Decitabine regulates the resistance of Hep3B to sorafenib through demethylation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Decitabine regulates the resistance of Hep3B to sorafenib through demethylation Miao zhang, Qiaoqiao han, Yu miao, Tianyu zhao, Libo wang, Yongdeng xu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4200321/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose: To investigate the mechanism of drug resistance in hepatocellular carcinoma treated with sorafenib from an epigenetic perspective , and to examine the effect of Sorafenib sensitivity on hepatocellular carcinoma after in vitro and vivo combination with the epigenetic drug decitabine . This research aims to provide new ideas and methods for the clinical treatment of hepatocellular carcinoma. Methods: Using the GEPIA 2 database, the expression of organic anion transporting polypeptide 1B3 (OATP1B3) gene in different tumors and adjacent normal tissues of 508 patients with primary hepatocellular carcinoma (HCC) was retrieved. The Kaplan-Meier method was used to perform survival analysis by grouping based on the expression levels of this gene.. Using the TCGA-LIHC dataset to analyze the correlation between SLCO1B3 and DNMTs. Additionally, OATP1B3 promoter methylation levels were detected in Hep3B, HepG2, SNU182, LM3, HUH7, and SNU387 cells using bisulfite methylation data. The expression of OATP1B3 was assessed by RT-qPCR and Western Blot. The effect of Sorafenib in combination with DAC on the proliferation of Hep3B cells was dynamically monitored using RTCA-eSight. The mechanism was further verified in vivo using an in situ implantation tumor model in nude mice. The expression of OATP1B3 in tumor tissues was detected by immunohistochemical staining and Western Blot. Results: Individuals with high expression of the OATP1B3 gene have a significantly higher overall survival rate than individuals with low expression. The negative correlation between SLCO1B3 expression and the DNA methyltransferase DNMT1.In Hep3B,the DNA methylation of OATP1B3 results in decreased protein expression. After DAC incubation, OATP1B3 expression was up-regulated. Following DAC administration, Hep3B proliferated at a considerably lesser rate than the Sorafenib group. The absorption of Sorafenib by Hep3B was raised by 1.87-fold following co-administration of DAC. According to the Hep3B xenograft nude mice model data, the tumor sizes in the combination group were all noticeably lower after 21 days of dosing than those in the Sorafenib alone, DAC, and Control groups. Both the combination group and the DAC group had significantly greater levels of OATP1B3 expression than control and Sorafenib group. Conclusion: By inhibiting the DNA methylation of SLCO1B3 and increasing the expression of OATP1B3, which mediates Sorafenib transmembrane transporter protein, the epigenetic drug decitabine can enhance the accumulation of Sorafenib in hepatocellular carcinoma cells. This enhances sensitivity in hepatocellular carcinoma cells and reverses resistance to Sorafenib. DNA methylation decitabine Sorafenib OATP1B3 hepatocellular carcinoma Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Hepatocellular carcinoma(HCC)is one of the more prevalent malignancies worldwide, with approximately over 70,000 deaths from HCC each year [ 1 ]. Currently, targeted therapy is the preferred treatment for HCC [ 2 ], and sorafenib is internationally recommended as one of the standard targeted therapies for mid-stage primary liver cancer [ 3 ]. Sorafenib can inhibit tumor cell proliferation both directly by blocking cell signaling pathways mediated by RAF/MEK/ERK, and indirectly by inhibiting tumor neovascularisation through inhibition of the vascular endothelial growth factor receptor (VEGFR) and platelet-derived growth factor (PDGF) receptors [ 4 , 5 ]. However, the efficacy and therapeutic duration of these agents remain limited by acquired or intrinsic resistance which may be attributed to its reduced exposure in hepatocellular carcinoma tissues due to dysregulated expression of uptake/exocytosis transporter proteins or genes involved in drug metabolism enzymes[ 6 ]. Studies have shown that sorafenib exerts its drug effect through intracellular uptake by the uptake transporter OATP1B3 on the surface of hepatocytes[ 7 ]. Downregulation of OATP1B3 expression is thought to be a common feature in the development of multidrug resistance in hepatocellular carcinoma, cholangiocellular carcinoma and hepatoblastoma[ 8 ]. Expression of OATP1B3 is regulated by a complex set of factors, and promoter DNA methylation is a major factor in regulating transporter gene expression in hepatocellular carcinoma is one of the major factors [ 9 – 11 ]. Epigenetics encompasses genetic variation unrelated to changes in DNA base sequences, including DNA methylation[ 12 ], chromatin remodeling, and histone acetylation. Among these, DNA methylation is the most extensively studied aspect of epigenetics. DNA methylation involves the covalent binding of a methyl group to the cytosine 5, carbon position of a genomic CpG dinucleotide, facilitated by DNA methylation transferase. The study of DNA methylation has become crucial in epigenetics and epigenomics research, as it is closely associated with human development and tumor diseases. Particularly, CpG island methylation leads to the transcriptional inactivation of oncogenes[ 13 ]. Decitabine is an FDA-approved DNA methyltransferase inhibitor with the primary mechanism of action being the reversal of aberrant gene expression caused by methylation in cells or tissues. It achieves demethylation by inhibiting DNA methylation enzymes[ 14 ], primarily targeting DNA Methyltransferase 1 (DNMT1)[ 15 ]. This mechanism[ 16 ] helps in bringing back the efficacy of chemotherapeutic drugs that have become resistant by reversing the abnormal gene expression caused by methylation [ 17 ]. As a result, decitabine holds immense advantages and effectiveness in tumor treatment, making it a promising application[ 18 ]. OATP1B3 is primarily expressed in the hepatocyte membrane on the sinusoidal gap side of hepatocytes. Recent studies have shown that OATP1B3 is abnormally expressed in various cancer tissues and is closely associated with clinical drug resistance in hepatocellular carcinoma. However, there is limited research on the impact of epigenetic drugs on OATP1B3 expression. This study aims to investigate the relationship between DNA methylation and regulation of OATP1B3 expression at the molecular, cellular, and in vivo pharmacodynamic levels. We will utilize bisulfite methylation sequencing, RT-qPCR, Western Blot(WB), RTCA-eSight, and LC-MS/MS to examine this relationship. Additionally, we will explore the molecular mechanism underlying the enhanced sensitivity of Sorafenib, a demethylating drug, on hepatocellular carcinoma cells. The investigation of the molecular mechanism of Sorafenib's sensitivity on hepatocellular carcinoma cells will be conducted at the molecular and in vivo levels using MS/MS. The findings from this study will provide valuable data to elucidate the mechanism of clinical drug combinations in improving tumor efficacy[ 19 ]. Materials and methods Cell Culture All cells were purchased from the Peking Union Cell Bank (Beijing, China). All cells were cultured in a 37°C incubator in an atmosphere of 5% CO 2 . The human hepatoma cell lines (SNU182, SNU387) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 10,000 U/mL penicillin-streptomycin. The HUH7, HepG2, Hep3B and LM3 cell lines were in DMEM medium supplemented with 10% fetal bovine serum and 10,000 U/mL penicillin-streptomycin cultured. The cell culture media and supplements were purchased from Gibco. Bioinformatics The GEPIA 2 database was used to compare and analyze the expression differences of OATP1B3 in different cancers. The 508 hepatocellular carcinoma patients were grouped based on the high and low levels of OATP1B3 mRNA expression, and survival analysis was performed using the Kaplan-Meier method according to the different patient groups. Spearman correlation test was utilized to assess the correlation between SLCO1B3 and methylase inhibitors using the TCGA-LIHC dataset[ 20 ]. Gene expression studies Total RNA was extracted using TRIzol reagent, and cDNA was synthesized with Reverse Transcriptase. Quantitative real-time PCR was performed using SYBR GreenER qPCR SuperMix Universal(Roche, Switzerland). The threshold cycle (Ct) values for each gene were normalized to those of GAPDH, and the 2 –ΔΔCt method was used for quantitative analysis. The following primers were used: hGAPDH-F GTCTCCTCTGACTTCAACAGCG hGAPDH-R ACCACCCTGTTGCTGTAGCCAA hOATP1B3-F GTCACCTTGTCTAGCAGGATGC hOATP1B3-R GCATTCACCCAAGTGTGCTGAG OATP1B3 (#66381-1-Ig) and GAPDH(#60004-1-Ig) antibodies were purchased from Proteintech (Rosemont, IL, USA). Using a BCA Protein Assay Reagent Kit (#PC0020, Solarbio, China). Hep3B cells were lysed by RIPA. The protein concentration was determined. Cell lysates were separated by 10% SDS-PAGE and electrotransferred onto PVDF. The PVDF were blocked with 5% Skim Milk for 40min and then incubated with antibodies against OATP1B3 (1:3000)[ 21 ], and GAPDH (1:6000) overnight at 4℃. The blots were extensively washed with Tris-buffered saline with Tween-20 (TBST) buffer. The corresponding HRP-conjugated secondary antibodies were incubated for 1h at room. Immunoreactive bands were detected by an ECL(#P0018FM, Beyotime, Shanghai, China) system using an image reader. Densitometric analysis was performed by ImageJ. The data were corrected by background subtraction and normalized against GAPDH as an internal control. Bisulfite methylation sequencing The SLCO1B3 promoter sequence was searched for CpG islands using a database to predict the possible methylation sites. The Genomic DNA from HCC cell lines were prepared using the proteinase K method. Bisulfite treatment was performed. Methylation-specific PCR (MSP) primers were designed according to genomic sequences inside the CpG islands in the SLCO1B3 gene promoter region. Snap Gene was compared with the sequencing results to calculate the corresponding methylation rates. RTCA assays for cell killing Hep3B was inoculated in E-Plate View 96-well plates (for RTCA-eSight) overnight to detect the proliferation curve. After 24 h, the medium was replaced with fresh medium containing 0, 1, 3, 10 µmol/L DAC (#HY-A0004, MCE, New Jersey, USA) or sorafenib(#HY-10201, MCE, New Jersey, USA) in 3 replicate wells, and the cell proliferation curve was monitored continuously wells and continuously monitored.Hep3B was inoculated into E-Plate View 96-well plates and the control, DAC, sorafenib and combination groups were established. The 3 replicate wells were set up and the cell proliferation curve was measured overnight. When the cell index (CI) value was around 1, the DAC and combination groups were replaced with fresh medium containing 3 µmol/L DAC, and the Control and sorafenib groups were replaced with fresh medium. After 72h incubation, the fresh medium containing 3 µmol/L sorafenib was replaced and the cell proliferation was observed. The cell survival rate was calculated after a certain period of time, and GraphPad Prism was used for graphing. Cell viability assay Cell viability was evaluated using MTS. Cells were seeded in a 96-well plate, and after cell treatments, MTS reagent was added according to the manufacturer’s instructions. Absorbance was measured at 490 nm using a standard instrument. Transport assays HEK293-OATP1B3 cells were inoculated into 24 wells and incubated for 24 hours. The culture medium containing 3 µM Sorafenib was then replaced and incubated for 2 minutes in triplicate wells. The reaction was stopped using ice-cold PBS, and the cells were lysed with methanol. Sorafenib uptake was detected using LC-MS/MS. Similarly, Hep3B cells were inoculated into a 24-well plate and incubated for 24 hours. The culture medium was replaced with fresh medium containing 3 µM DAC and incubated for 72 hours. Then, fresh medium containing 10 µM Sorafenib was replaced and incubated for 1 hour in triplicate wells. The reaction was stopped using ice-cold PBS, and the cells were lysed with methanol. Sorafenib uptake was detected using LC-MS/MS. Chromatographic conditions: ZORBAX Eclipse XDB-C18 column (50 mm×4.6 mm, 5-Micron), mobile phase A: 0.1% formic acid, B: acetonitrile, 20:80 ratio, isocratic elution. Flow rate 0.5 ml/min. Injection 2 ΜL. Column temperature 37℃. Mass spectrometry conditions: electrospray ion source with positive ion mode mass spectrometry scan with multiple reaction monitoring(MRM). Combining DAC with Sorafenib induces Ferroptosis Hep3B was inoculated in 96-well plates (for RTCA-eSight) overnight to detect the proliferation curve. After 24h, the medium was replaced with fresh medium containing 6µM Sorafenib, Ferroptosis inhibitor 1µM Liproxstatin-1 + 6µM Sorafenib in 3 replicate wells, and the cell proliferation curve was monitored continuously wells and continuously monitored. Hep3B was inoculated in 12-well plates, with Control group, DAC group, Sorafenib group and combination group, triplicate wells, incubated overnight, and when the cells were wall-stabilized, the DAC group and combination group were replaced with fresh medium containing 3µM DAC. After 72h incubation, the Sorafenib group and the combination group were replaced with 3µM Sorafenib administration medium respectively. 12h later, the old culture medium was aspirated off, C11 BODIPY 581/591 (1:1000) (#HY-D1301, MCE, New Jersey, USA) was added, incubated for 20min protected from light, serum-free medium was washed three times, and cells were collected by digestion after rapid photo-preservation analysis under fluorescence microscope. Fluorescence values were detected by flow cytometric analysis. Xenograft studies Under SPF grade conditions, BALB/c nude mice were sterilized with alcohol in the right axilla and inoculated with Hep3B cells at 200 µL/each, 1 × 10 7 cells per inoculum. When the tumor volume reached 400 ~ 600 mm 3 , the tumor tissue was removed for passaging. When the tumor volume reached 100mm 3 , the mice were assigned randomly into different treatment groups (Control, DAC, Sorafenib, and DAC + Sorafenib groups).The 2.5 mg/kg of DAC was administered intraperitoneally to the DAC group and 20 mg/kg of Sorafenib was administered by gavage to the Sorafenib group. In the Control group, equal doses of Sorafenib were given intraperitoneally, and in the Control group, equal volumes of PBS were given intraperitoneally. All of the above were given on alternate days for 21 days. The tumor-bearing mice were weighed and tumor volumes were measured twice weekly. At the end of the experiment, the mice were humanely executed, the tumors were stripped and photographed, weighed. A portion of the tumors was immediately fixed in 10% buffered formalin for immunohistochemistry. The animal experiments were conducted in accordance with the Animal Ethics Committee of Tianjin Tiancheng New Drug Evaluation (Co.2021-0008) for experimental studies. Immunohistochemical For IHC staining, tissue slides were deparaffinized in xylene and rehydrated in alcohol. Endogenous peroxidase was blocked with 3% hydrogen peroxide. Antigen retrieval was achieved using a microwave and 0.1 M citric sodium buffer (pH 6.0). Sections were then incubated overnight at 4°C with the primary antibody. Then three PBS washes were performed, after which the slides were exposed to the secondary antibody for 1 h at room temperature. We wash 3 times with PBS, 5min each time, then with DAB color development for 5min, tap water for 10 min, hematoxylin counterstain for 2 min, tap water again for 10 min, and then routine dehydration, transparency, mounting, and microscopy. Positive expression of OATP1B3 protein as tan or brown granules. All patients complete the informed consent sign. Data and Statistical analysis Experimental data were statistically analyzed using GraphPad Prism 8(GraphPad Software, San Diego, CA, USA), and all experimental data were expressed as mean ± standard deviation (x ± s). Two groups were compared using independent samples t-test, and multiple comparisons were performed using one-way ANOVA, with p < 0.005 indicating significant differences. Results Analysis of OATP1B3 expression in clinical cases of hepatocellular carcinoma Search the GEPIA 2 database[ 16 ], Comparative analysis showed that SLCO1B3 varies widely among patients with different cancers and is expressed differently in paraneoplastic versus hepatocellular carcinoma tissues(Fig. 1 A-B), and the survival rate of patients with low expression is lower༈Fig. 1 C༉. Immunohistochemistry data demonstrated strong staining of OATP1B3 in Tumor-adjacent tissue and no staining in most of the HCC tissues (Fig. 1 D) Analysis of the correlation between SLCO1B3 and DNMTs in HCC That's an interesting finding. The negative correlation between SLCO1B3 expression and the DNA methylation transferase DNMT1 suggests a potential relationship between DNA methylation and the down-regulation of SLCO1B3 in cancer patients(Fig. 2 A-E), and the survival rate of patients with high expression DNMT1 is lower༈Fig. 2 F༉. This indicates that DNMT1 may play a role in the epigenetic regulation of SLCO1B3 expression in cancer. Further investigation into the specific mechanisms and pathways involved in this correlation could provide valuable insights into the regulation of SLCO1B3 and its potential implications for cancer treatment. OATP1B3 is silenced by promoter region hypermethylation in HCC cells The results of RT-qPCR and WB experiments revealed that the expression of OATP1B3 mRNA and protein was found to be the lowest in Hep3B (Fig. 3 A-B, C). The lower expression of OATP1B3 is believed to be caused by the methylation of its promoter. To determine the methylation of OATP1B3 in Hep3B, HepG2, SNU182, and SNU387, bisulfite conversion experiments were conducted. The results of the bisulfite methylation assay showed that the OATP1B3 DNA promoter methylation rates in Hep3B, HepG2, SNU182, and SNU387 were 97.6%, 65.3%, 3.5%, and 8.2%, respectively (Fig. 3 E). Therefore, Hep3B, with a higher OATP1B3 DNA methylation rate, was selected for further experiments. These findings indicate that the reduced expression of OATP1B3 is associated with methylation of its promoter region. To further validate that the expression of OATP1B3 was regulated by the promoter region methylation, HCC cells were treated with DAC. Upon treatment with DAC, increased expression of OATP1B3 was observed in Hep3B. It is speculated that after 7 days of incubation with DAC, the expression of OATP1B3 was enhanced 8.6 times (Fig. 3 F、D、G). Decitabine enhances the sensitivity of Hep3B to sorafenib To further investigate the impact of drugs on cell growth, the growth status of cells was monitored using RTCA-eSight. As shown in Fig. 4 A, a concentration of 10 µM DAC significantly inhibited the proliferation of Hep3B cells, while a concentration of 3 µM DAC had no significant effect. Similarly, in Fig. 4 B, it can be observed that a concentration of 10 µM Sorafenib significantly inhibited the proliferation of Hep3B cells, whereas a concentration of 3 µM Sorafenib had a weaker inhibitory effect. To examine the influence of DAC on the anti-tumor effect of Sorafenib, a combination of 3 µM DAC and 3 µM Sorafenib was tested. As illustrated in Fig. 4 C, the inhibitory effect of Sorafenib on the proliferation of Hep3B cells was significantly enhanced after the combination with DAC compared to DAC alone. After the administration of Sorafenib, the survival rates of Hep3B cells were observed in the DAC, Sorafenib, and DAC + Sorafenib groups, with percentages of 94.2%, 54.2%, and 31.9%, respectively. The cell morphology of each group after treatment is visually represented. Notably, the cell survival rate in the combination group was significantly lower compared to the Sorafenib group, indicating that DAC can enhance the sensitivity of Sorafenib to HCC. Relationship between hOATP1B3 expression drug uptake/activity The uptake of sorafenib was assessed after a 1-hour exposure to the drug. In HEK-293-OATP1B3 cells, sorafenib uptake was increased, but this enhancement was prevented when co-incubated with the hOATP1B3 inhibitor rifampicin (Fig. 4 D). Similar findings were observed in another cell line (Hep3B) (Fig. 4 E). Consistent with these results, the expression of hOATP1B3 in Hep3B cells conferred greater sensitivity to sorafenib, as demonstrated by cytostatic assays (Fig. 4 F-G). Our findings suggest that hOATP1B3 plays a significant role in the uptake of sorafenib by HCC cells. Co-exposure to rifampicin not only prevented hOATP1B3-mediated sorafenib uptake, but also protected against sorafenib-induced cytotoxicity. Additionally, co-exposure to DAC enhanced sorafenib-induced cytotoxicity, and similar results were observed when rifampicin prevented sorafenib-induced cytotoxicity. Enhanced Sorafenib-induced Ferroptosis by co-administration of DAC The proliferation of HCC was monitored using RTCA-eSight when combining sorafenib with inhibitors: Liproxstatin. Liproxstatin-1, a Ferroptosis inhibitor, reversed the inhibition of cell proliferation caused by sorafenib (Fig. 5 A). This suggests that sorafenib may induce Ferroptosis in cells. Further studies will investigate whether combining Sorafenib with DAC enhances the effect of cellular Ferroptosis. Microscopic observation of fluorescence intensity and flow cytometric detection of lipid peroxidation both showed higher levels of lipid peroxidation in the combination group (Fig. 5 B-C), indicating a stronger Ferroptosis effect in the combination group. These experimental results collectively suggest that DAC can enhance the effect of sorafenib in inducing Ferroptosis[ 5 ]. Combination DAC with Sorafenib suppresses human HCC cell xenograft growth in mice To further evaluate the effect of Combination DAC with Sorafenib in human HCC, Hep3B cell was used to establish the xenograft mouse models.The tumor volume and tumor weight of the tumor-bearing mice were significantly lower than those of the Sorafenib group after the combination of DAC and Sorafenib, which was consistent with the in vitro results(Fig. 6 A-F). The expression of OATP1B3 was up-regulated in the tumor tissues of tumor-bearing mice after DAC treatment. The RT-qPCR and WB all showed that the expression of OATP1B3 was significantly higher in the DAC group and the combination group than in the Control group and the Sorafenib group(Fig. 6 H-I、6J). Immunofluorescence analysis showed that the enhanced expression of hOATP1B3 resulted in a higher level of this protein at the plasma membrane(Fig. 6 G). Discussion Hepatocellular carcinoma (HCC) is the most clinically prevalent primary liver cancer, and it is responsible for the fourth highest number of cancer deaths worldwide[22]. The management of HCC is greatly challenged by multidrug resistance. Currently, there are several commonly used treatment approaches for hepatocellular carcinoma, including resection, local ablation, chemoembolization, liver transplantation, and molecular targeting. Sorafenib, known as the 'star drug' for hepatocellular carcinoma treatment, has proven efficacy and good tolerability. However, as the duration of sorafenib administration increases, resistance to the drug becomes more prominent, significantly limiting its effectiveness. Clinical studies have identified various mechanisms of resistance[23]to sorafenib, such as inhibition of apoptotic pathways, epithelial-mesenchymal transition[24], cellular autophagy, hypoxia, and epigenetic DNA methylation-mediated resistance. Numerous studies have consistently demonstrated the prevalence of DNA methylation as a significant epigenetic mechanism[25]. DNA methylation has been found to be capable of inducing changes in protein expression, among other effects. As genomics advances, it becomes increasingly crucial to unravel the intricate relationship between tumor formation, gene expression diversity, and epigenetic processes. Research has revealed that methylation of specific genes can influence tumor development and progression[26, 27]. Decitabine demethylation has been proven to be effective in inhibiting the activity of DNA methylation transferase, thereby reactivating oncogenes that were previously silenced or abnormally expressed and exerting an anti-tumor effect. Research studies have demonstrated that the effects of DAC vary depending on its concentration, with higher concentrations showing a more pronounced cytotoxic effect. In this thesis, lower concentrations of DAC were specifically chosen to activate oncogenes and transporter-related genes that have been silenced due to hypermethylation[28]. In this study, we screened Hep3B, HepG2, SNU182, LM3, HUH7 and SNU387 hepatocellular carcinoma cell lines with relatively low OATP1B3 expression at the molecular level and tested them for methylation rate. The sequencing results revealed high levels of OATP1B3 methylation in Hep3B, which is likely associated with the suppression of gene expression. To investigate the mechanism, we treated Hep3B cells with DAC, a methyltransferase inhibitor. The results showed that the mRNA and protein expression of the transporter-associated protein OATP1B3 were upregulated in Hep3B after drug administration. Furthermore, the combination of DAC significantly enhanced the uptake of Sorafenib and improved the proliferation inhibition of Sorafenib in hepatocellular carcinoma cells compared to Sorafenib alone. Additionally, the combination increased the lipid peroxide content in cells and effectively induced iron death in sorafenib-treated cells. The in vivo study also demonstrated that the combination treatment significantly inhibited tumor growth, consistent with the in vitro results. The epigenetic drug DAC has the ability to reverse sorafenib resistance by inhibiting the DNA methylation of SLCO1B3. This inhibition leads to an upregulation in the expression of OATP1B3, which is responsible for the transmembrane transport of Sorafenib (Fig 7). As a result, the accumulation of Sorafenib in hepatocellular carcinoma cells increases, enhancing its efficacy against them. These findings provide new guidance for the co-administration of DAC and sorafenib in clinical hepatocellular carcinoma treatment. Declarations Autor contributions . Z.M. and W.Z. contributed to the manuscript through data acquisition, data analysis and interpretation, drafting and editing of the manuscript. H.Q.Q. contributed through data acquisition. W.Z. substantial contributions to the conception or design of the work.W.L.B. and X.Y.D. prepared Figs 1and 2. M.Y. and Z.T.Y. prepared Figs 6.Corresponding author C.T. and Y.X.L. contributed to conception and design of the study, data analysis and interpretation, manuscript drafting and editing. All authors reviewed the manuscript. Funding This research was supported by the Medical and Health Science and Technology Innovation Project supported by the Chinese Academy of Medical Sciences(2019-I2M-5-020)and Tianjin Science and technology planning project (Research on druggability and transformation of cell products)(23ZGCXQY00050). Data availability All data are available in the main text or available upon request to the corresponding author. Compliance with ethical standards Competing interests The authors declare no competing interests. Conflict of interest All authors declare that they have no conflict of interests. References VOGEL, A., T. MEYER, G. SAPISOCHIN, et al. Hepatocellular carcinoma[J]. Lancet. 2022, 400(10360), 1345-1362. ZHANG, L., H. T. LI, R. SHEREDA, et al. DNMT and EZH2 inhibitors synergize to activate therapeutic targets in hepatocellular carcinoma[J]. Cancer Lett. 2022, 548, 215899. LLOVET JM, RICCI S, MAZZAFERRO V, HILGARD P, GANE E, BLANC JF ET AL. Sorafenib in Advanced Hepatocellular Carcinoma[J]. The new england journal of medicine. 2008, 13, 378–390. GARCIA-LEZANA, T., J. L. LOPEZ-CANOVAS and A. VILLANUEVA. Signaling pathways in hepatocellular carcinoma[J]. Adv Cancer Res. 2021, 149, 63-101. LI, Y., J. XIA, F. SHAO, et al. Sorafenib induces mitochondrial dysfunction and exhibits synergistic effect with cysteine depletion by promoting HCC cells ferroptosis[J]. Biochem Biophys Res Commun. 2021, 534, 877-884. J.J.G. MARIN, O. BRIZ, M.J. MONTE, ET AL. Genetic Variants in Genes Involved in Mechanisms of Chemoresistance to Anticancer Drugs[J]. Current Cancer Drug Targets. 2012, 37, 402-438. MARADA, V. V., S. FLORL, A. KUHNE, et al. Interaction of human organic anion transporter polypeptides 1B1 and 1B3 with antineoplastic compounds[J]. Eur J Med Chem. 2015, 92, 723-731. ZIMMERMAN, E. I., S. HU, J. L. ROBERTS, et al. Contribution of OATP1B1 and OATP1B3 to the disposition of sorafenib and sorafenib-glucuronide[J]. Clin Cancer Res. 2013, 19(6), 1458-1466. CSEREPES,, HRISTOS GLAVINAS,PéTER KRAJCSI,JUDIT. The Role of ABC Transporters in Drug Resistance, Metabolism and Toxicity[J]. Current Drug Delivery. 2004, 15, 27-41. MUPPIDI, M. R., S. PORTWOOD, E. A. GRIFFITHS, et al. Decitabine and Sorafenib Therapy in FLT-3 ITD-Mutant Acute Myeloid Leukemia[J]. Clin Lymphoma Myeloma Leuk. 2015, 15 Suppl, S73-79. ZHOU, T., S. LI, D. XIANG, et al. m6A RNA methylation-mediated HNF3gamma reduction renders hepatocellular carcinoma dedifferentiation and sorafenib resistance[J]. Signal Transduct Target Ther. 2020, 5(1), 296. BUOCIKOVA, V., S. TYCIAKOVA, E. PILALIS, et al. Decitabine-induced DNA methylation-mediated transcriptomic reprogramming in human breast cancer cell lines; the impact of DCK overexpression[J]. Front Pharmacol. 2022, 13, 991751. MATTEI, A. L., N. BAILLY and A. MEISSNER. DNA methylation: a historical perspective[J]. Trends Genet. 2022, 38(7), 676-707. LARANJEIRA, A. B. A., M. G. HOLLINGSHEAD, D. NGUYEN, et al. DNA damage, demethylation and anticancer activity of DNA methyltransferase (DNMT) inhibitors[J]. Sci Rep. 2023, 13(1), 5964. STRESEMANN, C. and F. LYKO. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine[J]. Int J Cancer. 2008, 123(1), 8-13. VERNIER, M., S. MCGUIRK, C. R. DUFOUR, et al. Inhibition of DNMT1 and ERRalpha crosstalk suppresses breast cancer via derepression of IRF4[J]. Oncogene. 2020, 39(41), 6406-6420. CHRISTINA M,BENDER, MARTHA M PAO ,. Inhibition of DNA Methylation by 5-Aza-2′-deoxycytidine Suppresses the Growth of Human Tumor Cell Lines[J]. Cancer Res. 1998, 58(1), 95-101. TAYLOR, PETER A. JONES,SHIRLEY M. Cellular Differentiation, Cytidine Analogs and DNA Methylation [J]. Cell. 1980, 20(1), 85-93. ICHIHARA, S., R. KIKUCHI and H. KUSUHARA. DNA methylation profiles of organic anion transporting polypeptide 1B3 in cancer cell lines[J]. Pharm Res. 2010, 27(3), 510-516. TANG, Z., B. KANG, C. LI, et al. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis[J]. Nucleic Acids Res. 2019, 47(W1), W556-W560. ZHI, LIANGHUI. SLCO1B3 promotes colorectal cancer tumorigenesis and metastasis through STAT3[J]. AGING. 2021, 1-12. MARSHALL, LAURA. Hepatocellular carcinoma[J]. Nat Rev Dis Primers. 2021, 7(1), 7. MARIN JJ, ROMERO MR, BRIZ O. Molecular Bases of Liver Cancer Refractoriness to Pharmacological Treatment[J]. Current Medicinal Chemistry. 2010, 32, 709-740. LIU, H., M. WANG, N. LIANG, et al. PDCD2 sensitizes HepG2 cells to sorafenib by suppressing epithelialmesenchymal transition[J]. Mol Med Rep. 2019, 19(3), 2173-2179. A,KOUZARIDES,T., DAWSON,M. Cancer epigenetics: from mechanism to therapy[J]. Cell. 2012, 150(1), 12-27. KELLY, A. D. and J. J. ISSA. The promise of epigenetic therapy: reprogramming the cancer epigenome[J]. Curr Opin Genet Dev. 2017, 42, 68-77. BAHARUDIN, R., F. Y. F. TIENG, L. H. LEE, et al. Epigenetics of SFRP1: The Dual Roles in Human Cancers[J]. Cancers (Basel). 2020, 12(2), YANG, B., J. Q. WANG, Y. TAN, et al. RNA methylation and cancer treatment[J]. Pharmacol Res. 2021, 174, 105937. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4200321","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":286387588,"identity":"a558eaed-8ad6-49fc-85e2-cb1023952c52","order_by":0,"name":"Miao zhang","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"zhang","suffix":""},{"id":286387589,"identity":"ac55f75d-43cb-44ad-9720-6120cd9cd450","order_by":1,"name":"Qiaoqiao han","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Qiaoqiao","middleName":"","lastName":"han","suffix":""},{"id":286387590,"identity":"1a2d9231-dbc7-4baa-bf0a-978b330b4767","order_by":2,"name":"Yu miao","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"miao","suffix":""},{"id":286387591,"identity":"71ff569b-7ec8-4fcb-81d6-85a93e8523cc","order_by":3,"name":"Tianyu zhao","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Tianyu","middleName":"","lastName":"zhao","suffix":""},{"id":286387592,"identity":"a65adfc5-82f7-4b57-9bc5-39e8f10e0de3","order_by":4,"name":"Libo wang","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Libo","middleName":"","lastName":"wang","suffix":""},{"id":286387593,"identity":"fa610bda-ad72-4eec-9de1-f056bfba4d32","order_by":5,"name":"Yongdeng xu","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Yongdeng","middleName":"","lastName":"xu","suffix":""},{"id":286387594,"identity":"1fdcb18a-6efb-4e8a-bb52-3b5f79fd5092","order_by":6,"name":"Ze Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYPACG2b79uYDBz78IF5LGrsBz7HEgzN7iNdymN9AIsf4MAcbEWoNjp89/PJHxWFpc4acD4cZeBjk+cUOENByJi/NQuJMurFlw9kNhwssGAxnzk7Ar8XsQI6ZgWGbdTLDwd4Nh2fwMCQY3Cak5fwbM4PEf8z1DYd5HhzmYSNGy40c4wcHG5yZDY7xMBCnxf7GGzPGhmNpzJI9bAbAQJYg7BfJ/hzjjz9qbJj55R8//vDhh408vzQBLUDAJoHEkcCpDBkwfyBK2SgYBaNgFIxcAAC89EmXoqtiaAAAAABJRU5ErkJggg==","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":true,"prefix":"","firstName":"Ze","middleName":"","lastName":"Wang","suffix":""},{"id":286387595,"identity":"4fcc6deb-abd9-4394-9b48-56619fa446fc","order_by":7,"name":"Tao Cui","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Cui","suffix":""},{"id":286387596,"identity":"2f20281e-c221-47b1-b8f3-9e45eaa6ad4a","order_by":8,"name":"Xiulin Yi","email":"","orcid":"","institution":"Tianjin Institute of Pharmaceutical Research","correspondingAuthor":false,"prefix":"","firstName":"Xiulin","middleName":"","lastName":"Yi","suffix":""}],"badges":[],"createdAt":"2024-04-01 11:31:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4200321/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4200321/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54178463,"identity":"78aadf7e-6ede-4354-80a0-f3bc6d987adc","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2387069,"visible":true,"origin":"","legend":"\u003cp\u003eOATP1B3 expression and patient survival in clinical cases of hepatocellular carcinoma (HCC). \u003cstrong\u003ea\u003c/strong\u003e The OATP1B3 expression profile across all tumor samples and adjacent normal tissues. \u003cstrong\u003eb\u003c/strong\u003e Comparing the difference in OATP1B3 expression in hepatocellular carcinoma tissues and paraneoplastic tissues. \u003cstrong\u003ec\u003c/strong\u003e Relationship between SLCO1B3 mRNA and patient survival in HCC. \u003cstrong\u003ed\u003c/strong\u003e Representative images of immunohistochemistry staining for OATP1B3 protein from 31 pairs of HCC and adjacent nontumor tissue. (×40)\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/464035a9725cc42e528241eb.png"},{"id":54178462,"identity":"0644e206-36eb-410a-ac9b-dc6a8c9b0a99","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":304899,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis between SLCO1B3 and DNMTs in HCC. \u003cstrong\u003ea-c\u003c/strong\u003e Spearman correlation test between OATP1B3 protein and DNMTs expression in 374 HCC tissues from TCGA-LIHC dataset. \u003cstrong\u003ed\u003c/strong\u003e The boxplots were generated using TCGA-LIHC dataset, whose expression levels were among the top (red) and bottom (blue) 33% of expression values for SLCO1B3. \u003cstrong\u003ee\u003c/strong\u003e Expression of SLCO1B3 is negatively correlated with DNMT1 expression in liver cancer patients. \u003cstrong\u003ef\u003c/strong\u003e Relationship between DNMT1 mRNA and patient survival in HCC.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/805280c416bd07a54d31d24f.png"},{"id":54178466,"identity":"8b6f0ee8-1c18-45f7-aefe-c83fe45c8bda","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":473970,"visible":true,"origin":"","legend":"\u003cp\u003eDNA methylation and protein expression. \u003cstrong\u003ea-b\u003c/strong\u003e OATP1B3 mRNA and protein expression of HCC cell. \u003cstrong\u003ec-d\u003c/strong\u003e Hep3B, HepG2, SNU182 and SNU387 methylation sequencing bar graphs. \u003cstrong\u003ee\u003c/strong\u003e Decitabine increases OATP1B3 mRNA expression in Hep3B. \u003cstrong\u003ef \u003c/strong\u003eDecitabine upregulates OATP1B3 protein expression in Hep3B. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05、**\u003cem\u003ep\u003c/em\u003e\u0026lt;0.005、*** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0005\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/2da70105dd7563701ce754d5.png"},{"id":54178464,"identity":"40eee400-e643-462b-8337-6de2eae58714","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":959948,"visible":true,"origin":"","legend":"\u003cp\u003eEfficacy of sorafenib on HCC. \u003cstrong\u003ea \u003c/strong\u003eEffect of different concentration of DAC on the proliferation of Hep3B. \u003cstrong\u003eb\u003c/strong\u003e Effect of different concentration of Sorafenib on the proliferation of Hep3B. \u003cstrong\u003ec\u003c/strong\u003e Effect of Sorafenib combined with DAC on Hep3B cell viability. \u003cstrong\u003ed \u003c/strong\u003eSorafenib uptake by HEK-293 cell. \u003cstrong\u003ee-f \u003c/strong\u003eSorafenib uptake by Hep3B and cell viability. \u003cstrong\u003eg \u003c/strong\u003eCell morphology of different groups. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05、**\u003cem\u003ep\u003c/em\u003e\u0026lt;0.005(×100)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/110ac60dadc6c46800f8e75d.png"},{"id":54178465,"identity":"34d6ddd8-a8c7-4b11-9344-bf1c8db5743d","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":556600,"visible":true,"origin":"","legend":"\u003cp\u003eCombining DAC with Sorafenib induces Ferroptosis. \u003cstrong\u003ea\u003c/strong\u003e Effect of different groups on the proliferation of Hep3B. \u003cstrong\u003eb\u003c/strong\u003e Fluorescence intensity. \u003cstrong\u003ec\u003c/strong\u003e Analysis of lipid peroxidation.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/1ef49a7ccff20231a3d8c365.png"},{"id":54178467,"identity":"b1452a79-2d30-469c-b5de-87d205b33403","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1892434,"visible":true,"origin":"","legend":"\u003cp\u003eSorafenib significantly inhibits tumor growth in vivo. \u003cstrong\u003ea \u003c/strong\u003eBody weight changes in tumor-bearing rats. \u003cstrong\u003eb\u003c/strong\u003e Tumor volume growth curves. \u003cstrong\u003ec\u003c/strong\u003e Relative tumor growth rate. \u003cstrong\u003ed\u003c/strong\u003e Time-dependent tumor volume. \u003cstrong\u003ee-f \u003c/strong\u003eTerminal tuberculosis. \u003cstrong\u003eh\u003c/strong\u003e OATP1B3 mRNA expression. \u003cstrong\u003ei-j\u003c/strong\u003e OATP1B3 protein expression. \u003cstrong\u003eg\u003c/strong\u003e IHC staining reveals the expression levels of OATP1B3. (×40)\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/35892d708cfb9edab397e1c6.png"},{"id":54178468,"identity":"1ba022f8-901f-40e5-86e1-113537d64dab","added_by":"auto","created_at":"2024-04-05 16:13:52","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":674276,"visible":true,"origin":"","legend":"\u003cp\u003eThe model of how decitabine increases the expression of OATP1B3 through inhibiting DNMT1 in human HCC.\u003c/p\u003e\n\u003cp\u003eLeft:The up-regulation of DNMT1 expression in hepatocellular carcinoma cells resulted in increased DNA methylation of OATP1B3, leading to its down-regulation. This inhibition of sorafenib accumulation in hepatocellular carcinoma cells ultimately suppressed tumor cell apoptosis.\u003c/p\u003e\n\u003cp\u003eRight:DAC upregulates OATP1B3 by inhibiting SLCO1B3 DNA methylation, increasing OATP1B3 expression, enhancing the transport ability of sorafenib, boosting sorafenib accumulation in hepatocellular carcinoma cells, and improving sensitivity to hepatocellular carcinoma cells. This ultimately reverses sorafenib resistance.\u003c/p\u003e","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/b775ed866858fd496db24664.png"},{"id":55265322,"identity":"abc326a4-98cd-4944-90e7-1e20adaa2d15","added_by":"auto","created_at":"2024-04-25 02:00:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4199713,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4200321/v1/fe91dec7-20a3-45cb-a7bc-491b7104e4dd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Decitabine regulates the resistance of Hep3B to sorafenib through demethylation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHepatocellular carcinoma(HCC)is one of the more prevalent malignancies worldwide, with approximately over 70,000 deaths from HCC each year [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Currently, targeted therapy is the preferred treatment for HCC [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], and sorafenib is internationally recommended as one of the standard targeted therapies for mid-stage primary liver cancer [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Sorafenib can inhibit tumor cell proliferation both directly by blocking cell signaling pathways mediated by RAF/MEK/ERK, and indirectly by inhibiting tumor neovascularisation through inhibition of the vascular endothelial growth factor receptor (VEGFR) and platelet-derived growth factor (PDGF) receptors [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, the efficacy and therapeutic duration of these agents remain limited by acquired or intrinsic resistance which may be attributed to its reduced exposure in hepatocellular carcinoma tissues due to dysregulated expression of uptake/exocytosis transporter proteins or genes involved in drug metabolism enzymes[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Studies have shown that sorafenib exerts its drug effect through intracellular uptake by the uptake transporter OATP1B3 on the surface of hepatocytes[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Downregulation of OATP1B3 expression is thought to be a common feature in the development of multidrug resistance in hepatocellular carcinoma, cholangiocellular carcinoma and hepatoblastoma[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Expression of OATP1B3 is regulated by a complex set of factors, and promoter DNA methylation is a major factor in regulating transporter gene expression in hepatocellular carcinoma is one of the major factors [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEpigenetics encompasses genetic variation unrelated to changes in DNA base sequences, including DNA methylation[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], chromatin remodeling, and histone acetylation. Among these, DNA methylation is the most extensively studied aspect of epigenetics. DNA methylation involves the covalent binding of a methyl group to the cytosine 5, carbon position of a genomic CpG dinucleotide, facilitated by DNA methylation transferase. The study of DNA methylation has become crucial in epigenetics and epigenomics research, as it is closely associated with human development and tumor diseases. Particularly, CpG island methylation leads to the transcriptional inactivation of oncogenes[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDecitabine is an FDA-approved DNA methyltransferase inhibitor with the primary mechanism of action being the reversal of aberrant gene expression caused by methylation in cells or tissues. It achieves demethylation by inhibiting DNA methylation enzymes[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], primarily targeting DNA Methyltransferase 1 (DNMT1)[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. This mechanism[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] helps in bringing back the efficacy of chemotherapeutic drugs that have become resistant by reversing the abnormal gene expression caused by methylation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. As a result, decitabine holds immense advantages and effectiveness in tumor treatment, making it a promising application[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOATP1B3 is primarily expressed in the hepatocyte membrane on the sinusoidal gap side of hepatocytes. Recent studies have shown that OATP1B3 is abnormally expressed in various cancer tissues and is closely associated with clinical drug resistance in hepatocellular carcinoma. However, there is limited research on the impact of epigenetic drugs on OATP1B3 expression. This study aims to investigate the relationship between DNA methylation and regulation of OATP1B3 expression at the molecular, cellular, and in vivo pharmacodynamic levels. We will utilize bisulfite methylation sequencing, RT-qPCR, Western Blot(WB), RTCA-eSight, and LC-MS/MS to examine this relationship. Additionally, we will explore the molecular mechanism underlying the enhanced sensitivity of Sorafenib, a demethylating drug, on hepatocellular carcinoma cells. The investigation of the molecular mechanism of Sorafenib's sensitivity on hepatocellular carcinoma cells will be conducted at the molecular and in vivo levels using MS/MS. The findings from this study will provide valuable data to elucidate the mechanism of clinical drug combinations in improving tumor efficacy[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture\u003c/h2\u003e \u003cp\u003eAll cells were purchased from the Peking Union Cell Bank (Beijing, China). All cells were cultured in a 37\u0026deg;C incubator in an atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e. The human hepatoma cell lines (SNU182, SNU387) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 10,000 U/mL penicillin-streptomycin. The HUH7, HepG2, Hep3B and LM3 cell lines were in DMEM medium supplemented with 10% fetal bovine serum and 10,000 U/mL penicillin-streptomycin cultured. The cell culture media and supplements were purchased from Gibco.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics\u003c/h2\u003e \u003cp\u003eThe GEPIA 2 database was used to compare and analyze the expression differences of OATP1B3 in different cancers. The 508 hepatocellular carcinoma patients were grouped based on the high and low levels of OATP1B3 mRNA expression, and survival analysis was performed using the Kaplan-Meier method according to the different patient groups. Spearman correlation test was utilized to assess the correlation between SLCO1B3 and methylase inhibitors using the TCGA-LIHC dataset[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGene expression studies\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using TRIzol reagent, and cDNA was synthesized with Reverse Transcriptase. Quantitative real-time PCR was performed using SYBR GreenER qPCR SuperMix Universal(Roche, Switzerland). The threshold cycle (Ct) values for each gene were normalized to those of GAPDH, and the 2\u003csup\u003e\u0026ndash;ΔΔCt\u003c/sup\u003e method was used for quantitative analysis.\u003c/p\u003e \u003cp\u003eThe following primers were used:\u003c/p\u003e \u003cp\u003ehGAPDH-F GTCTCCTCTGACTTCAACAGCG\u003c/p\u003e \u003cp\u003ehGAPDH-R ACCACCCTGTTGCTGTAGCCAA\u003c/p\u003e \u003cp\u003ehOATP1B3-F GTCACCTTGTCTAGCAGGATGC\u003c/p\u003e \u003cp\u003ehOATP1B3-R GCATTCACCCAAGTGTGCTGAG\u003c/p\u003e \u003cp\u003eOATP1B3 (#66381-1-Ig) and GAPDH(#60004-1-Ig) antibodies were purchased from Proteintech (Rosemont, IL, USA). Using a BCA Protein Assay Reagent Kit (#PC0020, Solarbio, China). Hep3B cells were lysed by RIPA. The protein concentration was determined. Cell lysates were separated by 10% SDS-PAGE and electrotransferred onto PVDF. The PVDF were blocked with 5% Skim Milk for 40min and then incubated with antibodies against OATP1B3 (1:3000)[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and GAPDH (1:6000) overnight at 4℃. The blots were extensively washed with Tris-buffered saline with Tween-20 (TBST) buffer. The corresponding HRP-conjugated secondary antibodies were incubated for 1h at room. Immunoreactive bands were detected by an ECL(#P0018FM, Beyotime, Shanghai, China) system using an image reader. Densitometric analysis was performed by ImageJ. The data were corrected by background subtraction and normalized against GAPDH as an internal control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eBisulfite methylation sequencing\u003c/h2\u003e \u003cp\u003eThe SLCO1B3 promoter sequence was searched for CpG islands using a database to predict the possible methylation sites. The Genomic DNA from HCC cell lines were prepared using the proteinase K method. Bisulfite treatment was performed. Methylation-specific PCR (MSP) primers were designed according to genomic sequences inside the CpG islands in the SLCO1B3 gene promoter region. Snap Gene was compared with the sequencing results to calculate the corresponding methylation rates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eRTCA assays for cell killing\u003c/h2\u003e \u003cp\u003eHep3B was inoculated in E-Plate View 96-well plates (for RTCA-eSight) overnight to detect the proliferation curve. After 24 h, the medium was replaced with fresh medium containing 0, 1, 3, 10 \u0026micro;mol/L DAC (#HY-A0004, MCE, New Jersey, USA) or sorafenib(#HY-10201, MCE, New Jersey, USA) in 3 replicate wells, and the cell proliferation curve was monitored continuously wells and continuously monitored.Hep3B was inoculated into E-Plate View 96-well plates and the control, DAC, sorafenib and combination groups were established. The 3 replicate wells were set up and the cell proliferation curve was measured overnight. When the cell index (CI) value was around 1, the DAC and combination groups were replaced with fresh medium containing 3 \u0026micro;mol/L DAC, and the Control and sorafenib groups were replaced with fresh medium. After 72h incubation, the fresh medium containing 3 \u0026micro;mol/L sorafenib was replaced and the cell proliferation was observed. The cell survival rate was calculated after a certain period of time, and GraphPad Prism was used for graphing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eCell viability was evaluated using MTS. Cells were seeded in a 96-well plate, and after cell treatments, MTS reagent was added according to the manufacturer\u0026rsquo;s instructions. Absorbance was measured at 490 nm using a standard instrument.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTransport assays\u003c/h2\u003e \u003cp\u003eHEK293-OATP1B3 cells were inoculated into 24 wells and incubated for 24 hours. The culture medium containing 3 \u0026micro;M Sorafenib was then replaced and incubated for 2 minutes in triplicate wells. The reaction was stopped using ice-cold PBS, and the cells were lysed with methanol. Sorafenib uptake was detected using LC-MS/MS. Similarly, Hep3B cells were inoculated into a 24-well plate and incubated for 24 hours. The culture medium was replaced with fresh medium containing 3 \u0026micro;M DAC and incubated for 72 hours. Then, fresh medium containing 10 \u0026micro;M Sorafenib was replaced and incubated for 1 hour in triplicate wells. The reaction was stopped using ice-cold PBS, and the cells were lysed with methanol. Sorafenib uptake was detected using LC-MS/MS.\u003c/p\u003e \u003cp\u003eChromatographic conditions: ZORBAX Eclipse XDB-C18 column (50 mm\u0026times;4.6 mm, 5-Micron), mobile phase A: 0.1% formic acid, B: acetonitrile, 20:80 ratio, isocratic elution. Flow rate 0.5 ml/min. Injection 2 ΜL. Column temperature 37℃. Mass spectrometry conditions: electrospray ion source with positive ion mode mass spectrometry scan with multiple reaction monitoring(MRM).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCombining DAC with Sorafenib induces Ferroptosis\u003c/h2\u003e \u003cp\u003eHep3B was inoculated in 96-well plates (for RTCA-eSight) overnight to detect the proliferation curve. After 24h, the medium was replaced with fresh medium containing 6\u0026micro;M Sorafenib, Ferroptosis inhibitor 1\u0026micro;M Liproxstatin-1\u0026thinsp;+\u0026thinsp;6\u0026micro;M Sorafenib in 3 replicate wells, and the cell proliferation curve was monitored continuously wells and continuously monitored.\u003c/p\u003e \u003cp\u003eHep3B was inoculated in 12-well plates, with Control group, DAC group, Sorafenib group and combination group, triplicate wells, incubated overnight, and when the cells were wall-stabilized, the DAC group and combination group were replaced with fresh medium containing 3\u0026micro;M DAC. After 72h incubation, the Sorafenib group and the combination group were replaced with 3\u0026micro;M Sorafenib administration medium respectively. 12h later, the old culture medium was aspirated off, C11 BODIPY 581/591 (1:1000) (#HY-D1301, MCE, New Jersey, USA) was added, incubated for 20min protected from light, serum-free medium was washed three times, and cells were collected by digestion after rapid photo-preservation analysis under fluorescence microscope. Fluorescence values were detected by flow cytometric analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eXenograft studies\u003c/h2\u003e \u003cp\u003eUnder SPF grade conditions, BALB/c nude mice were sterilized with alcohol in the right axilla and inoculated with Hep3B cells at 200 \u0026micro;L/each, 1 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e cells per inoculum. When the tumor volume reached 400\u0026thinsp;~\u0026thinsp;600 mm\u003csup\u003e3\u003c/sup\u003e, the tumor tissue was removed for passaging. When the tumor volume reached 100mm\u003csup\u003e3\u003c/sup\u003e, the mice were assigned randomly into different treatment groups (Control, DAC, Sorafenib, and DAC\u0026thinsp;+\u0026thinsp;Sorafenib groups).The 2.5 mg/kg of DAC was administered intraperitoneally to the DAC group and 20 mg/kg of Sorafenib was administered by gavage to the Sorafenib group. In the Control group, equal doses of Sorafenib were given intraperitoneally, and in the Control group, equal volumes of PBS were given intraperitoneally. All of the above were given on alternate days for 21 days. The tumor-bearing mice were weighed and tumor volumes were measured twice weekly. At the end of the experiment, the mice were humanely executed, the tumors were stripped and photographed, weighed. A portion of the tumors was immediately fixed in 10% buffered formalin for immunohistochemistry. The animal experiments were conducted in accordance with the Animal Ethics Committee of Tianjin Tiancheng New Drug Evaluation (Co.2021-0008) for experimental studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemical\u003c/h2\u003e \u003cp\u003eFor IHC staining, tissue slides were deparaffinized in xylene and rehydrated in alcohol. Endogenous peroxidase was blocked with 3% hydrogen peroxide. Antigen retrieval was achieved using a microwave and 0.1 M citric sodium buffer (pH 6.0). Sections were then incubated overnight at 4\u0026deg;C with the primary antibody. Then three PBS washes were performed, after which the slides were exposed to the secondary antibody for 1 h at room temperature. We wash 3 times with PBS, 5min each time, then with DAB color development for 5min, tap water for 10 min, hematoxylin counterstain for 2 min, tap water again for 10 min, and then routine dehydration, transparency, mounting, and microscopy. Positive expression of OATP1B3 protein as tan or brown granules. All patients complete the informed consent sign.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eData and Statistical analysis\u003c/h2\u003e \u003cp\u003eExperimental data were statistically analyzed using GraphPad Prism 8(GraphPad Software, San Diego, CA, USA), and all experimental data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x\u0026thinsp;\u0026plusmn;\u0026thinsp;s). Two groups were compared using independent samples t-test, and multiple comparisons were performed using one-way ANOVA, with p\u0026thinsp;\u0026lt;\u0026thinsp;0.005 indicating significant differences.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of OATP1B3 expression in clinical cases of hepatocellular carcinoma\u003c/h2\u003e \u003cp\u003eSearch the GEPIA 2 database[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], Comparative analysis showed that SLCO1B3 varies widely among patients with different cancers and is expressed differently in paraneoplastic versus hepatocellular carcinoma tissues(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-B), and the survival rate of patients with low expression is lower༈Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC༉. Immunohistochemistry data demonstrated strong staining of OATP1B3 in Tumor-adjacent tissue and no staining in most of the HCC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of the correlation between SLCO1B3 and DNMTs in HCC\u003c/h2\u003e \u003cp\u003eThat's an interesting finding. The negative correlation between SLCO1B3 expression and the DNA methylation transferase DNMT1 suggests a potential relationship between DNA methylation and the down-regulation of SLCO1B3 in cancer patients(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-E), and the survival rate of patients with high expression DNMT1 is lower༈Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eF༉. This indicates that DNMT1 may play a role in the epigenetic regulation of SLCO1B3 expression in cancer. Further investigation into the specific mechanisms and pathways involved in this correlation could provide valuable insights into the regulation of SLCO1B3 and its potential implications for cancer treatment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eOATP1B3 is silenced by promoter region hypermethylation in HCC cells\u003c/h2\u003e \u003cp\u003eThe results of RT-qPCR and WB experiments revealed that the expression of OATP1B3 mRNA and protein was found to be the lowest in Hep3B (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B, C). The lower expression of OATP1B3 is believed to be caused by the methylation of its promoter. To determine the methylation of OATP1B3 in Hep3B, HepG2, SNU182, and SNU387, bisulfite conversion experiments were conducted. The results of the bisulfite methylation assay showed that the OATP1B3 DNA promoter methylation rates in Hep3B, HepG2, SNU182, and SNU387 were 97.6%, 65.3%, 3.5%, and 8.2%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Therefore, Hep3B, with a higher OATP1B3 DNA methylation rate, was selected for further experiments. These findings indicate that the reduced expression of OATP1B3 is associated with methylation of its promoter region.\u003c/p\u003e \u003cp\u003eTo further validate that the expression of OATP1B3 was regulated by the promoter region methylation, HCC cells were treated with DAC. Upon treatment with DAC, increased expression of OATP1B3 was observed in Hep3B. It is speculated that after 7 days of incubation with DAC, the expression of OATP1B3 was enhanced 8.6 times (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF、D、G).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eDecitabine enhances the sensitivity of Hep3B to sorafenib\u003c/h2\u003e \u003cp\u003eTo further investigate the impact of drugs on cell growth, the growth status of cells was monitored using RTCA-eSight. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, a concentration of 10 \u0026micro;M DAC significantly inhibited the proliferation of Hep3B cells, while a concentration of 3 \u0026micro;M DAC had no significant effect. Similarly, in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, it can be observed that a concentration of 10 \u0026micro;M Sorafenib significantly inhibited the proliferation of Hep3B cells, whereas a concentration of 3 \u0026micro;M Sorafenib had a weaker inhibitory effect. To examine the influence of DAC on the anti-tumor effect of Sorafenib, a combination of 3 \u0026micro;M DAC and 3 \u0026micro;M Sorafenib was tested. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, the inhibitory effect of Sorafenib on the proliferation of Hep3B cells was significantly enhanced after the combination with DAC compared to DAC alone. After the administration of Sorafenib, the survival rates of Hep3B cells were observed in the DAC, Sorafenib, and DAC\u0026thinsp;+\u0026thinsp;Sorafenib groups, with percentages of 94.2%, 54.2%, and 31.9%, respectively. The cell morphology of each group after treatment is visually represented. Notably, the cell survival rate in the combination group was significantly lower compared to the Sorafenib group, indicating that DAC can enhance the sensitivity of Sorafenib to HCC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eRelationship between hOATP1B3 expression drug uptake/activity\u003c/h2\u003e \u003cp\u003eThe uptake of sorafenib was assessed after a 1-hour exposure to the drug. In HEK-293-OATP1B3 cells, sorafenib uptake was increased, but this enhancement was prevented when co-incubated with the hOATP1B3 inhibitor rifampicin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Similar findings were observed in another cell line (Hep3B) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Consistent with these results, the expression of hOATP1B3 in Hep3B cells conferred greater sensitivity to sorafenib, as demonstrated by cytostatic assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-G). Our findings suggest that hOATP1B3 plays a significant role in the uptake of sorafenib by HCC cells. Co-exposure to rifampicin not only prevented hOATP1B3-mediated sorafenib uptake, but also protected against sorafenib-induced cytotoxicity. Additionally, co-exposure to DAC enhanced sorafenib-induced cytotoxicity, and similar results were observed when rifampicin prevented sorafenib-induced cytotoxicity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEnhanced Sorafenib-induced Ferroptosis by co-administration of DAC\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe proliferation of HCC was monitored using RTCA-eSight when combining sorafenib with inhibitors: Liproxstatin. Liproxstatin-1, a Ferroptosis inhibitor, reversed the inhibition of cell proliferation caused by sorafenib (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). This suggests that sorafenib may induce Ferroptosis in cells. Further studies will investigate whether combining Sorafenib with DAC enhances the effect of cellular Ferroptosis. Microscopic observation of fluorescence intensity and flow cytometric detection of lipid peroxidation both showed higher levels of lipid peroxidation in the combination group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-C), indicating a stronger Ferroptosis effect in the combination group. These experimental results collectively suggest that DAC can enhance the effect of sorafenib in inducing Ferroptosis[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eCombination DAC with Sorafenib suppresses human HCC cell xenograft growth in mice\u003c/h2\u003e \u003cp\u003eTo further evaluate the effect of Combination DAC with Sorafenib in human HCC, Hep3B cell was used to establish the xenograft mouse models.The tumor volume and tumor weight of the tumor-bearing mice were significantly lower than those of the Sorafenib group after the combination of DAC and Sorafenib, which was consistent with the in vitro results(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-F).\u003c/p\u003e \u003cp\u003eThe expression of OATP1B3 was up-regulated in the tumor tissues of tumor-bearing mice after DAC treatment. The RT-qPCR and WB all showed that the expression of OATP1B3 was significantly higher in the DAC group and the combination group than in the Control group and the Sorafenib group(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH-I、6J). Immunofluorescence analysis showed that the enhanced expression of hOATP1B3 resulted in a higher level of this protein at the plasma membrane(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eHepatocellular carcinoma (HCC) is the most clinically prevalent primary liver cancer, and it is responsible for the fourth highest number of cancer deaths worldwide[22]. The management of HCC is greatly challenged by multidrug resistance. Currently, there are several commonly used treatment approaches for hepatocellular carcinoma, including resection, local ablation, chemoembolization, liver transplantation, and molecular targeting. Sorafenib, known as the \u0026apos;star drug\u0026apos; for hepatocellular carcinoma treatment, has proven efficacy and good tolerability. However, as the duration of sorafenib administration increases, resistance to the drug becomes more prominent, significantly limiting its effectiveness. Clinical studies have identified various mechanisms of resistance[23]to sorafenib, such as inhibition of apoptotic pathways, epithelial-mesenchymal transition[24], cellular autophagy, hypoxia, and epigenetic DNA methylation-mediated resistance.\u003c/p\u003e\n\u003cp\u003eNumerous studies have consistently demonstrated the prevalence of DNA methylation as a significant epigenetic mechanism[25]. DNA methylation has been found to be capable of inducing changes in protein expression, among other effects. As genomics advances, it becomes increasingly crucial to unravel the intricate relationship between tumor formation, gene expression diversity, and epigenetic processes. Research has revealed that methylation of specific genes can influence tumor development and progression[26, 27].\u003c/p\u003e\n\u003cp\u003eDecitabine demethylation has been proven to be effective in inhibiting the activity of DNA methylation transferase, thereby reactivating oncogenes that were previously silenced or abnormally expressed and exerting an anti-tumor effect. Research studies have demonstrated that the effects of DAC vary depending on its concentration, with higher concentrations showing a more pronounced cytotoxic effect. In this thesis, lower concentrations of DAC were specifically chosen to activate oncogenes and transporter-related genes that have been silenced due to hypermethylation[28].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, we screened Hep3B, HepG2, SNU182, LM3, HUH7 and SNU387 hepatocellular carcinoma cell lines with relatively low OATP1B3 expression at the molecular level and tested them for methylation rate. The sequencing results revealed high levels of OATP1B3 methylation in Hep3B, which is likely associated with the suppression of gene expression. To investigate the mechanism, we treated Hep3B cells with DAC, a methyltransferase inhibitor. The results showed that the mRNA and protein expression of the transporter-associated protein OATP1B3 were upregulated in Hep3B after drug administration. Furthermore, the combination of DAC significantly enhanced the uptake of Sorafenib and improved the proliferation inhibition of Sorafenib in hepatocellular carcinoma cells compared to Sorafenib alone. Additionally, the combination increased the lipid peroxide content in cells and effectively induced iron death in sorafenib-treated cells. The in vivo study also demonstrated that the combination treatment significantly inhibited tumor growth, consistent with the in vitro results.\u003c/p\u003e\n\u003cp\u003eThe epigenetic drug DAC has the ability to reverse sorafenib resistance by inhibiting the DNA methylation of SLCO1B3. This inhibition leads to an upregulation in the expression of OATP1B3, which is responsible for the transmembrane transport of Sorafenib (Fig 7). As a result, the accumulation of Sorafenib in hepatocellular carcinoma cells increases, enhancing its efficacy against them. These findings provide new guidance for the co-administration of DAC and sorafenib in clinical hepatocellular carcinoma treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAutor contributions\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eZ.M. and W.Z. \u0026nbsp;contributed to the manuscript through data acquisition, data analysis and interpretation, drafting and editing of the manuscript. \u0026nbsp;H.Q.Q. contributed through data acquisition. W.Z. substantial contributions to the conception or design of the work.W.L.B. and X.Y.D. prepared Figs 1and 2.\u003c/p\u003e\n\u003cp\u003eM.Y. and Z.T.Y. prepared Figs 6.Corresponding author C.T. and Y.X.L. contributed to conception and design of the study, data analysis and interpretation, manuscript drafting and editing. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis research was supported by the Medical and Health Science and Technology Innovation Project supported by the Chinese Academy of Medical Sciences(2019-I2M-5-020)and Tianjin Science and technology planning project (Research on druggability and transformation of cell products)(23ZGCXQY00050).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAll data are available in the main text or available upon request to the corresponding author.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompliance with ethical standards\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eAll authors declare that they have no conflict of interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVOGEL, A., T. MEYER, G. SAPISOCHIN, et al. Hepatocellular carcinoma[J]. Lancet. 2022, 400(10360), 1345-1362.\u003c/li\u003e\n\u003cli\u003eZHANG, L., H. T. LI, R. SHEREDA, et al. DNMT and EZH2 inhibitors synergize to activate therapeutic targets in hepatocellular carcinoma[J]. Cancer Lett. 2022, 548, 215899.\u003c/li\u003e\n\u003cli\u003eLLOVET JM, RICCI S, MAZZAFERRO V, HILGARD P, GANE E, BLANC JF ET AL. Sorafenib in Advanced Hepatocellular Carcinoma[J]. The new england journal of medicine. 2008, 13, 378\u0026ndash;390.\u003c/li\u003e\n\u003cli\u003eGARCIA-LEZANA, T., J. L. LOPEZ-CANOVAS and A. VILLANUEVA. Signaling pathways in hepatocellular carcinoma[J]. Adv Cancer Res. 2021, 149, 63-101.\u003c/li\u003e\n\u003cli\u003eLI, Y., J. XIA, F. SHAO, et al. Sorafenib induces mitochondrial dysfunction and exhibits synergistic effect with cysteine depletion by promoting HCC cells ferroptosis[J]. Biochem Biophys Res Commun. 2021, 534, 877-884.\u003c/li\u003e\n\u003cli\u003eJ.J.G. MARIN, O. BRIZ, M.J. MONTE, ET AL. Genetic Variants in Genes Involved in Mechanisms of Chemoresistance to Anticancer Drugs[J]. Current Cancer Drug Targets. 2012, 37, 402-438.\u003c/li\u003e\n\u003cli\u003eMARADA, V. V., S. FLORL, A. KUHNE, et al. Interaction of human organic anion transporter polypeptides 1B1 and 1B3 with antineoplastic compounds[J]. Eur J Med Chem. 2015, 92, 723-731.\u003c/li\u003e\n\u003cli\u003eZIMMERMAN, E. I., S. HU, J. L. ROBERTS, et al. Contribution of OATP1B1 and OATP1B3 to the disposition of sorafenib and sorafenib-glucuronide[J]. Clin Cancer Res. 2013, 19(6), 1458-1466.\u003c/li\u003e\n\u003cli\u003eCSEREPES,, HRISTOS GLAVINAS,P\u0026eacute;TER KRAJCSI,JUDIT. The Role of ABC Transporters in Drug Resistance, Metabolism and Toxicity[J]. Current Drug Delivery. 2004, 15, 27-41.\u003c/li\u003e\n\u003cli\u003eMUPPIDI, M. R., S. PORTWOOD, E. A. GRIFFITHS, et al. Decitabine and Sorafenib Therapy in FLT-3 ITD-Mutant Acute Myeloid Leukemia[J]. Clin Lymphoma Myeloma Leuk. 2015, 15 Suppl, S73-79.\u003c/li\u003e\n\u003cli\u003eZHOU, T., S. LI, D. XIANG, et al. m6A RNA methylation-mediated HNF3gamma reduction renders hepatocellular carcinoma dedifferentiation and sorafenib resistance[J]. Signal Transduct Target Ther. 2020, 5(1), 296.\u003c/li\u003e\n\u003cli\u003eBUOCIKOVA, V., S. TYCIAKOVA, E. PILALIS, et al. Decitabine-induced DNA methylation-mediated transcriptomic reprogramming in human breast cancer cell lines; the impact of DCK overexpression[J]. Front Pharmacol. 2022, 13, 991751.\u003c/li\u003e\n\u003cli\u003eMATTEI, A. L., N. BAILLY and A. MEISSNER. DNA methylation: a historical perspective[J]. Trends Genet. 2022, 38(7), 676-707.\u003c/li\u003e\n\u003cli\u003eLARANJEIRA, A. B. A., M. G. HOLLINGSHEAD, D. NGUYEN, et al. DNA damage, demethylation and anticancer activity of DNA methyltransferase (DNMT) inhibitors[J]. Sci Rep. 2023, 13(1), 5964.\u003c/li\u003e\n\u003cli\u003eSTRESEMANN, C. and F. LYKO. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine[J]. Int J Cancer. 2008, 123(1), 8-13.\u003c/li\u003e\n\u003cli\u003eVERNIER, M., S. MCGUIRK, C. R. DUFOUR, et al. Inhibition of DNMT1 and ERRalpha crosstalk suppresses breast cancer via derepression of IRF4[J]. Oncogene. 2020, 39(41), 6406-6420.\u003c/li\u003e\n\u003cli\u003eCHRISTINA M,BENDER, MARTHA M PAO ,. Inhibition of DNA Methylation by 5-Aza-2\u0026prime;-deoxycytidine Suppresses the Growth of Human Tumor Cell Lines[J]. Cancer Res. 1998, 58(1), 95-101.\u003c/li\u003e\n\u003cli\u003eTAYLOR, PETER A. JONES,SHIRLEY M. Cellular Differentiation, Cytidine Analogs and DNA Methylation [J]. Cell. 1980, 20(1), 85-93.\u003c/li\u003e\n\u003cli\u003eICHIHARA, S., R. KIKUCHI and H. KUSUHARA. DNA methylation profiles of organic anion transporting polypeptide 1B3 in cancer cell lines[J]. Pharm Res. 2010, 27(3), 510-516.\u003c/li\u003e\n\u003cli\u003eTANG, Z., B. KANG, C. LI, et al. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis[J]. Nucleic Acids Res. 2019, 47(W1), W556-W560.\u003c/li\u003e\n\u003cli\u003eZHI, LIANGHUI. SLCO1B3 promotes colorectal cancer tumorigenesis and metastasis through STAT3[J]. AGING. 2021, 1-12.\u003c/li\u003e\n\u003cli\u003eMARSHALL, LAURA. Hepatocellular carcinoma[J]. Nat Rev Dis Primers. 2021, 7(1), 7.\u003c/li\u003e\n\u003cli\u003eMARIN JJ, ROMERO MR, BRIZ O. Molecular Bases of Liver Cancer Refractoriness to Pharmacological Treatment[J]. Current Medicinal Chemistry. 2010, 32, 709-740.\u003c/li\u003e\n\u003cli\u003eLIU, H., M. WANG, N. LIANG, et al. PDCD2 sensitizes HepG2 cells to sorafenib by suppressing epithelialmesenchymal transition[J]. Mol Med Rep. 2019, 19(3), 2173-2179.\u003c/li\u003e\n\u003cli\u003eA,KOUZARIDES,T., DAWSON,M. Cancer epigenetics: from mechanism to therapy[J]. Cell. 2012, 150(1), 12-27.\u003c/li\u003e\n\u003cli\u003eKELLY, A. D. and J. J. ISSA. The promise of epigenetic therapy: reprogramming the cancer epigenome[J]. Curr Opin Genet Dev. 2017, 42, 68-77.\u003c/li\u003e\n\u003cli\u003eBAHARUDIN, R., F. Y. F. TIENG, L. H. LEE, et al. Epigenetics of SFRP1: The Dual Roles in Human Cancers[J]. Cancers (Basel). 2020, 12(2),\u003c/li\u003e\n\u003cli\u003eYANG, B., J. Q. WANG, Y. TAN, et al. RNA methylation and cancer treatment[J]. Pharmacol Res. 2021, 174, 105937.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"DNA methylation, decitabine, Sorafenib, OATP1B3, hepatocellular carcinoma","lastPublishedDoi":"10.21203/rs.3.rs-4200321/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4200321/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose:\u003c/strong\u003eTo investigate the mechanism of drug resistance in hepatocellular carcinoma treated with sorafenib from an epigenetic perspective , and to examine the effect of Sorafenib sensitivity on hepatocellular carcinoma after in vitro and vivo combination with the epigenetic drug decitabine . This research aims to provide new ideas and methods for the clinical treatment of hepatocellular carcinoma.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eUsing the GEPIA 2 database, the expression of organic anion transporting polypeptide 1B3 (OATP1B3) gene in different tumors and adjacent normal tissues of 508 patients with primary hepatocellular carcinoma (HCC) was retrieved. The Kaplan-Meier method was used to perform survival analysis by grouping based on the expression levels of this gene.. Using the TCGA-LIHC dataset to analyze the correlation between SLCO1B3 and DNMTs. Additionally, OATP1B3 promoter methylation levels were detected in Hep3B, HepG2, SNU182, LM3, HUH7, and SNU387 cells using bisulfite methylation data. The expression of OATP1B3 was assessed by RT-qPCR and Western Blot. The effect of Sorafenib in combination with DAC on the proliferation of Hep3B cells was dynamically monitored using RTCA-eSight. The mechanism was further verified in vivo using an in situ implantation tumor model in nude mice. The expression of OATP1B3 in tumor tissues was detected by immunohistochemical staining and Western Blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eIndividuals with high expression of the OATP1B3 gene have a significantly higher overall survival rate than individuals with low expression. The negative correlation between SLCO1B3 expression and the DNA methyltransferase DNMT1.In Hep3B,the DNA methylation of OATP1B3 results in decreased protein expression. After DAC incubation, OATP1B3 expression was up-regulated. Following DAC administration, Hep3B proliferated at a considerably lesser rate than the Sorafenib group. The absorption of Sorafenib by Hep3B was raised by 1.87-fold following co-administration of DAC. According to the Hep3B xenograft nude mice model data, the tumor sizes in the combination group were all noticeably lower after 21 days of dosing than those in the Sorafenib alone, DAC, and Control groups. Both the combination group and the DAC group had significantly greater levels of OATP1B3 expression than control and Sorafenib group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e By inhibiting the DNA methylation of SLCO1B3 and increasing the expression of OATP1B3, which mediates Sorafenib transmembrane transporter protein, the epigenetic drug decitabine can enhance the accumulation of Sorafenib in hepatocellular carcinoma cells. This enhances sensitivity in hepatocellular carcinoma cells and reverses resistance to Sorafenib.\u003c/p\u003e","manuscriptTitle":"Decitabine regulates the resistance of Hep3B to sorafenib through demethylation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-05 16:13:47","doi":"10.21203/rs.3.rs-4200321/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a4024a4-d6f3-461b-9e76-7ccb8ffb1ada","owner":[],"postedDate":"April 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-28T01:08:11+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-05 16:13:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4200321","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4200321","identity":"rs-4200321","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.