Alpha lipoic acid diminishes migration and invasion in hepatocellular carcinoma cells through an AMPK-p53 axis

Alpha lipoic acid diminishes migration and invasion in hepatocellular carcinoma cells through an AMPK-p53 axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Alpha lipoic acid diminishes migration and invasion in hepatocellular carcinoma cells through an AMPK-p53 axis Florencia Hidalgo, Anabela C. Ferretti, Carla Borini Etichetti, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3773984/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Hepatocellular carcinoma (HCC) associated with viral or metabolic liver diseases is a growing cancer that lacks effective therapy. AMPK is downregulated in the early stages of HCC and its activation diminishes tumor progression in culture and in vivo. Alpha lipoic acid (ALA), an indirect AMPK activator that inhibits hepatic steatosis in rodents, shows antitumor effects in different cancers. We aimed to study the putative antitumor action of ALA in HCC cells through AMPK signaling. ALA led to significant inhibition of cell migration and invasion in HCC cells with wild-type TP53. We showed that these effects depended on AMPK, and ALA also increased the levels and nuclear compartmentalization of the AMPK target p53. The anti-invasive effect of ALA was abrogated in stable-silenced versus isogenic-TP53 cells. Furthermore, ALA inhibited epithelial-mesenchymal transition in control wild-type TP53, but no significant changes of EMT markers were observed in silenced TP53 cells. In addition, we spotted that in patients from the HCC-TCGA dataset some EMT genes showed different expression patterns or survival profiles depending on TP53 status. ALA emerges as a potent activator of AMPK-p53 axis in HCC cells, and it decreases migration/invasion by reducing EMT which could mitigate the disease in wild-type TP53 patients. Biological sciences/Cancer/Gastrointestinal cancer/Liver cancer/Hepatocellular carcinoma Biological sciences/Cell biology/Cell migration/Epithelial mesenchymal transition AMPK EMT Hepatocarcinoma Migration Signaling TP53 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Hepatocellular carcinoma (HCC) is one of the main causes of death by cancer and current surgical or chemotherapeutic treatments fail in improving survival in most of the patients 1 . HCC is generally associated with an underlying chronic liver disease such as viral hepatitis, alcoholic cirrhosis or metabolic associated fatty liver disease. The latter is an increasing cause of pathology in occidental countries 2 . Carcinogenic transformation develops on these inflammatory diseases by producing dysplastic nodules that evolve into neoplastic foci with great molecular heterogeneity, to which a high intra and extra hepatic metastatic capacity is added making HCC a very aggressive cancer 3 , 4 . In this regard, to find new treatments that reduce or even prevent the rapid progression of HCC is a pressing matter of research. AMP activated kinase (AMPK) is a hetero trimer constituted by α, β and γ subunits, whose catalytic α subunit, in response to energy stress, is phosphorylated and activated by upstream kinases like LKB1 and it is stabilized by increased levels of AMP that bounds to γ subunit 5 . AMPK activation is both a hierarchical and a compartmentalized process that depends on the stress level, and where different isoforms of AMPK subunits form active complexes with different proteins in lysosomes, mitochondria and nucleus 6 , 7 . Activation of AMPK in different types of cancer cells induces distinct antitumor effects including decrease in cell survival or reduction of invasiveness 8 , 9 , 10 , 11 , which support it as an eligible target for therapy, at least in the initial states of the transformation process when AMPK would act as a tumor suppressor 12 , 13 . Moreover, given that during energy stress the effects of the tumor suppressor p53 are intertwined with the LKB1-AMPK axis as both a target and activator, the role of p53 in the therapeutic activation of this pathway should be considered, for a review see 14 and 15 . In HCC patients, active AMPK is decreased in tumor in comparison to neighboring tissue, and AMPK activation has been suggested as an effective antitumor strategy in mice 16 , 17 . In previous reports, we found that in HCC-derived cells different ways of activating AMPK, such as glucose restriction 18 and metformin, not only induce cell death but they early inhibit migration and invasion 19 . Alpha lipoic acid (ALA), a natural compound that is a physiological cofactor of mitochondrial pyruvate dehydrogenase (PDH), was studied as a possible anticancer drug in different types of cancer cells 20 , 21 . ALA induces mitochondrial dysfunction and cytotoxicity in various tumor cells where it is able to activate AMPK and, in some cases, ALA also decreases invasion through AMPK-p53 axis 20 , 22 . It is attractive to determine if this AMPK activator leads to any AMPK mediated anticarcinogenic actions in HCC cells, given that former studies show induction of apoptosis by ALA in HCC cell lines without clarifying other possible antitumor effects 23 . Interestingly, ALA activates hepatic AMPK in rat steatosis, and it decreases lipogenesis 24 , 25 . We hypothesize that ALA can induce different antitumor events through AMPK signaling in HCC cells as well. This therapeutic scenario would be very promising because of the putative multiple actions of ALA in metabolic or neoplastic liver disease. The control of epithelial-mesenchymal transition (EMT) in the carcinogenic and pre carcinogenic liver is a potential target to stop HCC progression 26 . p53 has been postulated as an unequivocal regulator of the stability of EMT transcription factors in diverse tumors 27 , 28 . Therefore, it is interesting to explore if ALA could modulate these functions in HCC cells via p53. In this study we tried to analyze the effect of ALA not only in the viability but also in the invasiveness of HCC cells, and to investigate if AMPK and its target p53 could be involved. For this purpose, we studied the response to ALA in HCC derived cells with different AMPK and p53 status. Methods Cell culture and genetic manipulations Hepatocellular carcinoma cells C3A (HepG2/C3A, a clonal derivative of HepG2, ATCC, Manassas, VA), and Hep3B (Hep 3B2.1–7, ATCC) were grown with 4.5 g/L glucose DMEM (Gibco, Thermo Fisher Scientific, Waltham, MA), plus 10% FBS and 100 U/ml penicillin and streptomycin (Invitrogen, Waltham, MA). Cells were cultured in a humidified incubator at 37ºC with 5% CO 2, and tested periodically for mycoplasma by PCR. When indicated, alpha lipoic acid (0.5 or 1 mM, Santa Cruz Biotechnology Inc., Santa Cruz, CA) was added. For reducing AMPKα1 protein expression in C3A cells, 21 nucleotide duplexes targeting two specific sequences and a scrambled control were designed and synthesized by Ambion SilencerTMsiRNA (Ambion, Thermo Fisher Scientific). The target sequences were AMPKα1 1842–1864: AACATTTCTGCATATTAGGCTCCTGTCTC and 2659–2681: AAGAGCTGAGTTGCATATACTCCTGTCTC, as we previously reported 19 . Experiments with silenced cells were carried out 24–48 h after transfection using siPORT NeoFX (Ambion, Thermo Fisher Scientific) with the Negative Control siRNA (Ambion) or the synthesized siRNAs against AMPKa1, and decrease (60 to 80%) in AMPKα expression for both duplexes was confirmed by immunoblotting. For stable knockdown of p53 in C3A cells, transduction with retrovirus-based plasmids harboring the following specific and control shRNAs were carried out: shp53 (GACUCCAGUGGUAAUCUAC), shp53-3′UTR (GGUGAACCUUAGUACCUAA), and control shLacZ (GUGACCAGCGAAUACCUGU), as we previously described 29 . Plasmid DNA was prepared using the Wizard DNA purification kit (Promega, Madison, WI). p53 diminution (80–90%) was confirmed by qRT-PCR. Colony formation assay Low density cell inoculum (1000 cells) was seeded in 35 mm dishes of 6-well plates and grew up to 15 days to allow the formation of visible colonies. After washing the colonies were fixed with cold methanol and toluidine blue staining was performed for 10 min. After removing the excess of colorant, the dishes were photographed and the number of colonies were counted and compared. MTT assay HCC cells were plated at the same density by triplicate in 96-well microplates and incubated 2 h with methylthiazolyldiphenyl-tetrazolium bromide (MTT, Sigma Chemical Co., St Louis, MO) at the indicated time. The metabolite produced from viable cells was dissolved in DMSO and detected at 540 nm in a microplate reader (Beckman Coulter LD400), as we described 19 . Results were expressed as percentage of absorbance in cells at 0 time. Annexin V/propidium iodide assay Annexin V assay (BD Biosciences, San José, CA) was used following the manufacturer recommendations and the samples were prepared as we previously described 18 . Briefly, after 48 h of treatments, homogenization in the medium and harvest, 100,000 cells were gently re-suspended and phosphatidylserine externalization and cell death was detected by staining with Annexin V-FITC and PI, respectively. The stained cells were subjected to flow cytometric analysis (Cell Sorter BD FACSAria II, BD Biosciences). Cell cycle analysis The proportion of cells in each cell cycle population at 48 h of culture in different conditions was analyzed by determining the cellular DNA content by flow cytometry (Cell Sorter BD FACSAria II, BD Biosciences), as we previously described 18 . In brief, 1 × 10 6 cells were fixed in 70% ethanol, washed and stained with 50 µg/ml propidium iodide (Sigma Chemical Co.) in a solution containing 0.1% sodium citrate, 0.02 mg/ml RNAse, and 0.3% NP-40. WinMDi and Cylchred softwares were used for data analysis. Wound healing assay Collective cell migration was determined by wound healing assay as we previously described 30 , with slight modifications. Briefly, cells were plated (6-well plates) at 1.5 × 10 6 cells/ml and growth for 24 h. Monolayers were wounded by dragging a 200-µl pipette tip, washed and treated. Captures of microscopy images (Zeiss Axiovert 25) of wounds were obtained at 0 h and 24 h after wounding. Lineal advance of the wound front (µm) was assessed by using ImageJ. Invasion studies For invasion assays, transwell chambers (Biofil, Beijing, China) with 8 µm pore size polyester membrane filters were coated with 250 µg/ml Matrigel (Corning, Corning, NY). Suspension of cells (1 × 105) in DMEM containing 1% FBS were plated into the upper chamber, and the lower chamber was filled with complete DMEM medium containing 10% FBS. Cells were treated for 48 h and after this period those cells that reached the lower chamber were fixed with methanol, stained with 1% toluidine blue-1% borax for 5 min, and counted by microscopy captures, as we previously described 19 . Immunofluorescence microscopy Cells were grown on coverslips, treated for 24 h and, at the end of experiments, fixed, permeabilized and blocked with 0.3% Triton X-100-1% albumin. Then, cell samples were incubated with anti p53 (sc-126, Santa Cruz Biotechnology), washed, incubated with anti-mouse secondary antibody (Invitrogen) and then incubated for nuclei staining with 4′,6-diamidino-2-phenylindole (DAPI, Molecular Probes, Eugene, OR), and mounted with ProLong (Molecular Probes). Fluorescence was detected by a confocal microscopy (Nikon C1SiR with inverted microscope Nikon TE200). Nuclear intensity of p53 staining was assessed in the Z-stack projections by using ImageJ tools. Western Blotting Cell lysates were obtained after scrapping and washing the cultured cells subjected to the indicated treatments during the indicated time. The harvest cells were incubated in 100 µl of ice cold RIPA buffer with protease and phosphatase inhibitors for 30 min and sonicated. Protein concentration was determined by the Lowry's method. Equal amounts of total protein (30–50 µg) were loaded, resolved by electrophoresis on SDS-polyacrylamide gels 31 , and transferred to polyvinylidene difluoride membranes (Perkin Elmer Life Sciences, Boston, MA, USA). Molecular weights were estimated using “rainbow” molecular weight markers. The membranes were blocked with 5% non-fat milk/0.3% Tween/PBS, washed and incubated O.N. with each primary antibody [α tubulin (T-5168 Sigma Chemical Co.); p53(DO-1), GAPDH (FL-335) (sc-126 and sc-25778 Santa Cruz Biotechnology); AMPKα, Phospho-AMPKα (Thr172), SNAIL/C15D3 (2532, 2535, 3879 Cell Signaling Technology); or E-cadherin (610182 BD Biosciences)]. After incubation of the membranes with the appropriate secondary antibody, the bands were detected by chemiluminescence (Amersham Pharmacia Biotech, Piscataway, NJ). Real-time quantitative PCR cDNA was obtained from Trizol (Invitrogen) extracts by retrotranscription with retrotranscriptase M-MLV (Promega) following the manufacturer conditions, and real-time PCR was performed using SYBR Green PCR master mix (Promega) according to the following conditions: 2 min at 95 ºC for one cycle; and 30 s at 95 ºC, 20 s at 60 ºC, 30 s at 72 ºC for 40 cycles. Results were analyzed using the comparative Ct method. Values were normalized to GAPDH expression. The following real-time PCR forward and reverse primers were used, respectively: TP53 : CTCCTCTCCCCAGCCAAAGA, GGAACATCTCGAAGCGCTCA; CDH1 : AAGAAGCTGGCTGACATGTACGGA, CCACCAGCAACGTGATTTCTGCAT; VIM : CCCTGCAATCTTTCAGACAG, ATCTGAGCCTGCAGCTCCT; SNAI1 : CCAGAGTTTACCTTCCAGCAGCC, CAGGACAGAGTCCCAGATGAGCAT; GAPDH : TCTCTGCTCCTCCTGTTC, GCCCAATACGACCAAATCC. Bioinformatic analyses RNAseq data from HCC patients (371 tumor and 50 non tumor samples) were obtained from TCGA datasets accessible from http://gdac.broadinstitute.org/ . Data were organized and processed for differential gene expression (DGE) analysis for a selected group of EMT related genes with EDAseq and edgeR, respectively. Other packages from tydiverse were used for data management. Mean log2 fold change (log2FC), p, and false discovery rate (FDR) values were obtained. Values of log2FC > 1 or 1 (FDR < 0.01) were set as cutoffs. A heatmap plot from the 50 patients with paired tumor and non-tumor samples was performed for the indicated genes using complexHeatmap, and the results were splitted in two groups by the status of TP53 gene. In the same dataset a comparison of the distribution of frequencies of log2FC values for each gene was performed between those patients with wild type (n = 37) or mutant TP53 (n = 13) using the Kolmogorov–Smirnov test. This analysis was performed with SAS Studio, and a p-value < 0.05 was considered statistically significant. Further expression profiles of the genes studied from the same TCGA patients were analyzed through the tools of the UALCAN data portal ( http://ualcan.path.uab.edu ). These tools match expression and clinical data allowing comparison of expression levels in different groups of patients, as cancer stages and others. Data processing and statistical analysis were described by the authors 32 . In addition, expression plus survival assays of these genes from the same dataset of TCGA were also analyzed with the visualization tools of The Human Protein Atlas ( www.proteinatlas.org ). For those groups of patients with low or high expression (below or above the median) of the selected genes with wild type or mutant TP53 survival analysis were performed using survival and survminer R tools. p < 0.05 was set as a significant difference among the Kaplan-Meier curves. When it was necessary, hazard ratios (HR) were calculated and represented as a forest plot and the p value for HR between the reference group versus each of the others was obtained. Statistical analysis In all the studies except for bioinformatics, data were expressed as mean ± S.E.M. and statistical comparisons were made by using Student t test. p < 0.05 was considered statistically significant. Results Changes in cell viability and growth in response to ALA ALA is well established as an oxidative stress and apoptosis inductor in HCC cells at a dose of 0.5 mM 23 , as occurs in different cancer cells 20 . We explored the effects of this low millimolar level of ALA in HCC derived cells: Both 0.5 and 1mM concentrations led to decreases in the number of viable cells, but the lower concentration had no significant effect below 48h. At 48 h the decreases in viability were − 20 and − 35% of control cells, respectively, as observed by MTT assay in C3A cells (Fig. 1 A), and similarly in Hep3B cells (data not shown). A marked diminution in colony formation was induced by ALA already at 0.5 mM suggesting a loss in the ability of treated cells to form clonal colonies (Fig. 1 B). To better characterize these phenomena, we performed cell death and cell cycle analyses in C3A and Hep3B cells. Cytometric analysis of apoptotic populations by AnnexinV/PI staining in HCC derived cells showed that total apoptotic cells (Annexin V positive) significantly increased by 30 or 80% after 48 h treatments with 0.5 or 1mM ALA, respectively. Those cells dead by apoptosis (double positive) reached nearly 8 or 12% of the cells in the presence of 0.5 or 1mM ALA after 48 h, respectively (Fig. 1 C). In addition, a 48-h treatment with 0.5 mM ALA arrested cell cycle at G0/G1 (Fig. 1 D). Altogether, results corroborated that ALA had diverse antitumor effects in HCC cells: a proapoptotic and a considerable cytostatic action reflected in the inhibition of anchorage independent growth. ALA impaired migration and invasion in wild type p53-HCC cells When migratory capacity and invasiveness of C3A and Hep3B cells were analyzed at a dose of 0.5 mM, which showed minor effects in viability, we found that, in HepG2/C3A cells (wild type TP53), 2D migration in the wound front along 24h decreased by 40% in ALA treated versus control cells. Conversely, migration in Hep3B cells (TP53 deletion) was the same irrespectively of ALA treatment (Fig. 2 A). In addition, invasion studies showed that invasion through matrigel coated transwells was significantly diminished by a half of the control values in C3A cells treated with 0.5 mM ALA, whilst under this treatment invasion of Hep3B cells was maintained without significant changes (Fig. 2 B). These results suggested that a distinct response of the migratory function to ALA could be attributed to the different genetic background of the cells. The anti-migratory effect of ALA was completely dependent on AMPK activation In order to deepen in the mechanism of the striking effect of ALA in migration and invasion of HCC cells that express the AMPK target p53, we evaluated the role of AMPK signaling in the decrease of these migratory functions. First, we detected AMPK activation in these HCC cells subjected to ALA treatment. ALA increased the levels of pAMPK (Fig. 3 A) in HepG2/C3A cells, and this was accompanied by an increase of p53 expression levels and also of its nuclear localization (Fig. 3 A, B). In turn, we analyzed the effect of the knockdown of the catalytic subunit of AMPK in HepG2/C3A cells (Fig. 3 C, upper left) on the migratory response and observed that this significantly blocked the anti-migratory effect of 0.5 mM ALA in C3A cells (Fig. 3 C). In association with this, the silencing of AMPKa abrogated the increase in total p53 levels in ALA treated cells (Fig. 3 D). Migration-Invasion in cell lines with diminished expression of p53 To determine the precise contribution of wild type p53 in the reduction of migration/invasion in HCC cells by ALA, we constructed from HepG2/C3A cells a control (shLacZ) and two stable retroviral clones with impaired expression of p53 (shp53 and shp53-3’UTR). The silenced cell lines showed more than 80%-reduction of TP53 transcription checked by qPCR (Supp. Figure 1 A). ALA (0.5 mM) effect was analyzed in these cells at the level of migration in wound healing assay and invasion through matrigel coated transwells. The knockdown of p53 almost completely blocked the anti migratory and anti invasive effects of ALA as observed in shp53 cells (Fig. 4 A and B), and in shp53-3’UTR cells (data not shown), thus confirming that p53 expression is needed for ALA anti migratory and anti-invasive actions. Analysis of EMT markers in HCC cells treated with ALA: role of wild type TP53 Migration and invasion in cancer cells depend mostly on the acquisition of mesenchymal properties which take place with the epithelial mesenchymal transition. Given that ALA reduced migration-invasion only in HCC cells that express wild type p53, a possibility existed that one or more proteins involved in EMT were affected via p53 in these cells thus inhibiting EMT and migration-invasion. When we analyzed some of these EMT markers after ALA treatment, we detected that the epithelial protein E-cadherin significantly increased its levels in ALA treated C3A cells but remained unchanged in Hep3B, in opposition with the levels of its negative regulator SNAIL which showed significant reduction in ALA treated C3A cells (Fig. 5 A). We confirmed similar ALA effects dependent on TP53 expression in the constructed cell clones: In fact, CDH1 mRNA levels increased after ALA treatment in control but were unchanged in shp53 cells (Fig. 5 B). Conversely, VIM decreased after ALA treatment in control cells only, although SNAI1 mRNA levels showed no significant changes at the time analyzed (Fig. 5 B). Altogether, these data pointed out that ALA inhibited EMT in HCC cells mostly via p53. Variations in the expression of EMT related genes putatively regulated by p53 and the impact in survival in HCC patients We then indagued if in fact some EMT actors had different expressions and could conditionate the outcome of HCC patients depending on p53. We first evaluated if HCC-TCGA patients presented changes in the expression of EMT related genes putatively regulated by p53. We focused on a set of genes including the EMT markers CDH1 , CDH2 and VIM ; as well as EMT transcription factors demonstrated to be negatively regulated by p53 in vitro : ZEB1/2 , TWIST1/2 and SNAI1/2 26,33 . In addition, we included genes involved in ECM degradation as the metalloproteinases MMP2 and MMP9 , also regulated by p53 34 . DGE analysis carried out in the complete dataset of HCC-TCGA patients showed that, of the selected genes, only VIM, MMP2, SNAI2, MMP9 and TWIST1 were differentially expressed and increased their expression in tumor versus non tumor samples, and no decreases (log2FC < 1) with statistically significance were detected (Fig. 6 A). A heatmap representation of gene expression in those 50 patients with paired control and tumor samples was performed and the plots were filtered and splitted in two groups of patients by TP53 status: although the clustering of genes was discretely different depending on TP53 , most of the patients had increased expression of MMP9 and SNAI2 , and, in the opposite side, most of them presented a decreased expression of CDH1 , as SNAI1 and ZEB2 which seemed counter-regulated with respect to their related transcription factors (Fig. 6 B). In the same group we compared the values of relative expression levels between patients with mutant TP53 and patients with wild type TP53 , and we observed that only in the case of CDH1 the distribution of values was significantly different in both populations: Patients with wild type TP53 had more preserved levels of CDH1 than those with mutant TP53 (Fig. 6 C). We also analyzed this set of genes in the same HCC-TCGA patients using the data analysis tools accessible from UALCAN and we compared gene expression levels among each cancer stage: Significant decreases in CDH1 , and increases in VIM, SNAI2, TWIST1, ZEB1 and MMPs in different stages were observed (Fig. 6 D). Again, SNAI1, ZEB2 and TWIST2 had decreased expressions (omitted in the figure), which were non-significant in the case of SNAI1 . In turn, we studied if these EMT related genes which are potential p53 targets led to any change in survival depending on the TP53 mutation status. In fact, TP53 expression levels were increased in most HCC patients from TCGA, which did not affect survival, however, survival did depend on mutation status: WT- TP53 patients showed a risk of death 65% lower than MUT- TP53 patients (Supp. Figure 1 B). We then analyzed if low or high levels of each selected gene in combination with the status of TP53 , wild type or mutant, led to any change in survival. Neither CDH1 (Fig. 6 E, left) nor VIM nor the EMT transcription factors expression levels in the presence of any of the two TP53 status were associated with significant changes in patient survival. Only in the case of MMP9 a significant difference among survival curves was found: In patients with low MMP9 expression and WT TP53 the longest median survival was registered, and the risk of death was less than half of the risk of those with high MMP9 plus mutant TP53 (Fig. 6 E, right). Discussion The uncontrolled growth and proliferation of tumor cells are very dependent on their increased glycolytic rate 35 . PDH catalyzes the decarboxylation of pyruvate in the TCA cycle, and prevention of pyruvate entry into the TCA cycle favors glycolysis and would promote tumor metabolic phenotype and survival of cancer cells, which is associated with high expression of the kinases that negatively regulate PDH, PDKs 36 , 37 . In this connection, recent studies in HCC cells demonstrate that PDH activation through downregulation of PDK4 leads to energy stress, increased ROS production and apoptosis 38 . The drug we analyze in this work, ALA, acts as a bonafide PDK inhibitor that is an effective anticarcinogenic drug in different tumor cells 39 , however its actions in HCC cells are not completely studied, especially the putative activation of AMPK and p53 as a mediator of antitumor effects. Considering this perspective, in this report we first tried to determine the effect of ALA in the whole viability and capacity of growth of HCC derived cells, and to further evaluate ALA effect on the metastatic ability through migration and invasion studies: We demonstrated that ALA had a cytotoxic effect, due to a well described pro apoptotic action. In addition, ALA treatment led to inhibition of cell cycle at G0 in the two different cell lines assayed. However, we observed that the anti-migratory and anti-invasive effects of ALA were significant in HepG2/C3A, but not appreciable in Hep3B cells. Given that the last cell line has a distinctive genetic background because of HBV gene inserts and p53 gene deletion, we aimed to better define the role of p53 in this response to ALA. ALA induces AMPK activation in different tumor cells where it may mediate many anticarcinogenic effects 21 , so we determined AMPKa phosphorylation (T172) levels in HCC cells treated with ALA: p-AMPK levels were significantly increased by ALA at low millimolar concentration in HCC cells. Besides, we demonstrated that ALA increased total and nuclear levels of the target of AMPK p53 in HepG2/C3A cells, which could be associated with the activation of p53. These results agreed strongly with recent evidence describing both stabilization and nuclear translocation of p53 in HepG2 cells during energy stress by fasting 40 , 41 . Furthermore, we observed that interfering with the expression of the catalytic subunit of AMPK resulted in a complete blockage in both p53 increase and migration reduction after ALA treatment in C3A cells. These findings indicated that ALA antimigratory effect is dependent on AMPK signaling and that p53 activation is a putative downstream event leading to this antitumor action. Pioneer genomic studies in HCC patients show by the first that survival in patients with mutations in the tumor suppressor p53 is diminished 42 . In fact, mutation of TP53 occurs early and it is a driver of HCC progression 43 , whilst the conservation of wild type TP53 could represent a significant benefit in the outcome of HCC, and a possibility to stabilize or activate p53 through novel strategies with antitumor results 44 , 45 , 46 . Wild type p53 is involved in the negative regulation of different EMT transcription factors in HCC 33 , 47 , 48 , hence we postulate that the status of p53 could be a strong determinant of the migratory ability of HCC cells and that the increase of WT p53 could lead to anti migratory effects. In the results presented herein, the stable silencing of WT p53 in HepG2/C3A cells avoided the reduction of migration and invasion after ALA treatment attributed to AMPK activation. These findings corroborated those we obtained in the p53-null cell line Hep3B, and they indicated that the activity of p53 is necessary in the anti migratory effect of ALA in HCC cells. We then tried to determine if EMT was inhibited by this axis after ALA treatment in HCC cells, thus explaining the reduction in migration and invasion observed. We evaluated the effect of ALA on EMT in C3A and Hep3B cells and in control and shp53-C3A cells. Altogether this set of results demonstrated that ALA increases E-cadherin probably via SNAIL reduction in cells expressing wild type p53 only, which is in the vein with the anti-migratory effect of ALA in these cells. The results also suggested the gravitation of E-cadherin in HCC biology depending on the presence of wild type p53. In this connection, several findings support that E-cadherin expression diminishes in more metastatic HCC forms 49 , 50 , 51 , and that SNAIL or TWIST roles in E-cadherin downregulation and metastasis are crucial 52 . However, the impact of the variations of these EMT markers in relation with other tumor regulators as p53 is understudied in HCC patients. For these reasons, we analyzed if some of these actors of the EMT process potentially regulated by p53 changed its gene expression and conditioned survival in HCC patients depending on TP53 status. Of the genes selected, CDH1 significantly decreased its expression, whilst SNAI2 , TWIST1, ZEB1, VIM, MMP2 and MMP9 significantly increased in tumors of HCC-TCGA patients in one or more analyses. Furthermore, CDH1 had a distinct pattern of change in the expression: lower diminutions in patients with wild type TP53 compared with patients with mutated TP53 was observed. Among all these genes only MMP9 resulted in significant survival increase depending on p53. Given that p53 may regulate not only gene expression but also protein stability of EMT transcription factors like SNAIL and TWIST1 in HCC and in diverse tumor cells 47 , 53 , 54 , and considering that protein escindition of E-cadherin by metalloproteinases like MMP9 is also a way of EMT regulation in different cancers 55 , 56 , 57 , the complete picture is missing in transcriptomic analyses. Proteomic analyses from patients organized in databases are still scarce, but further studies would be necessary in HCC to find actual EMT determinants of the disease progression. In sum, in this study we showed strong evidence of ALA antitumor actions in HCC cells from cytotoxic to never described cytostatic and antimigratory effects. We found that the reduction of migration and invasion by ALA treatment were dependent on AMPK and p53 activations which reduced EMT in HCC cells. Our results confirmed that core genes of EMT regulable by p53 variate their expression in HCC patients, sometimes in a progressive stage-dependent or p53 status-dependent way. Our results constitute promising data on the putative therapeutic effect of ALA or similar mitochondrial drugs in HCC, specially by reducing EMT and cell migration in those patients with wild type p53. Declarations Competing interests The authors declare no competing interests. Author Contribution Conceived and designed the experiments: FH, CF. Performed the experiments or data analysis: FH, CBE, EB, AP and JB. Supervised the experiments: MCL, JEG, ACF and CF. Analyzed the results: FH, CF. Wrote the paper: CF. All authors read and approved the final manuscript. Acknowledgments This work was supported by the Argentine Govern through CONICET: PIP 11220120100287CO and PIP 11220150100293CO, and Agencia I + D + i: PICT 2021 − 427. Data availability The full-length blots used for the figures during this study are included in this published article [and its supplementary information files]. All other datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Llovet J. M. et al. Hepatocellular carcinoma. Nat. Rev. Dis. Primers. 7, 6 (2021). doi: 10.1038/s41572-020-00240-3 . Singal, A. G., Lampertico & P., Nahon, P. Epidemiology and surveillance for hepatocellular carcinoma: New trends. J. Hepatol. 72, 250–261 (2020). https://doi.org/10.1016/j.jhep.2019.08.025 Marquardt, J. U., Andersen, J. B. & Thorgeirsson, S. S. Functional and genetic deconstruction of the cellular origin in liver cancer. Nat. Rev. Cancer. 15, 653–67 (2015). https://doi.org/10.1038/nrc4017 Schulze, K., Nault, J. C.& Villanueva, A. Genetic profiling of hepatocellular carcinoma using next-generation sequencing. J. Hepatol. 65, 1031–1042 (2016). https://doi.org/10.1016/j.jhep.2016.05.035 Hardie, D. G. AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat. Rev. Mol. Cell. Biol. 8, 774–85 (2007). https://doi.org/10.1038/nrm2249 Zong, Y., et al . Hierarchical activation of compartmentalized pools of AMPK depends on severity of nutrient or energy stress. Cell Res. 29, 460–473 (2019). Carling, D. AMPK hierarchy: a matter of space and time. Cell Res. 29, 425–426 (2019). Schaffer, B. E., et al. Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Cell Metab. 22, 907–21 (2015). https://doi.org/10.1038/s41422-019-0171-6 Yan, Y., et al. Augmented AMPK activity inhibits cell migration by phosphorylating the novel substrate Pdlim5. Nat. Commun. 6, 6137 (2015). https://doi.org/10.1038/ncomms7137 Henry, W. S., et al. Aspirin Suppresses Growth in PI3K-Mutant Breast Cancer by Activating AMPK and Inhibiting mTORC1 Signaling. Cancer Res. 77, 790–801 (2017). https://doi.org/10.1158/0008-5472.CAN-16-2400 Duan, W., et al. Desmoplasia suppression by metformin-mediated AMPK activation inhibits pancreatic cancer progression. Cancer Lett. 385, 225–233 (2017). https://doi.org/10.1016/j.canlet.2016.10.019 Li, W., Saud, S. M., Young, M. R., Chen, G. & Hua, B. Targeting AMPK for cancer prevention and treatment. Oncotarget. 6, 7365–7378 (2015). doi: 10.18632/oncotarget.3629 Vara-Ciruelos, D., Russell, F. M. & Hardie, D. G. The strange case of AMPK and cancer: Dr Jekyll or Mr Hyde? Open Biol. 9, 190099 (2019). The strange case of AMPK and cancer: Dr Jekyll or Mr Hyde? https://doi.org/10.1098/rsob.190099 Gomes, A. S., Ramos, H., Soares, J., & Saraiva, L. p53 and glucose metabolism: an orchestra to be directed in cancer therapy. Pharmacol. Res. 131, 75–86 (2018). https://doi.org/10.1016/j.phrs.2018.03.015 Lacroix, M., Riscal, R., Arena, G., Linares, L. K., & Le Cam, L. Metabolic functions of the tumor suppressor p53: Implications in normal physiology, metabolic disorders, and cancer. Mol. Metab. 33, 2–22. (2020). https://doi.org/10.1016/j.molmet.2019.10.002 Lee, C. W., et al. AMPK promotes p53 acetylation via phosphorylation and inactivation of SIRT1 in liver cancer cells. Cancer Res. 72, 4394–404 (2012). https://doi.org/10.1158/0008-5472.CAN-12-0429 Cheng, J., et al . AMP-activated protein kinase suppresses the in vitro and in vivo proliferation of hepatocellular carcinoma. PLoS One. 9, e93256 (2014). https://doi.org/10.1371/journal.pone.0093256 Ferretti, A. C. et al . AMPK and PKA interaction in the regulation of survival of liver cancer cells subjected to glucose starvation. Oncotarget 7, 17815–17828 (2016). doi: 10.18632/oncotarget.7404 Ferretti, A. C., Hidalgo, F., Tonucci, F. M., Almada, E., Pariani, A., Larocca, M. C., & Favre, C. Metformin and glucose starvation decrease the migratory ability of hepatocellular carcinoma cells: targeting AMPK activation to control migration. Sci. Rep., 9, 1–14 (2019). https://doi.org/10.1038/s41598-019-39556-w Dörsam, B. & Fahrer, J. The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria. Cancer Lett. 371, 12–9 (2016). The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria. https://doi.org/10.1016/j.canlet.2015.11.019 Farhat, D., & Lincet, H. Lipoic acid a multi-level molecular inhibitor of tumorigenesis. Biochim. Biophys. Acta. Rev. Cancer. 1873, 188317 (2020). https://doi.org/10.1016/j.bbcan.2019.188317 Park, S., Choi, S. K., Choi, Y. & Moon, H. S. AMPK/p53 Axis Is Essential for α-Lipoic Acid-Regulated Metastasis in Human and Mouse Colon Cancer Cells. J. Investig. Med. 63, 882–5 (2015). http://dx.doi.org/10.1097/JIM.0000000000000233 Simbula, G., et al. Increased ROS generation and p53 activation in alpha-lipoic acid-induced apoptosis of hepatoma cells. Apoptosis. 12, 113–23 (2007). https://doi.org/10.1007/s10495-006-0487-9 Park, K. G., et al. Alpha-lipoic acid decreases hepatic lipogenesis through adenosine monophosphate-activated protein kinase (AMPK)-dependent and AMPK-independent pathways. Hepatology. 48, 1477–86 (2008). https://doi.org/10.1002/hep.22496 Yang Y, et al. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway. J. Nutr. Biochem. 25, 1207–1217 (2014). https://doi.org/10.1016/j.jnutbio.2014.06.001 Giannelli, G., Koudelkova, P., Dituri, F., & Mikulits, W. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J. Hepatol. 65, 798–808 (2016). https://doi.org/10.1016/j.jhep.2016.05.007 Shih, J-Y. & Yang, P-C. The EMT regulator slug and lung carcinogenesis, Carcinogenesis. 32, 1299–1304 (2011). https://doi.org/10.1093/carcin/bgr110 Kim, J., et al. Cooperative actions of p21 WAF 1 and p53 induce Slug protein degradation and suppress cell invasion. EMBO Rep. 15, 1062–1068 (2014). https://doi.org/10.15252/embr.201438587 Etichetti, C. B. et al. Isoprenylcysteine carboxy methyltransferase (ICMT) is associated with tumor aggressiveness and its expression is controlled by the p53 tumor suppressor. J. Biol. Chem., 294, 5060–5073 (2019). https://doi.org/10.1074/jbc.RA118.006037 Tonucci, F. M. et al . Centrosomal AKAP350 and CIP4 act in concert to define the polarized localization of the centrosome and Golgi in migratory cells. J. Cell Sci. 128, 3277–3289 (2015). https://doi.org/10.1242/jcs.170878 Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685 (1970). https://doi.org/10.1038/227680a0 Chandrashekar, D. S., et al. UALCAN: a portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia 19, 649–658 (2017). https://doi.org/10.1016/j.neo.2017.05.002 Wang, Z., et al. Critical roles of p53 in epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma cells. PLoS One 8, e72846 (2013). https://doi.org/10.1371/journal.pone.0072846 Powell, E., Piwnica-Worms, D., & Piwnica-Worms, H. Contribution of p53 to metastasis. Cancer Discov., 4, 405–414 (2014). https://doi.org/10.1158/2159-8290.CD-13-0136 Pavlova, N. N. & Thompson, C. B. The Emerging Hallmarks of Cancer Metabolism. Cell Metab. 23, 27–47 (2016). https://doi.org/10.1016/j.cmet.2015.12.006 Leclerc, D., et al. Oncogenic role of PDK4 in human colon cancer cells. Br. J. Cancer. 116, 930–936 (2017). https://doi.org/10.1038/bjc.2017.38 Pavlova, N. N., Zhu, J., & Thompson, C. B. The hallmarks of cancer metabolism: Still emerging. Cell Metab. 34, 355–377 (2022). https://doi.org/10.1016/j.cmet.2022.01.007 Wu, J., et al. Loss of PDK4 switches the hepatic NF-κB/TNF pathway from pro-survival to pro-apoptosis. Hepatology. 68, 1111–1124 (2018). https://doi.org/10.1002/hep.29902 Anwar, S., Shamsi, A., Mohammad, T., Islam, A. & Hassan, M. I. Targeting pyruvate dehydrogenase kinase signaling in the development of effective cancer therapy. Biochim. Biophys. Acta Rev. Cancer. 1876, 188568 (2021). https://doi.org/10.1016/j.bbcan.2021.188568 Krstic, J., Reinisch, I., Schindlmaier, K., Galhuber, M., Riahi, Z., Berger, N., …Prokesch, A. Fasting improves therapeutic response in hepatocellular carcinoma through p53-dependent metabolic synergism. Sci Adv. , 8, eabh2635 (2022). https://doi.org/10.1126/sciadv.abh2635 Galhuber, M., Michenthaler, H., Heininger, C. et al. Complementary omics strategies to dissect p53 signaling networks under nutrient stress. Cell. Mol. Life Sci. 79, 326 (2022). https://doi.org/10.1007/s00018-022-04345-8 Honda, K., et al. p53 mutation is a poor prognostic indicator for survival in patients with hepatocellular carcinoma undergoing surgical tumour ablation. Br. J. Cancer 77, 776–782 (1998). https://doi.org/10.1038/bjc.1998.126 Craig, A.J., et al. Tumour evolution in hepatocellular carcinoma. Nat. Rev. Gastroenterol. Hepatol. 17, 139–152 (2020). https://doi.org/10.1038/s41575-019-0229-4 Tortelli Jr, T. C., et al. Metformin-induced chemosensitization to cisplatin depends on P53 status and is inhibited by Jarid1b overexpression in non-small cell lung cancer cells. Aging (Albany NY), 13, 21914 (2021). https://doi.org/10.18632%2Faging.203528 Song, S., et al. Reticulon 3-mediated Chk2/p53 activation suppresses hepatocellular carcinogenesis and is blocked by hepatitis B virus. Gut 70, 2159–2171 (2021). http://dx.doi.org/10.1136/gutjnl-2020-321386 Yao, Jy., et al. Novel CDK9 inhibitor oroxylin A promotes wild-type P53 stability and prevents hepatocellular carcinoma progression by disrupting both MDM2 and SIRT1 signaling. Acta Pharmacol. Sin. 1–13 (2021). https://doi.org/10.1038/s41401-021-00708-2 Lim, S. O., Kim, H., & Jung, G. p53 inhibits tumor cell invasion via the degradation of snail protein in hepatocellular carcinoma. FEBS Lett. 584, 2231–2236 (2010). https://doi.org/10.1016/j.febslet.2010.04.006 Kim, T., et al. p53 regulates epithelial–mesenchymal transition through microRNAs targeting ZEB1 and ZEB2. J. Exp. Med. 208, 875–883 (2011). https://doi.org/10.1084/jem.20110235 Matsumura, T., Makino, R., & Mitamura, K. Frequent down-regulation of E-cadherin by genetic and epigenetic changes in the malignant progression of hepatocellular carcinomas. Clin. Cancer Res. 7, 594–599 (2001). Fransvea, E., Angelotti, U., Antonaci, S., & Giannelli, G. Blocking transforming growth factor–beta up-regulates E‐cadherin and reduces migration and invasion of hepatocellular carcinoma cells. Hepatology 47, 1557–1566 (2008). https://doi.org/10.1002/hep.22201 Yang, B., Li, M., et al. Dynamic network biomarker indicates pulmonary metastasis at the tipping point of hepatocellular carcinoma. Nat Commun 9, 678 (2018). https://doi.org/10.1038/s41467-018-03024-2 Yang, M. H., et al. Comprehensive analysis of the independent effect of twist and snail in promoting metastasis of hepatocellular carcinoma. Hepatology 50, 1464–1474 (2009). ​​https://doi.org/10.1002/hep.23221 Mol. Can. Res. , 17, 153–164 (2019). https://doi.org/10.1158/1541-7786.MCR-18-0238 Semenov, O., Daks, A., Fedorova, O., Shuvalov, O., & Barlev, N. A. Opposing roles of wild-type and mutant p53 in the process of epithelial to mesenchymal transition. Frontiers Mol. Biosc., 9, 928399 (2022). https://doi.org/10.3389%2Ffmolb.2022.928399 Cowden Dahl, K. D., et al. Matrix metalloproteinase 9 is a mediator of epidermal growth factor–dependent E-cadherin loss in ovarian carcinoma cells. Cancer Res. 68, 4606–4613 (2008). https://doi.org/10.1158/0008-5472.CAN-07-5046 Zuo, J. H., et al. Activation of EGFR promotes squamous carcinoma SCC10A cell migration and invasion via inducing EMT-like phenotype change and MMP‐9‐mediated degradation of E‐cadherin. J. Cell. Biochem. 112, 2508–2517 (2011). https://doi.org/10.1002/jcb.23175 Wang, J. R., et al. Orphan nuclear receptor Nur77 promotes colorectal cancer invasion and metastasis by regulating MMP-9 and E-cadherin. Carcinogenesis 35, 2474–2484 (2014). https://doi.org/10.1093/carcin/bgu157 Additional Declarations No competing interests reported. Supplementary Files dataset.pdf suppfig1.pdf Cite Share Download PDF Status: Published Journal Publication published 11 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 12 Apr, 2024 Reviews received at journal 10 Apr, 2024 Reviewers agreed at journal 08 Apr, 2024 Reviews received at journal 21 Mar, 2024 Reviewers agreed at journal 21 Feb, 2024 Reviewers invited by journal 03 Jan, 2024 Editor assigned by journal 03 Jan, 2024 Editor invited by journal 21 Dec, 2023 Submission checks completed at journal 21 Dec, 2023 First submitted to journal 18 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3773984","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":263075971,"identity":"d3e0d38d-c821-4de7-8764-cdba9da7857c","order_by":0,"name":"Florencia Hidalgo","email":"","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Florencia","middleName":"","lastName":"Hidalgo","suffix":""},{"id":263075972,"identity":"0f7d4313-2c8d-4261-b467-230e2c790dba","order_by":1,"name":"Anabela C. Ferretti","email":"","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anabela","middleName":"C.","lastName":"Ferretti","suffix":""},{"id":263075973,"identity":"14e25201-b1ca-46dc-a42e-f532d279b1fa","order_by":2,"name":"Carla Borini Etichetti","email":"","orcid":"","institution":"Institute of Clinical and Experimental Immunology of Rosario (IDICER), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Carla","middleName":"Borini","lastName":"Etichetti","suffix":""},{"id":263075974,"identity":"19eaedac-4a3d-476f-8575-4800b6ea65b0","order_by":3,"name":"Emilia Baffo","email":"","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Emilia","middleName":"","lastName":"Baffo","suffix":""},{"id":263075975,"identity":"9e276e73-483c-482b-85b1-be2566bfc5b6","order_by":4,"name":"Alejandro Pariani","email":"","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alejandro","middleName":"","lastName":"Pariani","suffix":""},{"id":263075976,"identity":"c2a5e0fb-ac91-4ba9-bf97-161fd512f73e","order_by":5,"name":"Tomás Rivabella Maknis","email":"","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tomás","middleName":"Rivabella","lastName":"Maknis","suffix":""},{"id":263075977,"identity":"41f5ed26-19b3-4751-b1d6-53f96ed3f496","order_by":6,"name":"Javier Bussi","email":"","orcid":"","institution":"School of Statistics, University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Javier","middleName":"","lastName":"Bussi","suffix":""},{"id":263075978,"identity":"6edaa3df-1287-41d3-a1b2-54ccc5a1e681","order_by":7,"name":"Javier E. Girardini","email":"","orcid":"","institution":"Institute of Clinical and Experimental Immunology of Rosario (IDICER), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Javier","middleName":"E.","lastName":"Girardini","suffix":""},{"id":263075979,"identity":"b967bede-6afd-4784-a70d-50b84ad3f25a","order_by":8,"name":"María C. Larocca","email":"","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"María","middleName":"C.","lastName":"Larocca","suffix":""},{"id":263075980,"identity":"50292804-be1b-4f86-ae78-26fb61c17cac","order_by":9,"name":"Cristián Favre","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDAC5gMg0gaIGRsPEKeFLQFEpoG0NJCk5TCYTZwW/jbmZ9IVFeft1rYfBtpSYxNNUIvEMTYzyTNnbidvO5MI1HIsLbeBkBYD+QZjw8a228lmB4BaGBsOE6GFjf2zYeO/c8lm5x8SrYXH8GFjwwE7sxvE2iJxjKfwYcOx5ASzG0BbEojxC38b+4aDDTV29mbn0x8++FBjQ1gLDCSCVSYQqxwE7ElRPApGwSgYBSMMAAC46kXt6E+1kQAAAABJRU5ErkJggg==","orcid":"","institution":"Institute of Experimental Physiology (IFISE), CONICET-University of Rosario","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Cristián","middleName":"","lastName":"Favre","suffix":""}],"badges":[],"createdAt":"2023-12-18 23:29:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3773984/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3773984/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-72309-y","type":"published","date":"2024-09-11T15:58:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":48835171,"identity":"6af287fe-5396-497c-be8b-9b149d8a8f0c","added_by":"auto","created_at":"2023-12-27 05:24:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":149368,"visible":true,"origin":"","legend":"\u003cp\u003eViability and cell cycle progression in HCC cells during ALA treatment.\u003c/p\u003e\n\u003cp\u003eA. MTT assay was performed in HepG2/C3A cells in DMEM medium after 0 (control), 16, 24, 48 and 72 h of treatments with 0.5 or 1mM ALA. Absorbance measurements were relativized to the controls at 0 time. The plots represent mean values of three-four independent experiments ± S.E.M. * p \u0026lt; 0.05 vs. control. B. Captures of stained wells after typical experiments of colony formation assay for HepG2/C3A cells in DMEM medium (control, C), or treated with 0.5 or 1mM ALA, respectively (\u003cem\u003eupper pane\u003c/em\u003el). The bars represent mean values of the number of colonies for three independent experiments ± S.E.M. * p \u0026lt; 0.05 vs. control. C. Annexin V and propidium iodide (PI) staining were performed in HepG2/C3A cells after 48h culture in DMEM alone (control, C) or with ALA, and the cells were prepared for flow cytometry assay. Single Annexin V stained and Annexin V plus PI-stained cells were analyzed. Representative outputs of the cytometric assay are shown (\u003cem\u003eupper panel\u003c/em\u003e). The percentage of each stained population was obtained. Bars represent mean values ± S.E.M of three independent experiments for Annexin V stained cells (total apoptosis) in control, 0.5 mM and 1 mM ALA treated cells as a percentage of the control group. * p \u0026lt; 0.05 vs. control. D. Cytometric analysis of PI-stained cells for cell cycle evaluation was performed in Hep3B cells after 48h cultures in DMEM alone (control, C) or with 0.5 mM ALA. Bars represent the mean percentages of each cell population from three independent experiments ± S.E.M. * p \u0026lt; 0.05 vs. control.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/bf03fb4ee57f5e9b5adfb5ba.png"},{"id":48835539,"identity":"776b06ee-01b2-46d8-8ab3-326affe9a32d","added_by":"auto","created_at":"2023-12-27 05:32:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":630428,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of ALA on migration and invasion in HepG2/C3A and Hep3B cells.\u003c/p\u003e\n\u003cp\u003eA. Wound healing assays were performed in HCC cells in DMEM medium alone (control, C) or with 0.5 mM ALA (ALA), and the distance migrated by the front cells, i.e. the difference of the respective wound widths in micra, was calculated through image analysis from captures at 0 and 24 h. Bars represent mean values ± S.E.M of three independent experiments expressed as percentages of the controls in HepG2/C3A and Hep3B cells, respectively. B. Invasion in matrigel coated transwells was compared for control (C) and 0.5 mM ALA treated (ALA) HepG2/C3A and Hep3B cells after 48 h. After staining, images were obtained and cells were quantified. Captures of typical experiments are shown (\u003cem\u003eright panel\u003c/em\u003e). Bars represent mean values (as a percentage of the control groups) of three independent experiments ± S.E.M. * p \u0026lt; 0.05 vs. control.\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/a0c8604d00804c1fb3566c47.png"},{"id":48835540,"identity":"01affa05-bf72-410f-a60a-bfbff57bacf3","added_by":"auto","created_at":"2023-12-27 05:32:08","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":249622,"visible":true,"origin":"","legend":"\u003cp\u003eActivation of AMPK and p53 during ALA treatment in wild type p53-HCC cells signals migration/invasion processes\u003c/p\u003e\n\u003cp\u003eA. HepG2/C3A cells cultured in DMEM (C, control) or in DMEM with 0.5 mM ALA (ALA) and after 24h cell lysates were obtained, as stated in Methods, and 20-30 μg of protein were loaded in minigels for immunodetection of p-AMPK and AMPK catalytic subunit. α-tubulin (α tub) was used as loading control. Immunoblots show an experiment representative of three independent ones. Selected lanes for each detection are in their original order and correspond to the same gel, and they are shown after cropping, aligning and separating them by white space. Full-length blots are available in Supplementary Dataset. Band densities were quantified relativized to loading and represented in bar charts. Bars represent the mean values, expressed as a percentage of the control group, ± S.E.M from three independent experiments. # p \u0026lt; 0.05 vs. control. B. C3A cells were incubated for 24 h in control DMEM (C, control) or in the presence of 0.5 mM ALA (ALA). Afterwards, cells were fixed and stained to visualize p53 (green) and nuclei (blue), red staining with Mitotracker Red was used for obtaining a signal of cell integrity. p53 intensity in the nucleus was relativized to total p53 signal. Bars represent the mean values, expressed as a percentage of the control group, ± S.E.M from 10 fields for three independent experiments. C and D. HepG2/C3A cells were transfected with AMPKα1 targeted (siAMPKa1) or scrambled siRNAs (sc) cultured for 48 h and subjected to additional 48 h (C) or 24 h (D) treatments. C. Cell lysates were processed as stated in Methods and AMPK silencing was corroborated by detection of total AMPK by the same procedure and with the same considerations stated above in 3A. A capture of a typical blotting is shown (\u003cem\u003eupper right\u003c/em\u003e). Wound healing assays were performed and data of cell migration were obtained as indicated in figure 2A. * p \u0026lt; 0.05 vs. control. D. Cell lysates were obtained and processed for immunodetection of p53 as in 3A, with the same considerations. p53 protein levels in the indicated groups were calculated and graphed in bar charts. Bars represent the mean values, expressed as a percentage of the control group, ± S.E.M from three independent experiments. # p \u0026lt; 0.05 vs. control, # # p \u0026lt; 0.005 vs. control. D. Wound healing assays were performed and data of cell migration were obtained as indicated in figure 2A.* p \u0026lt; 0.05 vs. control.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/ebc871623bb5def00d6f7605.png"},{"id":48835169,"identity":"05556614-12fd-4fb0-824d-83b3c004dd79","added_by":"auto","created_at":"2023-12-27 05:24:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":870287,"visible":true,"origin":"","legend":"\u003cp\u003eALA treatment does not affect migration/invasion capacity of cells with stable p53 knock down.\u003c/p\u003e\n\u003cp\u003eTransformed cell lines were constructed from HepG2/C3A cells transduced with retroviral plasmids containing specific shRNAs targeted to p53 or control sequences, named shp53 and shlacZ cells, respectively. These cell lines were cultured in DMEM without (C) or with 0.5 mM ALA (ALA) for 24 h or 48 h to analyze A. cell migration, or B. cell invasion. Data were obtained as indicated in figure 2 A and B, respectively. Yellow lines in A illustrate the widths measured in each capture. * p \u0026lt; 0.05 vs. each untreated group (C); # p \u0026lt; 0.05 vs. ALA treated shlacZ cells.\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/57bb9d0116afb5a786bb8542.png"},{"id":48835166,"identity":"350ac054-0684-45ab-9894-6e96a4df5cf8","added_by":"auto","created_at":"2023-12-27 05:24:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":124697,"visible":true,"origin":"","legend":"\u003cp\u003eALA reduces EMT activation in HCC cells with wild type p53 expression.\u003c/p\u003e\n\u003cp\u003eA. Cell lysates were obtained after 24 h treatment from HepG2/C3A or Hep2B cells cultured in DMEM (control, C) or in the indicated conditions, and 20-30 μg of protein were loaded in minigels for immunodetection of E-cadherin (E-cadh) and SNAIL. GAPDH was used as loading control. Immunoblots show an experiment representative of three independent ones. Selected lanes for each detection are in their original order and correspond to the same gel, and they are shown after cropping, aligning and separating them by white space. Full-length blots are available in Supplementary Dataset. Bars represent mean values of band density relativized to load and expressed as percentage of the control from three independent experiments ± S.E.M. * p \u0026lt; 0.05 vs. control. B. shlacZ (control) and shp53 cells obtained from HepG2/C3A cells were cultured in DMEM alone (untreated) or with 0.5 mM ALA for 24 h. After that, Trizol extracts and total cDNA from each group were generated by retrotranscription for use as qPCR samples. Transcript levels from \u003cem\u003eCDH1\u003c/em\u003e, \u003cem\u003eVIM\u003c/em\u003e and \u003cem\u003eSNAI1\u003c/em\u003e were estimated by Ct calculation from duplicate assays. \u003cem\u003eGAPDH\u003c/em\u003e was used as a housekeeping gene. Bars represent mean values of Ct from three independent experiments ± S.E.M expressed as fold change of each untreated group. # p \u0026lt; 5x10\u003csup\u003e-3\u003c/sup\u003e vs. untreated control, # # p \u0026lt; 5x10\u003csup\u003e-4\u003c/sup\u003e vs. untreated control.\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/3abebe08eaceaf64a984d057.png"},{"id":48835167,"identity":"d3fc703d-2e94-4f9d-a45d-bdb230db5ff3","added_by":"auto","created_at":"2023-12-27 05:24:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":103882,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of selected EMT related genes in HCC-TCGA patients: expression and survival analyses of groups with different mutation status of p53.\u003c/p\u003e\n\u003cp\u003eA. Differential gene expression analysis was performed in the complete HCC-TCGA dataset (tumor samples N= 371, non-tumor samples N=50) for a selected group of EMT related genes. Those genes with significantly increased expression (log2FC\u0026gt;1) are enlisted. Mean log2FC, p and FDR values are indicated. B. Heatmaps for the differential gene expression of the studied genes (columns) in the 50 HCC-TCGA patients with paired tumor and control non tumor samples (rows), filtered and splitted by their \u003cem\u003eTP53\u003c/em\u003e status: wild type (WT, left) or mutant (MUT, right). \u003cem\u003eCDH1\u003c/em\u003egene column in each group is underlined. C. The distribution of the relative expression levels of \u003cem\u003eCDH1\u003c/em\u003e was compared by K-S test between patients with wild type (WT) \u003cem\u003eTP53\u003c/em\u003e (N=37, blue line) and patients with mutant (MUT) \u003cem\u003eTP53\u003c/em\u003e (N=13, red line) from the 50 HCC-TGCA patients. The densities of patients for the variable log2FC are graphed. Vertical lines indicate the median values in each population. p = 0.0497. D. Comparison of the expression levels in TPM of the indicated genes from HCC-TCGA patients in non-tumor (NT, N=50) and in the four cancer stages, S1 (N=168), S2 (N=84), S3 (N=82), S4 (N=6) obtained from UALCAN data portal. Figures were constructed by adapting box and whisker plots of gene expression in non-tumor and in the four cancer stages from UALCAN web. Red lines represent the median values. Significant p values are indicated. E. Kaplan-Meier survival analyses for \u003cem\u003eCDH1\u003c/em\u003e (left) and \u003cem\u003eMMP9\u003c/em\u003e (right) in HCC-TCGA patients with low or high expression levels of each gene studied and wild type (WT) or mutant (MUT) \u003cem\u003eTP53\u003c/em\u003e. In the case of \u003cem\u003eMMP9\u003c/em\u003e a forest tree illustrating hazard ratios (HR) in each group is added. p values are indicated.\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/7f32239424ad0dc4414013f2.png"},{"id":64620220,"identity":"5ec0e975-e2e2-440d-b738-5ad0e161fa05","added_by":"auto","created_at":"2024-09-16 16:18:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2980801,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/49f7e5b4-22e6-4a92-b2d2-41338b7a466c.pdf"},{"id":48835173,"identity":"f2fbe7bd-6479-4831-8e15-5531f3f135da","added_by":"auto","created_at":"2023-12-27 05:24:09","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":5165532,"visible":true,"origin":"","legend":"","description":"","filename":"dataset.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/11df6d788f7a8ee2413f7c52.pdf"},{"id":48835172,"identity":"14696a90-06ee-4667-9e28-a825fd534385","added_by":"auto","created_at":"2023-12-27 05:24:08","extension":"pdf","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":247255,"visible":true,"origin":"","legend":"","description":"","filename":"suppfig1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3773984/v1/307af208e7cda636b1077f1f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Alpha lipoic acid diminishes migration and invasion in hepatocellular carcinoma cells through an AMPK-p53 axis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHepatocellular carcinoma (HCC) is one of the main causes of death by cancer and current surgical or chemotherapeutic treatments fail in improving survival in most of the patients\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. HCC is generally associated with an underlying chronic liver disease such as viral hepatitis, alcoholic cirrhosis or metabolic associated fatty liver disease. The latter is an increasing cause of pathology in occidental countries\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Carcinogenic transformation develops on these inflammatory diseases by producing dysplastic nodules that evolve into neoplastic foci with great molecular heterogeneity, to which a high intra and extra hepatic metastatic capacity is added making HCC a very aggressive cancer\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. In this regard, to find new treatments that reduce or even prevent the rapid progression of HCC is a pressing matter of research. AMP activated kinase (AMPK) is a hetero trimer constituted by α, β and γ subunits, whose catalytic α subunit, in response to energy stress, is phosphorylated and activated by upstream kinases like LKB1 and it is stabilized by increased levels of AMP that bounds to γ subunit\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. AMPK activation is both a hierarchical and a compartmentalized process that depends on the stress level, and where different isoforms of AMPK subunits form active complexes with different proteins in lysosomes, mitochondria and nucleus\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Activation of AMPK in different types of cancer cells induces distinct antitumor effects including decrease in cell survival or reduction of invasiveness\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, which support it as an eligible target for therapy, at least in the initial states of the transformation process when AMPK would act as a tumor suppressor\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Moreover, given that during energy stress the effects of the tumor suppressor p53 are intertwined with the LKB1-AMPK axis as both a target and activator, the role of p53 in the therapeutic activation of this pathway should be considered, for a review see\u003csup\u003e14\u003c/sup\u003e and\u003csup\u003e15\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn HCC patients, active AMPK is decreased in tumor in comparison to neighboring tissue, and AMPK activation has been suggested as an effective antitumor strategy in mice\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In previous reports, we found that in HCC-derived cells different ways of activating AMPK, such as glucose restriction\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e and metformin, not only induce cell death but they early inhibit migration and invasion\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAlpha lipoic acid (ALA), a natural compound that is a physiological cofactor of mitochondrial pyruvate dehydrogenase (PDH), was studied as a possible anticancer drug in different types of cancer cells\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. ALA induces mitochondrial dysfunction and cytotoxicity in various tumor cells where it is able to activate AMPK and, in some cases, ALA also decreases invasion through AMPK-p53 axis\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. It is attractive to determine if this AMPK activator leads to any AMPK mediated anticarcinogenic actions in HCC cells, given that former studies show induction of apoptosis by ALA in HCC cell lines without clarifying other possible antitumor effects\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Interestingly, ALA activates hepatic AMPK in rat steatosis, and it decreases lipogenesis\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. We hypothesize that ALA can induce different antitumor events through AMPK signaling in HCC cells as well. This therapeutic scenario would be very promising because of the putative multiple actions of ALA in metabolic or neoplastic liver disease.\u003c/p\u003e \u003cp\u003eThe control of epithelial-mesenchymal transition (EMT) in the carcinogenic and pre carcinogenic liver is a potential target to stop HCC progression\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. p53 has been postulated as an unequivocal regulator of the stability of EMT transcription factors in diverse tumors\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Therefore, it is interesting to explore if ALA could modulate these functions in HCC cells via p53.\u003c/p\u003e \u003cp\u003eIn this study we tried to analyze the effect of ALA not only in the viability but also in the invasiveness of HCC cells, and to investigate if AMPK and its target p53 could be involved. For this purpose, we studied the response to ALA in HCC derived cells with different AMPK and p53 status.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and genetic manipulations\u003c/h2\u003e \u003cp\u003eHepatocellular carcinoma cells C3A (HepG2/C3A, a clonal derivative of HepG2, ATCC, Manassas, VA), and Hep3B (Hep 3B2.1\u0026ndash;7, ATCC) were grown with 4.5 g/L glucose DMEM (Gibco, Thermo Fisher Scientific, Waltham, MA), plus 10% FBS and 100 U/ml penicillin and streptomycin (Invitrogen, Waltham, MA). Cells were cultured in a humidified incubator at 37\u0026ordm;C with 5% CO\u003csub\u003e2,\u003c/sub\u003e and tested periodically for mycoplasma by PCR.\u003c/p\u003e \u003cp\u003eWhen indicated, alpha lipoic acid (0.5 or 1 mM, Santa Cruz Biotechnology Inc., Santa Cruz, CA) was added.\u003c/p\u003e \u003cp\u003eFor reducing AMPKα1 protein expression in C3A cells, 21 nucleotide duplexes targeting two specific sequences and a scrambled control were designed and synthesized by Ambion SilencerTMsiRNA (Ambion, Thermo Fisher Scientific). The target sequences were AMPKα1 1842\u0026ndash;1864: AACATTTCTGCATATTAGGCTCCTGTCTC and 2659\u0026ndash;2681: AAGAGCTGAGTTGCATATACTCCTGTCTC, as we previously reported\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Experiments with silenced cells were carried out 24\u0026ndash;48 h after transfection using siPORT NeoFX (Ambion, Thermo Fisher Scientific) with the Negative Control siRNA (Ambion) or the synthesized siRNAs against AMPKa1, and decrease (60 to 80%) in AMPKα expression for both duplexes was confirmed by immunoblotting.\u003c/p\u003e \u003cp\u003eFor stable knockdown of p53 in C3A cells, transduction with retrovirus-based plasmids harboring the following specific and control shRNAs were carried out: shp53 (GACUCCAGUGGUAAUCUAC), shp53-3\u0026prime;UTR (GGUGAACCUUAGUACCUAA), and control shLacZ (GUGACCAGCGAAUACCUGU), as we previously described\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Plasmid DNA was prepared using the Wizard DNA purification kit (Promega, Madison, WI). p53 diminution (80\u0026ndash;90%) was confirmed by qRT-PCR.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eColony formation assay\u003c/h2\u003e \u003cp\u003eLow density cell inoculum (1000 cells) was seeded in 35 mm dishes of 6-well plates and grew up to 15 days to allow the formation of visible colonies. After washing the colonies were fixed with cold methanol and toluidine blue staining was performed for 10 min. After removing the excess of colorant, the dishes were photographed and the number of colonies were counted and compared.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMTT assay\u003c/h2\u003e \u003cp\u003eHCC cells were plated at the same density by triplicate in 96-well microplates and incubated 2 h with methylthiazolyldiphenyl-tetrazolium bromide (MTT, Sigma Chemical Co., St Louis, MO) at the indicated time. The metabolite produced from viable cells was dissolved in DMSO and detected at 540 nm in a microplate reader (Beckman Coulter LD400), as we described\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Results were expressed as percentage of absorbance in cells at 0 time.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAnnexin V/propidium iodide assay\u003c/h2\u003e \u003cp\u003eAnnexin V assay (BD Biosciences, San Jos\u0026eacute;, CA) was used following the manufacturer recommendations and the samples were prepared as we previously described\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Briefly, after 48 h of treatments, homogenization in the medium and harvest, 100,000 cells were gently re-suspended and phosphatidylserine externalization and cell death was detected by staining with Annexin V-FITC and PI, respectively. The stained cells were subjected to flow cytometric analysis (Cell Sorter BD FACSAria II, BD Biosciences).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell cycle analysis\u003c/h2\u003e \u003cp\u003eThe proportion of cells in each cell cycle population at 48 h of culture in different conditions was analyzed by determining the cellular DNA content by flow cytometry (Cell Sorter BD FACSAria II, BD Biosciences), as we previously described\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In brief, 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells were fixed in 70% ethanol, washed and stained with 50 \u0026micro;g/ml propidium iodide (Sigma Chemical Co.) in a solution containing 0.1% sodium citrate, 0.02 mg/ml RNAse, and 0.3% NP-40. WinMDi and Cylchred softwares were used for data analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eCollective cell migration was determined by wound healing assay as we previously described\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, with slight modifications. Briefly, cells were plated (6-well plates) at 1.5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/ml and growth for 24 h. Monolayers were wounded by dragging a 200-\u0026micro;l pipette tip, washed and treated. Captures of microscopy images (Zeiss Axiovert 25) of wounds were obtained at 0 h and 24 h after wounding. Lineal advance of the wound front (\u0026micro;m) was assessed by using ImageJ.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eInvasion studies\u003c/h2\u003e \u003cp\u003eFor invasion assays, transwell chambers (Biofil, Beijing, China) with 8 \u0026micro;m pore size polyester membrane filters were coated with 250 \u0026micro;g/ml Matrigel (Corning, Corning, NY). Suspension of cells (1 \u0026times; 105) in DMEM containing 1% FBS were plated into the upper chamber, and the lower chamber was filled with complete DMEM medium containing 10% FBS. Cells were treated for 48 h and after this period those cells that reached the lower chamber were fixed with methanol, stained with 1% toluidine blue-1% borax for 5 min, and counted by microscopy captures, as we previously described\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence microscopy\u003c/h2\u003e \u003cp\u003eCells were grown on coverslips, treated for 24 h and, at the end of experiments, fixed, permeabilized and blocked with 0.3% Triton X-100-1% albumin. Then, cell samples were incubated with anti p53 (sc-126, Santa Cruz Biotechnology), washed, incubated with anti-mouse secondary antibody (Invitrogen) and then incubated for nuclei staining with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI, Molecular Probes, Eugene, OR), and mounted with ProLong (Molecular Probes). Fluorescence was detected by a confocal microscopy (Nikon C1SiR with inverted microscope Nikon TE200). Nuclear intensity of p53 staining was assessed in the Z-stack projections by using ImageJ tools.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blotting\u003c/h2\u003e \u003cp\u003eCell lysates were obtained after scrapping and washing the cultured cells subjected to the indicated treatments during the indicated time. The harvest cells were incubated in 100 \u0026micro;l of ice cold RIPA buffer with protease and phosphatase inhibitors for 30 min and sonicated. Protein concentration was determined by the Lowry's method. Equal amounts of total protein (30\u0026ndash;50 \u0026micro;g) were loaded, resolved by electrophoresis on SDS-polyacrylamide gels\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, and transferred to polyvinylidene difluoride membranes (Perkin Elmer Life Sciences, Boston, MA, USA). Molecular weights were estimated using \u0026ldquo;rainbow\u0026rdquo; molecular weight markers. The membranes were blocked with 5% non-fat milk/0.3% Tween/PBS, washed and incubated O.N. with each primary antibody [α tubulin (T-5168 Sigma Chemical Co.); p53(DO-1), GAPDH (FL-335) (sc-126 and sc-25778 Santa Cruz Biotechnology); AMPKα, Phospho-AMPKα (Thr172), SNAIL/C15D3 (2532, 2535, 3879 Cell Signaling Technology); or E-cadherin (610182 BD Biosciences)]. After incubation of the membranes with the appropriate secondary antibody, the bands were detected by chemiluminescence (Amersham Pharmacia Biotech, Piscataway, NJ).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eReal-time quantitative PCR\u003c/h2\u003e \u003cp\u003ecDNA was obtained from Trizol (Invitrogen) extracts by retrotranscription with retrotranscriptase M-MLV (Promega) following the manufacturer conditions, and real-time PCR was performed using SYBR Green PCR master mix (Promega) according to the following conditions: 2 min at 95 \u0026ordm;C for one cycle; and 30 s at 95 \u0026ordm;C, 20 s at 60 \u0026ordm;C, 30 s at\u003c/p\u003e \u003cp\u003e72 \u0026ordm;C for 40 cycles. Results were analyzed using the comparative Ct method. Values were\u003c/p\u003e \u003cp\u003enormalized to \u003cem\u003eGAPDH\u003c/em\u003e expression. The following real-time PCR forward and reverse primers were used, respectively: \u003cem\u003eTP53\u003c/em\u003e: CTCCTCTCCCCAGCCAAAGA, GGAACATCTCGAAGCGCTCA; \u003cem\u003eCDH1\u003c/em\u003e: AAGAAGCTGGCTGACATGTACGGA, CCACCAGCAACGTGATTTCTGCAT; \u003cem\u003eVIM\u003c/em\u003e: CCCTGCAATCTTTCAGACAG, ATCTGAGCCTGCAGCTCCT; \u003cem\u003eSNAI1\u003c/em\u003e: CCAGAGTTTACCTTCCAGCAGCC, CAGGACAGAGTCCCAGATGAGCAT; \u003cem\u003eGAPDH\u003c/em\u003e: TCTCTGCTCCTCCTGTTC, GCCCAATACGACCAAATCC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analyses\u003c/h2\u003e \u003cp\u003eRNAseq data from HCC patients (371 tumor and 50 non tumor samples) were obtained from TCGA datasets accessible from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gdac.broadinstitute.org/\u003c/span\u003e\u003cspan address=\"http://gdac.broadinstitute.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Data were organized and processed for differential gene expression (DGE) analysis for a selected group of EMT related genes with EDAseq and edgeR, respectively. Other packages from tydiverse were used for data management. Mean log2 fold change (log2FC), p, and false discovery rate (FDR) values were obtained. Values of log2FC\u0026thinsp;\u0026gt;\u0026thinsp;1 or \u0026lt;\u0026thinsp;1, and -log2FDR\u0026thinsp;\u0026gt;\u0026thinsp;1 (FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01) were set as cutoffs. A heatmap plot from the 50 patients with paired tumor and non-tumor samples was performed for the indicated genes using complexHeatmap, and the results were splitted in two groups by the status of \u003cem\u003eTP53\u003c/em\u003e gene. In the same dataset a comparison of the distribution of frequencies of log2FC values for each gene was performed between those patients with wild type (n\u0026thinsp;=\u0026thinsp;37) or mutant \u003cem\u003eTP53\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;13) using the Kolmogorov\u0026ndash;Smirnov test. This analysis was performed with SAS Studio, and a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003cp\u003eFurther expression profiles of the genes studied from the same TCGA patients were analyzed through the tools of the UALCAN data portal (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://ualcan.path.uab.edu\u003c/span\u003e\u003cspan address=\"http://ualcan.path.uab.edu\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). These tools match expression and clinical data allowing comparison of expression levels in different groups of patients, as cancer stages and others. Data processing and statistical analysis were described by the authors\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In addition, expression plus survival assays of these genes from the same dataset of TCGA were also analyzed with the visualization tools of The Human Protein Atlas (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://gdac.broadinstitute.org/\" target=\"_blank\"\u003ewww.proteinatlas.org\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.proteinatlas.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor those groups of patients with low or high expression (below or above the median) of the selected genes with wild type or mutant \u003cem\u003eTP53\u003c/em\u003e survival analysis were performed using survival and survminer R tools. p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was set as a significant difference among the Kaplan-Meier curves. When it was necessary, hazard ratios (HR) were calculated and represented as a forest plot and the p value for HR between the reference group versus each of the others was obtained.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eIn all the studies except for bioinformatics, data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;S.E.M. and statistical comparisons were made by using Student t test. p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eChanges in cell viability and growth in response to ALA\u003c/h2\u003e \u003cp\u003eALA is well established as an oxidative stress and apoptosis inductor in HCC cells at a dose of 0.5 mM\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, as occurs in different cancer cells\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. We explored the effects of this low millimolar level of ALA in HCC derived cells: Both 0.5 and 1mM concentrations led to decreases in the number of viable cells, but the lower concentration had no significant effect below 48h. At 48 h the decreases in viability were \u0026minus;\u0026thinsp;20 and \u0026minus;\u0026thinsp;35% of control cells, respectively, as observed by MTT assay in C3A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), and similarly in Hep3B cells (data not shown). A marked diminution in colony formation was induced by ALA already at 0.5 mM suggesting a loss in the ability of treated cells to form clonal colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To better characterize these phenomena, we performed cell death and cell cycle analyses in C3A and Hep3B cells. Cytometric analysis of apoptotic populations by AnnexinV/PI staining in HCC derived cells showed that total apoptotic cells (Annexin V positive) significantly increased by 30 or 80% after 48 h treatments with 0.5 or 1mM ALA, respectively. Those cells dead by apoptosis (double positive) reached nearly 8 or 12% of the cells in the presence of 0.5 or 1mM ALA after 48 h, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). In addition, a 48-h treatment with 0.5 mM ALA arrested cell cycle at G0/G1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Altogether, results corroborated that ALA had diverse antitumor effects in HCC cells: a proapoptotic and a considerable cytostatic action reflected in the inhibition of anchorage independent growth.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eALA impaired migration and invasion in wild type p53-HCC cells\u003c/h2\u003e \u003cp\u003eWhen migratory capacity and invasiveness of C3A and Hep3B cells were analyzed at a dose of 0.5 mM, which showed minor effects in viability, we found that, in HepG2/C3A cells (wild type TP53), 2D migration in the wound front along 24h decreased by 40% in ALA treated versus control cells. Conversely, migration in Hep3B cells (TP53 deletion) was the same irrespectively of ALA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In addition, invasion studies showed that invasion through matrigel coated transwells was significantly diminished by a half of the control values in C3A cells treated with 0.5 mM ALA, whilst under this treatment invasion of Hep3B cells was maintained without significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These results suggested that a distinct response of the migratory function to ALA could be attributed to the different genetic background of the cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eThe anti-migratory effect of ALA was completely dependent on AMPK activation\u003c/h2\u003e \u003cp\u003eIn order to deepen in the mechanism of the striking effect of ALA in migration and invasion of HCC cells that express the AMPK target p53, we evaluated the role of AMPK signaling in the decrease of these migratory functions. First, we detected AMPK activation in these HCC cells subjected to ALA treatment. ALA increased the levels of pAMPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) in HepG2/C3A cells, and this was accompanied by an increase of p53 expression levels and also of its nuclear localization (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn turn, we analyzed the effect of the knockdown of the catalytic subunit of AMPK in HepG2/C3A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, upper left) on the migratory response and observed that this significantly blocked the anti-migratory effect of 0.5 mM ALA in C3A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In association with this, the silencing of AMPKa abrogated the increase in total p53 levels in ALA treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eMigration-Invasion in cell lines with diminished expression of p53\u003c/h2\u003e \u003cp\u003eTo determine the precise contribution of wild type p53 in the reduction of migration/invasion in HCC cells by ALA, we constructed from HepG2/C3A cells a control (shLacZ) and two stable retroviral clones with impaired expression of p53 (shp53 and shp53-3\u0026rsquo;UTR). The silenced cell lines showed more than 80%-reduction of \u003cem\u003eTP53\u003c/em\u003e transcription checked by qPCR (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). ALA (0.5 mM) effect was analyzed in these cells at the level of migration in wound healing assay and invasion through matrigel coated transwells. The knockdown of p53 almost completely blocked the anti migratory and anti invasive effects of ALA as observed in shp53 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B), and in shp53-3\u0026rsquo;UTR cells (data not shown), thus confirming that p53 expression is needed for ALA anti migratory and anti-invasive actions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of EMT markers in HCC cells treated with ALA: role of wild type TP53\u003c/h2\u003e \u003cp\u003eMigration and invasion in cancer cells depend mostly on the acquisition of mesenchymal properties which take place with the epithelial mesenchymal transition. Given that ALA reduced migration-invasion only in HCC cells that express wild type p53, a possibility existed that one or more proteins involved in EMT were affected via p53 in these cells thus inhibiting EMT and migration-invasion.\u003c/p\u003e \u003cp\u003eWhen we analyzed some of these EMT markers after ALA treatment, we detected that the epithelial protein E-cadherin significantly increased its levels in ALA treated C3A cells but remained unchanged in Hep3B, in opposition with the levels of its negative regulator SNAIL which showed significant reduction in ALA treated C3A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). We confirmed similar ALA effects dependent on \u003cem\u003eTP53\u003c/em\u003e expression in the constructed cell clones: In fact, \u003cem\u003eCDH1\u003c/em\u003e mRNA levels increased after ALA treatment in control but were unchanged in shp53 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Conversely, \u003cem\u003eVIM\u003c/em\u003e decreased after ALA treatment in control cells only, although \u003cem\u003eSNAI1\u003c/em\u003e mRNA levels showed no significant changes at the time analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Altogether, these data pointed out that ALA inhibited EMT in HCC cells mostly via p53.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eVariations in the expression of EMT related genes putatively regulated by p53 and the impact in survival in HCC patients\u003c/em\u003e \u003c/p\u003e \u003cp\u003eWe then indagued if in fact some EMT actors had different expressions and could conditionate the outcome of HCC patients depending on p53. We first evaluated if HCC-TCGA patients presented changes in the expression of EMT related genes putatively regulated by p53. We focused on a set of genes including the EMT markers \u003cem\u003eCDH1\u003c/em\u003e, \u003cem\u003eCDH2\u003c/em\u003e and \u003cem\u003eVIM\u003c/em\u003e; as well as EMT transcription factors demonstrated to be negatively regulated by p53 \u003cem\u003ein vitro\u003c/em\u003e: \u003cem\u003eZEB1/2\u003c/em\u003e, \u003cem\u003eTWIST1/2\u003c/em\u003e and \u003cem\u003eSNAI1/2\u003c/em\u003e\u003csup\u003e26,33\u003c/sup\u003e. In addition, we included genes involved in ECM degradation as the metalloproteinases \u003cem\u003eMMP2\u003c/em\u003e and \u003cem\u003eMMP9\u003c/em\u003e, also regulated by p53\u003csup\u003e34\u003c/sup\u003e. DGE analysis carried out in the complete dataset of HCC-TCGA patients showed that, of the selected genes, only \u003cem\u003eVIM, MMP2, SNAI2, MMP9\u003c/em\u003e and \u003cem\u003eTWIST1\u003c/em\u003e were differentially expressed and increased their expression in tumor versus non tumor samples, and no decreases (log2FC\u0026thinsp;\u0026lt;\u0026thinsp;1) with statistically significance were detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). A heatmap representation of gene expression in those 50 patients with paired control and tumor samples was performed and the plots were filtered and splitted in two groups of patients by \u003cem\u003eTP53\u003c/em\u003e status: although the clustering of genes was discretely different depending on \u003cem\u003eTP53\u003c/em\u003e, most of the patients had increased expression of \u003cem\u003eMMP9\u003c/em\u003e and \u003cem\u003eSNAI2\u003c/em\u003e, and, in the opposite side, most of them presented a decreased expression of \u003cem\u003eCDH1\u003c/em\u003e, as \u003cem\u003eSNAI1\u003c/em\u003e and \u003cem\u003eZEB2\u003c/em\u003e which seemed counter-regulated with respect to their related transcription factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). In the same group we compared the values of relative expression levels between patients with mutant \u003cem\u003eTP53\u003c/em\u003e and patients with wild type \u003cem\u003eTP53\u003c/em\u003e, and we observed that only in the case of \u003cem\u003eCDH1\u003c/em\u003e the distribution of values was significantly different in both populations: Patients with wild type \u003cem\u003eTP53\u003c/em\u003e had more preserved levels of \u003cem\u003eCDH1\u003c/em\u003e than those with mutant \u003cem\u003eTP53\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). We also analyzed this set of genes in the same HCC-TCGA patients using the data analysis tools accessible from UALCAN and we compared gene expression levels among each cancer stage: Significant decreases in \u003cem\u003eCDH1\u003c/em\u003e, and increases in \u003cem\u003eVIM, SNAI2, TWIST1, ZEB1\u003c/em\u003e and \u003cem\u003eMMPs\u003c/em\u003e in different stages were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Again, \u003cem\u003eSNAI1, ZEB2\u003c/em\u003e and \u003cem\u003eTWIST2\u003c/em\u003e had decreased expressions (omitted in the figure), which were non-significant in the case of \u003cem\u003eSNAI1\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn turn, we studied if these EMT related genes which are potential p53 targets led to any change in survival depending on the \u003cem\u003eTP53\u003c/em\u003e mutation status. In fact, \u003cem\u003eTP53\u003c/em\u003e expression levels were increased in most HCC patients from TCGA, which did not affect survival, however, survival did depend on mutation status: WT-\u003cem\u003eTP53\u003c/em\u003e patients showed a risk of death 65% lower than MUT-\u003cem\u003eTP53\u003c/em\u003e patients (Supp. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). We then analyzed if low or high levels of each selected gene in combination with the status of \u003cem\u003eTP53\u003c/em\u003e, wild type or mutant, led to any change in survival. Neither \u003cem\u003eCDH1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, left) nor \u003cem\u003eVIM\u003c/em\u003e nor the EMT transcription factors expression levels in the presence of any of the two \u003cem\u003eTP53\u003c/em\u003e status were associated with significant changes in patient survival. Only in the case of \u003cem\u003eMMP9\u003c/em\u003e a significant difference among survival curves was found: In patients with low \u003cem\u003eMMP9\u003c/em\u003e expression and WT \u003cem\u003eTP53\u003c/em\u003e the longest median survival was registered, and the risk of death was less than half of the risk of those with high \u003cem\u003eMMP9\u003c/em\u003e plus mutant \u003cem\u003eTP53\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, right).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe uncontrolled growth and proliferation of tumor cells are very dependent on their increased glycolytic rate\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. PDH catalyzes the decarboxylation of pyruvate in the TCA cycle, and prevention of pyruvate entry into the TCA cycle favors glycolysis and would promote tumor metabolic phenotype and survival of cancer cells, which is associated with high expression of the kinases that negatively regulate PDH, PDKs\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In this connection, recent studies in HCC cells demonstrate that PDH activation through downregulation of PDK4 leads to energy stress, increased ROS production and apoptosis\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The drug we analyze in this work, ALA, acts as a \u003cem\u003ebonafide\u003c/em\u003e PDK inhibitor that is an effective anticarcinogenic drug in different tumor cells\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, however its actions in HCC cells are not completely studied, especially the putative activation of AMPK and p53 as a mediator of antitumor effects.\u003c/p\u003e \u003cp\u003eConsidering this perspective, in this report we first tried to determine the effect of ALA in the whole viability and capacity of growth of HCC derived cells, and to further evaluate ALA effect on the metastatic ability through migration and invasion studies: We demonstrated that ALA had a cytotoxic effect, due to a well described pro apoptotic action. In addition, ALA treatment led to inhibition of cell cycle at G0 in the two different cell lines assayed. However, we observed that the anti-migratory and anti-invasive effects of ALA were significant in HepG2/C3A, but not appreciable in Hep3B cells. Given that the last cell line has a distinctive genetic background because of HBV gene inserts and p53 gene deletion, we aimed to better define the role of p53 in this response to ALA.\u003c/p\u003e \u003cp\u003eALA induces AMPK activation in different tumor cells where it may mediate many anticarcinogenic effects\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, so we determined AMPKa phosphorylation (T172) levels in HCC cells treated with ALA: p-AMPK levels were significantly increased by ALA at low millimolar concentration in HCC cells. Besides, we demonstrated that ALA increased total and nuclear levels of the target of AMPK p53 in HepG2/C3A cells, which could be associated with the activation of p53. These results agreed strongly with recent evidence describing both stabilization and nuclear translocation of p53 in HepG2 cells during energy stress by fasting\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Furthermore, we observed that interfering with the expression of the catalytic subunit of AMPK resulted in a complete blockage in both p53 increase and migration reduction after ALA treatment in C3A cells. These findings indicated that ALA antimigratory effect is dependent on AMPK signaling and that p53 activation is a putative downstream event leading to this antitumor action.\u003c/p\u003e \u003cp\u003ePioneer genomic studies in HCC patients show by the first that survival in patients with mutations in the tumor suppressor p53 is diminished\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. In fact, mutation of \u003cem\u003eTP53\u003c/em\u003e occurs early and it is a driver of HCC progression\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e, whilst the conservation of wild type \u003cem\u003eTP53\u003c/em\u003e could represent a significant benefit in the outcome of HCC, and a possibility to stabilize or activate p53 through novel strategies with antitumor results\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Wild type p53 is involved in the negative regulation of different EMT transcription factors in HCC \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e, hence we postulate that the status of p53 could be a strong determinant of the migratory ability of HCC cells and that the increase of WT p53 could lead to anti migratory effects. In the results presented herein, the stable silencing of WT p53 in HepG2/C3A cells avoided the reduction of migration and invasion after ALA treatment attributed to AMPK activation. These findings corroborated those we obtained in the p53-null cell line Hep3B, and they indicated that the activity of p53 is necessary in the anti migratory effect of ALA in HCC cells.\u003c/p\u003e \u003cp\u003eWe then tried to determine if EMT was inhibited by this axis after ALA treatment in HCC cells, thus explaining the reduction in migration and invasion observed. We evaluated the effect of ALA on EMT in C3A and Hep3B cells and in control and shp53-C3A cells. Altogether this set of results demonstrated that ALA increases E-cadherin probably via SNAIL reduction in cells expressing wild type p53 only, which is in the vein with the anti-migratory effect of ALA in these cells. The results also suggested the gravitation of E-cadherin in HCC biology depending on the presence of wild type p53. In this connection, several findings support that E-cadherin expression diminishes in more metastatic HCC forms\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e,\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e, and that SNAIL or TWIST roles in E-cadherin downregulation and metastasis are crucial\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. However, the impact of the variations of these EMT markers in relation with other tumor regulators as p53 is understudied in HCC patients. For these reasons, we analyzed if some of these actors of the EMT process potentially regulated by p53 changed its gene expression and conditioned survival in HCC patients depending on \u003cem\u003eTP53\u003c/em\u003e status. Of the genes selected, \u003cem\u003eCDH1\u003c/em\u003e significantly decreased its expression, whilst \u003cem\u003eSNAI2\u003c/em\u003e, \u003cem\u003eTWIST1, ZEB1, VIM, MMP2\u003c/em\u003e and \u003cem\u003eMMP9\u003c/em\u003e significantly increased in tumors of HCC-TCGA patients in one or more analyses. Furthermore, \u003cem\u003eCDH1\u003c/em\u003e had a distinct pattern of change in the expression: lower diminutions in patients with wild type \u003cem\u003eTP53\u003c/em\u003e compared with patients with mutated \u003cem\u003eTP53\u003c/em\u003e was observed. Among all these genes only \u003cem\u003eMMP9\u003c/em\u003e resulted in significant survival increase depending on p53. Given that p53 may regulate not only gene expression but also protein stability of EMT transcription factors like SNAIL and TWIST1 in HCC and in diverse tumor cells\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e,\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e, and considering that protein escindition of E-cadherin by metalloproteinases like MMP9 is also a way of EMT regulation in different cancers\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e,\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e,\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e, the complete picture is missing in transcriptomic analyses. Proteomic analyses from patients organized in databases are still scarce, but further studies would be necessary in HCC to find actual EMT determinants of the disease progression.\u003c/p\u003e \u003cp\u003eIn sum, in this study we showed strong evidence of ALA antitumor actions in HCC cells from cytotoxic to never described cytostatic and antimigratory effects. We found that the reduction of migration and invasion by ALA treatment were dependent on AMPK and p53 activations which reduced EMT in HCC cells. Our results confirmed that core genes of EMT regulable by p53 variate their expression in HCC patients, sometimes in a progressive stage-dependent or p53 status-dependent way. Our results constitute promising data on the putative therapeutic effect of ALA or similar mitochondrial drugs in HCC, specially by reducing EMT and cell migration in those patients with wild type p53.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceived and designed the experiments: FH, CF. Performed the experiments or data analysis: FH, CBE, EB, AP and JB. Supervised the experiments: MCL, JEG, ACF and CF. Analyzed the results: FH, CF. Wrote the paper: CF. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThis work was supported by the Argentine Govern through CONICET: PIP 11220120100287CO and PIP 11220150100293CO, and Agencia I\u0026thinsp;+\u0026thinsp;D\u0026thinsp;+\u0026thinsp;i: PICT 2021\u0026thinsp;\u0026minus;\u0026thinsp;427.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe full-length blots used for the figures during this study are included in this published article [and its supplementary information files]. All other datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLlovet J. M. et al. Hepatocellular carcinoma. Nat. Rev. Dis. Primers. 7, 6 (2021). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41572-020-00240-3\u003c/span\u003e\u003cspan address=\"10.1038/s41572-020-00240-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingal, A. G., Lampertico \u0026amp; P., Nahon, P. Epidemiology and surveillance for hepatocellular carcinoma: New trends. J. Hepatol. 72, 250\u0026ndash;261 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jhep.2019.08.025\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2019.08.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarquardt, J. U., Andersen, J. B. \u0026amp; Thorgeirsson, S. S. Functional and genetic deconstruction of the cellular origin in liver cancer. Nat. Rev. Cancer. 15, 653\u0026ndash;67 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrc4017\u003c/span\u003e\u003cspan address=\"10.1038/nrc4017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchulze, K., Nault, J. C.\u0026amp; Villanueva, A. Genetic profiling of hepatocellular carcinoma using next-generation sequencing. J. Hepatol. 65, 1031\u0026ndash;1042 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jhep.2016.05.035\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2016.05.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHardie, D. G. AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat. Rev. Mol. Cell. Biol. 8, 774\u0026ndash;85 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrm2249\u003c/span\u003e\u003cspan address=\"10.1038/nrm2249\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZong, Y., \u003cem\u003eet al\u003c/em\u003e. Hierarchical activation of compartmentalized pools of AMPK depends on severity of nutrient or energy stress. Cell Res. 29, 460\u0026ndash;473 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarling, D. AMPK hierarchy: a matter of space and time. Cell Res. 29, 425\u0026ndash;426 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaffer, B. E., \u003cem\u003eet al.\u003c/em\u003e Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Cell Metab. 22, 907\u0026ndash;21 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41422-019-0171-6\u003c/span\u003e\u003cspan address=\"10.1038/s41422-019-0171-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan, Y., \u003cem\u003eet al.\u003c/em\u003e Augmented AMPK activity inhibits cell migration by phosphorylating the novel substrate Pdlim5. Nat. Commun. 6, 6137 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncomms7137\u003c/span\u003e\u003cspan address=\"10.1038/ncomms7137\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHenry, W. S., \u003cem\u003eet al.\u003c/em\u003e Aspirin Suppresses Growth in PI3K-Mutant Breast Cancer by Activating AMPK and Inhibiting mTORC1 Signaling. Cancer Res. 77, 790\u0026ndash;801 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.CAN-16-2400\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-16-2400\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuan, W., \u003cem\u003eet al.\u003c/em\u003e Desmoplasia suppression by metformin-mediated AMPK activation inhibits pancreatic cancer progression. Cancer Lett. 385, 225\u0026ndash;233 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.canlet.2016.10.019\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2016.10.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, W., Saud, S. M., Young, M. R., Chen, G. \u0026amp; Hua, B. Targeting AMPK for cancer prevention and treatment. Oncotarget. 6, 7365\u0026ndash;7378 (2015). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.3629\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.3629\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVara-Ciruelos, D., Russell, F. M. \u0026amp; Hardie, D. G. The strange case of AMPK and cancer: Dr Jekyll or Mr Hyde? Open Biol. 9, 190099 (2019). The strange case of AMPK and cancer: Dr Jekyll or Mr Hyde? \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rsob.190099\u003c/span\u003e\u003cspan address=\"10.1098/rsob.190099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGomes, A. S., Ramos, H., Soares, J., \u0026amp; Saraiva, L. p53 and glucose metabolism: an orchestra to be directed in cancer therapy. Pharmacol. Res. 131, 75\u0026ndash;86 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phrs.2018.03.015\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2018.03.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLacroix, M., Riscal, R., Arena, G., Linares, L. K., \u0026amp; Le Cam, L. Metabolic functions of the tumor suppressor p53: Implications in normal physiology, metabolic disorders, and cancer. Mol. Metab. 33, 2\u0026ndash;22. (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molmet.2019.10.002\u003c/span\u003e\u003cspan address=\"10.1016/j.molmet.2019.10.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, C. W., \u003cem\u003eet al.\u003c/em\u003e AMPK promotes p53 acetylation via phosphorylation and inactivation of SIRT1 in liver cancer cells. Cancer Res. 72, 4394\u0026ndash;404 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.CAN-12-0429\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-12-0429\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng, J., \u003cem\u003eet al\u003c/em\u003e. AMP-activated protein kinase suppresses the in vitro and in vivo proliferation of hepatocellular carcinoma. PLoS One. 9, e93256 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0093256\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0093256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerretti, A. C. \u003cem\u003eet al\u003c/em\u003e. AMPK and PKA interaction in the regulation of survival of liver cancer cells subjected to glucose starvation. Oncotarget 7, 17815\u0026ndash;17828 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.7404\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.7404\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerretti, A. C., Hidalgo, F., Tonucci, F. M., Almada, E., Pariani, A., Larocca, M. C., \u0026amp; Favre, C. Metformin and glucose starvation decrease the migratory ability of hepatocellular carcinoma cells: targeting AMPK activation to control migration. Sci. Rep., 9, 1\u0026ndash;14 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-019-39556-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-39556-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026ouml;rsam, B. \u0026amp; Fahrer, J. The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria. \u003cem\u003eCancer Lett.\u003c/em\u003e 371, 12\u0026ndash;9 (2016). The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.canlet.2015.11.019\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2015.11.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarhat, D., \u0026amp; Lincet, H. Lipoic acid a multi-level molecular inhibitor of tumorigenesis. Biochim. Biophys. Acta. Rev. Cancer. 1873, 188317 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbcan.2019.188317\u003c/span\u003e\u003cspan address=\"10.1016/j.bbcan.2019.188317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, S., Choi, S. K., Choi, Y. \u0026amp; Moon, H. S. AMPK/p53 Axis Is Essential for α-Lipoic Acid-Regulated Metastasis in Human and Mouse Colon Cancer Cells. J. Investig. Med. 63, 882\u0026ndash;5 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1097/JIM.0000000000000233\u003c/span\u003e\u003cspan address=\"10.1097/JIM.0000000000000233\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimbula, G., et al. Increased ROS generation and p53 activation in alpha-lipoic acid-induced apoptosis of hepatoma cells. Apoptosis. 12, 113\u0026ndash;23 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10495-006-0487-9\u003c/span\u003e\u003cspan address=\"10.1007/s10495-006-0487-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, K. G., et al. Alpha-lipoic acid decreases hepatic lipogenesis through adenosine monophosphate-activated protein kinase (AMPK)-dependent and AMPK-independent pathways. Hepatology. 48, 1477\u0026ndash;86 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/hep.22496\u003c/span\u003e\u003cspan address=\"10.1002/hep.22496\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, et al. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway. J. Nutr. Biochem. 25, 1207\u0026ndash;1217 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jnutbio.2014.06.001\u003c/span\u003e\u003cspan address=\"10.1016/j.jnutbio.2014.06.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiannelli, G., Koudelkova, P., Dituri, F., \u0026amp; Mikulits, W. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J. Hepatol. 65, 798\u0026ndash;808 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jhep.2016.05.007\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2016.05.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShih, J-Y. \u0026amp; Yang, P-C. The EMT regulator slug and lung carcinogenesis, Carcinogenesis. 32, 1299\u0026ndash;1304 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/carcin/bgr110\u003c/span\u003e\u003cspan address=\"10.1093/carcin/bgr110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, J., et al. Cooperative actions of p21 WAF 1 and p53 induce Slug protein degradation and suppress cell invasion. EMBO Rep. 15, 1062\u0026ndash;1068 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15252/embr.201438587\u003c/span\u003e\u003cspan address=\"10.15252/embr.201438587\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEtichetti, C. B. et al. Isoprenylcysteine carboxy methyltransferase (ICMT) is associated with tumor aggressiveness and its expression is controlled by the p53 tumor suppressor. J. Biol. Chem., 294, 5060\u0026ndash;5073 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.RA118.006037\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA118.006037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTonucci, F. M. \u003cem\u003eet al\u003c/em\u003e. Centrosomal AKAP350 and CIP4 act in concert to define the polarized localization of the centrosome and Golgi in migratory cells. J. Cell Sci. 128, 3277\u0026ndash;3289 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.170878\u003c/span\u003e\u003cspan address=\"10.1242/jcs.170878\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680\u0026ndash;685 (1970). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/227680a0\u003c/span\u003e\u003cspan address=\"10.1038/227680a0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandrashekar, D. S., et al. UALCAN: a portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia 19, 649\u0026ndash;658 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neo.2017.05.002\u003c/span\u003e\u003cspan address=\"10.1016/j.neo.2017.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z., et al. Critical roles of p53 in epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma cells. PLoS One 8, e72846 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0072846\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0072846\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePowell, E., Piwnica-Worms, D., \u0026amp; Piwnica-Worms, H. Contribution of p53 to metastasis. Cancer Discov., 4, 405\u0026ndash;414 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/2159-8290.CD-13-0136\u003c/span\u003e\u003cspan address=\"10.1158/2159-8290.CD-13-0136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePavlova, N. N. \u0026amp; Thompson, C. B. The Emerging Hallmarks of Cancer Metabolism. Cell Metab. 23, 27\u0026ndash;47 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2015.12.006\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2015.12.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeclerc, D., et al. Oncogenic role of PDK4 in human colon cancer cells. Br. J. Cancer. 116, 930\u0026ndash;936 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/bjc.2017.38\u003c/span\u003e\u003cspan address=\"10.1038/bjc.2017.38\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePavlova, N. N., Zhu, J., \u0026amp; Thompson, C. B. The hallmarks of cancer metabolism: Still emerging. Cell Metab. 34, 355\u0026ndash;377 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2022.01.007\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2022.01.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, J., et al. Loss of PDK4 switches the hepatic NF-κB/TNF pathway from pro-survival to pro-apoptosis. Hepatology. 68, 1111\u0026ndash;1124 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/hep.29902\u003c/span\u003e\u003cspan address=\"10.1002/hep.29902\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnwar, S., Shamsi, A., Mohammad, T., Islam, A. \u0026amp; Hassan, M. I. Targeting pyruvate dehydrogenase kinase signaling in the development of effective cancer therapy. Biochim. Biophys. Acta Rev. Cancer. 1876, 188568 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbcan.2021.188568\u003c/span\u003e\u003cspan address=\"10.1016/j.bbcan.2021.188568\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrstic, J., Reinisch, I., Schindlmaier, K., Galhuber, M., Riahi, Z., Berger, N., \u0026hellip;Prokesch, A. Fasting improves therapeutic response in hepatocellular carcinoma through p53-dependent metabolic synergism. \u003cem\u003eSci Adv.\u003c/em\u003e, 8, eabh2635 (2022). https://doi.org/10.1126/sciadv.abh2635\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalhuber, M., Michenthaler, H., Heininger, C. \u003cem\u003eet al.\u003c/em\u003e Complementary omics strategies to dissect p53 signaling networks under nutrient stress. Cell. Mol. Life Sci. 79, 326 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00018-022-04345-8\u003c/span\u003e\u003cspan address=\"10.1007/s00018-022-04345-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHonda, K., \u003cem\u003eet al. p53\u003c/em\u003e mutation is a poor prognostic indicator for survival in patients with hepatocellular carcinoma undergoing surgical tumour ablation. \u003cem\u003eBr. J. Cancer\u003c/em\u003e 77, 776\u0026ndash;782 (1998). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/bjc.1998.126\u003c/span\u003e\u003cspan address=\"10.1038/bjc.1998.126\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCraig, A.J., \u003cem\u003eet al.\u003c/em\u003e Tumour evolution in hepatocellular carcinoma. Nat. Rev. Gastroenterol. Hepatol. 17, 139\u0026ndash;152 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41575-019-0229-4\u003c/span\u003e\u003cspan address=\"10.1038/s41575-019-0229-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTortelli Jr, T. C., et al. Metformin-induced chemosensitization to cisplatin depends on P53 status and is inhibited by Jarid1b overexpression in non-small cell lung cancer cells. Aging (Albany NY), 13, 21914 (2021). https://doi.org/10.18632%2Faging.203528\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, S., et al. Reticulon 3-mediated Chk2/p53 activation suppresses hepatocellular carcinogenesis and is blocked by hepatitis B virus. Gut 70, 2159\u0026ndash;2171 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1136/gutjnl-2020-321386\u003c/span\u003e\u003cspan address=\"10.1136/gutjnl-2020-321386\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao, Jy., \u003cem\u003eet al.\u003c/em\u003e Novel CDK9 inhibitor oroxylin A promotes wild-type P53 stability and prevents hepatocellular carcinoma progression by disrupting both MDM2 and SIRT1 signaling. Acta Pharmacol. Sin. 1\u0026ndash;13 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-021-00708-2\u003c/span\u003e\u003cspan address=\"10.1038/s41401-021-00708-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim, S. O., Kim, H., \u0026amp; Jung, G. p53 inhibits tumor cell invasion via the degradation of snail protein in hepatocellular carcinoma. FEBS Lett. 584, 2231\u0026ndash;2236 (2010). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.febslet.2010.04.006\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2010.04.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, T., et al. p53 regulates epithelial\u0026ndash;mesenchymal transition through microRNAs targeting ZEB1 and ZEB2. J. Exp. Med. 208, 875\u0026ndash;883 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1084/jem.20110235\u003c/span\u003e\u003cspan address=\"10.1084/jem.20110235\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsumura, T., Makino, R., \u0026amp; Mitamura, K. Frequent down-regulation of E-cadherin by genetic and epigenetic changes in the malignant progression of hepatocellular carcinomas. Clin. Cancer Res. 7, 594\u0026ndash;599 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFransvea, E., Angelotti, U., Antonaci, S., \u0026amp; Giannelli, G. Blocking transforming growth factor\u0026ndash;beta up-regulates E‐cadherin and reduces migration and invasion of hepatocellular carcinoma cells. Hepatology 47, 1557\u0026ndash;1566 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/hep.22201\u003c/span\u003e\u003cspan address=\"10.1002/hep.22201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, B., Li, M., \u003cem\u003eet al.\u003c/em\u003e Dynamic network biomarker indicates pulmonary metastasis at the tipping point of hepatocellular carcinoma. Nat Commun 9, 678 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-018-03024-2\u003c/span\u003e\u003cspan address=\"10.1038/s41467-018-03024-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, M. H., et al. Comprehensive analysis of the independent effect of twist and snail in promoting metastasis of hepatocellular carcinoma. Hepatology 50, 1464\u0026ndash;1474 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e​​https://doi.org/10.1002/hep.23221\u003c/span\u003e\u003cspan address=\"​​10.1002/hep.23221\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cem\u003eMol. Can. Res.\u003c/em\u003e, 17, 153\u0026ndash;164 (2019). https://doi.org/10.1158/1541-7786.MCR-18-0238\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSemenov, O., Daks, A., Fedorova, O., Shuvalov, O., \u0026amp; Barlev, N. A. Opposing roles of wild-type and mutant p53 in the process of epithelial to mesenchymal transition. Frontiers Mol. Biosc., 9, 928399 (2022). https://doi.org/10.3389%2Ffmolb.2022.928399\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCowden Dahl, K. D., et al. Matrix metalloproteinase 9 is a mediator of epidermal growth factor\u0026ndash;dependent E-cadherin loss in ovarian carcinoma cells. Cancer Res. 68, 4606\u0026ndash;4613 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.CAN-07-5046\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-07-5046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo, J. H., et al. Activation of EGFR promotes squamous carcinoma SCC10A cell migration and invasion via inducing EMT-like phenotype change and MMP‐9‐mediated degradation of E‐cadherin. J. Cell. Biochem. 112, 2508\u0026ndash;2517 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcb.23175\u003c/span\u003e\u003cspan address=\"10.1002/jcb.23175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J. R., et al. Orphan nuclear receptor Nur77 promotes colorectal cancer invasion and metastasis by regulating MMP-9 and E-cadherin. Carcinogenesis 35, 2474\u0026ndash;2484 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/carcin/bgu157\u003c/span\u003e\u003cspan address=\"10.1093/carcin/bgu157\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"AMPK, EMT, Hepatocarcinoma, Migration, Signaling, TP53","lastPublishedDoi":"10.21203/rs.3.rs-3773984/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3773984/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHepatocellular carcinoma (HCC) associated with viral or metabolic liver diseases is a growing cancer that lacks effective therapy. AMPK is downregulated in the early stages of HCC and its activation diminishes tumor progression in culture and in vivo. Alpha lipoic acid (ALA), an indirect AMPK activator that inhibits hepatic steatosis in rodents, shows antitumor effects in different cancers. We aimed to study the putative antitumor action of ALA in HCC cells through AMPK signaling.\u003c/p\u003e \u003cp\u003eALA led to significant inhibition of cell migration and invasion in HCC cells with wild-type TP53. We showed that these effects depended on AMPK, and ALA also increased the levels and nuclear compartmentalization of the AMPK target p53. The anti-invasive effect of ALA was abrogated in stable-silenced versus isogenic-TP53 cells. Furthermore, ALA inhibited epithelial-mesenchymal transition in control wild-type TP53, but no significant changes of EMT markers were observed in silenced TP53 cells. In addition, we spotted that in patients from the HCC-TCGA dataset some EMT genes showed different expression patterns or survival profiles depending on TP53 status. ALA emerges as a potent activator of AMPK-p53 axis in HCC cells, and it decreases migration/invasion by reducing EMT which could mitigate the disease in wild-type TP53 patients.\u003c/p\u003e","manuscriptTitle":"Alpha lipoic acid diminishes migration and invasion in hepatocellular carcinoma cells through an AMPK-p53 axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-12-27 05:24:03","doi":"10.21203/rs.3.rs-3773984/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-12T19:40:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-10T08:18:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"36098277-5776-422b-8952-1bcbc3f9dab1","date":"2024-04-09T00:13:02+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-22T03:45:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"bc67e790-bbb8-4555-a8d4-ed8514c1d609","date":"2024-02-21T19:59:55+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-03T16:26:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-03T16:15:19+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2023-12-21T17:47:12+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-12-21T17:23:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2023-12-18T23:24:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a355c309-8e83-4599-9bac-63ad200e02cd","owner":[],"postedDate":"December 27th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":27756088,"name":"Biological sciences/Cancer/Gastrointestinal cancer/Liver cancer/Hepatocellular carcinoma"},{"id":27756089,"name":"Biological sciences/Cell biology/Cell migration/Epithelial mesenchymal transition"}],"tags":[],"updatedAt":"2024-09-16T16:14:15+00:00","versionOfRecord":{"articleIdentity":"rs-3773984","link":"https://doi.org/10.1038/s41598-024-72309-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-09-11 15:58:24","publishedOnDateReadable":"September 11th, 2024"},"versionCreatedAt":"2023-12-27 05:24:03","video":"","vorDoi":"10.1038/s41598-024-72309-y","vorDoiUrl":"https://doi.org/10.1038/s41598-024-72309-y","workflowStages":[]},"version":"v1","identity":"rs-3773984","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3773984","identity":"rs-3773984","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}