Ptpn20 preserves actin-dependent vesicular trafficking and amyloid-β clearance capacity in the choroid plexus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Ptpn20 preserves actin-dependent vesicular trafficking and amyloid-β clearance capacity in the choroid plexus Ryo Miyahara, Masakazu Miyajima, Madoka Nakajima, Ikuko Ogino, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8759264/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Accumulation of amyloid-β (Aβ) in Alzheimer’s disease reflects not only excessive production but also impaired clearance. The choroid plexus (ChP), which forms the blood–cerebrospinal fluid barrier, plays an important role in cerebrospinal fluid turnover and molecular elimination; however, the mechanisms that maintain epithelial integrity and vesicle-mediated transport remain poorly understood. Here we identify the cytoplasmic protein tyrosine phosphatase Ptpn20 as a key regulator of actin-dependent vesicular trafficking in ChP epithelial cells. Loss of Ptpn20 destabilizes apical F-actin architecture, suppresses both caveolae- and clathrin-mediated endocytosis, and reduces transcytosis of Aβ from the cerebrospinal fluid to the bloodstream. Transcriptomic profiling reveals coordinated downregulation of cytoskeletal, junctional, and vesicular transport modules. Mechanistically, Ptpn20 deficiency induces an early, transient hyperactivation of RhoA signaling that subsequently diminishes as actin architecture deteriorates, indicating biphasic uncoupling of RhoA–actin regulation. In the APP^NL-G-F knock-in background, loss of Ptpn20 exacerbates epithelial degeneration, apical Aβ accumulation, brain amyloid pathology, synaptic loss, and cognitive impairment. These findings establish Ptpn20 as an essential determinant of ChP epithelial homeostasis and highlight impaired actin-dependent vesicular trafficking as a contributor to reduced Aβ clearance. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Alzheimer’s disease (AD) is characterized by progressive accumulation of amyloid-β (Aβ), reflecting an imbalance between its production and clearance rather than overproduction alone( 1 – 6 ). While impaired clearance has emerged as a central driver of early AD pathogenesis, the mechanisms governing Aβ movement across cerebrospinal fluid (CSF) interfaces remain incompletely understood. The choroid plexus (ChP), a highly vascularized epithelial structure forming the blood–CSF barrier (BCSFB), plays a pivotal role in CSF turnover and removal of metabolic waste from the central nervous system( 7 – 11 ). ChP epithelial cells possess a dense apical F-actin network that stabilizes tight junctions, maintains microvillar architecture, and supports receptor-mediated endocytosis ( 12 – 14 ). These features have been implicated in vectorial handling of amyloid-β across the blood–CSF interface ( 15 – 17 ). Age-related degeneration of the ChP epithelium—including fragmentation of apical F-actin, microvillar atrophy, and impaired vesicular trafficking—has been associated with reduced CSF production and diminished clearance of neurotoxic metabolites( 15 – 17 ). Similar structural and functional alterations are observed in idiopathic normal pressure hydrocephalus, where compromised ChP function improves following CSF diversion( 18 – 21 ), highlighting the ChP as an upstream regulator of brain homeostasis. Despite these observations, the molecular determinants that preserve cytoskeletal integrity and vesicular transport capacity in ChP epithelial cells remain largely undefined. Protein tyrosine phosphatases (PTPs), particularly cytoplasmic non-receptor PTPs, have emerged as critical modulators of cytoskeletal organization, epithelial adhesion, and small GTPase signaling( 22 – 25 ). Ptpn20, a non-receptor PTP with previously unclear physiological roles, has been implicated in actin remodeling and regulation of RhoA signaling in select cellular contexts ( 22 , 23 ). Given the reliance of ChP-mediated Aβ transport on actin-regulated endocytic pathways, we hypothesized that Ptpn20 is required to maintain the actin–vesicular trafficking axis essential for efficient Aβ clearance. Here, using transcriptomic profiling, ultrastructural analyses, endocytic assays, and genetic interaction studies with the APP NL-G-F knock-in model( 26 ), we investigate the role of Ptpn20 in ChP epithelial homeostasis. Our findings suggest that Ptpn20 supports apical actin organization and vesicle-associated transport processes in the ChP epithelium and that loss of Ptpn20 exacerbates Aβ-associated epithelial stress in vivo. These observations implicate dysregulation of actin-dependent vesicular trafficking as a potential contributor to impaired CSF-mediated Aβ clearance and accelerated AD-related pathology ( 27 – 29 ). Results Age-associated reduction of Ptpn20 expression and altered actin organization in the choroid plexus In 8-week-old wild-type (WT) mice, Ptpn20 immunoreactivity was diffusely distributed throughout the cytoplasm of choroid plexus (ChP) epithelial cells, while F-actin formed a dense and continuous apical band. By 48 weeks of age, Ptpn20 expression was markedly reduced, accompanied by pronounced thinning and attenuation of the apical F-actin structure (Fig. 1a). Quantitative RT–PCR confirmed a significant, age-dependent decline in Ptpn20 mRNA expression (Fig. 1b). In Ptpn20 knockout (Ptpn20KO) mice, Ptpn20 immunoreactivity was absent at 8 weeks of age, and the apical F-actin band was markedly thinner, closely resembling the aged WT phenotype (Fig. 1c). These findings indicate that loss of Ptpn20 is associated with alterations in apical actin organization resembling age-related changes. Altered RhoA signaling dynamics in Ptpn20-deficient choroid plexus RhoA immunoreactivity was detected along the apical membrane in both WT and Ptpn20KO ChP epithelia (Fig. 1d). Because RhoA is a central regulator of actin polymerization and vesicle dynamics, we quantified its activation state using G-LISA and ELISA assays. At 5–6 weeks of age, levels of active, GTP-bound RhoA were significantly elevated in Ptpn20KO ChP compared with WT controls (WT: 0.087 ± 0.012; KO: 0.184 ± 0.014; p = 0.001). In contrast, this genotype-dependent difference was no longer detectable at 8 weeks (WT: 0.138 ± 0.031; KO: 0.151 ± 0.012) (Fig. 1e). Total RhoA protein levels were modestly but significantly increased in Ptpn20KO mice at both 5–6 weeks and 8 weeks ( p < 0.05 for both comparisons) (Fig. 1f). Accordingly, the ratio of active to total RhoA—a measure of the fraction of RhoA in its GTP-bound state—was significantly elevated in Ptpn20KO mice at 5–6 weeks (WT: 3.46 ± 0.66; KO: 5.73 ± 0.58; p = 0.049), but not at 8 weeks (WT: 6.31 ± 1.35; KO: 5.94 ± 0.49) (Fig. 1g). Together, these results suggest that loss of Ptpn20 induces an early, transient hyperactivation of RhoA signaling, followed by convergence toward WT levels as apical actin architecture becomes progressively altered. Tracer retention suggests reduced uptake efficiency in Ptpn20-deficient choroid plexus To assess functional consequences of cytoskeletal and signaling abnormalities, we examined epithelial uptake following intracisternal tracer injection. After Carbon Black administration, WT mice exhibited minimal epithelial tracer accumulation, whereas Ptpn20KO mice showed prominent apical tracer retention within ChP epithelial cells (Fig. 1h). Although this approach does not directly quantify specific endocytic pathways, the observed tracer retention suggests reduced uptake efficiency and/or altered intracellular handling in Ptpn20-deficient epithelium. Ptpn20 deficiency disrupts endocytic, efflux, cytoskeletal, and barrier gene networks required for Aβ handling Microarray analysis of ChP tissue from 4-week-old WT and Ptpn20KO mice identified coordinated alterations across eight predefined functional gene modules: ( 1 ) uptake/transcytosis, ( 2 ) efflux transport, ( 3 ) degradation, ( 4 ) CSF/ion dynamics, ( 5 ) barrier/inflammation, ( 6 ) metal homeostasis, ( 7 ) stress/mTOR signaling, and ( 8 ) cytoskeleton/vesicular trafficking. Radar chart–integrated heatmap analysis revealed pronounced downregulation of modules associated with uptake/transcytosis, degradation, barrier integrity, and cytoskeleton/vesicular trafficking in Ptpn20KO mice (Fig. 2a, S1), suggesting coordinated alterations in pathways critical for Aβ handling. Quantitative RT–PCR at 5 weeks confirmed significant reductions in Cav1 and Cltc , representing caveolae- and clathrin-mediated endocytosis, respectively (Fig. 2b). Expression of the basolateral efflux transporter Abcc1 was significantly reduced, whereas Lrp1 expression remained unchanged. Aqp1 expression was also significantly downregulated, while ATP1a1 and Slc13a3 showed no significant change. Consistent with transcriptional alterations, immunofluorescence analysis demonstrated reduced claudin-1 immunoreactivity in Ptpn20KO ChP (Fig. 2c). By 16 weeks of age, apical F-actin organization and RhoA localization were severely disrupted (Fig. 2d). Collectively, these findings indicate that Ptpn20 loss disrupts multiple molecular pathways required for efficient Aβ uptake, intracellular routing, and basolateral efflux across the ChP epithelium. Ptpn20 deficiency exacerbates Aβ accumulation and transporter dysregulation in APPKI mice Genotyping confirmed successful generation of APPKI × Ptpn20KO double-mutant mice (Fig. S2). In 8-week-old APPKI mice, Aβ deposition was undetectable in the ChP and ZO-1 expression remained intact. In contrast, APPKI × Ptpn20KO mice exhibited prominent apical Aβ accumulation accompanied by reduced continuity of ZO-1 immunoreactivity (Fig. 3a). ELISA quantification revealed significantly elevated levels of both Aβ40 and Aβ42 in ChP tissue from APPKI × Ptpn20KO mice compared with APPKI controls (Fig. 3b). At 7 weeks of age, RT–PCR analysis demonstrated a shift in endocytic pathway utilization, characterized by increased Cltc expression and reduced Cav1 expression (Fig. 3c). In parallel, expression of Lrp1 , Abcc1 , Aqp1 , and Atp1a1 was upregulated, whereas Slc13a3 was markedly downregulated, indicating compensatory but dysregulated transporter responses to elevated CSF Aβ burden. Ultrastructural analyses revealed preserved epithelial architecture in APPKI mice, whereas APPKI × Ptpn20KO mice exhibited reduced tight-junction electron density, elongated and abnormal mitochondria, cytoskeletal collapse, widened intercellular spaces, and severe loss of apical microvilli. (Fig. 3d,e). Combined loss of Ptpn20 and APPKI accelerates brain Aβ deposition, synaptic degeneration, and cognitive impairment At 8 weeks of age, amyloid plaque burden was significantly increased in the cerebral cortex of APPKI × Ptpn20KO mice compared with APPKI mice (Fig. 4a,b). By 16 weeks, plaque deposition was further increased in both cortex and hippocampus, with consistently greater burden in double-mutant mice (Fig. 4c,d). Transmission electron microscopy of the hippocampal CA3 region revealed marked synaptic loss in APPKI × Ptpn20KO mice relative to APPKI controls (Fig. 5a). Behavioral analyses at 24 weeks demonstrated significant cognitive impairment in APPKI × Ptpn20KO mice. In the Y-maze, spontaneous alternation rates were significantly reduced compared with APPKI mice, indicating impaired working memory (Fig. 5b). Ptpn20KO mice without APPKI did not exhibit significant impairment, suggesting that Ptpn20 deficiency selectively exacerbates amyloid-associated cognitive dysfunction. In the Morris water maze, APPKI × Ptpn20KO mice displayed prolonged escape latency during acquisition trials, indicating impaired spatial learning (Fig. 5e). Probe test analysis further revealed a marked reduction in platform crossings within the target zone, reflecting impaired spatial memory retention (Fig. 5c,d). APPKI mice showed intermediate deficits, whereas Ptpn20KO mice alone exhibited only mild alterations, indicating a synergistic interaction between Ptpn20 deficiency and pathogenic amyloid-β. Discussion The choroid plexus (ChP) is increasingly recognized as a dynamic regulatory interface that governs cerebrospinal fluid (CSF) turnover, molecular exchange, and metabolic homeostasis within the central nervous system( 7 , 8 , 12 ). Specialized ChP epithelial cells rely on a dense apical F-actin network to maintain tight junction integrity, microvillar morphology, and receptor-mediated endocytosis( 12 – 17 ), thereby enabling vectorial transport of metabolites and neurotoxic species from the CSF to the bloodstream. Age-related deterioration of these cytoskeletal structures has been linked to reduced CSF production and impaired clearance of amyloid-β (Aβ)( 15 – 17 ); however, the molecular mechanisms that preserve epithelial integrity and vesicular transport capacity have remained poorly defined. In this study, we identify the cytoplasmic non-receptor protein tyrosine phosphatase Ptpn20 as an important regulator of actin–vesicle–associated processes in ChP epithelial cells. Loss of Ptpn20 destabilized apical F-actin architecture, disrupted microvillar organization, and impaired both caveolae- and clathrin-mediated endocytosis. These structural and functional defects were accompanied by coordinated transcriptional downregulation of cytoskeletal, junctional, and vesicular transport modules, yielding a molecular signature that closely resembles aged or metabolically compromised ChP tissue( 15 – 17 ). Together, these findings support a role for Ptpn20 in maintaining ChP epithelial homeostasis. A key mechanistic insight from our work is the biphasic dysregulation of RhoA signaling induced by Ptpn20 deficiency. RhoA is a central regulator of actin polymerization, membrane curvature, and vesicle budding, processes that are indispensable for epithelial trafficking( 30 – 32 ). Using quantitative G-LISA and ELISA assays, we demonstrate that Ptpn20 loss induces an early, transient hyperactivation of RhoA at 5–6 weeks of age, reflected by increased levels of GTP-bound RhoA and an elevated active-to-total RhoA ratio. This hyperactivation dissipates by 8 weeks, despite persistently increased total RhoA expression. We interpret this temporal pattern not as normalization of cytoskeletal regulation, but rather as progressive alterations in the coordination between RhoA signaling and the apical actin scaffold as structural integrity deteriorates. Such spatial and functional uncoupling is consistent with a shift from an early compensatory reinforcement response toward signaling exhaustion or mislocalization, ultimately insufficient to sustain epithelial architecture. The functional consequences of Ptpn20-dependent cytoskeletal regulation become particularly evident under Aβ burden. In the APP NL-G-F knock-in background( 26 ), combined loss of Ptpn20 produced a synergistic epithelial phenotype characterized by pronounced apical Aβ retention, disruption of claudin-1 continuity, collapse of microvilli and cilia, and mitochondrial degeneration. Although several Aβ transporters, including ABCC1 and LRP1, were transcriptionally upregulated in double-mutant mice, Aβ clearance capacity appeared markedly reduced. These findings indicate that transporter expression alone is insufficient to ensure effective Aβ flux in the absence of an intact actin-dependent endocytic and vesicular trafficking framework. Instead, our data support a model in which cytoskeletal integrity may act upstream of transporter-mediated efflux by enabling vesicle formation, routing, and directional transport across the epithelium. Importantly, epithelial dysfunction at the level of the ChP was accompanied by accelerated Aβ pathology in the brain parenchyma. APP NL-G-F × Ptpn20KO mice exhibited markedly increased cortical and hippocampal plaque deposition, synaptic degeneration, and profound cognitive impairment compared with APP NL-G-F mice alone. These observations reinforce the concept that ChP dysfunction is not merely a secondary consequence of neurodegeneration but can act as an upstream amplifier of disease progression by limiting CSF-mediated clearance pathways. Our findings therefore extend emerging evidence that impairment of CSF dynamics and barrier function contributes directly to the tempo and severity of Alzheimer’s disease pathology. In line with this interpretation, accumulating evidence suggests that alterations in cerebrospinal fluid dynamics and barrier-associated transport processes can modulate amyloid pathology and cognitive decline in Alzheimer’s disease ( 27 – 29 , 33 ). Collectively, this work establishes Ptpn20 as a previously unrecognized regulator of ChP epithelial stability and Aβ clearance. By maintaining apical F-actin organization and appropriate RhoA signaling dynamics, Ptpn20 preserves vesicular trafficking competence and directional transport across the blood–CSF barrier. Loss of Ptpn20 disrupts this regulatory axis, resulting in epithelial degeneration, impaired CSF-to-blood Aβ clearance, and synergistic acceleration of amyloid pathology in vivo. These findings position the ChP as an upstream determinant of brain Aβ homeostasis and highlight actin-dependent vesicular regulation as a potential therapeutic target for early intervention in Alzheimer’s disease. Limitations and future directions Several limitations should be considered. First, although Ptpn20 expression is enriched in the ChP epithelium, low levels are detectable in other CNS cell types, including ependymal and glial populations. The relative contributions of these cell types to Aβ handling and barrier integrity remain unresolved. Future studies employing cell-type-specific Ptpn20 deletion will help delineate compartment-specific roles. Second, while our results strongly support a model in which Ptpn20 regulates RhoA-dependent actin dynamics, the direct biochemical substrates and interacting partners of Ptpn20 were not identified. Proteomic and phosphoproteomic approaches will be required to determine whether Ptpn20 acts through direct dephosphorylation of RhoA regulators or via parallel cytoskeletal pathways. Third, although we demonstrate impaired Aβ uptake and basolateral efflux in Ptpn20-deficient ChP, we did not directly quantify vectorial Aβ transport across the epithelial layer. Future microfluidic, in situ perfusion, or ex vivo barrier assays will be essential for determining directional Aβ flux and dissecting the relative contributions of uptake, routing, and efflux. Finally, the synergistic acceleration of pathology in APPKI × Ptpn20KO mice suggests that restoring ChP function may represent a therapeutic strategy in early AD. Future work should evaluate whether pharmacological stabilization of actin dynamics, enhancement of vesicular trafficking, or modulation of RhoA activity can rescue Aβ clearance and mitigate neurodegeneration. Conclusion Our study identifies Ptpn20 as a key regulator of actin-dependent vesicular trafficking and Aβ transcytosis in the choroid plexus epithelium. By maintaining apical F-actin integrity and appropriate RhoA signaling dynamics, Ptpn20 preserves epithelial stability, endocytic competence, and CSF-mediated Aβ clearance. Loss of Ptpn20 is associated with epithelial degeneration and synergistic acceleration of Aβ pathology in the APPNL-G-F model. These findings establish the ChP as an upstream determinant of brain Aβ homeostasis and highlight actin–vesicular regulation as a potential therapeutic target for early intervention in Alzheimer’s disease. MATERIALS AND METHODS Animals All experimental animals were group-housed (2–5 mice per cage) in a temperature- and humidity-controlled facility (23 ± 1°C, 55 ± 5% humidity) under a 12-h light/12-h dark cycle at the Center for Experimental Medicine, Juntendo University, Japan. All animal procedures were approved by the Ethics Review Committee for Animal Experimentation of the Juntendo University School of Medicine (approval no. 1337) and were conducted in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals. Animals were monitored daily for health status, and no unexpected adverse events were observed. Only male mice were used in this study. Mice were deeply anesthetized with a mixed anesthetic agent (medetomidine 0.3 mg/kg, midazolam 4.0 mg/kg, and butorphanol 5.0 mg/kg; intraperitoneal injection) and euthanized by decapitation. Brain tissues were rapidly dissected and processed as described below. Mouse lines C57BL/6J mice were used as wild-type (WT) controls. Ptpn20 knockout mice (Ptpn20⁻/⁻; hereafter referred to as Ptpn20KO) were generated using CRISPR/Cas9 technology as previously described (Xu et al., 2022). App^NL-G-F/NL-G-F knock-in mice (RBRC06344; hereafter referred to as APPKI) were obtained from RIKEN BioResource Center and maintained on a C57BL/6J background. These mice harbor three familial Alzheimer’s disease mutations (Swedish, Iberian, and Arctic) introduced into the endogenous App locus. Double-mutant APPKI × Ptpn20KO mice were generated by crossing homozygous APPKI mice with homozygous Ptpn20KO mice (Fig.S2). Genotyping Genomic DNA was extracted from tail biopsies, and genotyping was performed by PCR using the following primers (Table 1 ). Microarray analysis Choroid plexuses were isolated from 5-week-old WT and Ptpn20KO mice. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) from RNAlater-stabilized tissue. RNA quality was assessed using a 4150 TapeStation (Agilent). Gene expression profiling was performed using the GeneChip Mouse Exon 1.0 ST Array (Affymetrix), and data were normalized using the Robust Multichip Average algorithm. Differentially expressed genes were analyzed using Transcriptome Analysis Console software and Ingenuity Pathway Analysis. Quantitative real-time PCR Total RNA (500 ng) was reverse-transcribed using SuperScript IV VILO Master Mix. Quantitative PCR was performed using TaqMan Gene Expression Assays on an ABI 7500 system. Gene expression levels were normalized to Actb, and reactions were performed in triplicate.(Table 2 ) Immunofluorescence Brains were fixed in 4% paraformaldehyde, embedded in paraffin or cryoprotected, and sectioned. Sections were blocked and incubated with primary antibodies overnight at 4°C, followed by appropriate secondary antibodies. Nuclei were counterstained with Hoechst 33342. Images were acquired using a Leica TCS-SP5 confocal microscope. (Table 3 , 4 ) Cisterna magna injection of Carbon Black Eight-week-old Ptpn20KO mice were anesthetized and placed in a stereotaxic frame. A total of 10 µL of 1% Nigrosin suspension was slowly injected into the cisterna magna using a 29-gauge microsyringe. Mice were maintained in a head-down position for 5 min and perfused 30 min later with PBS followed by 4% paraformaldehyde. Immunohistochemistry and plaque quantification Paraffin sections were stained with anti-Aβ antibody (82E1) and visualized using DAB. Amyloid plaques in the cortex and hippocampus were quantified using light microscopy. Data acquisition and quantitative analyses were performed by investigators blinded to genotype whenever feasible. (Table 4 ) Electron microscopy Choroid plexus tissues were fixed with paraformaldehyde and glutaraldehyde, postfixed with osmium tetroxide, dehydrated, and embedded for TEM or processed for SEM according to standard protocols. RhoA activity assay RhoA activity was measured using G-LISA and total RhoA ELISA kits. RhoA activity was expressed as the ratio of GTP-bound to total RhoA. ELISA Aβ₁₋₄₀ and Aβ₁₋₄₂ levels in choroid plexus homogenates were quantified using commercially available ELISA kits. Quantification was performed by an investigator blinded to genotype. Behavioral analysis Y-maze and Morris water maze tests were performed at 24 weeks of age. Behavioral tracking and analysis were conducted using automated video tracking systems. Data acquisition and quantitative analyses were performed by investigators blinded to genotype whenever feasible. This study was designed and reported in accordance with the ARRIVE 2.0 guidelines. Statistics Primary outcome measures included Aβ accumulation, choroid plexus structural integrity, and behavioral performance. Statistical analyses were performed using IBM SPSS Statistics v29. Appropriate statistical tests are described in the figure legends. A two-sided P value < 0.05 was considered statistically significant. Animals were assigned to experimental groups based on genotype and age, and were housed without systematic bias between groups. Data availability All data supporting the findings of this study are available within the Article and its Supplementary Information. Microarray data generated in this study have been deposited in the Gene Expression Omnibus (GEO) database and will be made publicly available upon publication. Additional datasets and analysis scripts are available from the corresponding author upon reasonable request. Table 1 Primer sequences and PCR product sizes for genotyping Gene (Allele) Primer Direction Sequence (5′→3′) PCR Product Size APP^NL-G-F Forward CTCCTTGTGGCTGGCGGTCACAC 670 bp (WT) / 870 bp (Mutant) Reverse CTATCGTGGACCGAGAATGGTCATG — Ptpn20 (KO allele) Forward TCATGGACACTGAAATACAGG 505 bp (WT) / 410 bp (KO) Reverse AATAGCGTCAATGGTCTAAGAG — Table 2 Assay IDs of Real-time PCR Target TaqMan Assay ID Ptpn20 Cav1 Cltc Lrp1 Abcc1 AQP1 Na + , K + -ATPase Slc13a3 Actin Ptpn20, Mm00477234_m1 Cav1, Mm00483057_m1 Cltc, Mm00483057_m1 Lrp1, Mm00464608_m1 Abcc1, Mm00456156_m1 AQP1, Mm00431834_m1 ATP1a1, Mm00523255_m1 Slc13a3, Mm00475289m1 Actb, Mm00607939_S1 Table 3 Reagents for immunofluorescence investigations Fig No Method Target Reagents Primary antibody Secondary antibody 1-a,c Cryosection Ptpn20 Rabbit PTPN20B antibody (CSB-PA065165, CusAb, 1:250) Donkey anti-Rabbit IgG (H + L) Alexa Fluor™ Plus 488 (A32790, Invitrogen, 1:25) 1,2-d RhoA Mouse RhoA antibody 66733-1-IG (Proteintech Group.Inc.,1:100) Donkey anti-Mouse IgG (H + L) Alexa Fluor™ Plus 488 (A32766, Invitrogen, 1:25) 2-d ZO-1 Rabbit ZO-1 antibody 21773-1-AP (Proteintech Group.Inc.,1:100) Donkey anti-Rabbit IgG (H + L) Alexa Fluor™ Plus 488 (A32790, Invitrogen, 1:25) 1,2-a,c,d F-Actin Actin-stain 555 Fluorescent Phalloidin (Cat. # PHDH1, Cytoskeleton. Inc., 1:50) 3-a FFPE Amyloid Anti-Human Amyloidβ (N) (82E1) Mouse IgG MoAb #10323 (IBL 1:100) Donkey anti-Mouse IgG (H + L) Alexa Fluor™ Plus 488 (A32766, Invitrogen, 1:25) 3-a ZO-1 Rabbit ZO-1 antibody 21773-1-AP (Proteintech Group.Inc.,1:100) Donkey anti-Rabbit IgG (H + L) Alexa Fluor™ Plus 488 (A32790, Invitrogen, 1:25) Table 4 Reagents for immunohistochemistry Fig No Method Target Reagents Treatment / Condition Primary antibody 2-c Paraffin Claudin Antigen Unmasking Solution,Citric Acid Based (VECTOR LABORATORIES, 1:100) 121℃ 10min Rabbit Claudin1 antibody 28674-1-AP(Proteintech Group.Inc.,1:500) 4-a,c Paraffin Amyloid Formic acid 11-0780-5 (SIGMAALDRICH) 5min Anti-Human Amyloidβ (N) (82E1) Mouse IgG MoAb #10323 (IBL 1:100) Declarations Author Contributions M.M. and R.M. designed the study, performed experiments, acquired and analysed data, and wrote the manuscript. M.N. and A.K. contributed to the study design. S.Y., K.K., C.A., K.S., K.H. and C.K. contributed to data acquisition. I.O. performed experiments. E.N. and N.T. generated the model mice. M.M. supervised the project and critically revised the manuscript. Materials & Correspondence Correspondence and requests for materials should be addressed to Masakazu Miyajima. Ethics approval and consent to participate All animal experiments were reviewed and approved by the Ethics Review Committee for Animal Experimentation of the Juntendo University School of Medicine (approval number 1337 ). All procedures were conducted in strict accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals , as well as institutional and national guidelines for animal welfare. The study was designed, conducted, and reported in compliance with the ARRIVE 2.0 guidelines . Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Funding This study was financially supported by the Juntendo Research Branding Project and the Japan Society for the Promotion of Science under Grants-in-Aid for Scientific Research (Grant Numbers 23K15674, 24K10497) Acknowledgements The authors thank Takeomi C. Saido (Laboratory for Proteolytic Neuroscience, RIKEN Center for Brain Science) and Takashi Saito (Department of Neurocognitive Science, Institute of Brain Science, Nagoya City University) for generously providing the APP^NL-G-F knock-in mice. We also thank the staff of the Center for Experimental Medicine, Juntendo University, for their technical assistance and animal care. Authors’ information Not applicable. References Zhang J et al (2024) Recent advances in Alzheimer’s disease: mechanisms, clinical trials and new drug development strategies. Signal Transduct Target Therapy 9(1):211 Morató X et al (2022) Symptomatic and Disease-Modifying Therapy Pipeline for Alzheimer’s Disease: Towards a Personalized Polypharmacology Patient-Centered Approach. Int J Mol Sci 23(16):9305 Aisen PS et al (2017) On the path to 2025: understanding the Alzheimer’s disease continuum. Alzheimers Res Ther 9(1):60 Behl C (2024) In the amyloid-cascade-hypothesis still remains a working hypothesis, no less but certainly no more. Front Aging Neurosci, 2024. 16: p. 1459224 Fontana IC et al (2020) Amyloid-beta oligomers in cellular models of Alzheimer's disease. J Neurochem 155(4):348–369 Kepp KP et al (2023) The amyloid cascade hypothesis: an updated critical review. Brain 146(10):3969–3990 Gião T et al (2022) Choroid Plexus in Alzheimer’s Disease—The Current State of Knowledge. Biomedicines 10(2):224 Balusu S et al (2016) The choroid plexus-cerebrospinal fluid interface in Alzheimer's disease: more than just a barrier. Neural Regeneration Res 11(4):534–537 Matsumoto K et al (2015) Immunohistochemical analysis of transporters related to clearance of amyloid-beta peptides through blood-cerebrospinal fluid barrier in human brain. Histochem Cell Biol 144(6):597–611 Delvenne A et al (2024) Involvement of the choroid plexus in Alzheimer's disease pathophysiology: findings from mouse and human proteomic studies. Fluids Barriers CNS 21(1):58 Municio C et al (2023) Choroid Plexus Aquaporins in CSF Homeostasis and the Glymphatic System: Their Relevance for Alzheimer's Disease. Int J Mol Sci, 24(1) Saunders NR et al (2023) The choroid plexus: a missing link in our understanding of brain development and function. Physiol Rev 103(1):919–956 Tietz S, Engelhardt B (2015) Brain barriers: Crosstalk between complex tight junctions and adherens junctions. J Cell Biol 209(4):493–506 Baehr C, Reichel V, Fricker G (2006) Choroid plexus epithelial monolayers – a cell culture model from porcine brain. Cerebrospinal Fluid Res 3(1):13 Sadanandan J, Sathyanesan M, Newton SS (2024) Aging alters the expression of trophic factors and tight junction proteins in the mouse choroid plexus. Fluids Barriers CNS 21(1):77 Dani N et al (2021) A cellular and spatial map of the choroid plexus across brain ventricles and ages. Cell 184(11):3056–3074e21 Scarpetta V et al (2023) Morphological and mitochondrial changes in murine choroid plexus epithelial cells during healthy aging. Fluids Barriers CNS 20(1):19 Eide PK et al (2020) Delayed clearance of cerebrospinal fluid tracer from choroid plexus in idiopathic normal pressure hydrocephalus. J Cereb Blood Flow Metabolism 40(9):1849–1858 Murakami Y et al (2018) Rapid increase of 'brain-type' transferrin in cerebrospinal fluid after shunt surgery for idiopathic normal pressure hydrocephalus: a prognosis marker for cognitive recovery. J Biochem 164(3):205–213 Murakami Y et al (2019) Transferrin isoforms in cerebrospinal fluid and their relation to neurological diseases. Proc Jpn Acad Ser B Phys Biol Sci 95(5):198–210 Silverberg GD et al (2002) Assessment of low-flow CSF drainage as a treatment for AD. Neurology 59(8):1139–1145 Xu H et al (2022) Ptpn20 deletion in H-Tx rats enhances phosphorylation of the NKCC1 cotransporter in the choroid plexus: an evidence of genetic risk for hydrocephalus in an experimental study. Fluids Barriers CNS 19(1):39 Fodero-Tavoletti MT et al (2005) Protein tyrosine phosphatase hPTPN20a is targeted to sites of actin polymerization. Biochem J 389(Pt 2):343–354 Young KA, Biggins L, Sharpe HJ (2021) Protein tyrosine phosphatases in cell adhesion. Biochem J 478(5):1061–1083 Zuo X et al (2024) PTPN20 promotes metastasis through activating NF-κB signaling in triple-negative breast cancer. Breast Cancer Res 26(1):155 Saito T et al (2014) Single App knock-in mouse models of Alzheimer's disease. Nat Neurosci 17(5):661–663 Brkic M et al (2015) Amyloid beta Oligomers Disrupt Blood-CSF Barrier Integrity by Activating Matrix Metalloproteinases. J Neurosci 35(37):12766–12778 Silverberg GD et al (2001) The cerebrospinal fluid production rate is reduced in dementia of the Alzheimer’s type. Neurology 57(10):1763–1766 González-Marrero I et al (2015) Choroid plexus dysfunction impairs beta-amyloid clearance in a triple transgenic mouse model of Alzheimer's disease. Front Cell Neurosci 9:17 Ridley AJ, Hall A (1992) The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70(3):389–399 Amano M, Nakayama M, Kaibuchi K (2010) Rho-kinase/ROCK: A key regulator of the cytoskeleton and cell polarity. Cytoskeleton (Hoboken) 67(9):545–554 Nishimura Y et al (2006) A role of LIM kinase 1/cofilin pathway in regulating endocytic trafficking of EGF receptor in human breast cancer cells. Histochem Cell Biol 126(5):627–638 Kant S et al (2018) Choroid plexus genes for CSF production and brain homeostasis are altered in Alzheimer’s disease. Fluids Barriers CNS 15(1):34 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigureLegends.docx Supplement.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8759264","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":589879786,"identity":"5b5c71b7-bc7c-48e0-8d11-d160fb2ddefd","order_by":0,"name":"Ryo Miyahara","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ryo","middleName":"","lastName":"Miyahara","suffix":""},{"id":589879787,"identity":"931d904b-a452-47fb-9be0-2198dad0d97e","order_by":1,"name":"Masakazu Miyajima","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYNCCAwxyjA1gFjNEQIIILcZALSBdJGhJBCpH0oIP6E47/PjDjzN26c0zco8/+LjDWo6B/fADBssduLWY3U4zk+y5kZzbOCMvsXHmmXRjBp40AwbJM/i0JJgx8HxgBmrJMWzmbTsMdGEOA4NkGz4t6Z8//vlQn84I0vIXpIX/DSEtOQbSPDcOJ4C1MIK0SBC0JadMWubMccPGnjeGM3vb0o3ZJJ4ZHMDvl/TNH98cq5Y3bM8x+PCzzVqOnz/54WNJPCEGB4YNUAYbEB+WbMCtEg7kkTmMH4nRMgpGwSgYBSMFAAAkE1aohrzvegAAAABJRU5ErkJggg==","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Masakazu","middleName":"","lastName":"Miyajima","suffix":""},{"id":589879788,"identity":"3a94d3f8-293d-4955-856d-ae8d1bb31ed5","order_by":2,"name":"Madoka Nakajima","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Madoka","middleName":"","lastName":"Nakajima","suffix":""},{"id":589879789,"identity":"7ab7f698-9666-44af-a4f7-c52594398143","order_by":3,"name":"Ikuko Ogino","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ikuko","middleName":"","lastName":"Ogino","suffix":""},{"id":589879790,"identity":"fb73d6b2-1b29-4e06-a8a6-68b31932ca68","order_by":4,"name":"Ko Horikoshi","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ko","middleName":"","lastName":"Horikoshi","suffix":""},{"id":589879791,"identity":"cb5980a7-1fb6-4a76-bef1-e65fed0c8a36","order_by":5,"name":"Koichiro Sakamoto","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Koichiro","middleName":"","lastName":"Sakamoto","suffix":""},{"id":589879793,"identity":"ffd24c2d-6c99-433b-b4dd-b2ea7d12e666","order_by":6,"name":"Kaito Kawamura","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kaito","middleName":"","lastName":"Kawamura","suffix":""},{"id":589879797,"identity":"50ff0d9d-6578-431f-b3d6-4d8c1de9c982","order_by":7,"name":"Chihiro Akiba","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chihiro","middleName":"","lastName":"Akiba","suffix":""},{"id":589879800,"identity":"11ba466c-818a-4e49-9375-732f2f41f5fd","order_by":8,"name":"Shinya Yamada","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shinya","middleName":"","lastName":"Yamada","suffix":""},{"id":589879802,"identity":"6b7eb6b7-27a0-450d-a89e-93c9602f2c14","order_by":9,"name":"Kostadin Karagiozov","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kostadin","middleName":"","lastName":"Karagiozov","suffix":""},{"id":589879803,"identity":"72ab9819-c9bc-402a-b242-d3c8ed723cd0","order_by":10,"name":"Chihiro Kamohara","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chihiro","middleName":"","lastName":"Kamohara","suffix":""},{"id":589879804,"identity":"822e5814-f06a-4c5d-ab6d-9da4846d44ad","order_by":11,"name":"Eri Nakamura","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Eri","middleName":"","lastName":"Nakamura","suffix":""},{"id":589879806,"identity":"782dea79-7edc-4808-86df-a74ca6c5e190","order_by":12,"name":"Nobuhiro Tada","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Nobuhiro","middleName":"","lastName":"Tada","suffix":""},{"id":589879807,"identity":"db820801-ce2d-439b-a487-a9c941c3133a","order_by":13,"name":"Akihide Kondo","email":"","orcid":"","institution":"Juntendo University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Akihide","middleName":"","lastName":"Kondo","suffix":""}],"badges":[],"createdAt":"2026-02-02 00:38:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8759264/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8759264/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102962458,"identity":"aa319bc4-6ea6-4d0a-afd7-3c09e35b4fed","added_by":"auto","created_at":"2026-02-19 04:08:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1107966,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAge-dependent decline of Ptpn20 expression, disruption of apical F-actin architecture, transient RhoA hyperactivation, and impaired epithelial uptake in the choroid plexus.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Immunofluorescence staining of Ptpn20 (green) and F-actin (red) in choroid plexus (ChP) epithelial cells. In 8-week-old wild-type (WT) mice, Ptpn20 is diffusely localized throughout the cytoplasm and F-actin forms a dense, continuous apical band. In 48-week-old WT mice, Ptpn20 immunoreactivity is markedly reduced and apical F-actin is attenuated. Scale bars = 10 μm.\u003cbr\u003e\n \u003cstrong\u003eb,\u003c/strong\u003e Quantitative RT–PCR analysis of \u003cem\u003ePtpn20\u003c/em\u003e mRNA expression in ChP tissue across age groups (5w: n=5, 10w: n=4, 24w: n=5, 48w: n=5). Expression levels were normalized to \u003cem\u003eActb\u003c/em\u003e, with 5 weeks set to 1.0. Data are presented as mean ± s.e.m.\u003cbr\u003e\n \u003cstrong\u003ec,\u003c/strong\u003e Immunofluorescence of Ptpn20 and F-actin in 8-week-old WT and Ptpn20 knockout (Ptpn20KO) mice. Ptpn20 immunoreactivity is absent in Ptpn20KO mice, and the apical F-actin band is markedly thinner, resembling the aged WT phenotype.\u003cbr\u003e\n \u003cstrong\u003ed,\u003c/strong\u003e Immunofluorescence staining for RhoA (green) and F-actin (red) shows apical localization of RhoA in both WT and Ptpn20KO ChP epithelium. Scale bars = 5 μm.\u003cbr\u003e\n \u003cstrong\u003ee,\u003c/strong\u003e Quantification of active, GTP-bound RhoA using a G-LISA assay. At 5–6 weeks, Ptpn20KO mice show significantly elevated active RhoA levels compared with WT controls, whereas no significant difference is observed at 8 weeks.\u003cbr\u003e\n \u003cstrong\u003ef,\u003c/strong\u003e Total RhoA protein levels measured by ELISA. Ptpn20KO mice exhibit modest but significant increases at both 5–6 weeks and 8 weeks.\u003cbr\u003e\n \u003cstrong\u003eg,\u003c/strong\u003e Ratio of active to total RhoA, representing the fraction of GTP-bound RhoA. The ratio is significantly elevated in Ptpn20KO mice at 5–6 weeks but converges with WT levels by 8 weeks. \u003cstrong\u003eActive and total RhoA levels were measured in the same mice (5–6 weeks: WT n=3, Ptpn20KO n=8; 8 weeks: WT n=3, Ptpn20KO n=7). \u003c/strong\u003eData in \u003cstrong\u003ee–g\u003c/strong\u003e are presented as mean ± s.e.m. Statistical significance was assessed using two-tailed unpaired Student’s \u003cem\u003et\u003c/em\u003e-tests.\u003cbr\u003e\n \u003cstrong\u003eh,\u003c/strong\u003e Intracisternal Carbon Black injection reveals minimal tracer accumulation in WT ChP epithelium, whereas Ptpn20KO mice show prominent apical tracer retention, suggesting reduced epithelial uptake efficiency and/or altered vesicular handling. Representative images are shown.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/ce03df82b75578e4f8f2d514.png"},{"id":102766782,"identity":"ae543289-666f-4489-bc6e-f3005812cb92","added_by":"auto","created_at":"2026-02-16 11:37:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":745973,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomic and molecular analyses reveal coordinated disruption of endocytic, efflux, cytoskeletal, and barrier pathways in Ptpn20-deficient choroid plexus.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Transcriptomic profiling of ChP tissue from 4-week-old WT and Ptpn20KO mice. Differentially expressed genes were categorized into eight functional modules related to molecular transport and epithelial homeostasis. Radar chart visualization reveals pronounced downregulation of modules associated with uptake/transcytosis, degradation, barrier/inflammation, and cytoskeleton/vesicular trafficking in Ptpn20KO mice. No statistical testing was applied to radar chart visualization.\u003cbr\u003e\n \u003cstrong\u003eb,\u003c/strong\u003e Quantitative RT–PCR validation of selected genes involved in Aβ handling in 5-week-old ChP. Gene expression levels were normalized to WT controls (WT = 1). \u003cem\u003eCav1\u003c/em\u003e, \u003cem\u003eCltc\u003c/em\u003e, \u003cem\u003eAbcc1\u003c/em\u003e, and \u003cem\u003eAqp1\u003c/em\u003e are significantly downregulated in Ptpn20KO mice, whereas \u003cem\u003eLrp1\u003c/em\u003e and \u003cem\u003eSlc13a3\u003c/em\u003e show no significant changes. Analyses were performed using ChP tissue from 5-week-old mice (WT: n=5, Ptpn20KO: n=4). Data are presented as mean ± s.e.m. Statistical analysis was performed using two-tailed unpaired Student’s \u003cem\u003et\u003c/em\u003e-tests.\u003cbr\u003e\n \u003cstrong\u003ec,\u003c/strong\u003e Immunofluorescence staining for claudin-1 demonstrates reduced barrier-associated protein expression in Ptpn20KO ChP epithelium compared with WT controls. Representative images are shown. Scale bars = 50 μm.\u003cbr\u003e\n \u003cstrong\u003ed,\u003c/strong\u003e Double immunofluorescence at 16 weeks of age for RhoA (green) and F-actin (red). WT mice show preserved apical F-actin architecture and junctional organization, whereas Ptpn20KO mice exhibit severe disruption of apical F-actin and altered RhoA localization. Representative images are shown. Scale bars = 5 μm.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/268ce876865e71e08a8dd6b2.png"},{"id":102766785,"identity":"a3ce5024-5d22-4ab9-b18d-f819856f049a","added_by":"auto","created_at":"2026-02-16 11:37:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1421703,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePtpn20 deficiency promotes apical Aβ accumulation, transporter dysregulation, and epithelial ultrastructural degeneration in APPKI mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Double immunofluorescence staining for amyloid-β (Aβ; green) and ZO-1 (red) in 8-week-old ChP tissue. APPKI mice show intact ZO-1 expression with no detectable Aβ accumulation, whereas APPKI × Ptpn20KO mice exhibit prominent apical Aβ deposition and reduced continuity of ZO-1 immunoreactivity. Representative images are shown.\u003cbr\u003e\n \u003cstrong\u003eb,\u003c/strong\u003e ELISA quantification of Aβ40 and Aβ42 levels in ChP tissue at 8 weeks. Both Aβ species are significantly elevated in APPKI × Ptpn20KO mice compared with APPKI controls. Aβ40 and Aβ42 levels were measured in the same mice (APPKI: n=4, APPKI × Ptpn20KO: n=5). Data are presented as mean ± s.e.m. Statistical significance was determined using two-tailed unpaired Student’s \u003cem\u003et\u003c/em\u003e-tests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec,\u003c/strong\u003e Quantitative RT–PCR analysis of transporter and endocytic pathway genes in 7-week-old ChP. Increased \u003cem\u003eCltc\u003c/em\u003e and reduced \u003cem\u003eCav1\u003c/em\u003e expression indicate a shift toward clathrin-mediated endocytosis. Transporters \u003cem\u003eLrp1\u003c/em\u003e, \u003cem\u003eAbcc1\u003c/em\u003e, \u003cem\u003eAqp1\u003c/em\u003e, and \u003cem\u003eAtp1a1\u003c/em\u003e are upregulated, whereas \u003cem\u003eSlc13a3\u003c/em\u003e is markedly downregulated. This analysis includes data from Fig. 2b (5-week-old WT and Ptpn20KO mice) as well as newly added samples from 7-week-old APPKI (n=5) and APPKI × Ptpn20KO (n=5) mice.\u003cbr\u003e\n \u003cstrong\u003ed,\u003c/strong\u003e Transmission electron microscopy (TEM) of 8-week-old ChP epithelium. APPKI × Ptpn20KO mice show reduced electron density of tight and adherens junctions, elongated and abnormal mitochondria, cytoskeletal collapse, and widened intercellular spaces compared with APPKI controls. TEM; Scale bars = 2 μm (x2000), 500 nm (x20000) and 1 μm (x5000).\u003cbr\u003e\n \u003cstrong\u003ee,\u003c/strong\u003e Representative scanning electron microscopy (SEM) and TEM images from 16-week-old APPKI × Ptpn20KO mice reveal severe epithelial degeneration, including loss of microvilli and cilia, diminished cytoskeletal tension, disrupted junctional structures, and mitochondrial depletion. SEM; Scale bars = 1 μm ( x7000).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/7dd2d59b00461f19c740a60a.png"},{"id":102766789,"identity":"95e9f94b-f263-4424-a1fd-6b14820b598f","added_by":"auto","created_at":"2026-02-16 11:37:52","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1198467,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAccelerated amyloid plaque deposition in the cerebral cortex and hippocampus of APPKI × Ptpn20KO mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Immunohistochemical detection of amyloid plaques in the cerebral cortex and hippocampus at 8 weeks of age. APPKI × Ptpn20KO mice exhibit markedly increased plaque density compared with APPKI mice. Scale bars = 500 μm\u003cbr\u003e\n \u003cstrong\u003eb,\u003c/strong\u003e Quantification of cortical and hippocampal plaque burden at 8 weeks.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec,\u003c/strong\u003e Representative images showing increased amyloid plaque accumulation in the cortex and hippocampus at 16 weeks of age. Scale bars = 500 μm\u003cbr\u003e\n \u003cstrong\u003ed,\u003c/strong\u003e Quantification of hippocampal plaque burden at 16 weeks demonstrates significantly greater plaque accumulation in APPKI × Ptpn20KO mice compared with APPKI controls. Data in \u003cstrong\u003eb\u003c/strong\u003e and \u003cstrong\u003ed\u003c/strong\u003e are presented as mean ± SD. Analyses were performed using cortex and hippocampal sections from APPKI (n=4) and APPKI × Ptpn20KO (n=5) mice. Statistical analysis was performed using two-tailed unpaired Student’s \u003cem\u003et\u003c/em\u003e-tests.\u003cbr\u003e\n \u003cstrong\u003ee,\u003c/strong\u003e Schematic model illustrating physiological and Ptpn20-deficient mechanisms of amyloid-β (Aβ) handling across the choroid plexus (ChP) epithelium. Under physiological conditions, Ptpn20 maintains apical F-actin organization and balanced RhoA signaling, supporting actin-dependent vesicular trafficking, clathrin- and caveolae-mediated endocytosis, and efficient CSF-to-blood Aβ transcytosis. In Ptpn20-deficient epithelium, disruption of apical F-actin architecture and altered RhoA signaling are associated with impaired vesicle formation and routing, reduced Aβ uptake and transcytosis, and apical Aβ retention, resulting in diminished CSF-mediated Aβ clearance. This model summarizes findings derived from transcriptomic, ultrastructural, biochemical, and functional analyses.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/5cd26c74e7437e441071c3bf.png"},{"id":102766786,"identity":"9c1fb6c9-5b50-4a08-b9e6-d8b8dc6823ba","added_by":"auto","created_at":"2026-02-16 11:37:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1016308,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCombined loss of Ptpn20 and APPKI accelerates synaptic degeneration and cognitive impairment.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Representative transmission electron microscopy (TEM) images of the hippocampal CA3 region from 16-week-old APPKI and APPKI × Ptpn20KO mice. APPKI × Ptpn20KO mice exhibit marked synaptic loss compared with APPKI controls. Right, quantification of synaptic structure density. Each dot represents one animal (APPKI: n=9, APPKI × Ptpn20KO: n=8). Data are presented as mean ± SD. Statistical significance was determined using a two-tailed unpaired Student’s \u003cem\u003et\u003c/em\u003e-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb,\u003c/strong\u003e Spontaneous alternation performance in the Y-maze at 24 weeks of age. APPKI × Ptpn20KO mice show a significant reduction in alternation rate compared with APPKI mice, indicating impaired working memory. Behavioral analyses in b–e were performed using the same cohort of mice (WT: n=6, Ptpn20KO: n=8, APPKI: n=7, APPKI × Ptpn20KO: n=10).\u003cstrong\u003e \u003c/strong\u003eData are presented as mean ± s.e.m. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec,\u003c/strong\u003e Percentage of time spent in each quadrant during the Morris water maze probe test at 24 weeks. APPKI × Ptpn20KO mice spend significantly less time in the target quadrant compared with control groups, indicating impaired spatial memory retention. Data are presented as mean ± s.e.m. Statistical significance was assessed using one-way ANOVA with Tukey’s post hoc test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed,\u003c/strong\u003e Number of platform crossings within the target zone (G1–G3) during the probe test. APPKI × Ptpn20KO mice exhibit a significant reduction in platform crossings, further indicating impaired spatial memory retention. Data are presented as mean ± s.e.m. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee,\u003c/strong\u003e Escape latency during acquisition trials of the Morris water maze over nine consecutive training days. APPKI × Ptpn20KO mice display prolonged escape latency compared with control groups, indicating impaired spatial learning. Data are presented as mean ± s.e.m.. Statistical analysis was performed using two-way repeated-measures ANOVA, with genotype as the between-subject factor and training day as the within-subject factor, followed by appropriate post hoc comparisons.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/49a99bfab772e5a527fe04f2.png"},{"id":105562915,"identity":"cffb4f95-7824-4046-ace1-8384a183d48f","added_by":"auto","created_at":"2026-03-27 12:45:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7050396,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/a17adc10-b63b-41c4-b45a-cae57a2f0cac.pdf"},{"id":103049544,"identity":"51f35fd3-5a81-4300-bfdf-a83c95448ab6","added_by":"auto","created_at":"2026-02-20 07:42:19","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":14447,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureLegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/b9b1eee4f8b149bf8a5facdd.docx"},{"id":102766788,"identity":"80c77f69-0f55-4ff7-81b2-e052e1d53c6a","added_by":"auto","created_at":"2026-02-16 11:37:52","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3917938,"visible":true,"origin":"","legend":"","description":"","filename":"Supplement.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8759264/v1/54f6303522ac622ccdeac2eb.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Ptpn20 preserves actin-dependent vesicular trafficking and amyloid-β clearance capacity in the choroid plexus","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlzheimer\u0026rsquo;s disease (AD) is characterized by progressive accumulation of amyloid-β (Aβ), reflecting an imbalance between its production and clearance rather than overproduction alone(\u003cspan additionalcitationids=\"CR2 CR3 CR4 CR5\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). While impaired clearance has emerged as a central driver of early AD pathogenesis, the mechanisms governing Aβ movement across cerebrospinal fluid (CSF) interfaces remain incompletely understood. The choroid plexus (ChP), a highly vascularized epithelial structure forming the blood\u0026ndash;CSF barrier (BCSFB), plays a pivotal role in CSF turnover and removal of metabolic waste from the central nervous system(\u003cspan additionalcitationids=\"CR8 CR9 CR10\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). ChP epithelial cells possess a dense apical F-actin network that stabilizes tight junctions, maintains microvillar architecture, and supports receptor-mediated endocytosis (\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). These features have been implicated in vectorial handling of amyloid-β across the blood\u0026ndash;CSF interface (\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAge-related degeneration of the ChP epithelium\u0026mdash;including fragmentation of apical F-actin, microvillar atrophy, and impaired vesicular trafficking\u0026mdash;has been associated with reduced CSF production and diminished clearance of neurotoxic metabolites(\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Similar structural and functional alterations are observed in idiopathic normal pressure hydrocephalus, where compromised ChP function improves following CSF diversion(\u003cspan additionalcitationids=\"CR19 CR20\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), highlighting the ChP as an upstream regulator of brain homeostasis. Despite these observations, the molecular determinants that preserve cytoskeletal integrity and vesicular transport capacity in ChP epithelial cells remain largely undefined.\u003c/p\u003e \u003cp\u003eProtein tyrosine phosphatases (PTPs), particularly cytoplasmic non-receptor PTPs, have emerged as critical modulators of cytoskeletal organization, epithelial adhesion, and small GTPase signaling(\u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Ptpn20, a non-receptor PTP with previously unclear physiological roles, has been implicated in actin remodeling and regulation of RhoA signaling in select cellular contexts (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Given the reliance of ChP-mediated Aβ transport on actin-regulated endocytic pathways, we hypothesized that Ptpn20 is required to maintain the actin\u0026ndash;vesicular trafficking axis essential for efficient Aβ clearance.\u003c/p\u003e \u003cp\u003eHere, using transcriptomic profiling, ultrastructural analyses, endocytic assays, and genetic interaction studies with the APP\u0026thinsp;\u0026lt;\u0026thinsp;sup\u0026gt;NL-G-F\u0026lt;/sup\u0026gt; knock-in model(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), we investigate the role of Ptpn20 in ChP epithelial homeostasis. Our findings suggest that Ptpn20 supports apical actin organization and vesicle-associated transport processes in the ChP epithelium and that loss of Ptpn20 exacerbates Aβ-associated epithelial stress in vivo. These observations implicate dysregulation of actin-dependent vesicular trafficking as a potential contributor to impaired CSF-mediated Aβ clearance and accelerated AD-related pathology (\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAge-associated reduction of Ptpn20 expression and altered actin organization in the choroid plexus\u003c/h2\u003e \u003cp\u003eIn 8-week-old wild-type (WT) mice, Ptpn20 immunoreactivity was diffusely distributed throughout the cytoplasm of choroid plexus (ChP) epithelial cells, while F-actin formed a dense and continuous apical band. By 48 weeks of age, Ptpn20 expression was markedly reduced, accompanied by pronounced thinning and attenuation of the apical F-actin structure (Fig.\u0026nbsp;1a). Quantitative RT\u0026ndash;PCR confirmed a significant, age-dependent decline in Ptpn20 mRNA expression (Fig.\u0026nbsp;1b). In Ptpn20 knockout (Ptpn20KO) mice, Ptpn20 immunoreactivity was absent at 8 weeks of age, and the apical F-actin band was markedly thinner, closely resembling the aged WT phenotype (Fig.\u0026nbsp;1c). These findings indicate that loss of Ptpn20 is associated with alterations in apical actin organization resembling age-related changes.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAltered RhoA signaling dynamics in Ptpn20-deficient choroid plexus\u003c/h3\u003e\n\u003cp\u003eRhoA immunoreactivity was detected along the apical membrane in both WT and Ptpn20KO ChP epithelia (Fig.\u0026nbsp;1d). Because RhoA is a central regulator of actin polymerization and vesicle dynamics, we quantified its activation state using G-LISA and ELISA assays. At 5\u0026ndash;6 weeks of age, levels of active, GTP-bound RhoA were significantly elevated in Ptpn20KO ChP compared with WT controls (WT: 0.087\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012; KO: 0.184\u0026thinsp;\u0026plusmn;\u0026thinsp;0.014; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001). In contrast, this genotype-dependent difference was no longer detectable at 8 weeks (WT: 0.138\u0026thinsp;\u0026plusmn;\u0026thinsp;0.031; KO: 0.151\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012) (Fig.\u0026nbsp;1e). Total RhoA protein levels were modestly but significantly increased in Ptpn20KO mice at both 5\u0026ndash;6 weeks and 8 weeks (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 for both comparisons) (Fig.\u0026nbsp;1f). Accordingly, the ratio of active to total RhoA\u0026mdash;a measure of the fraction of RhoA in its GTP-bound state\u0026mdash;was significantly elevated in Ptpn20KO mice at 5\u0026ndash;6 weeks (WT: 3.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66; KO: 5.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.049), but not at 8 weeks (WT: 6.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.35; KO: 5.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49) (Fig.\u0026nbsp;1g). Together, these results suggest that loss of Ptpn20 induces an early, transient hyperactivation of RhoA signaling, followed by convergence toward WT levels as apical actin architecture becomes progressively altered.\u003c/p\u003e\n\u003ch3\u003eTracer retention suggests reduced uptake efficiency in Ptpn20-deficient choroid plexus\u003c/h3\u003e\n\u003cp\u003eTo assess functional consequences of cytoskeletal and signaling abnormalities, we examined epithelial uptake following intracisternal tracer injection. After Carbon Black administration, WT mice exhibited minimal epithelial tracer accumulation, whereas Ptpn20KO mice showed prominent apical tracer retention within ChP epithelial cells (Fig.\u0026nbsp;1h). Although this approach does not directly quantify specific endocytic pathways, the observed tracer retention suggests reduced uptake efficiency and/or altered intracellular handling in Ptpn20-deficient epithelium.\u003c/p\u003e\n\u003ch3\u003ePtpn20 deficiency disrupts endocytic, efflux, cytoskeletal, and barrier gene networks required for Aβ handling\u003c/h3\u003e\n\u003cp\u003eMicroarray analysis of ChP tissue from 4-week-old WT and Ptpn20KO mice identified coordinated alterations across eight predefined functional gene modules: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) uptake/transcytosis, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) efflux transport, (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) degradation, (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) CSF/ion dynamics, (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e) barrier/inflammation, (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) metal homeostasis, (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e) stress/mTOR signaling, and (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e) cytoskeleton/vesicular trafficking. Radar chart\u0026ndash;integrated heatmap analysis revealed pronounced downregulation of modules associated with uptake/transcytosis, degradation, barrier integrity, and cytoskeleton/vesicular trafficking in Ptpn20KO mice (Fig.\u0026nbsp;2a, S1), suggesting coordinated alterations in pathways critical for Aβ handling. Quantitative RT\u0026ndash;PCR at 5 weeks confirmed significant reductions in \u003cem\u003eCav1\u003c/em\u003e and \u003cem\u003eCltc\u003c/em\u003e, representing caveolae- and clathrin-mediated endocytosis, respectively (Fig.\u0026nbsp;2b). Expression of the basolateral efflux transporter \u003cem\u003eAbcc1\u003c/em\u003e was significantly reduced, whereas \u003cem\u003eLrp1\u003c/em\u003e expression remained unchanged. \u003cem\u003eAqp1\u003c/em\u003e expression was also significantly downregulated, while \u003cem\u003eATP1a1\u003c/em\u003e and \u003cem\u003eSlc13a3\u003c/em\u003e showed no significant change. Consistent with transcriptional alterations, immunofluorescence analysis demonstrated reduced claudin-1 immunoreactivity in Ptpn20KO ChP (Fig.\u0026nbsp;2c). By 16 weeks of age, apical F-actin organization and RhoA localization were severely disrupted (Fig.\u0026nbsp;2d). Collectively, these findings indicate that Ptpn20 loss disrupts multiple molecular pathways required for efficient Aβ uptake, intracellular routing, and basolateral efflux across the ChP epithelium.\u003c/p\u003e\n\u003ch3\u003ePtpn20 deficiency exacerbates Aβ accumulation and transporter dysregulation in APPKI mice\u003c/h3\u003e\n\u003cp\u003eGenotyping confirmed successful generation of APPKI \u0026times; Ptpn20KO double-mutant mice (Fig. S2). In 8-week-old APPKI mice, Aβ deposition was undetectable in the ChP and ZO-1 expression remained intact. In contrast, APPKI \u0026times; Ptpn20KO mice exhibited prominent apical Aβ accumulation accompanied by reduced continuity of ZO-1 immunoreactivity (Fig.\u0026nbsp;3a). ELISA quantification revealed significantly elevated levels of both Aβ40 and Aβ42 in ChP tissue from APPKI \u0026times; Ptpn20KO mice compared with APPKI controls (Fig.\u0026nbsp;3b). At 7 weeks of age, RT\u0026ndash;PCR analysis demonstrated a shift in endocytic pathway utilization, characterized by increased \u003cem\u003eCltc\u003c/em\u003e expression and reduced \u003cem\u003eCav1\u003c/em\u003e expression (Fig.\u0026nbsp;3c). In parallel, expression of \u003cem\u003eLrp1\u003c/em\u003e, \u003cem\u003eAbcc1\u003c/em\u003e, \u003cem\u003eAqp1\u003c/em\u003e, and \u003cem\u003eAtp1a1\u003c/em\u003e was upregulated, whereas \u003cem\u003eSlc13a3\u003c/em\u003e was markedly downregulated, indicating compensatory but dysregulated transporter responses to elevated CSF Aβ burden. Ultrastructural analyses revealed preserved epithelial architecture in APPKI mice, whereas APPKI \u0026times; Ptpn20KO mice exhibited reduced tight-junction electron density, elongated and abnormal mitochondria, cytoskeletal collapse, widened intercellular spaces, and severe loss of apical microvilli. (Fig.\u0026nbsp;3d,e).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCombined loss of Ptpn20 and APPKI accelerates brain Aβ deposition, synaptic degeneration, and cognitive impairment\u003c/h2\u003e \u003cp\u003eAt 8 weeks of age, amyloid plaque burden was significantly increased in the cerebral cortex of APPKI \u0026times; Ptpn20KO mice compared with APPKI mice (Fig.\u0026nbsp;4a,b). By 16 weeks, plaque deposition was further increased in both cortex and hippocampus, with consistently greater burden in double-mutant mice (Fig.\u0026nbsp;4c,d). Transmission electron microscopy of the hippocampal CA3 region revealed marked synaptic loss in APPKI \u0026times; Ptpn20KO mice relative to APPKI controls (Fig.\u0026nbsp;5a). Behavioral analyses at 24 weeks demonstrated significant cognitive impairment in APPKI \u0026times; Ptpn20KO mice. In the Y-maze, spontaneous alternation rates were significantly reduced compared with APPKI mice, indicating impaired working memory (Fig.\u0026nbsp;5b). Ptpn20KO mice without APPKI did not exhibit significant impairment, suggesting that Ptpn20 deficiency selectively exacerbates amyloid-associated cognitive dysfunction. In the Morris water maze, APPKI \u0026times; Ptpn20KO mice displayed prolonged escape latency during acquisition trials, indicating impaired spatial learning (Fig.\u0026nbsp;5e). Probe test analysis further revealed a marked reduction in platform crossings within the target zone, reflecting impaired spatial memory retention (Fig.\u0026nbsp;5c,d). APPKI mice showed intermediate deficits, whereas Ptpn20KO mice alone exhibited only mild alterations, indicating a synergistic interaction between Ptpn20 deficiency and pathogenic amyloid-β.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe choroid plexus (ChP) is increasingly recognized as a dynamic regulatory interface that governs cerebrospinal fluid (CSF) turnover, molecular exchange, and metabolic homeostasis within the central nervous system(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Specialized ChP epithelial cells rely on a dense apical F-actin network to maintain tight junction integrity, microvillar morphology, and receptor-mediated endocytosis(\u003cspan additionalcitationids=\"CR13 CR14 CR15 CR16\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), thereby enabling vectorial transport of metabolites and neurotoxic species from the CSF to the bloodstream. Age-related deterioration of these cytoskeletal structures has been linked to reduced CSF production and impaired clearance of amyloid-β (Aβ)(\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e); however, the molecular mechanisms that preserve epithelial integrity and vesicular transport capacity have remained poorly defined.\u003c/p\u003e \u003cp\u003eIn this study, we identify the cytoplasmic non-receptor protein tyrosine phosphatase Ptpn20 as an important regulator of actin\u0026ndash;vesicle\u0026ndash;associated processes in ChP epithelial cells. Loss of Ptpn20 destabilized apical F-actin architecture, disrupted microvillar organization, and impaired both caveolae- and clathrin-mediated endocytosis. These structural and functional defects were accompanied by coordinated transcriptional downregulation of cytoskeletal, junctional, and vesicular transport modules, yielding a molecular signature that closely resembles aged or metabolically compromised ChP tissue(\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Together, these findings support a role for Ptpn20 in maintaining ChP epithelial homeostasis.\u003c/p\u003e \u003cp\u003eA key mechanistic insight from our work is the biphasic dysregulation of RhoA signaling induced by Ptpn20 deficiency. RhoA is a central regulator of actin polymerization, membrane curvature, and vesicle budding, processes that are indispensable for epithelial trafficking(\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Using quantitative G-LISA and ELISA assays, we demonstrate that Ptpn20 loss induces an early, transient hyperactivation of RhoA at 5\u0026ndash;6 weeks of age, reflected by increased levels of GTP-bound RhoA and an elevated active-to-total RhoA ratio. This hyperactivation dissipates by 8 weeks, despite persistently increased total RhoA expression. We interpret this temporal pattern not as normalization of cytoskeletal regulation, but rather as progressive alterations in the coordination between RhoA signaling and the apical actin scaffold as structural integrity deteriorates. Such spatial and functional uncoupling is consistent with a shift from an early compensatory reinforcement response toward signaling exhaustion or mislocalization, ultimately insufficient to sustain epithelial architecture.\u003c/p\u003e \u003cp\u003eThe functional consequences of Ptpn20-dependent cytoskeletal regulation become particularly evident under Aβ burden. In the APP\u0026thinsp;\u0026lt;\u0026thinsp;sup\u0026gt;NL-G-F\u0026lt;/sup\u0026gt; knock-in background(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), combined loss of Ptpn20 produced a synergistic epithelial phenotype characterized by pronounced apical Aβ retention, disruption of claudin-1 continuity, collapse of microvilli and cilia, and mitochondrial degeneration. Although several Aβ transporters, including ABCC1 and LRP1, were transcriptionally upregulated in double-mutant mice, Aβ clearance capacity appeared markedly reduced. These findings indicate that transporter expression alone is insufficient to ensure effective Aβ flux in the absence of an intact actin-dependent endocytic and vesicular trafficking framework. Instead, our data support a model in which cytoskeletal integrity may act upstream of transporter-mediated efflux by enabling vesicle formation, routing, and directional transport across the epithelium.\u003c/p\u003e \u003cp\u003eImportantly, epithelial dysfunction at the level of the ChP was accompanied by accelerated Aβ pathology in the brain parenchyma. APP\u0026thinsp;\u0026lt;\u0026thinsp;sup\u0026gt;NL-G-F\u0026lt;/sup\u0026gt; \u0026times; Ptpn20KO mice exhibited markedly increased cortical and hippocampal plaque deposition, synaptic degeneration, and profound cognitive impairment compared with APP\u0026thinsp;\u0026lt;\u0026thinsp;sup\u0026gt;NL-G-F\u0026lt;/sup\u0026gt; mice alone. These observations reinforce the concept that ChP dysfunction is not merely a secondary consequence of neurodegeneration but can act as an upstream amplifier of disease progression by limiting CSF-mediated clearance pathways. Our findings therefore extend emerging evidence that impairment of CSF dynamics and barrier function contributes directly to the tempo and severity of Alzheimer\u0026rsquo;s disease pathology. In line with this interpretation, accumulating evidence suggests that alterations in cerebrospinal fluid dynamics and barrier-associated transport processes can modulate amyloid pathology and cognitive decline in Alzheimer\u0026rsquo;s disease (\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCollectively, this work establishes Ptpn20 as a previously unrecognized regulator of ChP epithelial stability and Aβ clearance. By maintaining apical F-actin organization and appropriate RhoA signaling dynamics, Ptpn20 preserves vesicular trafficking competence and directional transport across the blood\u0026ndash;CSF barrier. Loss of Ptpn20 disrupts this regulatory axis, resulting in epithelial degeneration, impaired CSF-to-blood Aβ clearance, and synergistic acceleration of amyloid pathology in vivo. These findings position the ChP as an upstream determinant of brain Aβ homeostasis and highlight actin-dependent vesicular regulation as a potential therapeutic target for early intervention in Alzheimer\u0026rsquo;s disease.\u003c/p\u003e\n\u003ch3\u003eLimitations and future directions\u003c/h3\u003e\n\u003cp\u003eSeveral limitations should be considered.\u003c/p\u003e \u003cp\u003eFirst, although Ptpn20 expression is enriched in the ChP epithelium, low levels are detectable in other CNS cell types, including ependymal and glial populations. The relative contributions of these cell types to Aβ handling and barrier integrity remain unresolved. Future studies employing cell-type-specific Ptpn20 deletion will help delineate compartment-specific roles. Second, while our results strongly support a model in which Ptpn20 regulates RhoA-dependent actin dynamics, the direct biochemical substrates and interacting partners of Ptpn20 were not identified. Proteomic and phosphoproteomic approaches will be required to determine whether Ptpn20 acts through direct dephosphorylation of RhoA regulators or via parallel cytoskeletal pathways.\u003c/p\u003e \u003cp\u003eThird, although we demonstrate impaired Aβ uptake and basolateral efflux in Ptpn20-deficient ChP, we did not directly quantify vectorial Aβ transport across the epithelial layer. Future microfluidic, in situ perfusion, or ex vivo barrier assays will be essential for determining directional Aβ flux and dissecting the relative contributions of uptake, routing, and efflux. Finally, the synergistic acceleration of pathology in APPKI \u0026times; Ptpn20KO mice suggests that restoring ChP function may represent a therapeutic strategy in early AD. Future work should evaluate whether pharmacological stabilization of actin dynamics, enhancement of vesicular trafficking, or modulation of RhoA activity can rescue Aβ clearance and mitigate neurodegeneration.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study identifies Ptpn20 as a key regulator of actin-dependent vesicular trafficking and Aβ transcytosis in the choroid plexus epithelium. By maintaining apical F-actin integrity and appropriate RhoA signaling dynamics, Ptpn20 preserves epithelial stability, endocytic competence, and CSF-mediated Aβ clearance. Loss of Ptpn20 is associated with epithelial degeneration and synergistic acceleration of Aβ pathology in the APPNL-G-F model. These findings establish the ChP as an upstream determinant of brain Aβ homeostasis and highlight actin\u0026ndash;vesicular regulation as a potential therapeutic target for early intervention in Alzheimer\u0026rsquo;s disease.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS ","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eAll experimental animals were group-housed (2\u0026ndash;5 mice per cage) in a temperature- and humidity-controlled facility (23\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5% humidity) under a 12-h light/12-h dark cycle at the Center for Experimental Medicine, Juntendo University, Japan. All animal procedures were approved by the Ethics Review Committee for Animal Experimentation of the Juntendo University School of Medicine (approval no. 1337) and were conducted in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals. Animals were monitored daily for health status, and no unexpected adverse events were observed.\u003c/p\u003e \u003cp\u003eOnly male mice were used in this study. Mice were deeply anesthetized with a mixed anesthetic agent (medetomidine 0.3 mg/kg, midazolam 4.0 mg/kg, and butorphanol 5.0 mg/kg; intraperitoneal injection) and euthanized by decapitation. Brain tissues were rapidly dissected and processed as described below.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMouse lines\u003c/h2\u003e \u003cp\u003eC57BL/6J mice were used as wild-type (WT) controls.\u003c/p\u003e \u003cp\u003ePtpn20 knockout mice (Ptpn20⁻/⁻; hereafter referred to as Ptpn20KO) were generated using CRISPR/Cas9 technology as previously described (Xu et al., 2022).\u003c/p\u003e \u003cp\u003eApp^NL-G-F/NL-G-F knock-in mice (RBRC06344; hereafter referred to as APPKI) were obtained from RIKEN BioResource Center and maintained on a C57BL/6J background. These mice harbor three familial Alzheimer\u0026rsquo;s disease mutations (Swedish, Iberian, and Arctic) introduced into the endogenous App locus.\u003c/p\u003e \u003cp\u003eDouble-mutant APPKI \u0026times; Ptpn20KO mice were generated by crossing homozygous APPKI mice with homozygous Ptpn20KO mice (Fig.S2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eGenotyping\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from tail biopsies, and genotyping was performed by PCR using the following primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMicroarray analysis\u003c/h2\u003e \u003cp\u003eChoroid plexuses were isolated from 5-week-old WT and Ptpn20KO mice. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) from RNAlater-stabilized tissue. RNA quality was assessed using a 4150 TapeStation (Agilent). Gene expression profiling was performed using the GeneChip Mouse Exon 1.0 ST Array (Affymetrix), and data were normalized using the Robust Multichip Average algorithm. Differentially expressed genes were analyzed using Transcriptome Analysis Console software and Ingenuity Pathway Analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA (500 ng) was reverse-transcribed using SuperScript IV VILO Master Mix. Quantitative PCR was performed using TaqMan Gene Expression Assays on an ABI 7500 system. Gene expression levels were normalized to Actb, and reactions were performed in triplicate.(Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence\u003c/h2\u003e \u003cp\u003eBrains were fixed in 4% paraformaldehyde, embedded in paraffin or cryoprotected, and sectioned. Sections were blocked and incubated with primary antibodies overnight at 4\u0026deg;C, followed by appropriate secondary antibodies. Nuclei were counterstained with Hoechst 33342. Images were acquired using a Leica TCS-SP5 confocal microscope. (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eCisterna magna injection of Carbon Black\u003c/h2\u003e \u003cp\u003eEight-week-old Ptpn20KO mice were anesthetized and placed in a stereotaxic frame. A total of 10 \u0026micro;L of 1% Nigrosin suspension was slowly injected into the cisterna magna using a 29-gauge microsyringe. Mice were maintained in a head-down position for 5 min and perfused 30 min later with PBS followed by 4% paraformaldehyde.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry and plaque quantification\u003c/h2\u003e \u003cp\u003eParaffin sections were stained with anti-Aβ antibody (82E1) and visualized using DAB. Amyloid plaques in the cortex and hippocampus were quantified using light microscopy. Data acquisition and quantitative analyses were performed by investigators blinded to genotype whenever feasible. (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eElectron microscopy\u003c/h2\u003e \u003cp\u003eChoroid plexus tissues were fixed with paraformaldehyde and glutaraldehyde, postfixed with osmium tetroxide, dehydrated, and embedded for TEM or processed for SEM according to standard protocols.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eRhoA activity assay\u003c/h2\u003e \u003cp\u003eRhoA activity was measured using G-LISA and total RhoA ELISA kits. RhoA activity was expressed as the ratio of GTP-bound to total RhoA.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eELISA\u003c/h2\u003e \u003cp\u003eAβ₁₋₄₀ and Aβ₁₋₄₂ levels in choroid plexus homogenates were quantified using commercially available ELISA kits. Quantification was performed by an investigator blinded to genotype.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eBehavioral analysis\u003c/h2\u003e \u003cp\u003eY-maze and Morris water maze tests were performed at 24 weeks of age. Behavioral tracking and analysis were conducted using automated video tracking systems. Data acquisition and quantitative analyses were performed by investigators blinded to genotype whenever feasible.\u003c/p\u003e \u003cp\u003eThis study was designed and reported in accordance with the ARRIVE 2.0 guidelines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003ePrimary outcome measures included Aβ accumulation, choroid plexus structural integrity, and behavioral performance. Statistical analyses were performed using IBM SPSS Statistics v29. Appropriate statistical tests are described in the figure legends. A two-sided P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. Animals were assigned to experimental groups based on genotype and age, and were housed without systematic bias between groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eAll data supporting the findings of this study are available within the Article and its Supplementary Information. Microarray data generated in this study have been deposited in the Gene Expression Omnibus (GEO) database and will be made publicly available upon publication. Additional datasets and analysis scripts are available from the corresponding author upon reasonable request.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences and PCR product sizes for genotyping\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene (Allele)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Direction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePCR Product Size\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAPP^NL-G-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTTGTGGCTGGCGGTCACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e670 bp (WT) / 870 bp (Mutant)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTATCGTGGACCGAGAATGGTCATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePtpn20 (KO allele)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCATGGACACTGAAATACAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e505 bp (WT) / 410 bp (KO)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATAGCGTCAATGGTCTAAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAssay IDs of Real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTaqMan Assay ID\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePtpn20\u003c/p\u003e \u003cp\u003eCav1\u003c/p\u003e \u003cp\u003eCltc\u003c/p\u003e \u003cp\u003eLrp1\u003c/p\u003e \u003cp\u003eAbcc1\u003c/p\u003e \u003cp\u003eAQP1\u003c/p\u003e \u003cp\u003eNa\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e-ATPase\u003c/p\u003e \u003cp\u003eSlc13a3\u003c/p\u003e \u003cp\u003eActin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePtpn20, Mm00477234_m1\u003c/p\u003e \u003cp\u003eCav1, Mm00483057_m1\u003c/p\u003e \u003cp\u003eCltc, Mm00483057_m1\u003c/p\u003e \u003cp\u003eLrp1, Mm00464608_m1\u003c/p\u003e \u003cp\u003eAbcc1, Mm00456156_m1\u003c/p\u003e \u003cp\u003eAQP1, Mm00431834_m1\u003c/p\u003e \u003cp\u003eATP1a1, Mm00523255_m1\u003c/p\u003e \u003cp\u003eSlc13a3, Mm00475289m1\u003c/p\u003e \u003cp\u003eActb, Mm00607939_S1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReagents for immunofluorescence investigations\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFig No\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMethod\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eReagents\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSecondary antibody\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1-a,c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCryosection\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePtpn20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRabbit PTPN20B antibody (CSB-PA065165, CusAb, 1:250)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDonkey anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor\u0026trade; Plus 488 (A32790, Invitrogen, 1:25)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1,2-d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRhoA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMouse RhoA antibody 66733-1-IG (Proteintech Group.Inc.,1:100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDonkey anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor\u0026trade; Plus 488 (A32766, Invitrogen, 1:25)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2-d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRabbit ZO-1 antibody 21773-1-AP (Proteintech Group.Inc.,1:100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDonkey anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor\u0026trade; Plus 488 (A32790, Invitrogen, 1:25)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1,2-a,c,d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eActin-stain 555 Fluorescent Phalloidin (Cat. # PHDH1, Cytoskeleton. Inc., 1:50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3-a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFFPE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmyloid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnti-Human Amyloidβ (N) (82E1) Mouse IgG MoAb #10323 (IBL 1:100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDonkey anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor\u0026trade; Plus 488 (A32766, Invitrogen, 1:25)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3-a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRabbit ZO-1 antibody 21773-1-AP (Proteintech Group.Inc.,1:100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDonkey anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor\u0026trade; Plus 488 (A32790, Invitrogen, 1:25)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReagents for immunohistochemistry\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFig No\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMethod\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eReagents\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTreatment / Condition\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2-c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eParaffin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eClaudin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAntigen Unmasking Solution,Citric Acid Based (VECTOR LABORATORIES, 1:100)\u003c/p\u003e \u003cp\u003e121℃ 10min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRabbit Claudin1 antibody 28674-1-AP(Proteintech Group.Inc.,1:500)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4-a,c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eParaffin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmyloid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFormic acid 11-0780-5 (SIGMAALDRICH)\u003c/p\u003e \u003cp\u003e5min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAnti-Human Amyloidβ (N) (82E1) Mouse IgG MoAb #10323 (IBL 1:100)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.M. and R.M. designed the study, performed experiments, acquired and analysed data, and wrote the manuscript. M.N. and A.K. contributed to the study design. S.Y., K.K., C.A., K.S., K.H. and C.K. contributed to data acquisition. I.O. performed experiments. E.N. and N.T. generated the model mice. M.M. supervised the project and critically revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eMaterials \u0026amp; Correspondence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence and requests for materials should be addressed to\u0026nbsp;Masakazu Miyajima.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were reviewed and approved by the \u003cstrong\u003eEthics Review Committee for Animal Experimentation of the Juntendo University School of Medicine\u003c/strong\u003e (approval number \u003cstrong\u003e1337\u003c/strong\u003e). All procedures were conducted in strict accordance with the \u003cstrong\u003eNational Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals\u003c/strong\u003e, as well as institutional and national guidelines for animal welfare. The study was designed, conducted, and reported in compliance with the \u003cstrong\u003eARRIVE 2.0 guidelines\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financially supported by the Juntendo Research Branding Project and the Japan Society for the Promotion of Science under Grants-in-Aid for Scientific Research (Grant Numbers 23K15674, 24K10497)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank \u003cstrong\u003eTakeomi C. Saido\u003c/strong\u003e (Laboratory for Proteolytic Neuroscience, RIKEN Center for Brain Science) and \u003cstrong\u003eTakashi Saito\u003c/strong\u003e (Department of Neurocognitive Science, Institute of Brain Science, Nagoya City University) for generously providing the APP^NL-G-F knock-in mice. We also thank the staff of the Center for Experimental Medicine, Juntendo University, for their technical assistance and animal care.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang J et al (2024) Recent advances in Alzheimer\u0026rsquo;s disease: mechanisms, clinical trials and new drug development strategies. Signal Transduct Target Therapy 9(1):211\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorat\u0026oacute; X et al (2022) Symptomatic and Disease-Modifying Therapy Pipeline for Alzheimer\u0026rsquo;s Disease: Towards a Personalized Polypharmacology Patient-Centered Approach. Int J Mol Sci 23(16):9305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAisen PS et al (2017) On the path to 2025: understanding the Alzheimer\u0026rsquo;s disease continuum. Alzheimers Res Ther 9(1):60\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehl C (2024) In the amyloid-cascade-hypothesis still remains a working hypothesis, no less but certainly no more. Front Aging Neurosci, 2024. 16: p. 1459224\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontana IC et al (2020) Amyloid-beta oligomers in cellular models of Alzheimer's disease. J Neurochem 155(4):348\u0026ndash;369\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKepp KP et al (2023) The amyloid cascade hypothesis: an updated critical review. Brain 146(10):3969\u0026ndash;3990\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGi\u0026atilde;o T et al (2022) Choroid Plexus in Alzheimer\u0026rsquo;s Disease\u0026mdash;The Current State of Knowledge. Biomedicines 10(2):224\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalusu S et al (2016) The choroid plexus-cerebrospinal fluid interface in Alzheimer's disease: more than just a barrier. Neural Regeneration Res 11(4):534\u0026ndash;537\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsumoto K et al (2015) Immunohistochemical analysis of transporters related to clearance of amyloid-beta peptides through blood-cerebrospinal fluid barrier in human brain. Histochem Cell Biol 144(6):597\u0026ndash;611\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelvenne A et al (2024) Involvement of the choroid plexus in Alzheimer's disease pathophysiology: findings from mouse and human proteomic studies. Fluids Barriers CNS 21(1):58\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunicio C et al (2023) Choroid Plexus Aquaporins in CSF Homeostasis and the Glymphatic System: Their Relevance for Alzheimer's Disease. Int J Mol Sci, 24(1)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaunders NR et al (2023) The choroid plexus: a missing link in our understanding of brain development and function. Physiol Rev 103(1):919\u0026ndash;956\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTietz S, Engelhardt B (2015) Brain barriers: Crosstalk between complex tight junctions and adherens junctions. J Cell Biol 209(4):493\u0026ndash;506\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaehr C, Reichel V, Fricker G (2006) Choroid plexus epithelial monolayers \u0026ndash; a cell culture model from porcine brain. Cerebrospinal Fluid Res 3(1):13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadanandan J, Sathyanesan M, Newton SS (2024) Aging alters the expression of trophic factors and tight junction proteins in the mouse choroid plexus. Fluids Barriers CNS 21(1):77\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDani N et al (2021) A cellular and spatial map of the choroid plexus across brain ventricles and ages. Cell 184(11):3056\u0026ndash;3074e21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScarpetta V et al (2023) Morphological and mitochondrial changes in murine choroid plexus epithelial cells during healthy aging. Fluids Barriers CNS 20(1):19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEide PK et al (2020) Delayed clearance of cerebrospinal fluid tracer from choroid plexus in idiopathic normal pressure hydrocephalus. J Cereb Blood Flow Metabolism 40(9):1849\u0026ndash;1858\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurakami Y et al (2018) Rapid increase of 'brain-type' transferrin in cerebrospinal fluid after shunt surgery for idiopathic normal pressure hydrocephalus: a prognosis marker for cognitive recovery. J Biochem 164(3):205\u0026ndash;213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurakami Y et al (2019) Transferrin isoforms in cerebrospinal fluid and their relation to neurological diseases. Proc Jpn Acad Ser B Phys Biol Sci 95(5):198\u0026ndash;210\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilverberg GD et al (2002) Assessment of low-flow CSF drainage as a treatment for AD. Neurology 59(8):1139\u0026ndash;1145\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H et al (2022) Ptpn20 deletion in H-Tx rats enhances phosphorylation of the NKCC1 cotransporter in the choroid plexus: an evidence of genetic risk for hydrocephalus in an experimental study. Fluids Barriers CNS 19(1):39\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFodero-Tavoletti MT et al (2005) Protein tyrosine phosphatase hPTPN20a is targeted to sites of actin polymerization. Biochem J 389(Pt 2):343\u0026ndash;354\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung KA, Biggins L, Sharpe HJ (2021) Protein tyrosine phosphatases in cell adhesion. Biochem J 478(5):1061\u0026ndash;1083\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo X et al (2024) PTPN20 promotes metastasis through activating NF-κB signaling in triple-negative breast cancer. Breast Cancer Res 26(1):155\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaito T et al (2014) Single App knock-in mouse models of Alzheimer's disease. Nat Neurosci 17(5):661\u0026ndash;663\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrkic M et al (2015) Amyloid beta Oligomers Disrupt Blood-CSF Barrier Integrity by Activating Matrix Metalloproteinases. J Neurosci 35(37):12766\u0026ndash;12778\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilverberg GD et al (2001) The cerebrospinal fluid production rate is reduced in dementia of the Alzheimer\u0026rsquo;s type. Neurology 57(10):1763\u0026ndash;1766\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonz\u0026aacute;lez-Marrero I et al (2015) Choroid plexus dysfunction impairs beta-amyloid clearance in a triple transgenic mouse model of Alzheimer's disease. Front Cell Neurosci 9:17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRidley AJ, Hall A (1992) The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70(3):389\u0026ndash;399\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmano M, Nakayama M, Kaibuchi K (2010) Rho-kinase/ROCK: A key regulator of the cytoskeleton and cell polarity. Cytoskeleton (Hoboken) 67(9):545\u0026ndash;554\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishimura Y et al (2006) A role of LIM kinase 1/cofilin pathway in regulating endocytic trafficking of EGF receptor in human breast cancer cells. Histochem Cell Biol 126(5):627\u0026ndash;638\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKant S et al (2018) Choroid plexus genes for CSF production and brain homeostasis are altered in Alzheimer\u0026rsquo;s disease. Fluids Barriers CNS 15(1):34\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8759264/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8759264/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAccumulation of amyloid-β (Aβ) in Alzheimer\u0026rsquo;s disease reflects not only excessive production but also impaired clearance. The choroid plexus (ChP), which forms the blood\u0026ndash;cerebrospinal fluid barrier, plays an important role in cerebrospinal fluid turnover and molecular elimination; however, the mechanisms that maintain epithelial integrity and vesicle-mediated transport remain poorly understood. Here we identify the cytoplasmic protein tyrosine phosphatase Ptpn20 as a key regulator of actin-dependent vesicular trafficking in ChP epithelial cells. Loss of Ptpn20 destabilizes apical F-actin architecture, suppresses both caveolae- and clathrin-mediated endocytosis, and reduces transcytosis of Aβ from the cerebrospinal fluid to the bloodstream. Transcriptomic profiling reveals coordinated downregulation of cytoskeletal, junctional, and vesicular transport modules. Mechanistically, Ptpn20 deficiency induces an early, transient hyperactivation of RhoA signaling that subsequently diminishes as actin architecture deteriorates, indicating biphasic uncoupling of RhoA\u0026ndash;actin regulation. In the APP^NL-G-F knock-in background, loss of Ptpn20 exacerbates epithelial degeneration, apical Aβ accumulation, brain amyloid pathology, synaptic loss, and cognitive impairment. These findings establish Ptpn20 as an essential determinant of ChP epithelial homeostasis and highlight impaired actin-dependent vesicular trafficking as a contributor to reduced Aβ clearance.\u003c/p\u003e","manuscriptTitle":"Ptpn20 preserves actin-dependent vesicular trafficking and amyloid-β clearance capacity in the choroid plexus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-16 11:37:47","doi":"10.21203/rs.3.rs-8759264/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"15edf2ec-1c00-458b-ae29-bf05af0a2dca","owner":[],"postedDate":"February 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-20T12:56:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-16 11:37:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8759264","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8759264","identity":"rs-8759264","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.