Butyric acid alleviates LPS-induced intestinal mucosal barrier damage by inhibiting RhoA/ROCK2/MLCK signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Butyric acid alleviates LPS-induced intestinal mucosal barrier damage by inhibiting RhoA/ROCK2/MLCK signaling pathway Luqiong Liu, Tong Chen, Zhenrong Xie, Yongjin Zhang, Chenglu He, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3369797/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Bacground and Aim Butyric acid (BA), as a short-chain fatty acid, can improve intestinal barrier function, meanwhile intestinal mucosal epithelial injury is a common clinical phenomenon, especially in children. Moreover, RhoA/ROCK2/MLCK signaling pathway has been confirmed to play a vital role in the maintenance of intestinal epithelial permeability. However, the specific mechanism by which BA protects intestine mucosal barrier still needs to be clarified. This study intended to investigate the effect of BA in LPS-induced Caco2 cells, and determine whether BA protected epithelial barrier by inhibiting the RhoA/ROCK2/MLCK signaling pathway. Methods The optimal concentration and intervention time of the protective effect of BA on Caco2 were investigated by CCK-8 assay. On this basis of the above results, the damaged effect of LPS to Caco2 cells near the optimal time of BA protection was explored, then the optimal time and concentration were explored when BA and LPS were simultaneously administrated to Caco2 cells, the data were used to conduct further study. Then, cell growth status was observed, TEER and FD-4 permeability of monolayer barrier of Caco2 cells were detected, the mRNA expression of ZO-1 and Occludin, RhoA, ROCK2 and MLCK was detected by RT-qPCR. Moreover, immunofluorescence staning was adopted to observe the expression and distribution of ZO-1, Occludin, as well as RhoA, ROCK2 and MLCK in Caco2. After that, RhoA/ROCK2/MLCK pathway inhibitor Y-27632 was added to Caco2 cells, the cell growth status, TEER and FD-4 permeability of monolayers barrier, the expression level and distribution of ZO-1 and Occludin, RhoA, ROCK2 and MLCK in Caco2 cells were detected. Results The final concentration of 0.2mM BA action for 24 h had the greatest effect on the viability of Caco2 cells. After Caco2 cells exposure to LPS for 24 h, the final concentration of 5ug/ml LPS significantly decreased the viability of Caco2 cells. When combined with BA and LPS, compared with LPS alone, BA improved the growth state of Caco2 cells, restored the declined TEER, and reduced FD-4 permeability, as well as improved the mRNA expression of ZO-1, Occludin and inhibited the mRNA expression of RhoA, ROCK2 and MLCK, the expression and distribution of ZO-1, Occludin, RhoA, ROCK2 and MLCK were reversed in Caco2 cells. After treatment of Y-276432, the cell growth state and mucosal barrier function were further improved, the mRNA expression of ZO-1 and Occludin was further increased, the mRNA expression of RhoA, ROCK2 and MLCK was further decreased, and the expression and distribution of these proteins in Caco2 cells were further reversed. Conclusion This study provided complementary data for BA as a potential target for attenuating intestinal barrier injury induced by LPS through inhibiting the RhoA/ROCK2/MLCK signaling pathway, supporting a further research on BA protection intestinal barrier from damage and as a new therapeutic method. Butyric acid LPS Caco2 cells ZO-1 Occludin RhoA/ROCK2/MLCK pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Epithelial barrier hypothesis, which constitutes the first line of mechanical, physical, chemical, and immunologic defenses against environmental factors, has been widely accepted by many scholars[1]. Duo to intact barriers, host tissue was protected from infections, environmental toxins, pollutants and allergens, which leading to host imbalance. With urbanization and socioeconomic development, more and more harmful material are generated, which disrupting the physical integrity of the barrier[2]. Moreover, leakiness of the gut epithelium is also related to diabetes, systemic lupus erythematosus, and so on. In addition, some diseases, such as Parkinson disease, are suspected to be associated with distant inflammatory responses due to a 'leaky gut' and microbiome changes[3]. The intestinal microbiome includes bacteria, viruses and fungi, and related metabolites including vitamins, secondary bile acids, short-chain fatty acids and many other bioactive mediators. The correlation between intestinal flora, microbial metabolites and intestinal barrier affects the occurrence and development of diseases[4]. Compared with adults, children have thin intestinal walls, abundant blood vessels, tender mucosa, and lower intestinal flora than adults, and are easily affected by the external environment, resulting in flora imbalance and intestinal mucosal damage[5]. Some chronic intestinal conditions, such as celiac disease and inflammatory bowel diseases, are related to disturbance of dynamic and versatile microbial community of gastrointestinal tract. In addition, metabolites derived from microbiota play a vital role in health[6]. Therefore, essential dietary supplement such as dietary fibers, may change microbial metabolites and restore gut epithelial barrier, further to be beneficial to intestinal and systemic homeostasis, ameliorate associated diseases and improve prognosis. Butyric acid (BA) is the main metabolite of metamicutes, which can be absorbed and utilized by colon epithelial cells and is the main source of energy for colon and cecum[7]. At low concentrations, BA could promote colon mucosal epithelial cells proliferation and improve the tightness of epithelial cell connections[8]. Reducing intestinal permeability has represented a potential therapy through short chain fatty acid supplementationin in a variety of liver disease models[9]. Acute or chronic enteritis, ulcerative colitis, shock, trauma, high-fat diet, leukemia, pneumonia and other diseases can lead to intestinal mucosal barrier damage, as well as the intestinal epithelial cells. Tight junctions are vital for building the epithelial barrier and maintaining epithelial polarity[10], are the basis of the intestinal mucosal mechanical barrier, which can prevent the invasion of pathogens and harmful substances, and is vital to maintain the stability of the internal environment[11]. The flux of noxious molecules from lumen results in disruption of the intestinal TJ barrier and induces mucosal inflammation. So it is to worthy to explain the roles of extracellular factors to the intestinal TJ barrier[12]. The restoration of the intestinal barrier has important therapeutic value in both local and systematic diseases, regardless of the cause or effect of intestinal epithelial injury[13]. LPS-induced diarrhea in mice was alleviated by sodium butyrate via enriching beneficial bacterium and declining pathogens, which were involved in maintaining the epithelial barrier function[14]. Lipopolysaccharide (LPS) could reduce the expression of cingulin (Zona-1, ZO-1) and Occludin, increase intestinal mucosal barrier permeability. It has been used by many studies to form damaged cellular or animal models of intestinal mucosal barrier[15]. Under normal culture conditions, Caco2 cells can spontaneously form a monolayer with upper and lower polarity, which is similar to the differentiation characteristics of intraluminal mucosal epitheliumon. LPS-induced Caco-2 cells have been widely used as a model to evaluate human intestinal mucosal barrier function in vitro[16]. After the treatment of Caco2 cells by LPS, TEER value decreased, FITC-dextran permeability increased, and Occuludin, ZO-1 and claudin5 expression levels decreased[17]. These and other data have resulted in the view that BA protects the intestine barrier while LPS effects adverse role. Studies have confirmed that ROCK and myosin light chain kinase (MLCK) are involved in the regulation of tight junction protein in the process of intestinal inflammation, and participate in the pathogenesis of irritable bowel syndrome and other diseases[13]. Zearalenone was confirmed to induce intestinal barrier damage by activating the RhoA/ROCK signaling pathway to lead to increased FD-4 passage and significantly reduced TEER. Meanwhile, it could induce the significantly up-regulation of MLCK and down-regulation of occludin, claudin-1, ZO-1, and claudin-3, as well as relocation of ZO-1 in IPEC-J2 Cells [18]. In another study, on bEnd.3 brain endothelial cells, MLCK inhibitor ameliorated the downregulation of ZO-1 and increased permeability of brain endothelial monolayer induced by OGD/R[19]. Procyanidins was verified to maintain normal intestinal barrier functions by inhibiting MLCK, which is similar to the MLCK inhibitor in acrylamide-induced Caco-2 cell monolayer membrane in the third study[20]. In view of the evidence above, whether RhoA/ROCK2/MLCK pathway is associated to the specific role of BA in LPS-induced intestinal damage is deserved to be explored. In this study, we explored the optimal concentration and intervention time of BA to protect Caco2, and based on this, explored the damage of Caco2 cells by LPS, and later concluded the optimal time and concentration of BA and LPS when they were administrated to Caco2 cells together. Then, the effects of BA and LPS on the growth status of Caco2 cells, barrier permeability and tight junction protein expression were further studied, as well as the role of RhoA/ROCK2/MLCK signaling pathway in BA protection Caco2 cells from injury caused by LPS.We hypothesize that BA alleviates the intestine mucosal epithelium induced by LPS through inhibiting the activation of RhoA/ROCK2/MLCK signaling pathway, thus providing an important theoretical basis for BA effecting on LPS-induced barrier damage and the new clinical therapeutic schemes of intestinal injury. Materials and methods Cell culture Human epithelial Caco-2 cells were provided by Kunming Cell Bank, Typical Culture Preservation Committee, Chinese Academy of Sciences, and were grown in Dulbecco’s modified Eagle medium (DMEM)/F12 (C11330500BT, Gibco) containing 10% FBS (F8318-500ml, Sigma) and 50 U/mL penicillin–streptomycin and incubated in a humidified chamber of 5% CO2 at 37°C (PHCbi, MCO-18AC, USP No.6244103). When the cell density reached 80–90%, the original culture medium was sucked out, the cells were washed twice with PBS and digested with 0.25%EDTA (25200056, Gibco) pancreatic enzyme. After adjusting the cell density, the cells were inoculated on the cell culture plate and cultured until the cells were stable and attached to the wall. Experimental groups For drug intervention in vitro, PBS (BL302A, biosharp) was used to dissolve LPS (L4319, Sigma), as well as diluent butyric acid (107-92-6, DR.EHRENSTORFER) and Y-27632 (GC15712, GLPbio). To detect the optimal concentration and time of BA and LPS in Caco2 cells, different concentration of BA and LPS were treated for different time in cells. To evaluate the effect of BA on LPS-induced Caco2 cells, the cells were divided into four groups: control group, BA group, BL group and LPS group. To further verify the role of RhoA/ROCK2/MLCK pathway in protective effect of BA in LPS-induced cells, Caco2 cells were divided into four group: control + Y-27632 group, BA + Y-27632 group, BL + Y-27632 group and LPS + Y-27632 group. In these groups, cells were incubated with 10 uM Y-27632 and BA or LPS. Additionally, an equal volume of PBS was used as a control vehicle.The cell experimental treatments and groupings are shown in Table 1 . Table 1 Experimental treatments and groupings Grouping Treatment BA affects the cell viability BA 0mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 0.05mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 0.1mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 0.2mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 0.5mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 1.0mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 2.0mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 5.0mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 10.0mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively BA 20.0mM intervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively LPS affects the cell viability LPS intervention for 18 h 0, 0.2, 0.5, 1.0, 2.0, 5.0, 10, 20, 50 and 100 ug/ml, respectively LPS intervention for 24 h 0, 0.2, 0.5, 1.0, 2.0, 5.0, 10, 20, 50 and 100 ug/ml, respectively LPS intervention for 36 h 0, 0.2, 0.5, 1.0, 2.0, 5.0, 10, 20, 50 and 100 ug/ml, respectively BA and LPS commonly affects cell viability LPS 0ug/ml 0.2mM BA intervention for 24 h LPS 2ug/ml 0.2mM BA intervention for 24 h LPS 5ug/ml 0.2mM BA intervention for 24 h LPS 10ug/ml 0.2mM BA intervention for 24 h LPS 20ug/ml 0.2mM BA intervention for 24 h LPS 50ug/ml 0.2mM BA intervention for 24 h BA affects LPS-induced Caco2 cells control group cultured in normally medium BA group 0.2 mM BA in the medium for 24 h BL group 0.2 mM BA + 5 ug/ml LPS in the medium for 24 h LPS group 5 ug/ml LPS in the medium for 24 h BA alleviates the epithelial damage through the RhoA/ROCK2/MLCK signaling pathway in LPS-induced Caco2 cells control + Y−27632 group 10 uM Y−27632 in the medium for 24 h BA + Y−27632 group 0.2 mM BA + 10 uM Y−27643 in the medium for 24 h BL + Y−27632 group 0.2 mM BA + 5ug/ml LPS + 10 uM Y−27643 in the medium for 24 h LPS + Y−27632 group 5ug/ml LPS + 10 uM Y−27643 in the medium for 24 h Cell viability The Cell Counting Kit-8 assay (GK10001, GLPbio, USA) was adopted to assess Caco2 cells viability. The cells were inoculated into 96-well plates and cultured according to experimental groups. According to the instructions of the CCK8 kit, each well was treated with 100ul serum-free medium supplementing 10% CCK-8 and incubated at 37℃ for 2h in the dark. The OD absorbance at 450 nm was detected by a microplate reader after mixing. The results of cell proliferation activity were calculated as follows: Cell activity (%) =[A(dosing)-A (blank)]/[A(0 dosing)-A (blank)]x100. Where A (dosing) represents the OD absorbance of the well with culture medium, cells, drug and CCK-8, A (0 dosing) refers to the OD absorbance of the well with culture medium, cells and CCK-8, and A (blank) refers to the OD absorbance of the well with culture medium and CCK-8. Trans-epithelial electrical resistance (TEER) measurements According to the experimental group, TEER was measured 24 hours after intervention of relevant factors by using an epithelial voltohmmeter ERS-2 (Millicell-ER-2,Millipore MERS00002, USA). Before the measurement, the system function test is performed and the STX01 electrode is prepared. After that, the electrode was immersed in 70% ethanol for 15 minutes, the electrode was removed and air dried for 15 seconds, and the electrode was washed with PBS. The cells were placed at room temperature for balance for 30 minutes, then ensured that the meter was disconnected from the charger, the mode was turned ON to Ohms, and the switch was turned on. The short end of the electrode was immersed in the inside of the culture plate and the long end was immersed in the outside of the culture plate. The short end should not touch the cells growing on the small chamber membrane, and the long end should touch the bottom of the external hole plate. Electrical resistance of similar values on three consecutive measurements was recorded, the average value was taken. Values were corrected for background resistance and calculated as Ω. cm2. The final TEER = (R1-R0) xA, where R1 represents TEER of Caco2 cells inoculated in each group, R0 represents TEER of the blank control group (TEER of uninoculated cells), and A represents the mask area at the bottom of the cell. Paracellular marker FD-4 (FITC-Dextran 4 kDa) flux measurements Paracellular permeability was evaluated via FD-4 (60842-46-8, MedChemExpress) flux. Caco-2 cells (1x10 4 /200uL) were seeded into the upper chamber of 24-well Transwell system (3470, costar, Corning) and 1.5ml fresh medium was added into the lower chamber. After the Caco2 cells were inoculated and stuck to the wall statically, the medium was changed every other day to form monolayers. After intervention with BA, LPS and Y-27632, cells were incubated for 24 h in the upper chamber, the medium was sucked out, the upper chamber was supplemented with serum-free medium, which contained FD-4 with a final concentration of 1mg/mL, and 1mL serum-free medium was replaced into the lower chamber, which was placed back in the cell incubator, incubated at 37℃ for 2h, and then 100ul was absorbed from the lower chamber to the fluorescein enzyme labeled instrument for detection (Victor Nivo, PerkinElmer). The flux of FITC-dextran was calculated from the standard curve of diluents with known concentration gradients. Real-time quantitative PCR After the cells were removed, the old medium was discarded and cleaned once with PBS. The total RNA of Caco2 cells with different factors was extracted according to the instructions of TRIZOL reagent (15596026, Invitrogen, Carlsbad, CA, USA), and the total RNA concentration and purity were determined by ultramicrospectrophotometer (NanoDrop 2000/2000c Spectrophotometer, ThermoScientific). cDNA was prepared by RevertAid First Strand cDNA kit (91258333, Thermo Scientific) using 2ug total RNA as template in gene amplification apparatus (Thermal Cycler T960, Heal Force). Using cDNA as template, SYBR Green fluorescent dye (D7262, Beyotime) was used for relative quantification by real-time quantitative PCR on a 7500 fast real-time PCR system (QuantStudio TM 5, Life Technologies Holding Pte Ltd) in line with the manufacturer’s protocol. A 20ul reaction system was adopted, with 2ul cDNA template, 6.0ul enzyme-free water, 10ul SYBR Premix fluorescence quantitative reaction reagent, and 1.0ul upstream and downstream primers. Reaction condition: predenaturation at 95℃ for 2 minutes; PCR reaction stage: denaturation at 95℃ for 15 seconds, annealing at 60℃ for 10 seconds, extension at 72℃ for 20 seconds, repeated denaturation, annealing and extension, a total of 40 cycles; The dissolution curves are 95℃15 s, 60℃60 s, 95℃15 s. The primer sets were listed in Table 2 . The target gene was GAPDH and the results were calculated by 2-ΔΔCt formula. Relative expression was normalized and expressed as a fold change to the expression level in control group. Table 2 Primer for qRT-PCR Genes Primer for qRT-PCR Reverse sequence (5′–3′) GAPDH CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT ZO−1 ACCAGTAAGTCGTCCTGATCC TCGGCCAAATCTTCTCACTCC Occldin ACAAGCGGTTTTATCCAGAGTC GTCATCCACAGGCGAAGTTAAT RhoA AAGAGGCTGGACTCGGATTCGT CCACAGGCTCCATCACCAACAAT ROCK2 TCCCGATAACCACCCCTCTT CCAAGGAATTTAAGCCATCCACT MLCK CCCGAGGTTGTCTGGTTCAAA GCAGGTGTACTTGGCATCGT Immunofluorescence analysis Caco2 cells were fixed with 4% paraformaldehyde (BL539A, Biosharp) for 10min, then washed with PBS three times for 5 min, permeabilized with 1% Triton X-100 (T8200, Solarbio, China) for 10 min and sealed with 10% goat serum (SL038, Solarbio) at 37°C, and then incubated overnight with rabbit primary antibodies, ZO-1 (ab96587,1:500, Abcam), Occludin (27260-1-AP, 1:500, Proteintech), RhoA(10749-1-AP, 1:500, Proteintech), ROCK2༈20248-1-AP, 1:100, Proteintech, China), MLCK༈21642-1-AP, 1:100, Proteintech༉at 4°C. After three times of PBS washing, the cells were incubated at room temperature with fuorescence-labeled secondary antibodies (ab150081, 1:1000, Abcam) for 1 h. Subsequently, 6-diamino-2-phenylindole (DAPI, P0131, Beyotime, China) was used to staine Nuclei in a dark environment. Images were taken with a fuorescence microscope (N-SIM/C2si, Nikon, Japan). Statistical analysis GraphPad Prism 9.0 (GraphPad Software, USA) was used for data collation, statistics, analysis and plotting. The measurement data of normal distribution were presented as mean ± SD. Analysis of variance of factorial design was used and followed by Tukey’s multiple comparison test. P < 0.05 was considered statistically significant. Results The optimal concentration and intervention time of BA and LPS on Caco2 cells A CCK8 assay was used to research the effect of BA and LPS on the cell viability of Caco2 cells to form the in vitro model. As shown in Fig. 1 A, the Caco2 cells were treated with different final concentration of BA (0, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 mM) for 0, 6, 12, 18, 24, 30 and 36 h, respectively. Compared with 0 mM BA group, the cell viability of 0.05, 0.1, 0.2, 0.5 and 1 mM BA groups increased with the increase of BA concentration, however the cell viability of 2, 5, 10 and 20 mM BA groups decreased with the increase of BA concentration. BA could improved the viability of cells after it intervented only for 6 h. With the extension of the treatment time, the viability of cells was gradually enhanced, and the effect reached the top at 24 h after treatment, after which the cell viability gradually decreased. Thus, the cell model was created using 0.2 mM BA for 24 h. The effects of LPS at differently final concentrations for 18, 24 and 36 h on the viability of Caco2 cells were further observed. As shown in Fig. 1 B, the viability of Caco2 cells was reduced more and more significantly with increased concentrations of LPS, and the IC50 of LPS fluctuated in the range of 2–50 ug/ml. When the final concentration of LPS was greater than 5 ug/ml, the cell viability decreased significantly with the extension of the treatment time, moreover, the effect was obviously significant at 24 h after treatment. On the basis of the above results, BA with a final concentration of 0.2mM and LPS with different concentrations (2, 5, 10, 20 and 50 ug/ml, respectively) were simultaneously administrated to Caco2 cells for 24 h. As shown in Fig. 1 C, the IC50 of LPS increased significantly when BA was present, suggesting that BA could inhibit the cell damage caused by LPS. The protective effect of BA was relatively stable when the concentration of LPS was 2–10 ug/ml. When the concentration of LPS was greater than 10 ug/ml, the protective effect of BA decreased significantly. Therefore, 0.2 mM BA and 5 ug/ml LPS intervention for 24 h were used to create the cells model in vitro in follow-up experiments. BA attenuated the epithelial barrier injury induced by LPS in Caco2 cells As shown in Fig. 2 A, the administrated BA improved the growth status of cells. After 24 h treatment with BA or LPS, compared with 0 h treatment, the cells in control group and BA group had close connections and clear boundaries, and the cells in BA group were more obvious, and the cell growth was good. The cells in BL group and LPS group had shrunken, unclear boundaries, separation from surrounding cells, and poor growth, especially in LPS group. Compared with control group, the cells in BA group were more closely connected and had better growth status, while the cells in BL group and LPS group shrank and had unclear boundaries and poor growth status, and the cell status of LPS group was more severe. Subsequently, epithelial barrier function was evaluated by TEER and by FD-4 flux through the monolayer on the transwell membrane after BA and LPS. As shown in Fig. 2 B, TEER in LPS group was significantly reduced compared with control group, meanwhile, compared with BL group. It shows that BA can relieve the increased permaebility of Caco2 cells barrier. After 24 h of treatment with BA and LPS, there was no significance between BA group and control group (1718.000 ± 2.000 Ω.cm 2 vs. 1720.000 ± 1.000Ω.cm 2 , P > 0.05 ). Compared with control group, TEER of BL group (1464.667 ± 7.572 Ω.cm 2 ) showed a sharp decrease ( P < 0.0001), moreover, it was more serious ( P < 0.0001) in LPS group (1123.667 ± 4.041Ω.cm 2 ). TEER value of LPS group showed an obvious decrease compared to that in BL group ( P < 0.0001). Figure 2 C showed that compared with the concentration of FD-4 in control group (4.594 ± 0.015 ug/ml), the concentration of FD-4 in BA group (3.048 ± 0.064 ug/ml) decreased, however, increased concentration of FD-4 in BL group (7.080 ± 0.006 ug/mL) was found, moreover, and more significant increase in LPS group (8.821 ± 0.013 ug/mL) was showed. The concentration of FD-4 more significantly in the LPS group compared to that in BL group. These results indicate that BA mitigates LPS-induced decline in TEER and increase in FD-4 flux of Caco2 cell barrier to improve the epithelial barrier. ZO -1 and Occludin play an important role in intestine barrier, they form a continuous and circumferential structure at the boundary in epithelial cells, which are important for the exchange of substances, therefore, they are considered as useful biomarkers to reflect the epithelial barrier function[21]. To examine the mechanisms by which BA modifies epithelial function, the change of tight junction protein ZO-1 and Occludin was evaluated by RT-qPCR and immunofluorescent staining. As shown in Fig. 2 D, after 24 h of intervention with BA and LPS, compared with the control group, the expression of ZO-1 mRNA in BA group was increased, the expression of ZO-1 mRNA in BL group was decreased, and the expression of ZO-1 mRNA in LPS group was also decreased. The expression of ZO-1 mRNA in BL group was higher than that in LPS group. Figure 2 E showed that compared with control group, the Occludin mRNA expression increased in BA group, while higher Occludin mRNA expression was showed in BL group and decreased LPS group. The mRNA expression of Occludin in BL group was higher than that in LPS group. ZO-1 and Occludin mRNA expression were significantly down-regulated after LPS exposure, meanwhile, BA enhanced ZO-1 and Occludin mRNA expression after LPS exposure. Our data in Fig. 2 F showed that ZO-1 and Occludin were observed as a clear, continuous and organized net pattern surrounding the plasma membrane constituting a cell-cell junction in the control group and BA group, especially in BA group. After 24 h of LPS exposure, Caco2 cells presented depletion of ZO-1 and Occludin in several sites with a loose and discontinuous net pattern, which presented as apparently serrated or notched and fissured in BL group and LPS group, especially in LPS group. In addition, cytoplasmic accumulation of ZO-1 and Occludin in some regions were observed in BL group and LPS group, however, the presence of BA alleviated the alteration of ZO-1 and Occludin. These data suggests that the integrity of tight junction has been changed with a redistribution of ZO-1 and Occludin after LPS and BA exposure. In agreement with functional changes in barrier permeability, LPS administration observably decrease the expression of ZO-1 and Occludin, as well as modulated the reconstruction of continuous and integrated band pattern of ZO-1 and Occludin, while BA reversed LPS-induced abnormal alterations in expression and structures of ZO-1 and Occludin, hinting that tight junction is necessary for protection by BA. BA affects the RhoA/ROCK2/MLCK signaling pathway in LPS-induced Caco2 cells Subsequently, we investigated the role of BA in potential signaling pathway. Since RhoA/ROCK2 and MLCK has been reported to play a pivotal role in intestine barrier function, plays a vital role in the regulation of epithelial tight junctions and paracellular leakage pathways[22–23]. We further investigated involvements of the pathway in LPS-induced Caco2 cells and BA-prevented cells. As shown in Fig. 3 A, after 24 h treatment with BA and LPS, the RhoA mRNA expression in BA group was decreased, while the expression of RhoA mRNA in BL group and in LPS group was increased, compared to that in control group. The expression of RhoA mRNA in BL group was lower than that in LPS group. As shown in Fig. 3 B, compared with control group, the expression of ROCK2 mRNA in BA group was decreased. However, the expression of ROCK2 mRNA in BL group and in LPS group was increased. Moreover, the mRNA expression of ROCK2 showed a significant lower tread in BL group than that in LPS group. Figure 3 C showed that compared with control group, the MLCK mRNA expression in BA group was decreased, the MLCK mRNA expression in BL group and LPS group was increased. The MLCK mRNA expression in BL group was lower than that in LPS group. Compared with control group, the mRNA expression of RhoA, ROCK2 and MLCK increased in LPS group. However, the expression changes of these mRNA were partly abolished by BA treatment. What , s more, immunofluorescence stainning in Fig. 3 D showed that, in the control group and BA group, RhoA was mainly distributed in the cell membrane and cytoplasm, the expression of RhoA was significantly increased after LPS stimulation, and moved to the nucleus, so the expression was increased in the nucleus. The expression of RhoA in BL group was lower than that in LPS group, and RhoA mainly distributed in perinuclear and cytoplasm. ROCK2 was mainly distributed around cytoplasm and nucleus, the expression of ROCK2 was significantly increased after LPS stimulation, and its distribution around cell membrane and in nucleus was significantly increased. BA decreased the expression of ROCK2 induced by LPS, and decreased its distribution in perimembrane and nucleus. In control group and BA group, MLCK was mainly distributed in the cytoplasm and nucleus. After LPS exposure, the expression of MLCK was significantly increased and moved to the cell membrane, and the expression level around the cell membrane was significantly increased. LPS stimulation increased expression of RhoA, ROCK2 and MLCK in Caco2 cells, and changed the distribution of them in cells, while BA decreased the expression of them and reversed the subcellular localization of them. Take together, BA may improved the barrier function of Caco2 cells through inhibiting the RhoA/ROCK2/MLCK pathway. Y-27632 treatment enhanced the protective role of Butyric acid in LPS-induced Caco2 cells Finally, due to an important role of RhoA/ROCK2/MLCK pathway involved in epithelial injury in LPS-induced Caco2 cells as previously mentioned, the Caco2 cells were additionally treated with Y-27632, the inhibitor of ROCK, to further explore whether RhoA/ROCK2/MLCK pathway is an indispensable pathway by which BA exerted its protective effects on barrier injury in LPS-induced Caco2 cells. Firstly, as exhibited in Fig. 4 A, the cells in the control + Y-27632 and BA + Y27632 group had tight connections, clear boundaries and good cell growth, similar to that without Y-27632 after the intervention of Y-27632 and BA or LPS for 24 h. The cells in BL + Y-27632 group and the LPS + Y-27632 group showed shrank cells, which had not clear boundary, and were separated from the surrounding cells, and the growth state was poor, especially in LPS + Y-27632 group. However, the growth state of the cells was improved, the wrinkling phenomenon was improved, and the connection among cells was closer when the two groups were treated with Y-27632. Secondly, as showed in Fig. 4 B, compared to that in control + Y-27632 group (1720.000 ± 0.000 Ω.cm 2 ), TEER was no significance ( P > 0.05) in the BA + Y-27632 group (1719.667 ± 0.577 Ω.cm 2 ). However, BL + Y-27632 group (1570.000 ± 1.000 Ω.cm 2 ) and LPS + Y-27632 group (1320.000 ± 1.000 Ω.cm 2 ) showed a decreased TEER ( P < 0.0001), and more obvious alteration was found in LPS + Y-27632 group ( P < 0.0001). Compared with BL + Y-27632 group, TEER of LPS + Y-27632 group decreased significantly ( P 0.05). Compared with BL group, the decrease of TEER in BL + Y-27632 group was improved ( P < 0.01). Decreased TEER was significantly improved in LPS + Y-27632 group compared with LPS group ( P < 0.0001), indicating higher barrier integrity. Thirdly, as shown in Fig. 4 C, compared with the control + Y-27632 group, the concentration of FD-4 in lower chamber was (4.600 ± 0.013 ug/ml). The concentration of FD-4 in BA + Y-27632 group decreased (3.052 ± 0.026, ug/ml). The concentration of FD-4 in BL + Y-27632 group (5.384 ± 0.132 ug/ml) and LPS + Y-27632 group (7.283 ± 0.052 ug/mL) increased, and the concentration of FD-4 in LPS + Y-27632 group was even higher. Compared to that in BL + Y-27632 group, the concentration of FD-4 in LPS + Y-27632 group increased significantly. Compared with control group, FD-4 concentration of in control + Y-27632 group had no significant change. Compared with BA group, the concentration of FD-4 in BA + Y-27632 group had no significant change. Compared with BL group, the concentration decline of FD-4 in BL + Y-27632 group was improved. The concentration of FD-4 decreased significantly in LPS + Y-27632 group compared with that in LPS group. Moreover, as shown in Fig. 4 D- 4 E, compared with control + Y-27632 group, the expression of ZO-1 mRNA in BA + Y-27632 group was increased, while the expression of ZO-1 mRNA in BL + Y-27632 group was not decreased. The expression of LPS + Y-27632 group was also decreased. The expression of ZO-1 mRNA in BL + Y-27632 group was higher than that in LPS + Y-27632 group. Compared with control group, the Occludin mRNA expression of BA + Y-27632 group increased, and the Occludin mRNA expression of BL + Y-27632 group did not decrease. The expression of Occludin mRNA in LPS + Y-27632 also decreased. The mRNA expression of Occludin in BL + Y-27632 group was higher than that in LPS + Y-27632 group. It was proved that BA and Y-27632 can synergetically increase mRNA expression of ZO-1 and Occludin in LPS-induced Caco2 cells. However, as shown in Fig. 4 F- 4 H, compared with control + Y-27632 group, RhoA mRNA expression in BA + Y-27632 group was decreased, while RhoA mRNA expression in BL + Y-27632 group and LPS + Y-27632 group was increased. The expression of RhoA mRNA in BL + Y-27632 group was lower than that in LPS + Y-27632 group. Compared with the control + Y-27632 group, the expression of ROCK2 mRNA in BA + Y-27632 group was decreased, the expression of ROCK2 mRNA in BL + Y-27632 group was not significantly changed, and the expression of ROCK2 mRNA in LPS + Y-27632 group was also increased. The mRNA expression of ROCK2 in BL + Y-27632 group was lower than that in LPS + Y-27632 group. Compared with control + Y-27632 group, the expression of MLCK mRNA in BA + Y-27632 group was decreased, there was no significant change in the expression of MLCK mRNA in BL + Y-27632 group, and the expression of MLCK mRNA in LPS + Y-27632 group was increased. The MLCK mRNA expression in BL + Y-27632 group was lower than that in LPS + Y-27632 group. Take together, the mRNA expression of RhoA, ROCK2 and MLCK was notably elevated upon LPS stimulation in Caco2 cells, while BA significantly reduced the mRNA expression of these factors, which was partly enhanced by Y-27632 treatment, hindering by co-treatment with BA and Y-27632. The results showed that BA and Y-27632 could synergistically reduce the mRNA expression of RhoA, ROCK2 and MLCK mRNA. In addition, immunofluorence indicated that increased ZO-1 and Occludin expression was found on the cell membrane, when cells were exposure to Y-27632 and BA(Fig. 4 I). However, compared with the control + Y-27632 group, the expression of RhoA, ROCK2 and MLCK in BA + Y-27632 group decreased. RhoA was mainly distributed in the cell membrane and cytoplasm, ROCK2 was mainly distributed around the cytoplasm and nucleus, and MLCK was mainly located in the cytoplasm and nucleus. After LPS stimulation, the expression of RhoA, ROCK2 and MLCK increased significantly, RhoA moved to the nucleus, the expression increased in the nucleus, and the distribution of ROCK2 around the cell membrane and in the nucleus increased significantly. When MLCK moved to the cell membrane, the expression level around the cell membrane increased obviously. However, BA decreased the expression of RhoA, ROCK2 and MLCK induced by LPS and improved their distribution in cells. The expression levels of RhoA, ROCK2 and MLCK decreased after Y-27632 treatment compared with the control group. Compared with BA group, the expression levels of RhoA, ROCK2 and MLCK were also decreased. Compared with BL group and LPS group, LPS-induced abnormal expression and distribution were further improved by Y-27632 (Fig. 4 J). On the basis of above data, additional treatment of Y-27632 greatly improved the growth status, reduced the permeability of monolayer epithelial barrier, increased expression of ZO-1 and Occludin, decreased expression of RhoA, ROCK2 and MLCK, as well as reversed the redistribution of ZO-1, Occludin, RhoA, ROCK2 and MLCK, a perspective was upheld that BA down-regulats RhoA/ROCK2/MLCK pathway to modulate the expression and location of tight junction to provide the protective effect in the presence of LPS. Discussion Many enteral and systematic diseases lead to intestinal epithelial barrier damage and manifestations of enteritis. The pathogenesis and potential therapies for intestinal epithelial barrier damage have been widely researched[24]. The main treatment measures for intestinal epithelial barrier damage and enteritis are to use antibiotics, which may lead to intestinal flora imbalance and other problems[25]. However, appropriate techniques through food supplement with no adverse effect for reversing intestinal epithelial barrier damage to improve patient outcomes and prognosis have not yet definitely been established. Therefore, finding a new regimen with therapeutic value for intestinal epithelial barrier damage is of great significance for basic and clinical research. BA not only provides energy for colon cells, but also is important to maintain intestinal epithelial cells integrity[26]. Correspondingly, many studies have found that LPS induces intestinal barrier damage and has been a common molding methods[15]. Therefore, in this study, LPS was selected as a stimulating factor to create an in vitro intestinal barrier damage model. At the same time, BA as a protective factor of Caco2 cells to study the role of BA in LPS-induced intestinal barrier damage and possible related mechanisms. In this present study, it was found that BA could improve cell viability, improve the growth status of Caco2 cells, maintain the integrity of intestinal epithelial barrier, up-regulate ZO-1 and Occludin expression, maintain their subcellular distribution, inhibit RhoA/ROCK2/MLCK signaling pathway, reversed intracellular distribution of RhoA, ROCK2 and MLCK, leading to alleviate the LPS-caused damage of intestinal barrier. After addition of Y-27632, a kind of ROCK inhibitor, BA could further improve the above function. Therefore, this study concluded that BA could alleviate LPS-induced epithelial barrier damage of Caco2 cells by inhibiting RhoA/ROCK2/MLCK signaling pathway and provided a mechanistic research of the regulatory role of BA in intestine barrier damage. The intestinal mucosal barrier, composed of intestinal epithelial cells and mucus in the intestinal cavity, forms the first defensive barrier against pathogens. Therefore, the mechanical barrier of intestinal epithelial cells plays a vital role[27]. Its function is closely related to the tight junctions and gap junctions between epithelial cells, especially the tight junctions at the apical side of epithelial cells. Tight junctions are formed by the polymerization of several proteins, including transmembrane proteins junction adhesion molecules and triglycerides. Transmembrane proteins include claudins, occludins, and so on. Perimembrane proteins are mainly ZOs, including ZO-1, ZO-2 and ZO-3, which bridge membrane proteins to actin skeleton structure and signal transmitting proteins. The function of tight junction is relative to the arrangement of actin and the interaction among transmembrane proteins, it regulates the transcellular movement of substances including ions and water and closely related to transcellular permeability[28]. TEER is formed by ions flowing through the paracellular space and used as to reflect integrality of the monolayer barrier, TEER decreases when the barrier is damaged, while increases to a certain level when monolayer cell barrier is formed[29]. FD-4 flux is also used to evaluate monolayer epithelial barrier integrity[30]. Detection of TEER and FD-4 flux was included in this experiment. BA is a short-chain fatty acid that provides 60–70% of the energy required for intestinal mucosal epithelial cells. Studies have confirmed that BA enhances the intestinal barrier integrity by up-regulating the expression of Claudin2 and decreasing intestinal permeability through an IL-10 receptor-dependent mechanism[31]. In the presence of hypoxia-inducable-factor-1, as its stabilizer, BA activates genes encoding tight junction protein, and up-regulates the expression of tight junction proteins through transcription factor recombinant protein, to improve intestinal epithelial barrier function[32–33]. In this experiment, low final concentration (0-0.5mM) improved cell viability, while high concentration showed the opposite effect. A final concentration of 0.2mM BA treatment Caco2 cells for 24 h could significantly improve cell viability, confirming that low concentration of BA plays a protective role in maintaining intestinal epithelial barrier. On the basis of the above results, 0.2mM BA treatment Caco2 cells for 24 h was selected to proceed to the next stage of the experiment[34] . LPS-induced cell models have been widely used to assess intestinal epithelial barrier damage[35]. In the present study, different concentration of LPS was administrated to Caco2 cells for 18, 24 and 30 h, respectively. Through CCK-8 test, it was found that IC50 of LPS fluctuated in the range of 2–50 ug/ml, therefore, 2, 5, 10, 20 and 50 ug/ml LPS were added to Caco2 cells for 24 h, the results indicated that BA played a role in protecting epithelial barrier when the concentration of LPS was 2–10 ug/ml. Finally, in vitro model was created by using 0.2 mM BA and 5 ug/ml LPS for 24 h. LPS decreased TEER, and increased FD-4 flux, deteriorated the growth status of cells, down-regulated the expression of ZO-1 and Occludin, changed their intracellular distribution. The data were similar to the previous researches[36–37], indicating LPS induced intestine epithelial barrier dysfunction. When BA was administrated, these effects were mitigated significantly, inhibiting BA could reverse the epithelial barrier injury. These results related to BA improving barrier junction were consistent with previous studies[14]. RhoA plays a vital role in junction polymerization and function, which leads to abnormal tight junction function of epithelial cells[38]. Studies have shown that EphB2-Exos has been proved to protect the activity of Caco2 by inhibiting RhoA/ROCK pathway, and promote cell proliferation and migration[39]. Extracellular enzymes C3, Y-27632 and selective RhoA, ROCK1 and ROCK2 siRNAs significantly inhibited Caco2 epithelial cell migration[40]. LPS and TNF-α induced ROCK activation in Caco2 cells, which resulted in the relocation of ZO-1 and caludin-2, and ultimately down-regulated TEER and up-regulated FD-4 flux[41]. In brain capillary endothelial cells, the viability of cells decreased, TEER decreased, and fluorescence yellow permeability increased after LPS treatment. Transmission electron microscopy showed that cell tight junction were damaged after LPS exposure, and the expressions of claudin-5 and ZO-1 decreased, meanwhile, the mRNA expression of claudin-5 and Occludin decreased. By inhibiting RhoA/ROCK2 pathway, catalpol reversed the expression of proteins such as ZO-1 and Occludin, and reversed the increased blood-brain barrier permeability caused by LPS[42]. In addition, MLCK is also important in the physiological and pathophysiological regulation of epithelial tight junction protein. In vitro experiments showed that ZO-1 remodeling induced by MLCK was similar to Occludin and F-actin. Inflammatory stimulation, such as TNF-α, promoted MLCK activation, and Occludin bridging onto MLCK-dependent actin loops, resulting in endocytosis of Occludin, sequentially increasing paracellular permeability[43]. ROCK1 and MLCK were activated in Caco2 cells treated with LPS, thereby activating p-MYPT1 and p-MLC, and down-regulating tight junction protein expression[44]. After LPS was given to Caco2 cells, the distribution of ZO-1 and claudin-1 changed and activated the MLCK/MLC pathway, resulting in high permeability[45]. Sodium fluoride activated the calcium-dependent RhoA/ROCK pathway and MLCK, promoted the fracture of ZO-1 in Caco2 cells, changed the intracellular rearrangement of ZO-1 and F-actin, and induced intestinal mucosal damage, while Y-27632 reversed these effects induced by sodium fluoride[46]. In the study, LPS increased the mRNA expression of RhoA[47], ROCK2 [48] and MLCK [49] and affected the distribution of these proteins in Caco2 cells. In the control group, RhoA was mainly distributed in the cell membrane and cytoplasm[50], ROCK2 was mainly located around cytoplasm and nucleus[51], while MLCK was mainly distributed in the cytoplasm and nucleus. The expression of RhoA was significantly increased, and moved to the nucleus, the expression of ROCK2 around cell membrane and in nucleus was significantly increased, while the expression level of MLCK around the cell membrane was significantly increased after LPS stimulation[52]. After BA treatment, the mRNA expression levels of these proteins decreased and their distribution in cells also reversed[53]. When Y-27632, ROCK inhibitor, was added to Caco2 cells for 24 h, the viability and growth status of Caco2 cells, integrality of barrier, the expression and location of ZO-1 and Occludin, as well as the activated station of RhoA/ROCK2/MLCK pathway were further improved[54]. In summary, Y-27632 played a synergistic role with BA, which further proved that RhoA/ROCK/MLCK pathway participated in the protection of BA from epithelial barrier damage induced by LPS. There are several limitations to the present investigation. In the present study, we did not evaluate the role of inhibitor of RhoA and MLCK[55], nor did we conduct related researches using agonists of RhoA, ROCK2 and MLCK, further research is required to include agonists and other protein inhibitors except Y-27632 to further clarify the function of RhoA/ROCK2/MLCK signaling pathway. Furthermore, we only investigate one signaling pathway, it is still necessary to further expand experiments which relate to mechanisms. In addition, this experiment was only conducted on Caco2 cells, but there are many intestinal epithelial cell lines, which need to be further researched. Moreover, precise and versatile molecular researches should be adopted to better explore the direct target of BA on the RhoA/ROCK2/MLCK signaling pathway. Conclusion In summary, these data indicate BA plays an important role in intestine barrier protection through improving the viability and growth state of intestinal epithelial cells, increasing their TEER and reducing FD-4 flux, maintaining barrier integrity, and reversing the expression and location of ZO-1 and Occludin in Caco2 cells induced by LPS, which depends on activating RhoA/ROCK2/MLCK signaling pathway. This study extends the understanding of the pathogenesis of LPS-induced intestinal injury, as well as provides rationales for BA as new potential treatment for patients suffering from intestine barrier damage. Declarations Acknowledgements We thank the support provided from the National Natural Science Foundation of China and Science and Technology Department of Yunnan Province. References Odenwald MA, Turner JR. The intestinal epithelial barrier: a therapeutic target? Nature reviews Gastroenterology & hepatology. 2017;14(1):9-21. Celebi Sözener Z, Cevhertas L, Nadeau K, Akdis M, Akdis CA. Environmental factors in epithelial barrier dysfunction. The Journal of allergy and clinical immunology. 2020;145(6):1517-28. Akdis CA. Does the epithelial barrier hypothesis explain the increase in allergy, autoimmunity and other chronic conditions? Nature reviews Immunology. 2021;21(11):739-51. Zmora N, Suez J, Elinav E. You are what you eat: diet, health and the gut microbiota. Nature reviews Gastroenterology & hepatology. 2019;16(1):35-56. Groschwitz KR, Hogan SP. Intestinal barrier function: molecular regulation and disease pathogenesis. The Journal of allergy and clinical immunology. 2009;124(1):3-20; quiz 1-2. Gasaly N, de Vos P, Hermoso MA. Impact of Bacterial Metabolites on Gut Barrier Function and Host Immunity: A Focus on Bacterial Metabolism and Its Relevance for Intestinal Inflammation. Frontiers in immunology. 2021;12:658354. Martin-Gallausiaux C, Marinelli L, Blottière HM, Larraufie P, Lapaque N. SCFA: mechanisms and functional importance in the gut. The Proceedings of the Nutrition Society. 2021;80(1):37-49. Steele MA, Penner GB, Chaucheyras-Durand F, Guan LL. Development and physiology of the rumen and the lower gut: Targets for improving gut health. Journal of dairy science. 2016;99(6):4955-66. Pohl K, Moodley P, Dhanda A. The effect of increasing intestinal short-chain fatty acid concentration on gut permeability and liver injury in the context of liver disease: A systematic review. Journal of gastroenterology and hepatology. 2022;37(8):1498-506. Otani T, Furuse M. Tight Junction Structure and Function Revisited. Trends in cell biology. 2020;30(10):805-17. Monaco A, Ovryn B, Axis J, Amsler K. The Epithelial Cell Leak Pathway. International journal of molecular sciences. 2021;22(14). Suzuki T. Regulation of intestinal epithelial permeability by tight junctions. Cellular and molecular life sciences : CMLS. 2013;70(4):631-59. Du L, Kim JJ, Shen J, Dai N. Crosstalk between Inflammation and ROCK/MLCK Signaling Pathways in Gastrointestinal Disorders with Intestinal Hyperpermeability. Gastroenterology research and practice. 2016;2016:7374197. Chen X, Kong Q, Zhao X, Zhao C, Hao P, Irshad I, et al. Sodium acetate/sodium butyrate alleviates lipopolysaccharide-induced diarrhea in mice via regulating the gut microbiota, inflammatory cytokines, antioxidant levels, and NLRP3/Caspase-1 signaling. Frontiers in microbiology. 2022;13:1036042. Giordano NP, Cian MB, Dalebroux ZD. Outer Membrane Lipid Secretion and the Innate Immune Response to Gram-Negative Bacteria. Infection and immunity. 2020;88(7). Nighot M, Al-Sadi R, Guo S, Rawat M, Nighot P, Watterson MD, et al. Lipopolysaccharide-Induced Increase in Intestinal Epithelial Tight Permeability Is Mediated by Toll-Like Receptor 4/Myeloid Differentiation Primary Response 88 (MyD88) Activation of Myosin Light Chain Kinase Expression. The American journal of pathology. 2017;187(12):2698-710. Wu XX, Huang XL, Chen RR, Li T, Ye HJ, Xie W, et al. Paeoniflorin Prevents Intestinal Barrier Disruption and Inhibits Lipopolysaccharide (LPS)-Induced Inflammation in Caco-2 Cell Monolayers. Inflammation. 2019;42(6):2215-25. B H, J W, A G, T W, J L, A S. - Zearalenone-Induced Mechanical Damage of Intestinal Barrier via the RhoA/ROCK. International journal of molecular sciences. 2022;23(20). Li C, Zhang Y, Liu R, Mai Y. Anagliptin Protected against Hypoxia/Reperfusion-Induced Brain Vascular Endothelial Permeability by Increasing ZO-1. ACS omega. 2021;6(11):7771-7. Yan F, Chen W, Zhao L, Lu Q, Wang C, Liu R. Procyanidin A(1) and its digestive products prevent acrylamide-induced intestinal barrier dysfunction via the MAPK-mediated MLCK pathway. Food & function. 2021;12(23):11956-65. Li J, Zhang L, Wu T, Li Y, Zhou X, Ruan Z. Indole-3-propionic Acid Improved the Intestinal Barrier by Enhancing Epithelial Barrier and Mucus Barrier. Journal of agricultural and food chemistry. 2021;69(5):1487-95. Zhao D, Jiao S, Yi H. Arsenic exposure induces small intestinal toxicity in mice by barrier damage and inflammation response via activating RhoA/ROCK and TLR4/Myd88/NF-κB signaling pathways. Toxicology letters. 2023;384:44-51. Huang S, Fu Y, Xu B, Liu C, Wang Q, Luo S, et al. Wogonoside alleviates colitis by improving intestinal epithelial barrier function via the MLCK/pMLC2 pathway. Phytomedicine : international journal of phytotherapy and phytopharmacology. 2020;68:153179. Pellegrini C, Fornai M, D'Antongiovanni V, Antonioli L, Bernardini N, Derkinderen P. The intestinal barrier in disorders of the central nervous system. The lancet Gastroenterology & hepatology. 2023;8(1):66-80. Zhao C, Hu X, Qiu M, Bao L, Wu K, Meng X, et al. Sialic acid exacerbates gut dysbiosis-associated mastitis through the microbiota-gut-mammary axis by fueling gut microbiota disruption. Microbiome. 2023;11(1):78. Benvenuti L, D'Antongiovanni V, Pellegrini C, Fornai M, Bernardini N, Ippolito C, et al. Dietary Supplementation with the Probiotic SF68 Reinforces Intestinal Epithelial Barrier in Obese Mice by Improving Butyrate Bioavailability. Molecular nutrition & food research. 2023;67(13):e2200442. Mitamura Y, Ogulur I, Pat Y, Rinaldi AO, Ardicli O, Cevhertas L, et al. Dysregulation of the epithelial barrier by environmental and other exogenous factors. Contact dermatitis. 2021;85(6):615-26. Kuo WT, Odenwald MA, Turner JR, Zuo L. Tight junction proteins occludin and ZO-1 as regulators of epithelial proliferation and survival. Annals of the New York Academy of Sciences. 2022;1514(1):21-33. Spalinger MR, Sayoc-Becerra A, Santos AN, Shawki A, Canale V, Krishnan M, et al. PTPN2 Regulates Interactions Between Macrophages and Intestinal Epithelial Cells to Promote Intestinal Barrier Function. Gastroenterology. 2020;159(5):1763-77.e14. Ouyang F, Li B, Wang Y, Xu L, Li D, Li F, et al. Attenuation of Palmitic Acid-Induced Intestinal Epithelial Barrier Dysfunction by 6-Shogaol in Caco-2 Cells: The Role of MiR-216a-5p/TLR4/NF-κB Axis. Metabolites. 2022;12(11). Gonzalez A, Krieg R, Massey HD, Carl D, Ghosh S, Gehr TWB, et al. Sodium butyrate ameliorates insulin resistance and renal failure in CKD rats by modulating intestinal permeability and mucin expression. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association. 2019;34(5):783-94. Parada Venegas D, De la Fuente MK, Landskron G, González MJ, Quera R, Dijkstra G, et al. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Frontiers in immunology. 2019;10:277. Yin J, Zhou C, Yang K, Ren Y, Qiu Y, Xu P, et al. Mutual regulation between butyrate and hypoxia-inducible factor-1α in epithelial cell promotes expression of tight junction proteins. Cell biology international. 2020;44(6):1405-14. Salvi PS, Cowles RA. Butyrate and the Intestinal Epithelium: Modulation of Proliferation and Inflammation in Homeostasis and Disease. Cells. 2021;10(7). Cao Y, Teng Y, Liu H, Li J, Zhu B, Xia X. Rhopilema esculentum polysaccharides enhance epithelial cell barrier in vitro and alleviate chronic colitis in mice. International journal of biological macromolecules. 2023;241:124560. Gigli S, Seguella L, Pesce M, Bruzzese E, D'Alessandro A, Cuomo R, et al. Cannabidiol restores intestinal barrier dysfunction and inhibits the apoptotic process induced by Clostridium difficile toxin A in Caco-2 cells. United European gastroenterology journal. 2017;5(8):1108-15. Li BL, Zhao DY, Du PL, Wang XT, Yang Q, Cai YR. Luteolin alleviates ulcerative colitis through SHP-1/STAT3 pathway. Inflammation research : official journal of the European Histamine Research Society [et al]. 2021;70(6):705-17. Tong J, Wang Y, Chang B, Zhang D, Wang B. Evidence for the Involvement of RhoA Signaling in the Ethanol-Induced Increase in Intestinal Epithelial Barrier Permeability. International journal of molecular sciences. 2013;14(2):3946-60. Chu S, Yu T, Wang W, Wu H, Zhu F, Wei C, et al. Exosomes derived from EphB2-overexpressing bone marrow mesenchymal stem cells regulate immune balance and repair barrier function. Biotechnology letters. 2023;45(5-6):601-17. Chaturvedi LS, Marsh HM, Basson MD. Role of RhoA and its effectors ROCK and mDia1 in the modulation of deformation-induced FAK, ERK, p38, and MLC motogenic signals in human Caco-2 intestinal epithelial cells. American journal of physiology Cell physiology. 2011;301(5):C1224-38. So BR, Kim S, Jang SH, Kim MJ, Lee JJ, Kim SR, et al. Dietary protocatechuic acid redistributes tight junction proteins by targeting Rho-associated protein kinase to improve intestinal barrier function. Food & function. 2023;14(10):4777-91. Feng S, Zou L, Wang H, He R, Liu K, Zhu H. RhoA/ROCK-2 Pathway Inhibition and Tight Junction Protein Upregulation by Catalpol Suppresses Lipopolysaccaride-Induced Disruption of Blood-Brain Barrier Permeability. Molecules (Basel, Switzerland). 2018;23(9). He WQ, Wang J, Sheng JY, Zha JM, Graham WV, Turner JR. Contributions of Myosin Light Chain Kinase to Regulation of Epithelial Paracellular Permeability and Mucosal Homeostasis. International journal of molecular sciences. 2020;21(3). Song L, Wu T, Zhang L, Wan J, Ruan Z. Chlorogenic acid improves the intestinal barrier by relieving endoplasmic reticulum stress and inhibiting ROCK/MLCK signaling pathways. Food & function. 2022;13(8):4562-75. Lan H, Zhang LY, He W, Li WY, Zeng Z, Qian B, et al. Sinapic Acid Alleviated Inflammation-Induced Intestinal Epithelial Barrier Dysfunction in Lipopolysaccharide- (LPS-) Treated Caco-2 Cells. Mediators of inflammation. 2021;2021:5514075. Li L, Xin J, Wang H, Wang Y, Peng W, Sun N, et al. Fluoride disrupts intestinal epithelial tight junction integrity through intracellular calcium-mediated RhoA/ROCK signaling and myosin light chain kinase. Ecotoxicol Environ Saf. 2023;257:114940. Wang X, Chen S, Xiang H, Wang X, Xiao J, Zhao S, et al. S1PR2/RhoA/ROCK1 pathway promotes inflammatory bowel disease by inducing intestinal vascular endothelial barrier damage and M1 macrophage polarization. Biochemical pharmacology. 2022;201:115077. Xiang C, Yan Y, Zhang D. Alleviation of the doxorubicin-induced nephrotoxicity by fasudil in vivo and in vitro. Journal of pharmacological sciences. 2021;145(1):6-15. Xie Y, Zhan X, Tu J, Xu K, Sun X, Liu C, et al. Atractylodes oil alleviates diarrhea-predominant irritable bowel syndrome by regulating intestinal inflammation and intestinal barrier via SCF/c-kit and MLCK/MLC2 pathways. Journal of ethnopharmacology. 2021;272:113925. Babbin BA, Parkos CA, Mandell KJ, Winfree LM, Laur O, Ivanov AI, et al. Annexin 2 regulates intestinal epithelial cell spreading and wound closure through Rho-related signaling. The American journal of pathology. 2007;170(3):951-66. Demirdizen E, Al-Ali R, Narayanan A, Sun X, Varga JP, Steffl B, et al. TRIM67 drives tumorigenesis in oligodendrogliomas through Rho GTPase-dependent membrane blebbing. Neuro-oncology. 2023;25(6):1031-43. Xu J, Zhao S, Zhao L, Sun M. Carvedilol alleviates lipopolysaccharide (LPS)-induced acute lung injury by inhibiting Ras homolog family member A (RhoA)/ROCK activities. Bioengineered. 2022;13(2):4137-45. Teng G, Liu Z, Liu Y, Wu T, Dai Y, Wang H, et al. Probiotic Escherichia coli Nissle 1917 Expressing Elafin Protects Against Inflammation and Restores the Gut Microbiota. Frontiers in microbiology. 2022;13:819336. Tong J, Wang Y, Chang B, Zhang D, Wang B. Y-27632 inhibits ethanol-induced increase in intestinal epithelial barrier permeability. Molecular medicine reports. 2014;9(6):2357-61. Kazakova OA, Khapchaev AY, Shirinsky VP. MLCK and ROCK mutualism in endothelial barrier dysfunction. Biochimie. 2020;168:83-91. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3369797","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":237897225,"identity":"aa619c72-6183-4ce6-ba61-bcc6fe412168","order_by":0,"name":"Luqiong Liu","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Luqiong","middleName":"","lastName":"Liu","suffix":""},{"id":237897226,"identity":"ad0fddcf-04fd-4e6b-ad93-59e5e1283860","order_by":1,"name":"Tong Chen","email":"","orcid":"","institution":"The first Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Chen","suffix":""},{"id":237897227,"identity":"89f629da-4fe6-4724-b7bd-ae6f9be08189","order_by":2,"name":"Zhenrong Xie","email":"","orcid":"","institution":"BioBank, The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhenrong","middleName":"","lastName":"Xie","suffix":""},{"id":237897228,"identity":"d8997cd1-0115-4225-9b05-51184fae7658","order_by":3,"name":"Yongjin Zhang","email":"","orcid":"","institution":"The first Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yongjin","middleName":"","lastName":"Zhang","suffix":""},{"id":237897229,"identity":"4af0808a-e428-4755-9574-713884d7c838","order_by":4,"name":"Chenglu He","email":"","orcid":"","institution":"The first Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chenglu","middleName":"","lastName":"He","suffix":""},{"id":237897230,"identity":"280b5b5b-622a-4ae5-8c1e-12f99b87d5e1","order_by":5,"name":"Yongkun Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzklEQVRIiWNgGAWjYBACAwY2Zhjb8EFCRQ1pWowNHpw5RpoWM8mHLcz4FEOAuURastHNtjvy5hLJ2yoSG9gY+Nu7E/BqsZyRdjg5t+2Z4c4ZaWU3EnfIMEicObsBv8NupDcfzm07nGBwO8fsRuIZNgYDiVwStBQktjETowXsMIgWBuK0nHmWbJxz7rDhhvvPiiUSzhzjIeyX42nG0jllh+UNzhze+PFHRY0cf3svfi0MAgkMDIxsCD4PfuUgwH8ASPwhrG4UjIJRMApGMAAA4cFPUBoicPQAAAAASUVORK5CYII=","orcid":"","institution":"The first Affiliated Hospital of Kunming Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yongkun","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2023-09-19 16:29:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3369797/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3369797/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":44378988,"identity":"68a4c172-4890-46a1-9ed5-50fa1dc9401e","added_by":"auto","created_at":"2023-10-10 18:09:29","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":163414,"visible":true,"origin":"","legend":"\u003cp\u003eThe optimal concentration and treatment time of BA and LPS on Caco2 cells. \u003cstrong\u003eA\u003c/strong\u003eThe viability of Caco2 cells was determined by CCK8 assays after different concentrations of BA for 0-36 h. \u003cstrong\u003eB\u003c/strong\u003e Cell viability after treatment with different concentrations of LPS for 18-36 h, as determined by the CCK8 assay. \u003cstrong\u003eC\u003c/strong\u003e The viability of Caco2 cells was determined by CCK8 assays following treatment with 0.2 mM BA and different concentrations of LPS for 24 h.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3369797/v1/faff61a5c1a1e44a37ed2319.jpeg"},{"id":44380085,"identity":"aed88363-fc48-4dad-83cd-31bc7ffcba5e","added_by":"auto","created_at":"2023-10-10 18:17:29","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1346547,"visible":true,"origin":"","legend":"\u003cp\u003eBA attenuated the epithelial barrier injury induced by LPS in Caco2 cells. \u003cstrong\u003eA\u003c/strong\u003e The morphological alterations of LPS-induced Caco2 cells after treatment with BA (x600). \u003cstrong\u003eB\u003c/strong\u003e BA alleviated LPS-induced decreased TEER in Caco2 cells. \u003cstrong\u003eC\u003c/strong\u003e BA alleviated LPS-induced increased FD-4 flux in Caco2 cellls. \u003cstrong\u003eD\u003c/strong\u003e Relative expressions of the mRNA levels of ZO-1. \u003cstrong\u003eE\u003c/strong\u003e Relative expressions of the mRNA levels of Occludin. Values are expressed as mean±SD and were analyzed by variance of factorial design. *, ** ,*** and **** denote \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u0026lt; 0.01, \u0026lt; 0.001 or \u0026lt; 0.0001, respectively. \u003cstrong\u003eF\u003c/strong\u003e Representative images of immunofluorescence staining by labeling ZO-1 and Occludin (antibody, green) and nuclei (DAPI, blue) (scale bar = 20 μm)\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3369797/v1/be56c9323a44c29a935d0f0c.jpeg"},{"id":44377556,"identity":"2796be60-ffe5-4090-be09-c0c4f39a69c3","added_by":"auto","created_at":"2023-10-10 18:01:29","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1028436,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of BA on RhoA/ROCK2/MLCK signaling pathway in LPS-induced Caco2 cells. \u003cstrong\u003eA\u003c/strong\u003e Relative expressions of the mRNA levels of RhoA after exposure to LPS or BA. \u003cstrong\u003eB\u003c/strong\u003e Relative expressions of the mRNA levels of ROCK2. \u003cstrong\u003eC\u003c/strong\u003e Relative expressions of the mRNA levels of MLCK.Values are expressed as mean±SD and were analyzed by variance of factorial design. * and ** denote \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 or \u0026lt; 0.01, respectively. \u003cstrong\u003eD \u003c/strong\u003eRepresentative images of immunofluorescence staining by labeling RhoA, ROCK2 and MLCK (antibody, green) and nuclei (DAPI, green) (scale bar = 20 μm)\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3369797/v1/95968753e9a0fc90c9749e33.jpeg"},{"id":44378990,"identity":"78fb8b84-3d1a-44f3-9341-34eb24213cce","added_by":"auto","created_at":"2023-10-10 18:09:29","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2319722,"visible":true,"origin":"","legend":"\u003cp\u003eBA attenuated the epithelial barrier injury induced by LPS by inhibiting RhoA/ROCK2/MLCK pathway in Caco2 cells. \u003cstrong\u003eA\u003c/strong\u003e The morphological alterations of LPS or BA mediated Caco2 cells after treatment with Y-27632 for 24 h (scale bar = 200 μm). \u003cstrong\u003eB\u003c/strong\u003e Effects of Y-27632 on TEER in Caco2 cells. \u003cstrong\u003eC\u003c/strong\u003e Effects of Y-27632 on FD-4 flux in Caco2 cellls. \u003cstrong\u003eD\u003c/strong\u003e Expressions of the mRNA levels of ZO-1. \u003cstrong\u003eE\u003c/strong\u003e Expressions of the mRNA levels of Occludin. \u003cstrong\u003eF\u003c/strong\u003e Expressions of the mRNA levels of RhoA. \u003cstrong\u003eG\u003c/strong\u003e Expressions of the mRNA levels of ROCK2. \u003cstrong\u003eH\u003c/strong\u003e Expressions of the mRNA levels of MLCK.Values are expressed as mean±SD and were analyzed by variance of factorial design. *, ** , *** and ****denote \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u0026lt; 0.01, \u0026lt; 0.001 or \u0026lt; 0.0001, respectively; ns = not significant. \u003cstrong\u003eI \u003c/strong\u003eRepresentative images of immunofluorescence staining by labeling ZO-1 and Occludin (antibody, green) and nuclei (DAPI, blue). \u003cstrong\u003eJ\u003c/strong\u003e Representative images of immunofluorescence staining by labeling RhoA, ROCK2 and MLCK (antibody, green) and nuclei (DAPI, green) (scale bar = 20 μm)\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3369797/v1/02dc9e3ef229203cd3338689.jpeg"},{"id":44382627,"identity":"9b84fa44-b0aa-4e23-b070-4d5889d155be","added_by":"auto","created_at":"2023-10-10 18:33:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1035633,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3369797/v1/00273978-e929-4afd-86bf-a91dd269523c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Butyric acid alleviates LPS-induced intestinal mucosal barrier damage by inhibiting RhoA/ROCK2/MLCK signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEpithelial barrier hypothesis, which constitutes the first line of mechanical, physical, chemical, and immunologic defenses against environmental factors, has been widely accepted by many scholars[1]. Duo to intact barriers, host tissue was protected from infections, environmental toxins, pollutants and allergens, which leading to host imbalance. With urbanization and socioeconomic development, more and more harmful material are generated, which disrupting the physical integrity of the barrier[2]. Moreover, leakiness of the gut epithelium is also related to diabetes, systemic lupus erythematosus, and so on. In addition, some diseases, such as Parkinson disease, are suspected to be associated with distant inflammatory responses due to a 'leaky gut' and microbiome changes[3]. The intestinal microbiome includes bacteria, viruses and fungi, and related metabolites including vitamins, secondary bile acids, short-chain fatty acids and many other bioactive mediators. The correlation between intestinal flora, microbial metabolites and intestinal barrier affects the occurrence and development of diseases[4]. Compared with adults, children have thin intestinal walls, abundant blood vessels, tender mucosa, and lower intestinal flora than adults, and are easily affected by the external environment, resulting in flora imbalance and intestinal mucosal damage[5]. Some chronic intestinal conditions, such as celiac disease and inflammatory bowel diseases, are related to disturbance of dynamic and versatile microbial community of gastrointestinal tract. In addition, metabolites derived from microbiota play a vital role in health[6]. Therefore, essential dietary supplement such as dietary fibers, may change microbial metabolites and restore gut epithelial barrier, further to be beneficial to intestinal and systemic homeostasis, ameliorate associated diseases and improve prognosis.\u003c/p\u003e \u003cp\u003eButyric acid (BA) is the main metabolite of metamicutes, which can be absorbed and utilized by colon epithelial cells and is the main source of energy for colon and cecum[7]. At low concentrations, BA could promote colon mucosal epithelial cells proliferation and improve the tightness of epithelial cell connections[8]. Reducing intestinal permeability has represented a potential therapy through short chain fatty acid supplementationin in a variety of liver disease models[9]. Acute or chronic enteritis, ulcerative colitis, shock, trauma, high-fat diet, leukemia, pneumonia and other diseases can lead to intestinal mucosal barrier damage, as well as the intestinal epithelial cells. Tight junctions are vital for building the epithelial barrier and maintaining epithelial polarity[10], are the basis of the intestinal mucosal mechanical barrier, which can prevent the invasion of pathogens and harmful substances, and is vital to maintain the stability of the internal environment[11]. The flux of noxious molecules from lumen results in disruption of the intestinal TJ barrier and induces mucosal inflammation. So it is to worthy to explain the roles of extracellular factors to the intestinal TJ barrier[12]. The restoration of the intestinal barrier has important therapeutic value in both local and systematic diseases, regardless of the cause or effect of intestinal epithelial injury[13]. LPS-induced diarrhea in mice was alleviated by sodium butyrate via enriching beneficial bacterium and declining pathogens, which were involved in maintaining the epithelial barrier function[14].\u003c/p\u003e \u003cp\u003eLipopolysaccharide (LPS) could reduce the expression of cingulin (Zona-1, ZO-1) and Occludin, increase intestinal mucosal barrier permeability. It has been used by many studies to form damaged cellular or animal models of intestinal mucosal barrier[15]. Under normal culture conditions, Caco2 cells can spontaneously form a monolayer with upper and lower polarity, which is similar to the differentiation characteristics of intraluminal mucosal epitheliumon. LPS-induced Caco-2 cells have been widely used as a model to evaluate human intestinal mucosal barrier function in vitro[16]. After the treatment of Caco2 cells by LPS, TEER value decreased, FITC-dextran permeability increased, and Occuludin, ZO-1 and claudin5 expression levels decreased[17]. These and other data have resulted in the view that BA protects the intestine barrier while LPS effects adverse role.\u003c/p\u003e \u003cp\u003eStudies have confirmed that ROCK and myosin light chain kinase (MLCK) are involved in the regulation of tight junction protein in the process of intestinal inflammation, and participate in the pathogenesis of irritable bowel syndrome and other diseases[13]. Zearalenone was confirmed to induce intestinal barrier damage by activating the RhoA/ROCK signaling pathway to lead to increased FD-4 passage and significantly reduced TEER. Meanwhile, it could induce the significantly up-regulation of MLCK and down-regulation of occludin, claudin-1, ZO-1, and claudin-3, as well as relocation of ZO-1 in IPEC-J2 Cells [18]. In another study, on bEnd.3 brain endothelial cells, MLCK inhibitor ameliorated the downregulation of ZO-1 and increased permeability of brain endothelial monolayer induced by OGD/R[19]. Procyanidins was verified to maintain normal intestinal barrier functions by inhibiting MLCK, which is similar to the MLCK inhibitor in acrylamide-induced Caco-2 cell monolayer membrane in the third study[20]. In view of the evidence above, whether RhoA/ROCK2/MLCK pathway is associated to the specific role of BA in LPS-induced intestinal damage is deserved to be explored.\u003c/p\u003e \u003cp\u003eIn this study, we explored the optimal concentration and intervention time of BA to protect Caco2, and based on this, explored the damage of Caco2 cells by LPS, and later concluded the optimal time and concentration of BA and LPS when they were administrated to Caco2 cells together. Then, the effects of BA and LPS on the growth status of Caco2 cells, barrier permeability and tight junction protein expression were further studied, as well as the role of RhoA/ROCK2/MLCK signaling pathway in BA protection Caco2 cells from injury caused by LPS.We hypothesize that BA alleviates the intestine mucosal epithelium induced by LPS through inhibiting the activation of RhoA/ROCK2/MLCK signaling pathway, thus providing an important theoretical basis for BA effecting on LPS-induced barrier damage and the new clinical therapeutic schemes of intestinal injury.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman epithelial Caco-2 cells were provided by Kunming Cell Bank, Typical Culture Preservation Committee, Chinese Academy of Sciences, and were grown in Dulbecco\u0026rsquo;s modified Eagle medium (DMEM)/F12 (C11330500BT, Gibco) containing 10% FBS (F8318-500ml, Sigma) and 50 U/mL penicillin\u0026ndash;streptomycin and incubated in a humidified chamber of 5% CO2 at 37\u0026deg;C (PHCbi, MCO-18AC, USP No.6244103). When the cell density reached 80\u0026ndash;90%, the original culture medium was sucked out, the cells were washed twice with PBS and digested with 0.25%EDTA (25200056, Gibco) pancreatic enzyme. After adjusting the cell density, the cells were inoculated on the cell culture plate and cultured until the cells were stable and attached to the wall.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExperimental groups\u003c/h2\u003e \u003cp\u003eFor drug intervention in vitro, PBS (BL302A, biosharp) was used to dissolve LPS (L4319, Sigma), as well as diluent butyric acid (107-92-6, DR.EHRENSTORFER) and Y-27632 (GC15712, GLPbio). To detect the optimal concentration and time of BA and LPS in Caco2 cells, different concentration of BA and LPS were treated for different time in cells. To evaluate the effect of BA on LPS-induced Caco2 cells, the cells were divided into four groups: control group, BA group, BL group and LPS group. To further verify the role of RhoA/ROCK2/MLCK pathway in protective effect of BA in LPS-induced cells, Caco2 cells were divided into four group: control\u0026thinsp;+\u0026thinsp;Y-27632 group, BA\u0026thinsp;+\u0026thinsp;Y-27632 group, BL\u0026thinsp;+\u0026thinsp;Y-27632 group and LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. In these groups, cells were incubated with 10 uM Y-27632 and BA or LPS. Additionally, an equal volume of PBS was used as a control vehicle.The cell experimental treatments and groupings are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExperimental treatments and groupings\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrouping\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eBA affects the cell viability\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 0mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 0.05mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 0.1mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 0.2mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 0.5mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 1.0mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 2.0mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 5.0mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 10.0mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA 20.0mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eintervention for 6 h, 12 h, 18 h, 24 h, 30 h and 36 h, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLPS affects the cell viability\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS intervention for 18 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0, 0.2, 0.5, 1.0, 2.0, 5.0, 10, 20, 50 and 100 ug/ml, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0, 0.2, 0.5, 1.0, 2.0, 5.0, 10, 20, 50 and 100 ug/ml, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS intervention for 36 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0, 0.2, 0.5, 1.0, 2.0, 5.0, 10, 20, 50 and 100 ug/ml, respectively\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBA and LPS commonly affects cell viability\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS 0ug/ml\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2mM BA intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS 2ug/ml\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2mM BA intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS 5ug/ml\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2mM BA intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS 10ug/ml\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2mM BA intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS 20ug/ml\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2mM BA intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS 50ug/ml\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2mM BA intervention for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBA affects LPS-induced Caco2 cells\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003econtrol group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecultured in normally medium\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2 mM BA in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2 mM BA\u0026thinsp;+\u0026thinsp;5 ug/ml LPS in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5 ug/ml LPS in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBA alleviates the epithelial damage through the RhoA/ROCK2/MLCK signaling pathway in LPS-induced Caco2 cells\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003econtrol\u0026thinsp;+\u0026thinsp;Y\u0026minus;27632 group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 uM Y\u0026minus;27632 in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA\u0026thinsp;+\u0026thinsp;Y\u0026minus;27632 group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2 mM BA\u0026thinsp;+\u0026thinsp;10 uM Y\u0026minus;27643 in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBL\u0026thinsp;+\u0026thinsp;Y\u0026minus;27632 group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2 mM BA\u0026thinsp;+\u0026thinsp;5ug/ml LPS\u0026thinsp;+\u0026thinsp;10 uM Y\u0026minus;27643 in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPS\u0026thinsp;+\u0026thinsp;Y\u0026minus;27632 group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5ug/ml LPS\u0026thinsp;+\u0026thinsp;10 uM Y\u0026minus;27643 in the medium for 24 h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell viability\u003c/h2\u003e \u003cp\u003eThe Cell Counting Kit-8 assay (GK10001, GLPbio, USA) was adopted to assess Caco2 cells viability. The cells were inoculated into 96-well plates and cultured according to experimental groups. According to the instructions of the CCK8 kit, each well was treated with 100ul serum-free medium supplementing 10% CCK-8 and incubated at 37℃ for 2h in the dark. The OD absorbance at 450 nm was detected by a microplate reader after mixing. The results of cell proliferation activity were calculated as follows: Cell activity (%) =[A(dosing)-A (blank)]/[A(0 dosing)-A (blank)]x100. Where A (dosing) represents the OD absorbance of the well with culture medium, cells, drug and CCK-8, A (0 dosing) refers to the OD absorbance of the well with culture medium, cells and CCK-8, and A (blank) refers to the OD absorbance of the well with culture medium and CCK-8.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTrans-epithelial electrical resistance (TEER) measurements\u003c/h2\u003e \u003cp\u003eAccording to the experimental group, TEER was measured 24 hours after intervention of relevant factors by using an epithelial voltohmmeter ERS-2 (Millicell-ER-2,Millipore MERS00002, USA). Before the measurement, the system function test is performed and the STX01 electrode is prepared. After that, the electrode was immersed in 70% ethanol for 15 minutes, the electrode was removed and air dried for 15 seconds, and the electrode was washed with PBS. The cells were placed at room temperature for balance for 30 minutes, then ensured that the meter was disconnected from the charger, the mode was turned ON to Ohms, and the switch was turned on. The short end of the electrode was immersed in the inside of the culture plate and the long end was immersed in the outside of the culture plate. The short end should not touch the cells growing on the small chamber membrane, and the long end should touch the bottom of the external hole plate. Electrical resistance of similar values on three consecutive measurements was recorded, the average value was taken. Values were corrected for background resistance and calculated as Ω. cm2. The final TEER = (R1-R0) xA, where R1 represents TEER of Caco2 cells inoculated in each group, R0 represents TEER of the blank control group (TEER of uninoculated cells), and A represents the mask area at the bottom of the cell.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eParacellular marker FD-4 (FITC-Dextran 4 kDa) flux measurements\u003c/h2\u003e \u003cp\u003eParacellular permeability was evaluated via FD-4 (60842-46-8, MedChemExpress) flux. Caco-2 cells (1x10\u003csup\u003e4\u003c/sup\u003e/200uL) were seeded into the upper chamber of 24-well Transwell system (3470, costar, Corning) and 1.5ml fresh medium was added into the lower chamber. After the Caco2 cells were inoculated and stuck to the wall statically, the medium was changed every other day to form monolayers. After intervention with BA, LPS and Y-27632, cells were incubated for 24 h in the upper chamber, the medium was sucked out, the upper chamber was supplemented with serum-free medium, which contained FD-4 with a final concentration of 1mg/mL, and 1mL serum-free medium was replaced into the lower chamber, which was placed back in the cell incubator, incubated at 37℃ for 2h, and then 100ul was absorbed from the lower chamber to the fluorescein enzyme labeled instrument for detection (Victor Nivo, PerkinElmer). The flux of FITC-dextran was calculated from the standard curve of diluents with known concentration gradients.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eReal-time quantitative PCR\u003c/h2\u003e \u003cp\u003eAfter the cells were removed, the old medium was discarded and cleaned once with PBS. The total RNA of Caco2 cells with different factors was extracted according to the instructions of TRIZOL reagent (15596026, Invitrogen, Carlsbad, CA, USA), and the total RNA concentration and purity were determined by ultramicrospectrophotometer (NanoDrop 2000/2000c Spectrophotometer, ThermoScientific). cDNA was prepared by RevertAid First Strand cDNA kit (91258333, Thermo Scientific) using 2ug total RNA as template in gene amplification apparatus (Thermal Cycler T960, Heal Force). Using cDNA as template, SYBR Green fluorescent dye (D7262, Beyotime) was used for relative quantification by real-time quantitative PCR on a 7500 fast real-time PCR system (QuantStudio\u003csup\u003eTM\u003c/sup\u003e5, Life Technologies Holding Pte Ltd) in line with the manufacturer\u0026rsquo;s protocol. A 20ul reaction system was adopted, with 2ul cDNA template, 6.0ul enzyme-free water, 10ul SYBR Premix fluorescence quantitative reaction reagent, and 1.0ul upstream and downstream primers. Reaction condition: predenaturation at 95℃ for 2 minutes; PCR reaction stage: denaturation at 95℃ for 15 seconds, annealing at 60℃ for 10 seconds, extension at 72℃ for 20 seconds, repeated denaturation, annealing and extension, a total of 40 cycles; The dissolution curves are 95℃15 s, 60℃60 s, 95℃15 s. The primer sets were listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The target gene was GAPDH and the results were calculated by 2-ΔΔCt formula. Relative expression was normalized and expressed as a fold change to the expression level in control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer for qRT-PCR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGAGAAGTATGACAACAGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTCCTTCCACGATACCAAAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZO\u0026minus;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCAGTAAGTCGTCCTGATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGGCCAAATCTTCTCACTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOccldin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAAGCGGTTTTATCCAGAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCATCCACAGGCGAAGTTAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRhoA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGAGGCTGGACTCGGATTCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACAGGCTCCATCACCAACAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eROCK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCCGATAACCACCCCTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAGGAATTTAAGCCATCCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGAGGTTGTCTGGTTCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGTGTACTTGGCATCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence analysis\u003c/h2\u003e \u003cp\u003eCaco2 cells were fixed with 4% paraformaldehyde (BL539A, Biosharp) for 10min, then washed with PBS three times for 5 min, permeabilized with 1% Triton X-100 (T8200, Solarbio, China) for 10 min and sealed with 10% goat serum (SL038, Solarbio) at 37\u0026deg;C, and then incubated overnight with rabbit primary antibodies, ZO-1 (ab96587,1:500, Abcam), Occludin (27260-1-AP, 1:500, Proteintech), RhoA(10749-1-AP, 1:500, Proteintech), ROCK2༈20248-1-AP, 1:100, Proteintech, China), MLCK༈21642-1-AP, 1:100, Proteintech༉at 4\u0026deg;C. After three times of PBS washing, the cells were incubated at room temperature with fuorescence-labeled secondary antibodies (ab150081, 1:1000, Abcam) for 1 h. Subsequently, 6-diamino-2-phenylindole (DAPI, P0131, Beyotime, China) was used to staine Nuclei in a dark environment. Images were taken with a fuorescence microscope (N-SIM/C2si, Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism 9.0 (GraphPad Software, USA) was used for data collation, statistics, analysis and plotting. The measurement data of normal distribution were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Analysis of variance of factorial design was used and followed by Tukey\u0026rsquo;s multiple comparison test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eThe optimal concentration and intervention time of BA and LPS on Caco2 cells\u003c/h2\u003e \u003cp\u003eA CCK8 assay was used to research the effect of BA and LPS on the cell viability of Caco2 cells to form the in vitro model. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, the Caco2 cells were treated with different final concentration of BA (0, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 mM) for 0, 6, 12, 18, 24, 30 and 36 h, respectively. Compared with 0 mM BA group, the cell viability of 0.05, 0.1, 0.2, 0.5 and 1 mM BA groups increased with the increase of BA concentration, however the cell viability of 2, 5, 10 and 20 mM BA groups decreased with the increase of BA concentration. BA could improved the viability of cells after it intervented only for 6 h. With the extension of the treatment time, the viability of cells was gradually enhanced, and the effect reached the top at 24 h after treatment, after which the cell viability gradually decreased. Thus, the cell model was created using 0.2 mM BA for 24 h. The effects of LPS at differently final concentrations for 18, 24 and 36 h on the viability of Caco2 cells were further observed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, the viability of Caco2 cells was reduced more and more significantly with increased concentrations of LPS, and the IC50 of LPS fluctuated in the range of 2\u0026ndash;50 ug/ml. When the final concentration of LPS was greater than 5 ug/ml, the cell viability decreased significantly with the extension of the treatment time, moreover, the effect was obviously significant at 24 h after treatment. On the basis of the above results, BA with a final concentration of 0.2mM and LPS with different concentrations (2, 5, 10, 20 and 50 ug/ml, respectively) were simultaneously administrated to Caco2 cells for 24 h. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, the IC50 of LPS increased significantly when BA was present, suggesting that BA could inhibit the cell damage caused by LPS. The protective effect of BA was relatively stable when the concentration of LPS was 2\u0026ndash;10 ug/ml. When the concentration of LPS was greater than 10 ug/ml, the protective effect of BA decreased significantly. Therefore, 0.2 mM BA and 5 ug/ml LPS intervention for 24 h were used to create the cells model in vitro in follow-up experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBA attenuated the epithelial barrier injury induced by LPS in Caco2 cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the administrated BA improved the growth status of cells. After 24 h treatment with BA or LPS, compared with 0 h treatment, the cells in control group and BA group had close connections and clear boundaries, and the cells in BA group were more obvious, and the cell growth was good. The cells in BL group and LPS group had shrunken, unclear boundaries, separation from surrounding cells, and poor growth, especially in LPS group. Compared with control group, the cells in BA group were more closely connected and had better growth status, while the cells in BL group and LPS group shrank and had unclear boundaries and poor growth status, and the cell status of LPS group was more severe. Subsequently, epithelial barrier function was evaluated by TEER and by FD-4 flux through the monolayer on the transwell membrane after BA and LPS. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, TEER in LPS group was significantly reduced compared with control group, meanwhile, compared with BL group. It shows that BA can relieve the increased permaebility of Caco2 cells barrier. After 24 h of treatment with BA and LPS, there was no significance between BA group and control group (1718.000\u0026thinsp;\u0026plusmn;\u0026thinsp;2.000 Ω.cm\u003csup\u003e2\u003c/sup\u003e vs. 1720.000\u0026thinsp;\u0026plusmn;\u0026thinsp;1.000Ω.cm\u003csup\u003e2\u003c/sup\u003e, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05 ). Compared with control group, TEER of BL group (1464.667\u0026thinsp;\u0026plusmn;\u0026thinsp;7.572 Ω.cm\u003csup\u003e2\u003c/sup\u003e) showed a sharp decrease (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), moreover, it was more serious (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) in LPS group (1123.667\u0026thinsp;\u0026plusmn;\u0026thinsp;4.041Ω.cm\u003csup\u003e2\u003c/sup\u003e). TEER value of LPS group showed an obvious decrease compared to that in BL group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC showed that compared with the concentration of FD-4 in control group (4.594\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015 ug/ml), the concentration of FD-4 in BA group (3.048\u0026thinsp;\u0026plusmn;\u0026thinsp;0.064 ug/ml) decreased, however, increased concentration of FD-4 in BL group (7.080\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006 ug/mL) was found, moreover, and more significant increase in LPS group (8.821\u0026thinsp;\u0026plusmn;\u0026thinsp;0.013 ug/mL) was showed. The concentration of FD-4 more significantly in the LPS group compared to that in BL group. These results indicate that BA mitigates LPS-induced decline in TEER and increase in FD-4 flux of Caco2 cell barrier to improve the epithelial barrier.\u003c/p\u003e \u003cp\u003eZO -1 and Occludin play an important role in intestine barrier, they form a continuous and circumferential structure at the boundary in epithelial cells, which are important for the exchange of substances, therefore, they are considered as useful biomarkers to reflect the epithelial barrier function[21]. To examine the mechanisms by which BA modifies epithelial function, the change of tight junction protein ZO-1 and Occludin was evaluated by RT-qPCR and immunofluorescent staining. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, after 24 h of intervention with BA and LPS, compared with the control group, the expression of ZO-1 mRNA in BA group was increased, the expression of ZO-1 mRNA in BL group was decreased, and the expression of ZO-1 mRNA in LPS group was also decreased. The expression of ZO-1 mRNA in BL group was higher than that in LPS group. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE showed that compared with control group, the Occludin mRNA expression increased in BA group, while higher Occludin mRNA expression was showed in BL group and decreased LPS group. The mRNA expression of Occludin in BL group was higher than that in LPS group. ZO-1 and Occludin mRNA expression were significantly down-regulated after LPS exposure, meanwhile, BA enhanced ZO-1 and Occludin mRNA expression after LPS exposure. Our data in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF showed that ZO-1 and Occludin were observed as a clear, continuous and organized net pattern surrounding the plasma membrane constituting a cell-cell junction in the control group and BA group, especially in BA group. After 24 h of LPS exposure, Caco2 cells presented depletion of ZO-1 and Occludin in several sites with a loose and discontinuous net pattern, which presented as apparently serrated or notched and fissured in BL group and LPS group, especially in LPS group. In addition, cytoplasmic accumulation of ZO-1 and Occludin in some regions were observed in BL group and LPS group, however, the presence of BA alleviated the alteration of ZO-1 and Occludin. These data suggests that the integrity of tight junction has been changed with a redistribution of ZO-1 and Occludin after LPS and BA exposure. In agreement with functional changes in barrier permeability, LPS administration observably decrease the expression of ZO-1 and Occludin, as well as modulated the reconstruction of continuous and integrated band pattern of ZO-1 and Occludin, while BA reversed LPS-induced abnormal alterations in expression and structures of ZO-1 and Occludin, hinting that tight junction is necessary for protection by BA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBA affects the RhoA/ROCK2/MLCK signaling pathway in LPS-induced Caco2 cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSubsequently, we investigated the role of BA in potential signaling pathway. Since RhoA/ROCK2 and MLCK has been reported to play a pivotal role in intestine barrier function, plays a vital role in the regulation of epithelial tight junctions and paracellular leakage pathways[22\u0026ndash;23]. We further investigated involvements of the pathway in LPS-induced Caco2 cells and BA-prevented cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, after 24 h treatment with BA and LPS, the RhoA mRNA expression in BA group was decreased, while the expression of RhoA mRNA in BL group and in LPS group was increased, compared to that in control group. The expression of RhoA mRNA in BL group was lower than that in LPS group. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, compared with control group, the expression of ROCK2 mRNA in BA group was decreased. However, the expression of ROCK2 mRNA in BL group and in LPS group was increased. Moreover, the mRNA expression of ROCK2 showed a significant lower tread in BL group than that in LPS group. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC showed that compared with control group, the MLCK mRNA expression in BA group was decreased, the MLCK mRNA expression in BL group and LPS group was increased. The MLCK mRNA expression in BL group was lower than that in LPS group. Compared with control group, the mRNA expression of RhoA, ROCK2 and MLCK increased in LPS group. However, the expression changes of these mRNA were partly abolished by BA treatment. What\u003csup\u003e,\u003c/sup\u003es more, immunofluorescence stainning in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD showed that, in the control group and BA group, RhoA was mainly distributed in the cell membrane and cytoplasm, the expression of RhoA was significantly increased after LPS stimulation, and moved to the nucleus, so the expression was increased in the nucleus. The expression of RhoA in BL group was lower than that in LPS group, and RhoA mainly distributed in perinuclear and cytoplasm. ROCK2 was mainly distributed around cytoplasm and nucleus, the expression of ROCK2 was significantly increased after LPS stimulation, and its distribution around cell membrane and in nucleus was significantly increased. BA decreased the expression of ROCK2 induced by LPS, and decreased its distribution in perimembrane and nucleus. In control group and BA group, MLCK was mainly distributed in the cytoplasm and nucleus. After LPS exposure, the expression of MLCK was significantly increased and moved to the cell membrane, and the expression level around the cell membrane was significantly increased. LPS stimulation increased expression of RhoA, ROCK2 and MLCK in Caco2 cells, and changed the distribution of them in cells, while BA decreased the expression of them and reversed the subcellular localization of them. Take together, BA may improved the barrier function of Caco2 cells through inhibiting the RhoA/ROCK2/MLCK pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eY-27632 treatment enhanced the protective role of Butyric acid in LPS-induced Caco2 cells\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFinally, due to an important role of RhoA/ROCK2/MLCK pathway involved in epithelial injury in LPS-induced Caco2 cells as previously mentioned, the Caco2 cells were additionally treated with Y-27632, the inhibitor of ROCK, to further explore whether RhoA/ROCK2/MLCK pathway is an indispensable pathway by which BA exerted its protective effects on barrier injury in LPS-induced Caco2 cells. Firstly, as exhibited in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, the cells in the control\u0026thinsp;+\u0026thinsp;Y-27632 and BA\u0026thinsp;+\u0026thinsp;Y27632 group had tight connections, clear boundaries and good cell growth, similar to that without Y-27632 after the intervention of Y-27632 and BA or LPS for 24 h. The cells in BL\u0026thinsp;+\u0026thinsp;Y-27632 group and the LPS\u0026thinsp;+\u0026thinsp;Y-27632 group showed shrank cells, which had not clear boundary, and were separated from the surrounding cells, and the growth state was poor, especially in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. However, the growth state of the cells was improved, the wrinkling phenomenon was improved, and the connection among cells was closer when the two groups were treated with Y-27632. Secondly, as showed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, compared to that in control\u0026thinsp;+\u0026thinsp;Y-27632 group (1720.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.000 Ω.cm\u003csup\u003e2\u003c/sup\u003e), TEER was no significance (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in the BA\u0026thinsp;+\u0026thinsp;Y-27632 group (1719.667\u0026thinsp;\u0026plusmn;\u0026thinsp;0.577 Ω.cm\u003csup\u003e2\u003c/sup\u003e). However, BL\u0026thinsp;+\u0026thinsp;Y-27632 group (1570.000\u0026thinsp;\u0026plusmn;\u0026thinsp;1.000 Ω.cm\u003csup\u003e2\u003c/sup\u003e) and LPS\u0026thinsp;+\u0026thinsp;Y-27632 group (1320.000\u0026thinsp;\u0026plusmn;\u0026thinsp;1.000 Ω.cm\u003csup\u003e2\u003c/sup\u003e) showed a decreased TEER (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and more obvious alteration was found in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Compared with BL\u0026thinsp;+\u0026thinsp;Y-27632 group, TEER of LPS\u0026thinsp;+\u0026thinsp;Y-27632 group decreased significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Compared with control group or BA group, TEER of control\u0026thinsp;+\u0026thinsp;Y-27632 group or BA\u0026thinsp;+\u0026thinsp;Y-27632 group had no significant change (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Compared with BL group, the decrease of TEER in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was improved (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Decreased TEER was significantly improved in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group compared with LPS group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating higher barrier integrity. Thirdly, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, compared with the control\u0026thinsp;+\u0026thinsp;Y-27632 group, the concentration of FD-4 in lower chamber was (4.600\u0026thinsp;\u0026plusmn;\u0026thinsp;0.013 ug/ml). The concentration of FD-4 in BA\u0026thinsp;+\u0026thinsp;Y-27632 group decreased (3.052\u0026thinsp;\u0026plusmn;\u0026thinsp;0.026, ug/ml). The concentration of FD-4 in BL\u0026thinsp;+\u0026thinsp;Y-27632 group (5.384\u0026thinsp;\u0026plusmn;\u0026thinsp;0.132 ug/ml) and LPS\u0026thinsp;+\u0026thinsp;Y-27632 group (7.283\u0026thinsp;\u0026plusmn;\u0026thinsp;0.052 ug/mL) increased, and the concentration of FD-4 in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group was even higher. Compared to that in BL\u0026thinsp;+\u0026thinsp;Y-27632 group, the concentration of FD-4 in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group increased significantly. Compared with control group, FD-4 concentration of in control\u0026thinsp;+\u0026thinsp;Y-27632 group had no significant change. Compared with BA group, the concentration of FD-4 in BA\u0026thinsp;+\u0026thinsp;Y-27632 group had no significant change. Compared with BL group, the concentration decline of FD-4 in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was improved. The concentration of FD-4 decreased significantly in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group compared with that in LPS group. Moreover, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, compared with control\u0026thinsp;+\u0026thinsp;Y-27632 group, the expression of ZO-1 mRNA in BA\u0026thinsp;+\u0026thinsp;Y-27632 group was increased, while the expression of ZO-1 mRNA in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was not decreased. The expression of LPS\u0026thinsp;+\u0026thinsp;Y-27632 group was also decreased. The expression of ZO-1 mRNA in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was higher than that in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. Compared with control group, the Occludin mRNA expression of BA\u0026thinsp;+\u0026thinsp;Y-27632 group increased, and the Occludin mRNA expression of BL\u0026thinsp;+\u0026thinsp;Y-27632 group did not decrease. The expression of Occludin mRNA in LPS\u0026thinsp;+\u0026thinsp;Y-27632 also decreased. The mRNA expression of Occludin in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was higher than that in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. It was proved that BA and Y-27632 can synergetically increase mRNA expression of ZO-1 and Occludin in LPS-induced Caco2 cells. However, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH, compared with control\u0026thinsp;+\u0026thinsp;Y-27632 group, RhoA mRNA expression in BA\u0026thinsp;+\u0026thinsp;Y-27632 group was decreased, while RhoA mRNA expression in BL\u0026thinsp;+\u0026thinsp;Y-27632 group and LPS\u0026thinsp;+\u0026thinsp;Y-27632 group was increased. The expression of RhoA mRNA in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was lower than that in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. Compared with the control\u0026thinsp;+\u0026thinsp;Y-27632 group, the expression of ROCK2 mRNA in BA\u0026thinsp;+\u0026thinsp;Y-27632 group was decreased, the expression of ROCK2 mRNA in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was not significantly changed, and the expression of ROCK2 mRNA in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group was also increased. The mRNA expression of ROCK2 in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was lower than that in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. Compared with control\u0026thinsp;+\u0026thinsp;Y-27632 group, the expression of MLCK mRNA in BA\u0026thinsp;+\u0026thinsp;Y-27632 group was decreased, there was no significant change in the expression of MLCK mRNA in BL\u0026thinsp;+\u0026thinsp;Y-27632 group, and the expression of MLCK mRNA in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group was increased. The MLCK mRNA expression in BL\u0026thinsp;+\u0026thinsp;Y-27632 group was lower than that in LPS\u0026thinsp;+\u0026thinsp;Y-27632 group. Take together, the mRNA expression of RhoA, ROCK2 and MLCK was notably elevated upon LPS stimulation in Caco2 cells, while BA significantly reduced the mRNA expression of these factors, which was partly enhanced by Y-27632 treatment, hindering by co-treatment with BA and Y-27632. The results showed that BA and Y-27632 could synergistically reduce the mRNA expression of RhoA, ROCK2 and MLCK mRNA. In addition, immunofluorence indicated that increased ZO-1 and Occludin expression was found on the cell membrane, when cells were exposure to Y-27632 and BA(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). However, compared with the control\u0026thinsp;+\u0026thinsp;Y-27632 group, the expression of RhoA, ROCK2 and MLCK in BA\u0026thinsp;+\u0026thinsp;Y-27632 group decreased. RhoA was mainly distributed in the cell membrane and cytoplasm, ROCK2 was mainly distributed around the cytoplasm and nucleus, and MLCK was mainly located in the cytoplasm and nucleus. After LPS stimulation, the expression of RhoA, ROCK2 and MLCK increased significantly, RhoA moved to the nucleus, the expression increased in the nucleus, and the distribution of ROCK2 around the cell membrane and in the nucleus increased significantly. When MLCK moved to the cell membrane, the expression level around the cell membrane increased obviously. However, BA decreased the expression of RhoA, ROCK2 and MLCK induced by LPS and improved their distribution in cells. The expression levels of RhoA, ROCK2 and MLCK decreased after Y-27632 treatment compared with the control group. Compared with BA group, the expression levels of RhoA, ROCK2 and MLCK were also decreased. Compared with BL group and LPS group, LPS-induced abnormal expression and distribution were further improved by Y-27632 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). On the basis of above data, additional treatment of Y-27632 greatly improved the growth status, reduced the permeability of monolayer epithelial barrier, increased expression of ZO-1 and Occludin, decreased expression of RhoA, ROCK2 and MLCK, as well as reversed the redistribution of ZO-1, Occludin, RhoA, ROCK2 and MLCK, a perspective was upheld that BA down-regulats RhoA/ROCK2/MLCK pathway to modulate the expression and location of tight junction to provide the protective effect in the presence of LPS.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMany enteral and systematic diseases lead to intestinal epithelial barrier damage and manifestations of enteritis. The pathogenesis and potential therapies for intestinal epithelial barrier damage have been widely researched[24]. The main treatment measures for intestinal epithelial barrier damage and enteritis are to use antibiotics, which may lead to intestinal flora imbalance and other problems[25]. However, appropriate techniques through food supplement with no adverse effect for reversing intestinal epithelial barrier damage to improve patient outcomes and prognosis have not yet definitely been established. Therefore, finding a new regimen with therapeutic value for intestinal epithelial barrier damage is of great significance for basic and clinical research. BA not only provides energy for colon cells, but also is important to maintain intestinal epithelial cells integrity[26]. Correspondingly, many studies have found that LPS induces intestinal barrier damage and has been a common molding methods[15]. Therefore, in this study, LPS was selected as a stimulating factor to create an in vitro intestinal barrier damage model. At the same time, BA as a protective factor of Caco2 cells to study the role of BA in LPS-induced intestinal barrier damage and possible related mechanisms. In this present study, it was found that BA could improve cell viability, improve the growth status of Caco2 cells, maintain the integrity of intestinal epithelial barrier, up-regulate ZO-1 and Occludin expression, maintain their subcellular distribution, inhibit RhoA/ROCK2/MLCK signaling pathway, reversed intracellular distribution of RhoA, ROCK2 and MLCK, leading to alleviate the LPS-caused damage of intestinal barrier. After addition of Y-27632, a kind of ROCK inhibitor, BA could further improve the above function. Therefore, this study concluded that BA could alleviate LPS-induced epithelial barrier damage of Caco2 cells by inhibiting RhoA/ROCK2/MLCK signaling pathway and provided a mechanistic research of the regulatory role of BA in intestine barrier damage.\u003c/p\u003e \u003cp\u003eThe intestinal mucosal barrier, composed of intestinal epithelial cells and mucus in the intestinal cavity, forms the first defensive barrier against pathogens. Therefore, the mechanical barrier of intestinal epithelial cells plays a vital role[27]. Its function is closely related to the tight junctions and gap junctions between epithelial cells, especially the tight junctions at the apical side of epithelial cells. Tight junctions are formed by the polymerization of several proteins, including transmembrane proteins junction adhesion molecules and triglycerides. Transmembrane proteins include claudins, occludins, and so on. Perimembrane proteins are mainly ZOs, including ZO-1, ZO-2 and ZO-3, which bridge membrane proteins to actin skeleton structure and signal transmitting proteins. The function of tight junction is relative to the arrangement of actin and the interaction among transmembrane proteins, it regulates the transcellular movement of substances including ions and water and closely related to transcellular permeability[28]. TEER is formed by ions flowing through the paracellular space and used as to reflect integrality of the monolayer barrier, TEER decreases when the barrier is damaged, while increases to a certain level when monolayer cell barrier is formed[29]. FD-4 flux is also used to evaluate monolayer epithelial barrier integrity[30]. Detection of TEER and FD-4 flux was included in this experiment.\u003c/p\u003e \u003cp\u003eBA is a short-chain fatty acid that provides 60\u0026ndash;70% of the energy required for intestinal mucosal epithelial cells. Studies have confirmed that BA enhances the intestinal barrier integrity by up-regulating the expression of Claudin2 and decreasing intestinal permeability through an IL-10 receptor-dependent mechanism[31]. In the presence of hypoxia-inducable-factor-1, as its stabilizer, BA activates genes encoding tight junction protein, and up-regulates the expression of tight junction proteins through transcription factor recombinant protein, to improve intestinal epithelial barrier function[32\u0026ndash;33]. In this experiment, low final concentration (0-0.5mM) improved cell viability, while high concentration showed the opposite effect. A final concentration of 0.2mM BA treatment Caco2 cells for 24 h could significantly improve cell viability, confirming that low concentration of BA plays a protective role in maintaining intestinal epithelial barrier. On the basis of the above results, 0.2mM BA treatment Caco2 cells for 24 h was selected to proceed to the next stage of the experiment[34] .\u003c/p\u003e \u003cp\u003eLPS-induced cell models have been widely used to assess intestinal epithelial barrier damage[35]. In the present study, different concentration of LPS was administrated to Caco2 cells for 18, 24 and 30 h, respectively. Through CCK-8 test, it was found that IC50 of LPS fluctuated in the range of 2\u0026ndash;50 ug/ml, therefore, 2, 5, 10, 20 and 50 ug/ml LPS were added to Caco2 cells for 24 h, the results indicated that BA played a role in protecting epithelial barrier when the concentration of LPS was 2\u0026ndash;10 ug/ml. Finally, in vitro model was created by using 0.2 mM BA and 5 ug/ml LPS for 24 h. LPS decreased TEER, and increased FD-4 flux, deteriorated the growth status of cells, down-regulated the expression of ZO-1 and Occludin, changed their intracellular distribution. The data were similar to the previous researches[36\u0026ndash;37], indicating LPS induced intestine epithelial barrier dysfunction. When BA was administrated, these effects were mitigated significantly, inhibiting BA could reverse the epithelial barrier injury. These results related to BA improving barrier junction were consistent with previous studies[14].\u003c/p\u003e \u003cp\u003eRhoA plays a vital role in junction polymerization and function, which leads to abnormal tight junction function of epithelial cells[38]. Studies have shown that EphB2-Exos has been proved to protect the activity of Caco2 by inhibiting RhoA/ROCK pathway, and promote cell proliferation and migration[39]. Extracellular enzymes C3, Y-27632 and selective RhoA, ROCK1 and ROCK2 siRNAs significantly inhibited Caco2 epithelial cell migration[40]. LPS and TNF-α induced ROCK activation in Caco2 cells, which resulted in the relocation of ZO-1 and caludin-2, and ultimately down-regulated TEER and up-regulated FD-4 flux[41]. In brain capillary endothelial cells, the viability of cells decreased, TEER decreased, and fluorescence yellow permeability increased after LPS treatment. Transmission electron microscopy showed that cell tight junction were damaged after LPS exposure, and the expressions of claudin-5 and ZO-1 decreased, meanwhile, the mRNA expression of claudin-5 and Occludin decreased. By inhibiting RhoA/ROCK2 pathway, catalpol reversed the expression of proteins such as ZO-1 and Occludin, and reversed the increased blood-brain barrier permeability caused by LPS[42]. In addition, MLCK is also important in the physiological and pathophysiological regulation of epithelial tight junction protein. In vitro experiments showed that ZO-1 remodeling induced by MLCK was similar to Occludin and F-actin. Inflammatory stimulation, such as TNF-α, promoted MLCK activation, and Occludin bridging onto MLCK-dependent actin loops, resulting in endocytosis of Occludin, sequentially increasing paracellular permeability[43]. ROCK1 and MLCK were activated in Caco2 cells treated with LPS, thereby activating p-MYPT1 and p-MLC, and down-regulating tight junction protein expression[44]. After LPS was given to Caco2 cells, the distribution of ZO-1 and claudin-1 changed and activated the MLCK/MLC pathway, resulting in high permeability[45]. Sodium fluoride activated the calcium-dependent RhoA/ROCK pathway and MLCK, promoted the fracture of ZO-1 in Caco2 cells, changed the intracellular rearrangement of ZO-1 and F-actin, and induced intestinal mucosal damage, while Y-27632 reversed these effects induced by sodium fluoride[46]. In the study, LPS increased the mRNA expression of RhoA[47], ROCK2 [48] and MLCK [49] and affected the distribution of these proteins in Caco2 cells. In the control group, RhoA was mainly distributed in the cell membrane and cytoplasm[50], ROCK2 was mainly located around cytoplasm and nucleus[51], while MLCK was mainly distributed in the cytoplasm and nucleus. The expression of RhoA was significantly increased, and moved to the nucleus, the expression of ROCK2 around cell membrane and in nucleus was significantly increased, while the expression level of MLCK around the cell membrane was significantly increased after LPS stimulation[52]. After BA treatment, the mRNA expression levels of these proteins decreased and their distribution in cells also reversed[53]. When Y-27632, ROCK inhibitor, was added to Caco2 cells for 24 h, the viability and growth status of Caco2 cells, integrality of barrier, the expression and location of ZO-1 and Occludin, as well as the activated station of RhoA/ROCK2/MLCK pathway were further improved[54]. In summary, Y-27632 played a synergistic role with BA, which further proved that RhoA/ROCK/MLCK pathway participated in the protection of BA from epithelial barrier damage induced by LPS.\u003c/p\u003e \u003cp\u003eThere are several limitations to the present investigation. In the present study, we did not evaluate the role of inhibitor of RhoA and MLCK[55], nor did we conduct related researches using agonists of RhoA, ROCK2 and MLCK, further research is required to include agonists and other protein inhibitors except Y-27632 to further clarify the function of RhoA/ROCK2/MLCK signaling pathway. Furthermore, we only investigate one signaling pathway, it is still necessary to further expand experiments which relate to mechanisms. In addition, this experiment was only conducted on Caco2 cells, but there are many intestinal epithelial cell lines, which need to be further researched. Moreover, precise and versatile molecular researches should be adopted to better explore the direct target of BA on the RhoA/ROCK2/MLCK signaling pathway.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, these data indicate BA plays an important role in intestine barrier protection through improving the viability and growth state of intestinal epithelial cells, increasing their TEER and reducing FD-4 flux, maintaining barrier integrity, and reversing the expression and location of ZO-1 and Occludin in Caco2 cells induced by LPS, which depends on activating RhoA/ROCK2/MLCK signaling pathway. This study extends the understanding of the pathogenesis of LPS-induced intestinal injury, as well as provides rationales for BA as new potential treatment for patients suffering from intestine barrier damage.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank the support provided from the National Natural Science Foundation of China and Science and Technology Department of Yunnan Province.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eOdenwald MA, Turner JR. The intestinal epithelial barrier: a therapeutic target? Nature reviews Gastroenterology \u0026amp; hepatology. 2017;14(1):9-21.\u003c/li\u003e\n\u003cli\u003eCelebi S\u0026ouml;zener Z, Cevhertas L, Nadeau K, Akdis M, Akdis CA. Environmental factors in epithelial barrier dysfunction. The Journal of allergy and clinical immunology. 2020;145(6):1517-28.\u003c/li\u003e\n\u003cli\u003eAkdis CA. Does the epithelial barrier hypothesis explain the increase in allergy, autoimmunity and other chronic conditions? Nature reviews Immunology. 2021;21(11):739-51.\u003c/li\u003e\n\u003cli\u003eZmora N, Suez J, Elinav E. You are what you eat: diet, health and the gut microbiota. Nature reviews Gastroenterology \u0026amp; hepatology. 2019;16(1):35-56.\u003c/li\u003e\n\u003cli\u003eGroschwitz KR, Hogan SP. Intestinal barrier function: molecular regulation and disease pathogenesis. The Journal of allergy and clinical immunology. 2009;124(1):3-20; quiz 1-2.\u003c/li\u003e\n\u003cli\u003eGasaly N, de Vos P, Hermoso MA. Impact of Bacterial Metabolites on Gut Barrier Function and Host Immunity: A Focus on Bacterial Metabolism and Its Relevance for Intestinal Inflammation. Frontiers in immunology. 2021;12:658354.\u003c/li\u003e\n\u003cli\u003eMartin-Gallausiaux C, Marinelli L, Blotti\u0026egrave;re HM, Larraufie P, Lapaque N. SCFA: mechanisms and functional importance in the gut. The Proceedings of the Nutrition Society. 2021;80(1):37-49.\u003c/li\u003e\n\u003cli\u003eSteele MA, Penner GB, Chaucheyras-Durand F, Guan LL. Development and physiology of the rumen and the lower gut: Targets for improving gut health. Journal of dairy science. 2016;99(6):4955-66.\u003c/li\u003e\n\u003cli\u003ePohl K, Moodley P, Dhanda A. The effect of increasing intestinal short-chain fatty acid concentration on gut permeability and liver injury in the context of liver disease: A systematic review. Journal of gastroenterology and hepatology. 2022;37(8):1498-506.\u003c/li\u003e\n\u003cli\u003eOtani T, Furuse M. Tight Junction Structure and Function Revisited. Trends in cell biology. 2020;30(10):805-17.\u003c/li\u003e\n\u003cli\u003eMonaco A, Ovryn B, Axis J, Amsler K. The Epithelial Cell Leak Pathway. International journal of molecular sciences. 2021;22(14).\u003c/li\u003e\n\u003cli\u003eSuzuki T. Regulation of intestinal epithelial permeability by tight junctions. Cellular and molecular life sciences : CMLS. 2013;70(4):631-59.\u003c/li\u003e\n\u003cli\u003eDu L, Kim JJ, Shen J, Dai N. Crosstalk between Inflammation and ROCK/MLCK Signaling Pathways in Gastrointestinal Disorders with Intestinal Hyperpermeability. Gastroenterology research and practice. 2016;2016:7374197.\u003c/li\u003e\n\u003cli\u003eChen X, Kong Q, Zhao X, Zhao C, Hao P, Irshad I, et al. Sodium acetate/sodium butyrate alleviates lipopolysaccharide-induced diarrhea in mice via regulating the gut microbiota, inflammatory cytokines, antioxidant levels, and NLRP3/Caspase-1 signaling. Frontiers in microbiology. 2022;13:1036042.\u003c/li\u003e\n\u003cli\u003eGiordano NP, Cian MB, Dalebroux ZD. Outer Membrane Lipid Secretion and the Innate Immune Response to Gram-Negative Bacteria. Infection and immunity. 2020;88(7).\u003c/li\u003e\n\u003cli\u003eNighot M, Al-Sadi R, Guo S, Rawat M, Nighot P, Watterson MD, et al. Lipopolysaccharide-Induced Increase in Intestinal Epithelial Tight Permeability Is Mediated by Toll-Like Receptor 4/Myeloid Differentiation Primary Response 88 (MyD88) Activation of Myosin Light Chain Kinase Expression. The American journal of pathology. 2017;187(12):2698-710.\u003c/li\u003e\n\u003cli\u003eWu XX, Huang XL, Chen RR, Li T, Ye HJ, Xie W, et al. Paeoniflorin Prevents Intestinal Barrier Disruption and Inhibits Lipopolysaccharide (LPS)-Induced Inflammation in Caco-2 Cell Monolayers. Inflammation. 2019;42(6):2215-25.\u003c/li\u003e\n\u003cli\u003eB H, J W, A G, T W, J L, A S. - Zearalenone-Induced Mechanical Damage of Intestinal Barrier via the RhoA/ROCK. International journal of molecular sciences. 2022;23(20).\u003c/li\u003e\n\u003cli\u003eLi C, Zhang Y, Liu R, Mai Y. Anagliptin Protected against Hypoxia/Reperfusion-Induced Brain Vascular Endothelial Permeability by Increasing ZO-1. ACS omega. 2021;6(11):7771-7.\u003c/li\u003e\n\u003cli\u003eYan F, Chen W, Zhao L, Lu Q, Wang C, Liu R. Procyanidin A(1) and its digestive products prevent acrylamide-induced intestinal barrier dysfunction via the MAPK-mediated MLCK pathway. Food \u0026amp; function. 2021;12(23):11956-65.\u003c/li\u003e\n\u003cli\u003eLi J, Zhang L, Wu T, Li Y, Zhou X, Ruan Z. Indole-3-propionic Acid Improved the Intestinal Barrier by Enhancing Epithelial Barrier and Mucus Barrier. Journal of agricultural and food chemistry. 2021;69(5):1487-95.\u003c/li\u003e\n\u003cli\u003eZhao D, Jiao S, Yi H. Arsenic exposure induces small intestinal toxicity in mice by barrier damage and inflammation response via activating RhoA/ROCK and TLR4/Myd88/NF-\u0026kappa;B signaling pathways. Toxicology letters. 2023;384:44-51.\u003c/li\u003e\n\u003cli\u003eHuang S, Fu Y, Xu B, Liu C, Wang Q, Luo S, et al. Wogonoside alleviates colitis by improving intestinal epithelial barrier function via the MLCK/pMLC2 pathway. Phytomedicine : international journal of phytotherapy and phytopharmacology. 2020;68:153179.\u003c/li\u003e\n\u003cli\u003ePellegrini C, Fornai M, D\u0026apos;Antongiovanni V, Antonioli L, Bernardini N, Derkinderen P. The intestinal barrier in disorders of the central nervous system. The lancet Gastroenterology \u0026amp; hepatology. 2023;8(1):66-80.\u003c/li\u003e\n\u003cli\u003eZhao C, Hu X, Qiu M, Bao L, Wu K, Meng X, et al. Sialic acid exacerbates gut dysbiosis-associated mastitis through the microbiota-gut-mammary axis by fueling gut microbiota disruption. Microbiome. 2023;11(1):78.\u003c/li\u003e\n\u003cli\u003eBenvenuti L, D\u0026apos;Antongiovanni V, Pellegrini C, Fornai M, Bernardini N, Ippolito C, et al. Dietary Supplementation with the Probiotic SF68 Reinforces Intestinal Epithelial Barrier in Obese Mice by Improving Butyrate Bioavailability. Molecular nutrition \u0026amp; food research. 2023;67(13):e2200442.\u003c/li\u003e\n\u003cli\u003eMitamura Y, Ogulur I, Pat Y, Rinaldi AO, Ardicli O, Cevhertas L, et al. Dysregulation of the epithelial barrier by environmental and other exogenous factors. Contact dermatitis. 2021;85(6):615-26.\u003c/li\u003e\n\u003cli\u003eKuo WT, Odenwald MA, Turner JR, Zuo L. Tight junction proteins occludin and ZO-1 as regulators of epithelial proliferation and survival. Annals of the New York Academy of Sciences. 2022;1514(1):21-33.\u003c/li\u003e\n\u003cli\u003eSpalinger MR, Sayoc-Becerra A, Santos AN, Shawki A, Canale V, Krishnan M, et al. PTPN2 Regulates Interactions Between Macrophages and Intestinal Epithelial Cells to Promote Intestinal Barrier Function. Gastroenterology. 2020;159(5):1763-77.e14.\u003c/li\u003e\n\u003cli\u003eOuyang F, Li B, Wang Y, Xu L, Li D, Li F, et al. Attenuation of Palmitic Acid-Induced Intestinal Epithelial Barrier Dysfunction by 6-Shogaol in Caco-2 Cells: The Role of MiR-216a-5p/TLR4/NF-\u0026kappa;B Axis. Metabolites. 2022;12(11).\u003c/li\u003e\n\u003cli\u003eGonzalez A, Krieg R, Massey HD, Carl D, Ghosh S, Gehr TWB, et al. Sodium butyrate ameliorates insulin resistance and renal failure in CKD rats by modulating intestinal permeability and mucin expression. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association. 2019;34(5):783-94.\u003c/li\u003e\n\u003cli\u003eParada Venegas D, De la Fuente MK, Landskron G, Gonz\u0026aacute;lez MJ, Quera R, Dijkstra G, et al. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Frontiers in immunology. 2019;10:277.\u003c/li\u003e\n\u003cli\u003eYin J, Zhou C, Yang K, Ren Y, Qiu Y, Xu P, et al. Mutual regulation between butyrate and hypoxia-inducible factor-1\u0026alpha; in epithelial cell promotes expression of tight junction proteins. Cell biology international. 2020;44(6):1405-14.\u003c/li\u003e\n\u003cli\u003eSalvi PS, Cowles RA. Butyrate and the Intestinal Epithelium: Modulation of Proliferation and Inflammation in Homeostasis and Disease. Cells. 2021;10(7).\u003c/li\u003e\n\u003cli\u003eCao Y, Teng Y, Liu H, Li J, Zhu B, Xia X. Rhopilema esculentum polysaccharides enhance epithelial cell barrier in vitro and alleviate chronic colitis in mice. International journal of biological macromolecules. 2023;241:124560.\u003c/li\u003e\n\u003cli\u003eGigli S, Seguella L, Pesce M, Bruzzese E, D\u0026apos;Alessandro A, Cuomo R, et al. Cannabidiol restores intestinal barrier dysfunction and inhibits the apoptotic process induced by Clostridium difficile toxin A in Caco-2 cells. United European gastroenterology journal. 2017;5(8):1108-15.\u003c/li\u003e\n\u003cli\u003eLi BL, Zhao DY, Du PL, Wang XT, Yang Q, Cai YR. Luteolin alleviates ulcerative colitis through SHP-1/STAT3 pathway. Inflammation research : official journal of the European Histamine Research Society [et al]. 2021;70(6):705-17.\u003c/li\u003e\n\u003cli\u003eTong J, Wang Y, Chang B, Zhang D, Wang B. Evidence for the Involvement of RhoA Signaling in the Ethanol-Induced Increase in Intestinal Epithelial Barrier Permeability. International journal of molecular sciences. 2013;14(2):3946-60.\u003c/li\u003e\n\u003cli\u003eChu S, Yu T, Wang W, Wu H, Zhu F, Wei C, et al. Exosomes derived from EphB2-overexpressing bone marrow mesenchymal stem cells regulate immune balance and repair barrier function. Biotechnology letters. 2023;45(5-6):601-17.\u003c/li\u003e\n\u003cli\u003eChaturvedi LS, Marsh HM, Basson MD. Role of RhoA and its effectors ROCK and mDia1 in the modulation of deformation-induced FAK, ERK, p38, and MLC motogenic signals in human Caco-2 intestinal epithelial cells. American journal of physiology Cell physiology. 2011;301(5):C1224-38.\u003c/li\u003e\n\u003cli\u003eSo BR, Kim S, Jang SH, Kim MJ, Lee JJ, Kim SR, et al. Dietary protocatechuic acid redistributes tight junction proteins by targeting Rho-associated protein kinase to improve intestinal barrier function. Food \u0026amp; function. 2023;14(10):4777-91.\u003c/li\u003e\n\u003cli\u003eFeng S, Zou L, Wang H, He R, Liu K, Zhu H. RhoA/ROCK-2 Pathway Inhibition and Tight Junction Protein Upregulation by Catalpol Suppresses Lipopolysaccaride-Induced Disruption of Blood-Brain Barrier Permeability. Molecules (Basel, Switzerland). 2018;23(9).\u003c/li\u003e\n\u003cli\u003eHe WQ, Wang J, Sheng JY, Zha JM, Graham WV, Turner JR. Contributions of Myosin Light Chain Kinase to Regulation of Epithelial Paracellular Permeability and Mucosal Homeostasis. International journal of molecular sciences. 2020;21(3).\u003c/li\u003e\n\u003cli\u003eSong L, Wu T, Zhang L, Wan J, Ruan Z. Chlorogenic acid improves the intestinal barrier by relieving endoplasmic reticulum stress and inhibiting ROCK/MLCK signaling pathways. Food \u0026amp; function. 2022;13(8):4562-75.\u003c/li\u003e\n\u003cli\u003eLan H, Zhang LY, He W, Li WY, Zeng Z, Qian B, et al. Sinapic Acid Alleviated Inflammation-Induced Intestinal Epithelial Barrier Dysfunction in Lipopolysaccharide- (LPS-) Treated Caco-2 Cells. Mediators of inflammation. 2021;2021:5514075.\u003c/li\u003e\n\u003cli\u003eLi L, Xin J, Wang H, Wang Y, Peng W, Sun N, et al. Fluoride disrupts intestinal epithelial tight junction integrity through intracellular calcium-mediated RhoA/ROCK signaling and myosin light chain kinase. Ecotoxicol Environ Saf. 2023;257:114940.\u003c/li\u003e\n\u003cli\u003eWang X, Chen S, Xiang H, Wang X, Xiao J, Zhao S, et al. S1PR2/RhoA/ROCK1 pathway promotes inflammatory bowel disease by inducing intestinal vascular endothelial barrier damage and M1 macrophage polarization. Biochemical pharmacology. 2022;201:115077.\u003c/li\u003e\n\u003cli\u003eXiang C, Yan Y, Zhang D. Alleviation of the doxorubicin-induced nephrotoxicity by fasudil in vivo and in vitro. Journal of pharmacological sciences. 2021;145(1):6-15.\u003c/li\u003e\n\u003cli\u003eXie Y, Zhan X, Tu J, Xu K, Sun X, Liu C, et al. Atractylodes oil alleviates diarrhea-predominant irritable bowel syndrome by regulating intestinal inflammation and intestinal barrier via SCF/c-kit and MLCK/MLC2 pathways. Journal of ethnopharmacology. 2021;272:113925.\u003c/li\u003e\n\u003cli\u003eBabbin BA, Parkos CA, Mandell KJ, Winfree LM, Laur O, Ivanov AI, et al. Annexin 2 regulates intestinal epithelial cell spreading and wound closure through Rho-related signaling. The American journal of pathology. 2007;170(3):951-66.\u003c/li\u003e\n\u003cli\u003eDemirdizen E, Al-Ali R, Narayanan A, Sun X, Varga JP, Steffl B, et al. TRIM67 drives tumorigenesis in oligodendrogliomas through Rho GTPase-dependent membrane blebbing. Neuro-oncology. 2023;25(6):1031-43.\u003c/li\u003e\n\u003cli\u003eXu J, Zhao S, Zhao L, Sun M. Carvedilol alleviates lipopolysaccharide (LPS)-induced acute lung injury by inhibiting Ras homolog family member A (RhoA)/ROCK activities. Bioengineered. 2022;13(2):4137-45.\u003c/li\u003e\n\u003cli\u003eTeng G, Liu Z, Liu Y, Wu T, Dai Y, Wang H, et al. Probiotic Escherichia coli Nissle 1917 Expressing Elafin Protects Against Inflammation and Restores the Gut Microbiota. Frontiers in microbiology. 2022;13:819336.\u003c/li\u003e\n\u003cli\u003eTong J, Wang Y, Chang B, Zhang D, Wang B. Y-27632 inhibits ethanol-induced increase in intestinal epithelial barrier permeability. Molecular medicine reports. 2014;9(6):2357-61.\u003c/li\u003e\n\u003cli\u003eKazakova OA, Khapchaev AY, Shirinsky VP. MLCK and ROCK mutualism in endothelial barrier dysfunction. Biochimie. 2020;168:83-91.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Butyric acid, LPS, Caco2 cells, ZO-1, Occludin, RhoA/ROCK2/MLCK pathway","lastPublishedDoi":"10.21203/rs.3.rs-3369797/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3369797/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cb\u003eBacground and Aim\u003c/b\u003e Butyric acid (BA), as a short-chain fatty acid, can improve intestinal barrier function, meanwhile intestinal mucosal epithelial injury is a common clinical phenomenon, especially in children. Moreover, RhoA/ROCK2/MLCK signaling pathway has been confirmed to play a vital role in the maintenance of intestinal epithelial permeability. However, the specific mechanism by which BA protects intestine mucosal barrier still needs to be clarified. This study intended to investigate the effect of BA in LPS-induced Caco2 cells, and determine whether BA protected epithelial barrier by inhibiting the RhoA/ROCK2/MLCK signaling pathway.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMethods\u003c/b\u003e The optimal concentration and intervention time of the protective effect of BA on Caco2 were investigated by CCK-8 assay. On this basis of the above results, the damaged effect of LPS to Caco2 cells near the optimal time of BA protection was explored, then the optimal time and concentration were explored when BA and LPS were simultaneously administrated to Caco2 cells, the data were used to conduct further study. Then, cell growth status was observed, TEER and FD-4 permeability of monolayer barrier of Caco2 cells were detected, the mRNA expression of ZO-1 and Occludin, RhoA, ROCK2 and MLCK was detected by RT-qPCR. Moreover, immunofluorescence staning was adopted to observe the expression and distribution of ZO-1, Occludin, as well as RhoA, ROCK2 and MLCK in Caco2. After that, RhoA/ROCK2/MLCK pathway inhibitor Y-27632 was added to Caco2 cells, the cell growth status, TEER and FD-4 permeability of monolayers barrier, the expression level and distribution of ZO-1 and Occludin, RhoA, ROCK2 and MLCK in Caco2 cells were detected.\u003c/p\u003e \u003cp\u003e \u003cb\u003eResults\u003c/b\u003e The final concentration of 0.2mM BA action for 24 h had the greatest effect on the viability of Caco2 cells. After Caco2 cells exposure to LPS for 24 h, the final concentration of 5ug/ml LPS significantly decreased the viability of Caco2 cells. When combined with BA and LPS, compared with LPS alone, BA improved the growth state of Caco2 cells, restored the declined TEER, and reduced FD-4 permeability, as well as improved the mRNA expression of ZO-1, Occludin and inhibited the mRNA expression of RhoA, ROCK2 and MLCK, the expression and distribution of ZO-1, Occludin, RhoA, ROCK2 and MLCK were reversed in Caco2 cells. After treatment of Y-276432, the cell growth state and mucosal barrier function were further improved, the mRNA expression of ZO-1 and Occludin was further increased, the mRNA expression of RhoA, ROCK2 and MLCK was further decreased, and the expression and distribution of these proteins in Caco2 cells were further reversed.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConclusion\u003c/b\u003e This study provided complementary data for BA as a potential target for attenuating intestinal barrier injury induced by LPS through inhibiting the RhoA/ROCK2/MLCK signaling pathway, supporting a further research on BA protection intestinal barrier from damage and as a new therapeutic method.\u003c/p\u003e","manuscriptTitle":"Butyric acid alleviates LPS-induced intestinal mucosal barrier damage by inhibiting RhoA/ROCK2/MLCK signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-10 18:01:24","doi":"10.21203/rs.3.rs-3369797/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9d8d9f3a-f620-4d91-9928-26b710d33cd9","owner":[],"postedDate":"October 10th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-11-20T11:14:51+00:00","versionOfRecord":[],"versionCreatedAt":"2023-10-10 18:01:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3369797","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3369797","identity":"rs-3369797","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.