Engineering the C. elegans genome with a nested, self-excising selection cassette

preprint OA: closed

Abstract

C. elegans is a powerful model for dissecting biological processes in vivo . In particular, the ease of generating targeted knock-in alleles makes it possible to visualize and functionally modify endogenous proteins to gain fundamental insights into biological mechanisms. Methods for C. elegans genome engineering typically utilize selectable markers, visual screening for fluorescence, or PCR genotyping to identify successfully edited animals. A common genetic tool known as the Self-Excising Cassette (SEC) combines drug and phenotypic selection, which makes it possible to screen large numbers of progeny rapidly and with minimal hands-on effort. However, N-terminal and internal knock-ins using the SEC cause loss of function until the selectable marker cassette is excised, which makes it impossible to isolate homozygous lines for essential genes prior to SEC excision. To simplify generating knock-ins for essential genes, we developed a Nested, Self-Excising selection Cassette (NSEC) that is located entirely within a synthetic intron and does not interfere with the expression of endogenous, N-terminally-tagged NSEC-fusion proteins. This innovation makes it possible to isolate homozygous lines for N-terminally tagged genes prior to selectable marker excision and allows for a standardized workflow to generate N-terminal and internal tags in any background and without the need for genetic balancers. We designed versions of NSEC that include an optional auxin-inducible degron tag and mTurquoise2, GFP, mStayGold, mNeonGreen, or mScarlet-I fluorescent proteins for experimental flexibility. The NSEC expands our molecular toolbox and enhances the scalability, efficiency, and versatility of C. elegans genome engineering.
Full text 41,436 characters Β· extracted from preprint-html Β· click to expand
Engineering the C. elegans genome with a nested, self-excising selection cassette | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Engineering the C. elegans genome with a nested, self-excising selection cassette View ORCID Profile Theresa V Gibney , View ORCID Profile Ariel M Pani doi: https://doi.org/10.1101/2025.05.01.651742 Theresa V Gibney 1 Department of Biology, University of Virginia , Charlottesville, VA 22904, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Theresa V Gibney Ariel M Pani 1 Department of Biology, University of Virginia , Charlottesville, VA 22904, USA 2 Department of Cell Biology, University of Virginia School of Medicine , Charlottesville, VA 22903, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Ariel M Pani For correspondence: amp2na{at}virginia.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract C. elegans is a powerful model for dissecting biological processes in vivo . In particular, the ease of generating targeted knock-in alleles makes it possible to visualize and functionally modify endogenous proteins to gain fundamental insights into biological mechanisms. Methods for C. elegans genome engineering typically utilize selectable markers, visual screening for fluorescence, or PCR genotyping to identify successfully edited animals. A common genetic tool known as the Self-Excising Cassette (SEC) combines drug and phenotypic selection, which makes it possible to screen large numbers of progeny rapidly and with minimal hands-on effort. However, N-terminal and internal knock-ins using the SEC cause loss of function until the selectable marker cassette is excised, which makes it impossible to isolate homozygous lines for essential genes prior to SEC excision. To simplify generating knock-ins for essential genes, we developed a Nested, Self-Excising selection Cassette (NSEC) that is located entirely within a synthetic intron and does not interfere with the expression of endogenous, N-terminally-tagged NSEC-fusion proteins. This innovation makes it possible to isolate homozygous lines for N-terminally tagged genes prior to selectable marker excision and allows for a standardized workflow to generate N-terminal and internal tags in any background and without the need for genetic balancers. We designed versions of NSEC that include an optional auxin-inducible degron tag and mTurquoise2, GFP, mStayGold, mNeonGreen, or mScarlet-I fluorescent proteins for experimental flexibility. The NSEC expands our molecular toolbox and enhances the scalability, efficiency, and versatility of C. elegans genome engineering. Introduction C. elegans is a genetically tractable model organism used to investigate a broad range of fundamental biological processes. Its small size, optical transparency, and relative ease of genome engineering compared to other multicellular organisms make C. elegans a particularly powerful system for studies that use in vivo imaging. Efficient genome engineering approaches based on CRISPR/Cas9 have revolutionized genetic manipulations in C. elegans , providing researchers with unprecedented abilities to generate precise fluorescent protein knock-ins and other modifications at endogenous loci (reviewed by DICKINSON AND GOLDSTEIN 2016 ). When tagging endogenous genes, it is critical to choose tag locations that do not affect the function of the resulting fusion protein. Many proteins do not tolerate C-terminal tags because specific C-terminal sequences are often required for proper localization, function, or post-translational modification ( CLARKE 1992 ; CHOY et al . 1999 ; SNAPP 2005 ; ROBERTS et al . 2008 ). Both the N- and C-termini are required for native properties of some proteins, and internal knock-ins may be needed to preserve their functions ( WALL et al . 1995 ; ADJOBO-HERMANS et al . 2011 ; ARMENTI et al . 2014 ; BENDEZU et al . 2015 ). For some genes, the presence of alternative splice forms may also necessitate using an N-terminal or internal tag ( KEELEY et al . 2020 ). In other cases, specific tag locations may be needed due to native protein cleavage, and/or there may be experimental requirements to tag the protein in multiple locations ( SOHR et al . 2019 ). Accordingly, there is a need for rapid, flexible, and efficient methods that can be used to tag proteins in any location. Tagging endogenous genes in C. elegans typically relies on homology-directed repair (HDR) to insert a repair template with site-specific homology arms at the site of a Cas9-induced double-stranded DNA break. Multiple techniques leverage Cas9-triggered HDR to tag endogenous genes in C. elegans (reviewed by DICKINSON AND GOLDSTEIN 2016 ). Relatively small sequences (<140bp) can be inserted using a synthetic, single-stranded DNA oligonucleotide repair template with short homology arms ( PAIX et al . 2014 ; ZHAO et al . 2014 ; WARD 2015 ). Larger sequences, up to the size of a fluorescent protein, can also be inserted using PCR-generated double-stranded DNA repair templates with short homology arms ( PAIX et al . 2015 ; GHANTA AND MELLO 2020 ), but with lower efficiency than smaller inserts. While these approaches are effective for some sites, success rates are variable, and post-injection screening can be highly labor-intensive. Screening is particularly time-consuming for loci with low editing efficiency and/or knock-ins targeting genes that are expressed at levels too low to visualize on a fluorescence stereomicroscope. To simplify the process of identifying rare knock-ins, several strategies incorporate selectable markers encoded in the homologous repair template ( DICKINSON et al . 2013 ; ARMENTI et al . 2014 ; DICKINSON et al . 2015 ) that make it possible to screen for successful knock-ins with minimal hands-on effort and a flexible timeline. A common method uses a Self-Excising selection Cassette (SEC) that includes a hygromycin resistance gene, a dominant sqt-1(d) marker that confers a visible rolling phenotype, and heat-shock-driven cre recombinase ( DICKINSON et al . 2015 ). Unlike selection methods that rely on rescuing a mutant, the SEC has the key advantage that it can be used in any genetic background. In addition to streamlining the process of identifying knock-in animals, the roller phenotype simplifies subsequent strain crossing by serving as a visible proxy for the knock-in genotype. The SEC is flanked by loxP sites and can be excised from the genome by Cre-lox recombination. Despite the ease of screening for knock-ins, the original SEC has design features that complicate tagging many genes of interest. Knocking the SEC into an endogenous gene interferes with the expression of downstream coding and/or untranslated regions (UTRs) prior to SEC excision ( DICKINSON et al . 2015 ). Until the SEC is excised, N-terminal SEC insertions typically act as strong loss-of-function alleles while internal knock-ins truncate the endogenous protein. Therefore, N-terminal and internal SEC knock-in alleles for essential genes are typically not viable as homozygotes, and lines must be maintained prior to SEC excision by picking rolling worms in each generation or by crossing in a genetic balancer. C-terminal SEC knock-ins do not disrupt the coding sequence but result in a transcript where the endogenous 3’ UTR is replaced with a let-858 3’ UTR located in the SEC prior to excision. While many genes tolerate this 3’ UTR replacement, essential genes with critical regulatory elements in the 3’UTR ( THOMPSON et al . 2006 ; MERRITT et al . 2008 ; OLDENBROEK et al . 2013 ) may not. The ease of balancing SEC alleles depends on the availability of balancer strains for the targeted region and their genetic and phenotypic compatibility with the knock-in’s parental strain, which may include mutations or insertions at multiple loci. Although it is possible to excise the SEC from unbalanced heterozygous lines, identifying excised progeny can be very challenging because their movement phenotype is indistinguishable from the 25% of progeny that do not carry a knock-in allele. As a result, it is not possible to use a standardized workflow for making N-terminal and internal tags on essential genes using the SEC, and each knock-in requires individualized efforts that limit throughput and can become an impediment to progress. We sought to reengineer the SEC to allow for functional N-terminal and internal knock-ins prior to cassette excision while maintaining the core advantages of the original design. To do so, we designed a Nested, Self-Excising selection Cassette (NSEC) that is entirely embedded within a synthetic intron and does not interfere with expression or function of N-terminal and internal NSEC knock-in alleles. To validate this approach, we endogenously tagged the essential ERK1/2 homolog mpk-1 at its N-terminus with mNeonGreen(mNG) and an auxin-inducible degron (AID) using the SEC or NSEC. As predicted, the mNG^SEC^3xFlag::AID::mpk-1 knock-in (^ denotes an artificial intron prior to SEC/NSEC excision) caused loss of MPK-1 function, and knock-in lines could only be maintained as heterozygotes. In contrast, an otherwise identical NSEC-based knock-in preserved endogenous MPK-1 function. mNG::AID^NSEC^mpk-1 animals were viable as homozygotes, did not display loss-of-function phenotypes, and mNG::AID^NSEC^MPK-1 protein was localized correctly. To facilitate wider use in the C. elegans community, we also generated ten NSEC plasmid backbones that can be used to clone homologous repair templates with the fluorescent proteins mTurquoise2, GFP, mStayGold, mNG, and mScarlet-I, with or without an AID tag. NSEC provides a scalable and user-friendly approach for tagging endogenous genes in any location without initially disrupting their function, which simplifies the workflow to generate knock-ins and has potential to facilitate large-scale endogenous tagging efforts. Results/Discussion To prevent N-terminal and internal SEC knock-ins from disrupting gene function, we sought to redesign the SEC so that it could be embedded entirely within an artificial intron. We reasoned that it should be possible to hide the SEC within an intron by flanking the selectable marker cassette with splice donor and acceptor sites and eliminating transcriptional terminators and other splice acceptors in the same orientation as the gene of interest. We first removed a splice acceptor sequence, HA tag, and let-858 3’UTR that are present at the 5’ end of the original SEC. We then rearranged the HygR, sqt-1(d) , and hs>cre genes that make up the SEC so that all three are transcribed in the opposite orientation as the tagged gene of interest ( Figure 1 ). For an intronic SEC to be functionally β€œhidden” from an endogenously tagged gene, it should also be essential to remove all splice acceptors within the selectable marker genes to ensure that the entire cassette is spliced out of the target gene’s mRNA. To identify splice acceptors within the rearranged SEC, we used NetGene 2 - 2.42 ( BRUNAK et al . 1991 ; HEBSGAARD et al . 1996 ) to produce neural network predictions of C. elegans splice sites in our modified sequence. For predicted splice acceptors in coding sequences, we made synonymous substitutions to disrupt the splice acceptor function without altering the encoded protein. For predicted splice acceptors in non-coding sequences, we made semi-random single nucleotide substitutions or added a single nucleotide to disrupt the splice acceptor function (Supplemental Note 1A). To reduce the overall size of the selectable marker cassette, we removed extraneous sequence between the rps-0 promoter and hygromycin phosphotransferase and replaced the unc-54 3’UTR in the HygR gene with a 107 bp minimal let-858 3’UTR. We also shortened the tbb-2 3’ UTR in the hs>cre gene to 40 bp. We flanked this redesigned SEC with loxP sites and nested it within a synthetic intron that included unique intronic sequences to facilitate subsequent cloning by Gibson assembly ( Figure 1 ; Supplemental Note 1). We named this modified selectable marker cassette the Nested Self-Excising selection Cassette (NSEC). To generate a user-friendly backbone plasmid for cloning homologous repair templates, we added mNG::AID along with extended flexible linker sequences and restriction sites located between functional sequence features ( Figure 1 ; Supplemental Note 1). Download figure Open in new tab Figure 1. Design of the Nested, Self-Excising selection Cassette. To assess performance of the NSEC for N-terminal knock-ins, we decided to endogenously tag an essential gene with a known localization pattern. As a test case, we chose the ERK1/2 homolog mpk-1 , which is essential for larval development and adult fertility (reviewed by SUNDARAM 2013 ). Endogenously tagged MPK-1 localizes to the nucleus in a subset of cells where MAPK/ERK is active ( RASMUSSEN AND REINER 2021 ), and its subcellular localization is clearly distinguishable from the uniform fluorescence observed in N-terminal knock-ins with the original SEC prior to excision ( DICKINSON et al . 2015 ). To assess NSEC functionality, we generated knock-ins tagging mpk-1 at its N-terminus using either the original SEC or NSEC for direct comparisons ( Figure 2 ). mNG^SEC^3xFlag::AID::mpk-1 knock-in animals generated using the original SEC could not be maintained as homozygotes prior to SEC excision ( Figure 2A ), as expected based on essential functions for ERK/MPK-1. mNG protein in these knock-in animals localized uniformly throughout the cytoplasm and nucleus ( Figure 2B ). In contrast, mNG::AID^NSEC^mpk-1 knock-in animals were viable as homozygotes ( Figure 2A ) and did not exhibit mpk-1 loss-of-function phenotypes. In all cell types examined, the subcellular localization of mNG::AID^NSEC^MPK-1 protein ( Figure 2B ) resembled published knock-in strains ( RASMUSSEN AND REINER 2021 ; GIBNEY et al . 2025 ) consistent with production of functional mNG::AID::MPK-1 protein prior to selectable marker excision in mNG::AID^NSEC^mpk-1 animals. To verify that the NSEC design remained capable of self-excision, we heat shocked young L1 stage mNG::AID^NSEC^mpk-1 worms and screened their progeny for individuals without the roller phenotype. We observed numerous F1 animals with wild-type movement and picked a single founder to establish an excised, homozygous mNG::AID::mpk-1 line ( Figure 2A ). mNG::AID::MPK-1 protein localization was indistinguishable between the NSEC and excised lines ( Figure 2B ). The combination of biological functionality and correct subcellular localization prior to NSEC excision indicates that the NSEC does not interfere with the function of an essential N-terminally-tagged protein. To streamline use of this method by the C. elegans community, we developed a plasmid toolkit featuring NSEC backbones with five codon-optimized fluorescent proteins with and without an AID tag ( Table 1 ). View this table: View inline View popup Download powerpoint Table 1. Plasmids for NSEC-based endogenous gene tagging Download figure Open in new tab Figure 2. N-terminal NSEC knock-in does not interfere with endogenous ERK/MPK-1 function or localization. Conclusions The NSEC provides a user-friendly approach to tag endogenous genes in any location without initially disrupting expression or function ( Figure 3 ). Because N-terminal or internal tags are often required to preserve the functionality of tagged proteins, we expect the NSEC will streamline the process of generating endogenously tagged alleles for many genes. The ability to use a standard workflow for N-terminal, internal, and C-terminal tags without the need for genetic balancers simplifies the process of making knock-ins for essential genes and should facilitate endogenous tagging efforts in C. elegans . The ability to maintain homozygous NSEC lines for N-terminally tagged essential genes prior to selectable marker excision also eases strain maintenance and makes it possible to easily genotype subsequent crosses using the roller phenotype. Compared to methods that rely on screening for edited animals by PCR or fluorescence, the use of selectable markers makes it possible to recover knock-ins at sites with low insertion efficiency and/or for genes expressed at low levels with minimal hands-on effort. While we have only tested the NSEC for fluorescent protein-tagging, this method should allow for other types of genome edits and insertions by modifying the homologous repair templates using conveniently placed restriction sites (see Figure 1 ; Supplemental Information). For labs that are familiar with the existing SEC workflow ( DICKINSON et al . 2015 ), using the NSEC should be seamless as the process remains identical except for the use of a different repair template plasmid. To facilitate adoption, we provided ten NSEC repair template backbones that meet a range of experimental needs. Beyond C. elegans , this strategy has potential applications in other model systems, providing a framework for scarless knock-ins that retain endogenous gene function during all steps of the process. By easing the burden of tagging essential genes, the NSEC will facilitate large-scale efforts to endogenously tag C. elegans genes and accelerate the types of experiments needed for a mechanistic understanding of fundamental biological processes in vivo . Download figure Open in new tab Figure 3. Workflow and expected outcomes for endogenous gene tagging with the SEC or NSEC strategies. Data and Materials Availability NSEC plasmid backbones generated in this study are listed in Table 1 and have been deposited at Addgene. Additional materials are listed in Table S1 (Resources and Reagents). Annotated plasmid sequence files are provided in Supplemental File 1. Original image data are available upon request. For further inquiries or requests, please contact Ariel Pani at amp2na{at}virginia.edu . Author Contributions Conceptualization, TVG and AMP; methodology, TVG and AMP; investigation, TVG and AMP; data curation, TVG; writing – original draft, TVG; writing – review & editing AMP; visualization, TVG and AMP; project administration, AMP; funding acquisition, TVG and AMP. Declaration of Interests The authors declare no competing interests. Materials and methods C. elegans maintenance C. elegans knock-in strains were generated in a wild-type (N2) background. All C. elegans strains were maintained at room temperature (approximately 22Β°C) on Nematode Growth Media (NGM) plates seeded with E. coli OP50 as described in detail elsewhere ( STIERNAGLE 2006 ). Plasmid design and molecular cloning We identified potential intron splice acceptor sites using neural network-based prediction implemented through the NetGene2 - 2.42 server with C. elegans selected as the species ( https://services.healthtech.dtu.dk/services/NetGene2-2.42/ ; BRUNAK et al . 1991 ; HEBSGAARD et al . 1996 ). We then made synonymous substitutions to eliminate predicted splice acceptors within coding sequences without altering the encoded protein. For predicted splice acceptors in noncoding sequence, we either altered or added individual bases to eliminate the predicted splice acceptor function. Alterations made relative to the original SEC sequence are detailed in Supplemental Note 1. Including an intron in cre was essential to prevent bacterial cre expression and resulting Cre-lox recombination within the NSEC plasmids during cloning. The NSEC sequence was synthesized commercially (GENEWIZ, Azenta Life Sciences). To generate pTG610 and pTG611, we used Gibson assembly (New England Biolabs HiFi DNA Assembly) to add flanking intron, linker, and mNG or mNG::AID sequences. Because some fluorescent protein fusions require longer linker sequences than used in the original SEC to retain biological function ( GIBNEY et al . 2025 ), we added new extended, flexible linker sequences. To generate additional repair templates with other fluorescent proteins, the mNG coding sequence in pTG610 or pTG611 was replaced with mTurquoise2, GFP, mStayGold, or mScarlet-I using Gibson assembly. Homologous repair template plasmids for mNG^SEC^3xFlag::AID::mpk-1 and mNG::AID^NSEC^mpk-1 were made from pUA77 ( AGHAYEVA et al . 2021 ) or the precursor of pTG611, respectively. PCR fragments were amplified from existing plasmids or genomic DNA using Q5 Hi-Fidelity 2X Master Mix (New England Biolabs). Plasmids were transformed into DH5-alpha cells (New England Biolabs), and miniprepped with a PureLink HQ Mini Plasmid DNA Purification Kit (Invitrogen). Site-directed mutagenesis of pDD162 ( DICKINSON et al . 2013 ) was used to generate the Cas9 + N-terminal mpk-1 guide RNA plasmid pTG173. mpk-1 was endogenously tagged immediately following the start codon of F43C1.2a using the guide RNA sequence 5’ TTCTTCTTGCAGATGGCCGA 3’, which is predicted to result in an N-terminal tag for MPK-1 isoform A and an internal tag for isoform B ( STERNBERG et al . 2024 ). All plasmid sequences were confirmed with whole-plasmid nanopore sequencing (Plasmidsaurus). Strain construction C. elegans knock-in strains using either SEC- or NSEC-based plasmid repair templates were generated by germline microinjection as described in detail elsewhere ( DICKINSON et al . 2015 ; GIBNEY et al . 2023 ) ( https://wormcas9hr.weebly.com/ ). Briefly, we injected a mix containing a repair template plasmid, Cas9 + guide RNA plasmid pTG173, and red fluorescent co-injection markers ( DICKINSON et al . 2013 ) into the germlines of young adult hermaphrodites. Following microinjections, animals were moved to fresh, NGM plates seeded with E. coli OP50 (3-4 worms per plate). Plates were treated with hygromycin 2-3 days post-injection, prior to reproductive maturity of the F1 progeny. We screened for candidate knock-ins 7-9 days post-injection by looking for plates with numerous young, rolling animals that lacked the red fluorescent co-injection markers. Sixteen animals from each candidate plate were then picked onto individual plates without hygromycin. These plates were assessed three days later for homozygosity by screening for plates where 100% of progeny exhibited the roller phenotype. Because mNG^SEC^3xFlag::AID::mpk-1 could not be maintained as a homozygote, we maintained this strain as heterozygotes by picking rolling animals with superficially normal development. The NSEC was excised from homozygous mNG::AID^NSEC^mpk-1 (APL958) animals by heat shocking approximately 30 young L1 stage worms at 34Β°C for four hours. We then established the excised mNG::AID::mpk-1 line (APL959) by picking progeny with wild-type movement four days after heat shock. Microscopy Images in Figure 2A were taken using an Apple iPhone15 and Zeiss Axio Zoom V16 fluorescence microscope with a Plan NeoFluar Z 2.3x/0.57 objective. Images in Figure 2B were acquired using a Yokogawa CSU-X1 spinning disk confocal and Hamamatsu ORCA Fusion BT sCMOS camera mounted on a Nikon Ti2E inverted microscope stand. Spinning disk imaging was performed using an Apo TIRF 60X/1.49 NA oil immersion objective with 514 nm laser excitation, 445/514/594 dichroic mirror, and 545/40m emission filter. Larval worms were immobilized for live imaging in 0.3 mmol/L levamisole in M9 buffer and mounted on 3% (wt/vol) agarose pads. Strains were imaged within 30 minutes of mounting, and at least 50 worms were examined per strain. To compare protein localization between strains, animals were imaged at comparable developmental stages. Images were acquired using Nikon NIS Elements AR 5.42 software. Images were deconvolved using Nikon NIS Elements and adjusted for brightness and contrast using Fiji/ImageJ ( SCHINDELIN et al . 2012 ). Figures were prepared using Adobe Illustrator 28.3. Figure and Table Legends Figure 1. Design of the Nested, Self-Excising selection Cassette (NSEC) . ( A ) The NSEC consists of a hygromycin resistance gene, sqt-1(d) dominant phenotypic marker, and heat-shock inducible cre flanked by loxP sites and embedded within a synthetic intron. Cre-lox recombination can excise the NSEC, leaving behind a seamless genomic insertion. The mNG::AID^NSEC^linker plasmid is shown for illustrative purposes, but the design is similar for all versions described here. ( B ) Schematic of plasmid backbone pTG611 corresponding to the NSEC design in A. Locations of restriction sites for inserting homology arms and making other repair template modifications are highlighted. See Supplemental Information for plasmid sequences and annotations. Figure 2. N-terminal NSEC knock-in does not interfere with endogenous ERK/MPK-1 function or localization . ( A ) Architecture and functionality of N-terminal SEC and NSEC knock-ins tagging the essential gene mpk- 1. An mNG^SEC^3xFlag::AID::mpk-1 knock-in disrupts function of mpk-1 due to the design of the original SEC, which includes a strong transcriptional terminator at the 5’ end of the SEC. mNG^SEC^3xFlag::AID::mpk-1 animals could only be maintained as heterozygotes, which segregated wild-type animals, fertile heterozygous knock-in animals, and sterile homozygous knock-in animals with loss of MPK-1 function (maternally rescued homozygotes are viable but sterile). In contrast, mNG::AID^NSEC^mpk-1 knock-in animals were viable as homozygotes and did not exhibit loss-of-function phenotypes. The NSEC can be self-excised by heat shock to remove the selectable marker cassette and restore a wild-type movement phenotype. ( B ) Expression and subcellular localization of SEC- and NSEC-tagged endogenous MPK-1. mNG^SEC^3xFlag::AID::mpk-1 knock-in animals expressed only mNG, which localized uniformly throughout both the cytosol and nuclei of cells that express mpk-1 . In contrast, subcellular localization of mNG::AID^NSEC^MPK-1 was indistinguishable from excised mNG::AID::MPK-1. The tagged protein in both NSEC and excised strains is excluded from the nuclei of multiple cells in the head but enriched in nuclei (arrows) in other cell types including vulval precursors and muscles where ERK signaling is active. mNG::AID^NSEC^MPK-1 and excised mNG::AID::MPK-1 protein also exhibited a striated localization pattern in body wall muscles. Scale bars = 10Β΅m. Figure 3. Workflow and expected outcomes for endogenous gene tagging with the SEC or NSEC strategies . ( A ) The SEC and NSEC strategies use identical workflows to generate endogenous knock-ins with the exception that the SEC can interfere with endogenous gene function prior to excision. ( B ) Schematic diagrams of SEC and NSEC architectures and expected outcomes for endogenous knock-ins in different locations within a gene. The SEC includes a let-858 3’UTR with a strong transcriptional terminator that is appended to the fluorescent protein prior to excision. N-terminal and internal tags using the SEC are expected to result in loss of endogenous gene function prior to SEC excision. The NSEC is embedded entirely within a synthetic intron and includes no splice acceptors, stop codons, or transcriptional terminators in the same orientation as the gene of interest. NSEC knock-ins in any location within a gene are expected to retain endogenous gene expression and function prior to NSEC excision. Table 1. Plasmids for NSEC-based endogenous gene tagging . Names, descriptions, and Addgene accession numbers for NSEC plasmids for gene tagging with codon-optimized mTurquoise2, GFP, mStayGold, mNeonGreen, or mScarlet-I. Supplemental Information Supplemental Note 1 . ( A ) Modifications in the NSEC coding and regulatory sequences relative to the SEC. ( B ) Annotated sequence for pTG611 (mNG::AID^NSEC^linker). Table S1. Resources and Reagents . Supplemental File 1. NSEC plasmid sequence files . Single .zip file containing sequences for NSEC backbone plasmids and mNG::AID^NSEC^mpk-1 homologous repair template plasmid. Figshare link: https://doi.org/10.6084/m9.figshare.28893263.v1 Supplemental Information including Supplemental Note 1 – Annotated NSEC sequence features Table S1 – Resources and Reagents Supplemental File 1 – Plasmid sequences (.zip) Supplemental Note 1 (A) Nucleotide substitutions in the NSEC coding and regulatory sequences relative to the SEC Sequences are shown in the orientation present in the NSEC. Nucleotides that were edited to eliminate sense strand splice acceptors or restriction sites are shown in bold. Download figure Open in new tab Download figure Open in new tab (B) Annotated sequence for pTG611 (mNG::AID^NSEC^linker) Download figure Open in new tab Download figure Open in new tab View this table: View inline View popup Download powerpoint Table S1. Resources and Reagents Supplemental File 1. NSEC plasmid sequence files . Single .zip file containing sequences for NSEC backbone plasmids and mNG::AID^NSEC^mpk-1 homologous repair template plasmid. Figshare: https://doi.org/10.6084/m9.figshare.28893263.v1 Acknowledgements This research was funded by National Institute of General Medical Sciences grant R35GM142880 (AMP) and Eunice Kennedy Schriver National Institute of Child Health and Human Development fellowship F31HD112152 (TVG). The wild-type N2 strain was provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). Funder Information Declared National Institute of General Medical SciencesNational Institute of General Medical Sciences, , R35GM142880 Eunice Kennedy Shriver National Institute of Child Health and Human DevelopmentEunice Kennedy Shriver National Institute of Child Health and Human Development, , F31HD112152 References ↡ Adjobo-Hermans , M. J. , J. Goedhart , L. van Weeren , S. Nijmeijer , E. M. Manders et al. , 2011 Real-time visualization of heterotrimeric G protein Gq activation in living cells . BMC Biol 9 : 32 . OpenUrl CrossRef PubMed ↡ Aghayeva , U. , A. Bhattacharya , S. Sural , E. Jaeger , M. Churgin et al. , 2021 DAF-16/FoxO and DAF-12/VDR control cellular plasticity both cell-autonomously and via interorgan signaling . PLoS Biol 19 : e3001204 . OpenUrl CrossRef PubMed ↡ Armenti , S. T. , L. L. Lohmer , D. R. Sherwood and J. Nance , 2014 Repurposing an endogenous degradation system for rapid and targeted depletion of C . elegans proteins. Development 141 : 4640 – 4647 . OpenUrl PubMed ↡ Bendezu , F. O. , V. Vincenzetti , D. Vavylonis , R. Wyss , H. Vogel et al. , 2015 Spontaneous Cdc42 polarization independent of GDI-mediated extraction and actin-based trafficking . PLoS Biol 13 : e1002097 . OpenUrl CrossRef PubMed ↡ Brunak , S. , J. Engelbrecht and S. Knudsen , 1991 Prediction of human mRNA donor and acceptor sites from the DNA sequence . J Mol Biol 220 : 49 – 65 . OpenUrl CrossRef PubMed Web of Science ↡ Choy , E. , V. K. Chiu , J. Silletti , M. Feoktistov , T. Morimoto et al. , 1999 Endomembrane trafficking of ras: the CAAX motif targets proteins to the ER and Golgi . Cell 98 : 69 – 80 . OpenUrl CrossRef PubMed Web of Science ↡ Clarke , S. , 1992 Protein isoprenylation and methylation at carboxyl-terminal cysteine residues . Annu Rev Biochem 61 : 355 – 386 . OpenUrl CrossRef PubMed Web of Science ↡ Dickinson , D. J. , and B. Goldstein , 2016 CRISPR-Based Methods for Caenorhabditis elegans Genome Engineering . Genetics 202 : 885 – 901 . OpenUrl Abstract / FREE Full Text ↡ Dickinson , D. J. , A. M. Pani , J. K. Heppert , C. D. Higgins and B. Goldstein , 2015 Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette . Genetics 200 : 1035 – 1049 . OpenUrl Abstract / FREE Full Text ↡ Dickinson , D. J. , J. D. Ward , D. J. Reiner and B. Goldstein , 2013 Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination . Nat Methods 10 : 1028 – 1034 . OpenUrl CrossRef PubMed Web of Science ↡ Ghanta , K. S. , and C. C. Mello , 2020 Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans . Genetics 216 : 643 – 650 . OpenUrl Abstract / FREE Full Text ↡ Gibney , T. V. , M. Favichia , L. Latifi , T. N. Medwig-Kinney , D. Q. Matus et al. , 2023 A simple method to dramatically increase C . elegans germline microinjection efficiency. Dev Biol 502 : 63 – 67 . OpenUrl PubMed ↡ Gibney , T. V. , J. I. Mardick , N. R. Rasmussen , L. Latifi , M. V. Sundaram et al. , 2025 FGF-dependent, polarized SOS activity orchestrates directed migration of C. elegans muscle progenitors independently of canonical effectors in vivo . bioRxiv : 2025.2004.2011.648432. ↡ Hebsgaard , S. M. , P. G. Korning , N. Tolstrup , J. Engelbrecht , P. Rouze et al. , 1996 Splice site prediction in Arabidopsis thaliana pre-mRNA by combining local and global sequence information . Nucleic Acids Res 24 : 3439 – 3452 . OpenUrl CrossRef PubMed Web of Science ↡ Keeley , D. P. , E. Hastie , R. Jayadev , L. C. Kelley , Q. Chi et al. , 2020 Comprehensive Endogenous Tagging of Basement Membrane Components Reveals Dynamic Movement within the Matrix Scaffolding . Dev Cell 54 : 60 – 74 e67 . OpenUrl CrossRef PubMed ↡ Merritt , C. , D. Rasoloson , D. Ko and G. Seydoux , 2008 3’ UTRs are the primary regulators of gene expression in the C . elegans germline. Curr Biol 18 : 1476 – 1482 . OpenUrl CrossRef PubMed ↡ Oldenbroek , M. , S. M. Robertson , T. Guven-Ozkan , C. Spike , D. Greenstein et al. , 2013 Regulation of maternal Wnt mRNA translation in C . elegans embryos. Development 140 : 4614 – 4623 . OpenUrl PubMed ↡ Paix , A. , A. Folkmann , D. Rasoloson and G. Seydoux , 2015 High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes . Genetics 201 : 47 – 54 . OpenUrl Abstract / FREE Full Text ↡ Paix , A. , Y. Wang , H. Smith , C. Y. Lee , D. Calidas et al. , 2014 Scalable and Versatile Genome Editing Using Linear DNAs with Micro-homology to Cas9 Sites in Caenorhabditis elegans . Genetics . ↡ Rasmussen , N. R. , and D. J. Reiner , 2021 Nuclear translocation of the tagged endogenous MAPK MPK-1 denotes a subset of activation events in C. elegans development . J Cell Sci 134 . ↡ Roberts , P. J. , N. Mitin , P. J. Keller , E. J. Chenette , J. P. Madigan et al. , 2008 Rho Family GTPase modification and dependence on CAAX motif-signaled posttranslational modification . J Biol Chem 283 : 25150 – 25163 . OpenUrl Abstract / FREE Full Text ↡ Schindelin , J. , I. Arganda-Carreras , E. Frise , V. Kaynig , M. Longair et al. , 2012 Fiji: an open-source platform for biological-image analysis . Nat Methods 9 : 676 – 682 . OpenUrl CrossRef PubMed Web of Science ↡ Snapp , E. , 2005 Design and use of fluorescent fusion proteins in cell biology . Curr Protoc Cell Biol Chapter 21 : 21 24 21 – 21 24 13 . OpenUrl ↡ Sohr , A. , L. Du , R. Wang , L. Lin and S. Roy , 2019 Drosophila FGF cleavage is required for efficient intracellular sorting and intercellular dispersal . J Cell Biol 218 : 1653 – 1669 . OpenUrl Abstract / FREE Full Text ↡ Sternberg , P. W. , K. Van Auken , Q. Wang , A. Wright , K. Yook et al. , 2024 WormBase 2024: status and transitioning to Alliance infrastructure . Genetics 227 . ↡ Stiernagle , T. , 2006 Maintenance of C. elegans . WormBook : 1 – 11 . ↡ Sundaram , M. V. , 2013 Canonical RTK-Ras-ERK signaling and related alternative pathways . WormBook : 1 – 38 . ↡ Thompson , B. E. , L. B. Lamont and J. Kimble , 2006 Germ-line induction of the Caenorhabditis elegans vulva . Proc Natl Acad Sci U S A 103 : 620 – 625 . OpenUrl Abstract / FREE Full Text ↡ Wall , M. A. , D. E. Coleman , E. Lee , J. A. Iniguez-Lluhi , B. A. Posner et al. , 1995 The structure of the G protein heterotrimer Gi alpha 1 beta 1 gamma 2 . Cell 83 : 1047 – 1058 . OpenUrl CrossRef PubMed Web of Science ↡ Ward , J. D. , 2015 Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co-conversion and inactivation of NHEJ repair . Genetics 199 : 363 – 377 . OpenUrl Abstract / FREE Full Text ↡ Zhao , P. , Z. Zhang , H. Ke , Y. Yue and D. Xue , 2014 Oligonucleotide-based targeted gene editing in C . elegans via the CRISPR/Cas9 system. Cell Res 24 : 247 – 250 . OpenUrl View the discussion thread. Back to top Previous Next Posted May 01, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Engineering the C. elegans genome with a nested, self-excising selection cassette Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Engineering the C. elegans genome with a nested, self-excising selection cassette Theresa V Gibney , Ariel M Pani bioRxiv 2025.05.01.651742; doi: https://doi.org/10.1101/2025.05.01.651742 Share This Article: Copy Citation Tools Engineering the C. elegans genome with a nested, self-excising selection cassette Theresa V Gibney , Ariel M Pani bioRxiv 2025.05.01.651742; doi: https://doi.org/10.1101/2025.05.01.651742 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17690) Bioengineering (13892) Bioinformatics (41936) Biophysics (21451) Cancer Biology (18588) Cell Biology (25499) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88603) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15152) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source β€” PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

βš™ Ask this paper AI returns verbatim quotes from the full text Β· source: preprint-html β“˜

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (sparse)

Too few in-corpus citations on either side for a chart; here are the lists.

Cited by (1)

Cited by (1)

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00