u003evexCD\u003c/em\u003e efflux systems. \u003cem\u003eArch Microbiol\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e, 171-181 (2006). https://doi.org:10.1007/s00203-006-0133-5\u003c/li\u003e\n\u003cli\u003eKlenotic, P. A. \u0026amp; Yu, E. W. Structural analysis of resistance-nodulation cell division transporters. \u003cem\u003eMicrobiol Mol Biol Rev\u003c/em\u003e \u003cstrong\u003e88\u003c/strong\u003e, e0019823 (2024). https://doi.org:10.1128/mmbr.00198-23\u003c/li\u003e\n\u003cli\u003eFernandez-Recio, J.\u003cem\u003e et al.\u003c/em\u003e A model of a transmembrane drug-efflux pump from Gram-negative bacteria. \u003cem\u003eFEBS Lett\u003c/em\u003e \u003cstrong\u003e578\u003c/strong\u003e, 5-9 (2004). https://doi.org:10.1016/j.febslet.2004.10.097\u003c/li\u003e\n\u003cli\u003eBina, X. R., Provenzano, D., Nguyen, N. \u0026amp; Bina, J. E. \u003cem\u003eVibrio cholerae \u003c/em\u003eRND family efflux systems are required for antimicrobial resistance, optimal virulence factor production, and colonization of the infant mouse small intestine. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e76\u003c/strong\u003e, 3595-3605 (2008). https://doi.org:10.1128/IAI.01620-07\u003c/li\u003e\n\u003cli\u003eTaylor, R. K., Manoil, C. \u0026amp; Mekalanos, J. J. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of \u003cem\u003eVibrio cholerae\u003c/em\u003e. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e171\u003c/strong\u003e, 1870-1878 (1989). https://doi.org:10.1128/jb.171.4.1870-1878.1989\u003c/li\u003e\n\u003cli\u003ePohlner, J., Meyer, T. F., Jalajakumari, M. B. \u0026amp; Manning, P. A. Nucleotide sequence of\u003cem\u003e ompV\u003c/em\u003e, the gene for a major \u003cem\u003eVibrio cholerae\u003c/em\u003e outer membrane protein. \u003cem\u003eMol Gen Genet\u003c/em\u003e \u003cstrong\u003e205\u003c/strong\u003e, 494-500 (1986). https://doi.org:10.1007/BF00338088\u003c/li\u003e\n\u003cli\u003eStevenson, G., Leavesley, D. I., Lagnado, C. A., Heuzenroeder, M. W. \u0026amp; Manning, P. A. Purification of the 25-kDa \u003cem\u003eVibrio cholerae \u003c/em\u003emajor outer-membrane protein and the molecular cloning of its gene: \u003cem\u003eompV\u003c/em\u003e. \u003cem\u003eEur J Biochem\u003c/em\u003e \u003cstrong\u003e148\u003c/strong\u003e, 385-390 (1985). https://doi.org:10.1111/j.1432-1033.1985.tb08850.x\u003c/li\u003e\n\u003cli\u003eKabir, S. Composition and immunochemical properties of outer membrane proteins of \u003cem\u003eVibrio cholerae\u003c/em\u003e. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e144\u003c/strong\u003e, 382-389 (1980). https://doi.org:10.1128/jb.144.1.382-389.1980\u003c/li\u003e\n\u003cli\u003eKelley, J. T. \u0026amp; Parker, C. D. Identification and preliminary characterization of \u003cem\u003eVibrio cholerae\u003c/em\u003e outer membrane proteins. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e145\u003c/strong\u003e, 1018-1024 (1981). https://doi.org:10.1128/jb.145.2.1018-1024.1981\u003c/li\u003e\n\u003cli\u003eManning, P. A. \u0026amp; Haynes, D. R. A common-immunogenic \u003cem\u003eVibrio \u003c/em\u003eouter membrane protein. \u003cem\u003eFEMS Microbiology Letters\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 297-302 (1984). \u003c/li\u003e\n\u003cli\u003ePohlner, J., Meyer, T. F. \u0026amp; Manning, P. A. Serological properties and processing in \u003cem\u003eEscherichia coli\u003c/em\u003e K12 of OmpV fusion proteins of \u003cem\u003eVibrio cholerae\u003c/em\u003e. \u003cem\u003eMol Gen Genet\u003c/em\u003e \u003cstrong\u003e205\u003c/strong\u003e, 501-506 (1986). https://doi.org:10.1007/BF00338089\u003c/li\u003e\n\u003cli\u003eChiu, Y., Kuo, T. Y., Lin, C. C. \u0026amp; Chen, W. J. Proteomic analysis reveals responsive proteins of \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e on exposure to cationic antimicrobial peptides. \u003cem\u003eJ Appl Microbiol\u003c/em\u003e \u003cstrong\u003e110\u003c/strong\u003e, 80-89 (2011). https://doi.org:10.1111/j.1365-2672.2010.04856.x\u003c/li\u003e\n\u003cli\u003eNakata, N.\u003cem\u003e et al.\u003c/em\u003e Identification and characterization of \u003cem\u003evirK\u003c/em\u003e, a virulence-associated large plasmid gene essential for intercellular spreading of \u003cem\u003eShigella flexneri\u003c/em\u003e. \u003cem\u003eMol Microbiol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 2387-2395 (1992). https://doi.org:10.1111/j.1365-2958.1992.tb01413.x\u003c/li\u003e\n\u003cli\u003eDetweiler, C. S., Monack, D. M., Brodsky, I. E., Mathew, H. \u0026amp; Falkow, S. \u003cem\u003evirK, somA\u003c/em\u003e and \u003cem\u003ercsC \u003c/em\u003eare important for systemic \u003cem\u003eSalmonella enterica\u003c/em\u003e serovar Typhimurium infection and cationic peptide resistance. \u003cem\u003eMol Microbiol\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 385-400 (2003). https://doi.org:10.1046/j.1365-2958.2003.03455.x\u003c/li\u003e\n\u003cli\u003eNovik, V., Hofreuter, D. \u0026amp; Gal\u0026aacute;n, J. E. Characterization of a \u003cem\u003eCampylobacter jejuni \u003c/em\u003eVirK protein homolog as a novel virulence determinant. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e77\u003c/strong\u003e, 5428-5436 (2009). https://doi.org:10.1128/iai.00528-09\u003c/li\u003e\n\u003cli\u003eSzklarczyk, D.\u003cem\u003e et al.\u003c/em\u003e The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, D638-d646 (2023). https://doi.org:10.1093/nar/gkac1000\u003c/li\u003e\n\u003cli\u003eKanehisa, M., Furumichi, M., Sato, Y., Matsuura, Y. \u0026amp; Ishiguro-Watanabe, M. KEGG: biological systems database as a model of the real world. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, D672-d677 (2025). https://doi.org:10.1093/nar/gkae909\u003c/li\u003e\n\u003cli\u003eKanehisa, M. \u0026amp; Goto, S. KEGG: kyoto encyclopedia of genes and genomes. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 27-30 (2000). https://doi.org:10.1093/nar/28.1.27\u003c/li\u003e\n\u003cli\u003eKanehisa, M. Toward understanding the origin and evolution of cellular organisms. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1947-1951 (2019). https://doi.org:10.1002/pro.3715\u003c/li\u003e\n\u003cli\u003eMathieu-Denoncourt, A. \u0026amp; Duperthuy, M. The VxrAB Two-component system is important for the Polymyxin B dependent activation of the type VI secretion system in \u003cem\u003eVibrio cholerae\u003c/em\u003e O1 strain A1552. \u003cem\u003eCan J Microbiol\u003c/em\u003e (2023). https://doi.org:10.1139/cjm-2023-0026\u003c/li\u003e\n\u003cli\u003eDuperthuy, M.\u003cem\u003e et al.\u003c/em\u003e Role of the \u003cem\u003eVibrio cholerae\u003c/em\u003e matrix protein Bap1 in cross-resistance to antimicrobial peptides. \u003cem\u003ePLoS Pathog\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e1003620 (2013). https://doi.org:10.1371/journal.ppat.1003620\u003c/li\u003e\n\u003cli\u003eBouillet, S., Bauer Taran, S. \u0026amp; Gottesman, S. RpoS and the bacterial general stress response. \u003cem\u003eMicrobiology and Molecular Biology Reviews\u003c/em\u003e \u003cstrong\u003e88\u003c/strong\u003e, e00151-00122 (2024). https://doi.org:10.1128/mmbr.00151-22\u003c/li\u003e\n\u003cli\u003eRodr\u0026iacute;guez-Rojas, A. \u0026amp; Rolff, J. Antimicrobial activity of cationic antimicrobial peptides against stationary phase bacteria. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e (2022). \u003c/li\u003e\n\u003cli\u003eMuheim, C.\u003cem\u003e et al.\u003c/em\u003e Increasing the permeability of \u003cem\u003eEscherichia coli\u003c/em\u003e using MAC13243. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 17629 (2017). https://doi.org:10.1038/s41598-017-17772-6\u003c/li\u003e\n\u003cli\u003eGiacomucci, S., Cros, C. D., Perron, X., Mathieu-Denoncourt, A. \u0026amp; Duperthuy, M. Flagella-dependent inhibition of biofilm formation by sub-inhibitory concentration of polymyxin B in \u003cem\u003eVibrio cholerae\u003c/em\u003e. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e0221431 (2019). https://doi.org:10.1371/journal.pone.0221431\u003c/li\u003e\n\u003cli\u003eMagana, G., Harvey, C., Taggart, C. C. \u0026amp; Rodgers, A. M. Bacterial outer membrane vesicles: Role in pathogenesis and host-cell interactions. \u003cem\u003eAntibiotics (Basel)\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e (2023). https://doi.org:10.3390/antibiotics13010032\u003c/li\u003e\n\u003cli\u003eGiacomucci, S., Mathieu-Denoncourt, A., Vincent, A. T., Jannadi, H. \u0026amp; Duperthuy, M. Experimental evolution of \u003cem\u003eVibrio cholerae\u003c/em\u003e identifies hypervesiculation as a way to increase motility in the presence of polymyxin B. \u003cem\u003eFront Microbiol\u003c/em\u003e (2022). https://doi.org:https://doi.org/10.3389/fmicb.2022.932165\u003c/li\u003e\n\u003cli\u003eAssaf, R., Xia, F. \u0026amp; Stevens, R. Detecting operons in bacterial genomes via visual representation learning. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 2124 (2021). https://doi.org:10.1038/s41598-021-81169-9\u003c/li\u003e\n\u003cli\u003eWattam, A. R.\u003cem\u003e et al.\u003c/em\u003e Improvements to PATRIC, the all-bacterial Bioinformatics Database and Analysis Resource Center. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e45\u003c/strong\u003e, D535-d542 (2017). https://doi.org:10.1093/nar/gkw1017\u003c/li\u003e\n\u003cli\u003eOberto, J. SyntTax: a web server linking synteny to prokaryotic taxonomy. \u003cem\u003eBMC Bioinformatics\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 4 (2013). https://doi.org:10.1186/1471-2105-14-4\u003c/li\u003e\n\u003cli\u003eKo, D.\u003cem\u003e et al.\u003c/em\u003e CarRS two-component system essential for Polymyxin B resistance of \u003cem\u003eVibrio vulnificus\u003c/em\u003e responds to multiple host environmental signals. \u003cem\u003eMicrobiol Spectr\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, e0030523 (2023). https://doi.org:10.1128/spectrum.00305-23\u003c/li\u003e\n\u003cli\u003eMathur, J. \u0026amp; Waldor, M. K. The \u003cem\u003eVibrio cholerae\u003c/em\u003e ToxR-regulated porin OmpU confers resistance to antimicrobial peptides. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 3577-3583 (2004). https://doi.org:10.1128/IAI.72.6.3577-3583.2004\u003c/li\u003e\n\u003cli\u003eMathur, J., Davis, B. M. \u0026amp; Waldor, M. K. Antimicrobial peptides activate the \u003cem\u003eVibrio cholerae \u003c/em\u003esigmaE regulon through an OmpU-dependent signalling pathway. \u003cem\u003eMol Microbiol\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e, 848-858 (2007). https://doi.org:10.1111/j.1365-2958.2006.05544.x\u003c/li\u003e\n\u003cli\u003eMirdita, M.\u003cem\u003e et al.\u003c/em\u003e ColabFold: making protein folding accessible to all. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 679-682 (2022). https://doi.org:10.1038/s41592-022-01488-1\u003c/li\u003e\n\u003cli\u003evan Kempen, M.\u003cem\u003e et al.\u003c/em\u003e Fast and accurate protein structure search with Foldseek. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e, 243-246 (2024). https://doi.org:10.1038/s41587-023-01773-0\u003c/li\u003e\n\u003cli\u003eHolm, L., Laiho, A., Toronen, P. \u0026amp; Salgado, M. DALI shines a light on remote homologs: One hundred discoveries. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, e4519 (2023). https://doi.org:10.1002/pro.4519\u003c/li\u003e\n\u003cli\u003eJanet-Maitre, M.\u003cem\u003e et al.\u003c/em\u003e \u003cem\u003ePseudomonas aeruginos\u003c/em\u003ea MipA-MipB envelope proteins act as new sensors of polymyxins. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, e0221123 (2024). https://doi.org:10.1128/mbio.02211-23\u003c/li\u003e\n\u003cli\u003eYe, B., Tian, W., Wang, B. \u0026amp; Liang, J. CASTpFold: Computed Atlas of Surface Topography of the universe of protein Folds. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, W194-W199 (2024). https://doi.org:10.1093/nar/gkae415\u003c/li\u003e\n\u003cli\u003eEberhardt, J., Santos-Martins, D., Tillack, A. F. \u0026amp; Forli, S. AutoDock Vina 1.2.0: new docking methods, expanded force field, and python bindings. \u003cem\u003eJ Chem Inf Model\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 3891-3898 (2021). https://doi.org:10.1021/acs.jcim.1c00203\u003c/li\u003e\n\u003cli\u003eWohlwend, J.\u003cem\u003e et al.\u003c/em\u003e Boltz-1 democratizing biomolecular interaction modeling. \u003cem\u003ebioRxiv\u003c/em\u003e (2024). https://doi.org:10.1101/2024.11.19.624167\u003c/li\u003e\n\u003cli\u003eMathieu-Denoncourt, A. \u0026amp; Duperthuy, M. Secretome analysis reveals a role of subinhibitory concentrations of polymyxin B in the survival of \u003cem\u003eVibrio cholerae \u003c/em\u003emediated by the type VI secretion system. \u003cem\u003eEnviron Microbiol\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 1133-1149 (2022). https://doi.org:10.1111/1462-2920.15762\u003c/li\u003e\n\u003cli\u003eBina, X. R.\u003cem\u003e et al.\u003c/em\u003e The \u003cem\u003eVibrio cholerae \u003c/em\u003eRND efflux systems impact virulence factor production and adaptive responses via periplasmic sensor proteins. \u003cem\u003ePLoS Pathog\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e1006804 (2018). https://doi.org:10.1371/journal.ppat.1006804\u003c/li\u003e\n\u003cli\u003eTaylor, D. L., Ante, V. M., Bina, X. R., Howard, M. F. \u0026amp; Bina, J. E. Substrate-dependent activation of the \u003cem\u003eVibrio cholerae vexAB\u003c/em\u003e RND efflux system requires \u003cem\u003evexR\u003c/em\u003e. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e0117890 (2015). https://doi.org:10.1371/journal.pone.0117890\u003c/li\u003e\n\u003cli\u003eDestoumieux-Garzon, D., Duperthuy, M., Vanhove, A. S., Schmitt, P. \u0026amp; Wai, S. N. Resistance to antimicrobial peptides in Vibrios. \u003cem\u003eAntibiotics (Basel)\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 540-563 (2014). https://doi.org:10.3390/antibiotics3040540\u003c/li\u003e\n\u003cli\u003eMatson, J. S., Livny, J. \u0026amp; DiRita, V. J. A putative \u003cem\u003eVibrio cholerae\u003c/em\u003e two-component system controls a conserved periplasmic protein in response to the antimicrobial peptide polymyxin B. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, e0186199 (2017). https://doi.org:10.1371/journal.pone.0186199\u003c/li\u003e\n\u003cli\u003eKaur, D., Gandhi, S. \u0026amp; Mukhopadhaya, A. \u003cem\u003eSalmonella \u003c/em\u003eTyphimurium adhesin OmpV activates host immunity to confer protection against systemic and gastrointestinal infection in mice. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, e0012121 (2021). https://doi.org:10.1128/IAI.00121-21\u003c/li\u003e\n\u003cli\u003eKaur, D. \u0026amp; Mukhopadhaya, A. Outer membrane protein OmpV mediates \u003cem\u003eSalmonella enterica\u003c/em\u003e serovar typhimurium adhesion to intestinal epithelial cells via fibronectin and alpha1beta1 integrin. \u003cem\u003eCell Microbiol\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, e13172 (2020). https://doi.org:10.1111/cmi.13172\u003c/li\u003e\n\u003cli\u003eXu, C.\u003cem\u003e et al.\u003c/em\u003e Proteomic analysis on the expression of outer membrane proteins of \u003cem\u003eVibrio alginolyticus\u003c/em\u003e at different sodium concentrations. \u003cem\u003eProteomics\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 3142-3152 (2005). https://doi.org:10.1002/pmic.200401128\u003c/li\u003e\n\u003cli\u003eXu, C., Ren, H., Wang, S. \u0026amp; Peng, X. Proteomic analysis of salt-sensitive outer membrane proteins of \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e. \u003cem\u003eRes Microbiol\u003c/em\u003e \u003cstrong\u003e155\u003c/strong\u003e, 835-842 (2004). https://doi.org:10.1016/j.resmic.2004.07.001\u003c/li\u003e\n\u003cli\u003eWu, L.\u003cem\u003e et al.\u003c/em\u003e OmpW and OmpV are required for NaCl regulation in Photobacterium damsela. \u003cem\u003eJ Proteome Res\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 2250-2257 (2006). https://doi.org:10.1021/pr060046c\u003c/li\u003e\n\u003cli\u003eVollmer, W., von Rechenberg, M. \u0026amp; Holtje, J. V. Demonstration of molecular interactions between the murein polymerase PBP1B, the lytic transglycosylase MltA, and the scaffolding protein MipA of \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e274\u003c/strong\u003e, 6726-6734 (1999). https://doi.org:10.1074/jbc.274.10.6726\u003c/li\u003e\n\u003cli\u003eLi, H., Zhang, D. F., Lin, X. M. \u0026amp; Peng, X. X. Outer membrane proteomics of kanamycin-resistant \u003cem\u003eEscherichia coli \u003c/em\u003eidentified MipA as a novel antibiotic resistance-related protein. \u003cem\u003eFEMS Microbiol Lett\u003c/em\u003e \u003cstrong\u003e362\u003c/strong\u003e (2015). https://doi.org:10.1093/femsle/fnv074\u003c/li\u003e\n\u003cli\u003eGiacomucci, S., Mathieu-Denoncourt, A., Vincent, A. T., Jannadi, H. \u0026amp; Duperthuy, M. Experimental evolution of \u003cem\u003eVibrio cholerae\u003c/em\u003e identifies hypervesiculation as a way to increase motility in the presence of polymyxin B. \u003cem\u003eFront Microbiol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 932165 (2022). https://doi.org:10.3389/fmicb.2022.932165\u003c/li\u003e\n\u003cli\u003eManning, A. J. \u0026amp; Kuehn, M. J. Contribution of bacterial outer membrane vesicles to innate bacterial defense. \u003cem\u003eBMC Microbiol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 258 (2011). https://doi.org:10.1186/1471-2180-11-258\u003c/li\u003e\n\u003cli\u003eLi, Z. \u0026amp; Velkov, T. in \u003cem\u003ePolymyxin antibiotics: From laboratory bench to bedside\u003c/em\u003e (eds Jian Li, Roger L. Nation, \u0026amp; Keith S. Kaye) 37-54 (Springer International Publishing, 2019).\u003c/li\u003e\n\u003cli\u003eCerda-Maira, F. A., Ringelberg, C. S. \u0026amp; Taylor, R. K. The bile response repressor BreR regulates expression of the \u003cem\u003eVibrio cholerae breAB\u003c/em\u003e efflux system operon. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e190\u003c/strong\u003e, 7441-7452 (2008). https://doi.org:10.1128/JB.00584-08\u003c/li\u003e\n\u003cli\u003eChung, I. Y., Choi, S. Y., Bae, H. W. \u0026amp; Cho, Y. H. A TetR family regulator of an RND efflux system that directs artemisinin resistance in \u003cem\u003eVibrio cholerae\u003c/em\u003e. \u003cem\u003emSystems\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e0085123 (2024). https://doi.org:10.1128/msystems.00851-23\u003c/li\u003e\n\u003cli\u003eBina, J. E. \u0026amp; Mekalanos, J. J. \u003cem\u003eVibrio cholerae\u003c/em\u003e tolC is required for bile resistance and colonization. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e, 4681-4685 (2001). https://doi.org:10.1128/IAI.69.7.4681-4685.2001\u003c/li\u003e\n\u003cli\u003eTaylor, D. L., Bina, X. R. \u0026amp; Bina, J. E. \u003cem\u003eVibrio cholerae \u003c/em\u003eVexH encodes a multiple drug efflux pump that contributes to the production of cholera toxin and the toxin co-regulated pilus. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e38208 (2012). https://doi.org:10.1371/journal.pone.0038208\u003c/li\u003e\n\u003cli\u003eBina, J.\u003cem\u003e et al.\u003c/em\u003e ToxR regulon of \u003cem\u003eVibrio cholerae\u003c/em\u003e and its expression in vibrios shed by cholera patients. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e100\u003c/strong\u003e, 2801-2806 (2003). https://doi.org:10.1073/pnas.2628026100\u003c/li\u003e\n\u003cli\u003eMa, D.\u003cem\u003e et al.\u003c/em\u003e Genes \u003cem\u003eacrA\u003c/em\u003e and \u003cem\u003eacrB \u003c/em\u003eencode a stress-induced efflux system of \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eMol Microbiol\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 45-55 (1995). https://doi.org:10.1111/j.1365-2958.1995.tb02390.x\u003c/li\u003e\n\u003cli\u003eWeng, Y.\u003cem\u003e et al.\u003c/em\u003e \u003cem\u003eVibrio cholerae \u003c/em\u003eTolC Is required for expression of the ToxR regulon. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, e0024221 (2021). https://doi.org:10.1128/IAI.00242-21\u003c/li\u003e\n\u003cli\u003eCho, T. H. S., Wang, J. \u0026amp; Raivio, T. L. NlpE is an OmpA-associated outer membrane sensor of the Cpx envelope stress response. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e205\u003c/strong\u003e, e0040722 (2023). https://doi.org:10.1128/jb.00407-22\u003c/li\u003e\n\u003cli\u003eDuperthuy, M.\u003cem\u003e et al.\u003c/em\u003e The major outer membrane protein OmpU of \u003cem\u003eVibrio splendidus \u003c/em\u003econtributes to host antimicrobial peptide resistance and is required for virulence in the oyster \u003cem\u003eCrassostrea gigas\u003c/em\u003e. \u003cem\u003eEnviron Microbiol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 951-963 (2010). https://doi.org:10.1111/j.1462-2920.2009.02138.x\u003c/li\u003e\n\u003cli\u003eWalsh, N. P., Alba, B. M., Bose, B., Gross, C. A. \u0026amp; Sauer, R. T. OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e113\u003c/strong\u003e, 61-71 (2003). https://doi.org:10.1016/s0092-8674(03)00203-4\u003c/li\u003e\n\u003cli\u003eMissiakas, D., Mayer, M. P., Lemaire, M., Georgopoulos, C. \u0026amp; Raina, S. Modulation of the \u003cem\u003eEscherichia coli \u003c/em\u003esigmaE (RpoE) heat-shock transcription-factor activity by the RseA, RseB and RseC proteins. \u003cem\u003eMol Microbiol\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 355-371 (1997). https://doi.org:10.1046/j.1365-2958.1997.3601713.x\u003c/li\u003e\n\u003cli\u003eWilken, C., Kitzing, K., Kurzbauer, R., Ehrmann, M. \u0026amp; Clausen, T. Crystal structure of the DegS stress sensor: How a PDZ domain recognizes misfolded protein and activates a protease. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e117\u003c/strong\u003e, 483-494 (2004). https://doi.org:10.1016/s0092-8674(04)00454-4\u003c/li\u003e\n\u003cli\u003eAdes, S. E., Connolly, L. E., Alba, B. M. \u0026amp; Gross, C. A. The \u003cem\u003eEscherichia coli \u003c/em\u003esigma(E)-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 2449-2461 (1999). https://doi.org:10.1101/gad.13.18.2449\u003c/li\u003e\n\u003cli\u003eKanehara, K., Ito, K. \u0026amp; Akiyama, Y. YaeL (EcfE) activates the sigma(E) pathway of stress response through a site-2 cleavage of anti-sigma(E), RseA. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 2147-2155 (2002). https://doi.org:10.1101/gad.1002302\u003c/li\u003e\n\u003cli\u003eDavis, B. M. \u0026amp; Waldor, M. K. High-throughput sequencing reveals suppressors of \u003cem\u003eVibrio cholerae rpoE \u003c/em\u003emutations: one fewer porin is enough. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 5757-5767 (2009). https://doi.org:10.1093/nar/gkp568\u003c/li\u003e\n\u003cli\u003eZhang, H., Srinivas, S., Xu, Y., Wei, W. \u0026amp; Feng, Y. Genetic and biochemical mechanisms for bacterial lipid A modifiers associated with polymyxin resistance. \u003cem\u003eTrends Biochem Sci\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 973-988 (2019). https://doi.org:10.1016/j.tibs.2019.06.002\u003c/li\u003e\n\u003cli\u003eBenz, R., Maier, E. \u0026amp; Chakraborty, T. Purification of OmpU from \u003cem\u003eVibrio cholerae\u003c/em\u003e classical strain 569B: evidence for the formation of large cation-selective ion-permeable channels by OmpU. \u003cem\u003eMicrobiologia\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 321-330 (1997). \u003c/li\u003e\n\u003cli\u003eTapia-Pastrana, G., Chavez-Duenas, L., Lanz-Mendoza, H., Teter, K. \u0026amp; Navarro-Garcia, F. VirK is a periplasmic protein required for efficient secretion of plasmid-encoded toxin from enteroaggregative \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 2276-2285 (2012). https://doi.org:10.1128/IAI.00167-12\u003c/li\u003e\n\u003cli\u003eAllue-Guardia, A., Echazarreta, M., Koenig, S. S. K., Klose, K. E. \u0026amp; Eppinger, M. Closed genome sequence of \u003cem\u003eVibrio cholerae\u003c/em\u003e O1 El Tor Inaba strain A1552. \u003cem\u003eGenome Announc\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e (2018). https://doi.org:10.1128/genomeA.00098-18\u003c/li\u003e\n\u003cli\u003eDatsenko, K. A. \u0026amp; Wanner, B. L. One-step inactivation of chromosomal genes in \u003cem\u003eEscherichia coli \u003c/em\u003eK-12 using PCR products. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e97\u003c/strong\u003e, 6640-6645 (2000). https://doi.org:10.1073/pnas.120163297\u003c/li\u003e\n\u003cli\u003eYamamoto, S., Izumiya, H., Morita, M., Arakawa, E. \u0026amp; Watanabe, H. Application of \u003cem\u003elambda\u003c/em\u003e Red recombination system to \u003cem\u003eVibrio cholerae\u003c/em\u003e genetics: simple methods for inactivation and modification of chromosomal genes. \u003cem\u003eGene\u003c/em\u003e \u003cstrong\u003e438\u003c/strong\u003e, 57-64 (2009). https://doi.org:10.1016/j.gene.2009.02.015\u003c/li\u003e\n\u003cli\u003eMarvig, R. L. \u0026amp; Blokesch, M. Natural transformation of \u003cem\u003eVibrio cholerae\u003c/em\u003e as a tool--optimizing the procedure. \u003cem\u003eBMC Microbiol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 155 (2010). https://doi.org:10.1186/1471-2180-10-155\u003c/li\u003e\n\u003cli\u003eSt-Pierre, F.\u003cem\u003e et al.\u003c/em\u003e One-step cloning and chromosomal integration of DNA. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 537-541 (2013). https://doi.org:10.1021/sb400021j\u003c/li\u003e\n\u003cli\u003eLiu, J.\u003cem\u003e et al.\u003c/em\u003e An Improved Method of Preparing High Efficiency Transformation \u003cem\u003eEscherichia coli\u003c/em\u003e with Both Plasmids and Larger DNA Fragments. \u003cem\u003eIndian J Microbiol\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 448-456 (2018). https://doi.org:10.1007/s12088-018-0743-z\u003c/li\u003e\n\u003cli\u003eAltschul, S. F., Gish, W., Miller, W., Myers, E. W. \u0026amp; Lipman, D. J. Basic local alignment search tool. \u003cem\u003eJ Mol Biol\u003c/em\u003e \u003cstrong\u003e215\u003c/strong\u003e, 403-410 (1990). https://doi.org:10.1016/S0022-2836(05)80360-2\u003c/li\u003e\n\u003cli\u003eNečas, D. \u0026amp; Klapetek, P. Gwyddion: an open-source software for SPM data analysis. \u003cstrong\u003e10\u003c/strong\u003e, 181-188 (2012). https://doi.org:doi:10.2478/s11534-011-0096-2\u003c/li\u003e\n\u003cli\u003eMa, B.\u003cem\u003e et al.\u003c/em\u003e Contemporaneous measurement of outer and inner membrane permeability in Gram-negative bacteria. \u003cem\u003eBio Protoc\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e3548 (2020). https://doi.org:10.21769/BioProtoc.3548\u003c/li\u003e\n\u003cli\u003eTeufel, F.\u003cem\u003e et al.\u003c/em\u003e SignalP 6.0 predicts all five types of signal peptides using protein language models. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 1023-1025 (2022). https://doi.org:10.1038/s41587-021-01156-3\u003c/li\u003e\n\u003cli\u003eJumper, J.\u003cem\u003e et al.\u003c/em\u003e Highly accurate protein structure prediction with AlphaFold. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e596\u003c/strong\u003e, 583-589 (2021). https://doi.org:10.1038/s41586-021-03819-2\u003c/li\u003e\n\u003cli\u003eMeng, E. C.\u003cem\u003e et al.\u003c/em\u003e UCSF ChimeraX: Tools for structure building and analysis. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, e4792 (2023). https://doi.org:10.1002/pro.4792\u003c/li\u003e\n\u003cli\u003eJurrus, E.\u003cem\u003e et al.\u003c/em\u003e Improvements to the APBS biomolecular solvation software suite. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 112-128 (2018). https://doi.org:10.1002/pro.3280\u003c/li\u003e\n\u003cli\u003ePettersen, E. F.\u003cem\u003e et al.\u003c/em\u003e UCSF Chimera--a visualization system for exploratory research and analysis. \u003cem\u003eJ Comput Chem\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 1605-1612 (2004). https://doi.org:10.1002/jcc.20084\u003c/li\u003e\n\u003cli\u003eGuzman, L. M., Belin, D., Carson, M. J. \u0026amp; Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e177\u003c/strong\u003e, 4121-4130 (1995). https://doi.org:10.1128/jb.177.14.4121-4130.1995\u003c/li\u003e\n\u003cli\u003eThe Gene Ontology, C.\u003cem\u003e et al.\u003c/em\u003e The Gene Ontology knowledgebase in 2023. \u003cem\u003eGenetics\u003c/em\u003e \u003cstrong\u003e224\u003c/strong\u003e, iyad031 (2023). https://doi.org:10.1093/genetics/iyad031\u003c/li\u003e\n\u003cli\u003eAshburner, M.\u003cem\u003e et al.\u003c/em\u003e Gene Ontology: tool for the unification of biology. \u003cem\u003eNature Genetics\u003c/em\u003e\u003cstrong\u003e25\u003c/strong\u003e, 25-29 (2000). https://doi.org:10.1038/75556\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Vibrio cholerae, OmpV, polymyxin B, antimicrobial peptides, antimicrobial resistance, resistance operon","lastPublishedDoi":"10.21203/rs.3.rs-5220433/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5220433/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAntimicrobial peptides are small cationic molecules produced by eukaryotic cells to combat infection, as well as by bacteria for niche competition. Polymyxin B (PmB), a cyclic antimicrobial peptide, is used prophylactically in livestock and as a last-resort treatment for multidrug-resistant bacterial infections in humans. In this study, a transcriptomic analysis in \u003cem\u003eVibrio cholerae\u003c/em\u003e showed that expression of the uncharacterized gene \u003cem\u003eompV\u003c/em\u003e is stimulated in response to PmB. We found that \u003cem\u003eompV\u003c/em\u003e is organized in a conserved four-gene operon with the two-component system \u003cem\u003ecarRS\u003c/em\u003e and \u003cem\u003evirK \u003c/em\u003ein \u003cem\u003eV.\u003c/em\u003e \u003cem\u003echolerae\u003c/em\u003e. A \u003cem\u003evirK\u003c/em\u003edeletion mutant and an \u003cem\u003eompV\u003c/em\u003e deletion mutant were more sensitive to antimicrobials, suggesting that both OmpV and VirK contribute to antimicrobial resistance. Our transcriptomic analysis showed that the efflux pump \u003cem\u003evexAB\u003c/em\u003e, a known effector of PmB resistance, was upregulated in an \u003cem\u003eompV\u003c/em\u003e-dependent manner in the presence of PmB. The predicted structure of OmpV revealed a lateral opening in the β-barrel wall with access to an electronegative pocket in the barrel lumen that can accommodate PmB. Such an interaction could facilitate intracellular signaling through a conformational change in OmpV. This provides the first evidence of a specialized operon governing multiple systems for antimicrobial resistance in \u003cem\u003eV. cholerae\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"The carRS-ompV-virK operon of Vibrio cholerae senses antimicrobial peptides and activates the expression of multiple resistance systems","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-25 06:42:48","doi":"10.21203/rs.3.rs-5220433/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-04-10T04:28:34+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-26T05:51:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"204996329617008090606804018879676635438","date":"2025-03-24T14:41:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"3709332365397072344616033336143393841","date":"2025-03-24T14:41:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-24T14:34:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-21T15:18:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-11T14:39:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"37bb1d9d-05fd-4f2a-909c-89d525ac5a64","owner":[],"postedDate":"March 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46142417,"name":"Biological sciences/Microbiology"},{"id":46142418,"name":"Biological sciences/Microbiology/Antimicrobials"},{"id":46142419,"name":"Biological sciences/Microbiology/Bacteria"},{"id":46142420,"name":"Biological sciences/Microbiology/Bacteriology"},{"id":46142421,"name":"Biological sciences/Microbiology/Pathogens"},{"id":46142422,"name":"Biological sciences/Molecular biology"},{"id":46142423,"name":"Biological sciences/Molecular biology/Transcriptomics"}],"tags":[],"updatedAt":"2025-04-28T16:02:34+00:00","versionOfRecord":{"articleIdentity":"rs-5220433","link":"https://doi.org/10.1038/s41598-025-98217-3","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-04-21 15:57:47","publishedOnDateReadable":"April 21st, 2025"},"versionCreatedAt":"2025-03-25 06:42:48","video":"","vorDoi":"10.1038/s41598-025-98217-3","vorDoiUrl":"https://doi.org/10.1038/s41598-025-98217-3","workflowStages":[]},"version":"v1","identity":"rs-5220433","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5220433","identity":"rs-5220433","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.