METTL3 mediated m6A methylation of HIF-1 α promoted progression in glioma

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Glioma was a malignant tumor of the central nervous system. m6A methylation and HIF-1α were related to the occurrence and development of gliomas. However, the co-mechanism of m6A methylation and HIF-1α in glioma is unclear. Objective This aim was to determine the m6A methylation of HIF-1α in glioma. Methods Elisa and dot blot were used to detect m6A level. The changes of related genes, biological pathways and gene ontology were analyzed by bioinformatics. METTL3 and HIF-1α were knockdown by sh-RNA, and the mRNA and protein level were detected by qPCR and western blot. In addition, the m6A RNA methylation sites were predicted and verified by m6A-RIP-MMP-6 analysis༎ Results We found that compared with paracancerous, the mRNA and protein levels of m6A were dramatically increased in glioma. The biological different were found in glioma and paracancerous. Moreover, glioma had highly mRNA and protein level of HIF-1α. METTL3 and HIF- 1α knockdown can significantly decrease the growth of glioma cells. Furthermore, we confirmed the m6A RNA methylation site in HIF-1α. Finally, we found that METTL3 regulated the m6A level and RNA stability of HIF-1α. Conclusion Our finding demonstrated that the co-mechanism of m6A methylation of HIF-1α and METTL3 in glioma, and may be helpful in the treatment of glioma.
Full text 71,668 characters · extracted from preprint-html · click to expand
METTL3 mediated m6A methylation of HIF-1 α promoted progression in glioma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article METTL3 mediated m6A methylation of HIF-1 α promoted progression in glioma Jubo Wang, Pengyu Ren, Yu Quan, Lv Jian This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3231271/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Glioma was a malignant tumor of the central nervous system. m6A methylation and HIF-1α were related to the occurrence and development of gliomas. However, the co-mechanism of m6A methylation and HIF-1α in glioma is unclear. Objective This aim was to determine the m6A methylation of HIF-1α in glioma. Methods Elisa and dot blot were used to detect m6A level. The changes of related genes, biological pathways and gene ontology were analyzed by bioinformatics. METTL3 and HIF-1α were knockdown by sh-RNA, and the mRNA and protein level were detected by qPCR and western blot. In addition, the m6A RNA methylation sites were predicted and verified by m6A-RIP-MMP-6 analysis༎ Results We found that compared with paracancerous, the mRNA and protein levels of m6A were dramatically increased in glioma. The biological different were found in glioma and paracancerous. Moreover, glioma had highly mRNA and protein level of HIF-1α. METTL3 and HIF- 1α knockdown can significantly decrease the growth of glioma cells. Furthermore, we confirmed the m6A RNA methylation site in HIF-1α. Finally, we found that METTL3 regulated the m6A level and RNA stability of HIF-1α. Conclusion Our finding demonstrated that the co-mechanism of m6A methylation of HIF-1α and METTL3 in glioma, and may be helpful in the treatment of glioma. glioma m6A methylation HIF 1 α METTL3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Glioma is a primary malignant tumor of the central nervous system, accounting for about 80% of all brain tumors[ 1 , 2 ]. Glioma is characterized by rapid cell proliferation, infiltration of surrounding tissue and angiogenesis[ 3 ]. Tumor cells diffuse invade the surrounding brain and hinder the effect of drug therapy, resulting in poor prognosis and high recurrence rate of glioma patients[ 4 , 5 ]. Therefore, it is very important to find direct and closely related targets so that gliomas can be diagnosed early and explore the potential mechanism of gliomas. RNA methylation is an epigenetic modification[ 6 ]. N6-methyladenosine (M6A) modification is the most common and well-studied one of RNA methylation[ 7 , 8 ]. M6A exists throughout the life cycle of RNA and exerts its biological functions by affecting RNA metabolism, including mRNA splicing, 3'- terminal processing, nucleic acid clearance and output, translation regulation, mRNA decay and non-coding RNA processing[ 7 , 9 , 10 ]. The regulators of m6A regulate the growth, progression and invasion of glioma cells by regulating target genes, which provides a reliable basis for M6A regulation target axis as a new therapeutic target and clinical prognosis index for glioma[ 4 , 11 – 13 ]. Hypoxia inducible factor 1 α (HIF 1 α) is a key transcription factor in the regulation of tumor microenvironment[ 14 – 16 ]. In an anaerobic environment, HIF1 α escapes proteasome system degradation, enters the nucleus, and then up-regulates genes associated with cancer progression[ 17 , 18 ]. It has been reported that HIF-1 α is abnormally expressed in glioma[ 19 – 21 ]. HIF-1 α supports tumor progression by regulating its downstream genes, including angiogenesis, cell proliferation and survival, invasion and metastasis[ 22 ]. The expression of HIF-1 α is considered to be positively correlated with the grade, invasion and progression of gliomas[ 23 , 24 ]. Therefore, the occurrence and development of glioma can be regulated by targeting HIF-1 α and its downstream signal molecules. However, the mechanism of m6A mediated HIF-1 α expression in the malignant progression of gliomas has not been reported before. The aim of this study is to explore the co-mechanism of HIF-1 α and m6A on the survival and progression of glioma, hoping to provide the theoretical basis for the treatment of gliomas. Methods Enzyme-linked immunosorbent assay (ELISA) RNA was isolated with Trizol (Invitrogen, USA)[ 25 ]. The level of m6A was detected using the Epiquik m6A RNA methylation quantication kit (Epigentek, P9005). In briefly, The RNA solution was measure according to the instructions. Dot blot To detect the level of M6a in glioma and paracancerous, dot blot was used to in m6A analysis[ 26 ]. Briefly, Equal amount of RNA of each sample were transferred to a Amersham Hybond-N + membrane (BIO EXCELLENCE; RPN1732B) using a Bio-Dot apparatus (Bio-red, #170–6545) and UV crosslinked membrane.After blocking in 5% skim milk (solved in PTBS) for 1h at room temperature and incubated with m6A antibodies (1:1000; Abcam;ab151230 ) overnight at 4℃. The membrane was exposed to HRP-conjugated goat anti-rabbit IgG secondary antibodies (1:5000; Proteintech) at room temperature for 1h. Immunoreactive blots were visualized with ECL detection kit (Sangon). The images were captured by ChemiDoc Touch imaging system (Bio-Rad) and the relative signal density was analyzed by Image J. Bioinformatic analysis Total RNA was extracted using Trizol (Invitrogen, USA) for RNA-seq analysis throughput sequencing on the Illumina MiSeq platform. Sequencing data were processed and analyzed by Personalbio Technology Company (Shanghai, China). Quantitative real-time PCR (qPCR) The mRNA level was detected by Quantitative real-time PCR (qPCR) as described previously [ 25 ]. The total RNA of samples was extracted using EZ-press Tissue RNA Purification Kit (RN001-plus, EZBioscience, USA). An 4× Reverse Transcription Master Mix (EZBioscience) was used for reverse transcription reaction at 42˚C for 15 min, 95˚C for 3 min. The 2× SYBR Green qPCR Master Mix (EZBioscience) was used to perform qPCR following this protocol: denaturation(5min, 95°C), and 40 amplification cycles(10S at 95°C, and 30S at 60°C) by using the Strata Gene Mx3000p (Agilent Technologies, Inc., Santa Clara, CA). The 2 −△△Ct method was used to evaluate the expression levels of examined genes. Each gene of interest was normalized to GAPDH and the fold change was compared relative to the control sample. Each assay was performed in triplicate and experiments were repeated in at least three pooled tissue samples. The primers used: GAPDH: 5’ -GGAGCGAGATCCCTCCAAAAT-3’ 5’-GGCTGTTGTCATACTTCTCATGG-3’; METTL3: 5’ -TTGTCTCCAACCTTCCGTAGT-3’ 5’ -CCAGATCAGAGAGGTGGTGTAG-3’; HIF-1α: 5’- AAAGCGCAAGTCCTCAAAGC-3’ 5’- TCTGTTTGGTGAGGCTGTCC − 3’. Western blot To detect the level of proteins, cells and tissues were lysed in lysis buffer. Equal amount of Proteins (20µg) of each sample were resolved by 12% SDS-PAGE, and the gel were transferred to PVDF membranes for immunoblotting. After blocking in buffer (5% skim milk in TBS) for 1h at room temperature and incubated with primary antibodies overnight at 4℃. The PVDF membranes were washed with TBST three times for 10min/times, and exposed to HRP-conjugated goat anti-mouse or anti-rabbit IgG secondary antibodies for 1h at room temperature. Immunoreactive bands were visualized with ECL detection kit (Sangon). The images were captured by ChemiDoc Touch imaging system (Bio-Rad) and analyzed by Image J. The primary antibodies were as followed: anti-Mettl3 (1:1000; Abcam; ab195352); anti- HIF-1α (1:1000; Abcam; ab16066); and anti-GAPDH (1:1000; Abcam; ab181602). HRP-conjugated goat anti-mouse or anti-rabbit IgG secondary antibodies were used from Proteintech (1:2000 dilution). Histopathological analysis U87MG cells slices were fixed in 4% paraformaldehyde for 15 min and stained with heatoxylin and eosin(H&E). Briefly, cells slices were deparaffinized with xylene for 30 min and rehydrated through gradient alcohol. After staining in heatoxylin for 5min, cells slices were incubated with HCl-alcohol for 10s, washed with H 2 O for 50min. Then, cells slices were stained with eosin for 5min, dehydrated through gradient alcohol, and cleared with xylene twice. Finally, the slices were mounted with neutral balsam for light microscope observations. Methylation analysis The sequence of HIF-1α promoter region was predicted using the University of California, Santa Cruz (UCSC) genome browser ( http://genome.ucsc.edu/ ). Methylation primers of HIF-1α were designed using PrimerBank ( https://pga.mgh.harvard.edu/primerbank/ ) with the CpG island criteria. The MSP primers were: forward༚ 5’- AAAGCGCAAGTCCTCAAAGC -3’ and reverse: 5’- TCTGTTTGGTGAGGCTGTCC − 3’. m6A RNA immunoprecipitation (MeRIP) assay MeRIP was using EpiQuik CUT&RUN m6A RNA Enrichment (MeRIP) Kit(Epigentek;p-9018-24) to detect the m6A level of HIF-1α as performed previously[ 26 ].In brief, total RNA was extracted with Trizol reagent from glioma and paracanerous tissue and incubated with anti-m6A antibody (1:500;Abcam; ab208577) and protein A/G magnetic beads (Santa Cruz ;sc2003) with rotation at 4℃ overnight. Then, the beads were wash with the buffer and subjected to isolate RNA for RT-qPCR. Luciferase reporter assay The sequence was cloned into a luciferase expression vector (GenePharma, Shanghai, China) containing Renilla luciferase (R-luc) and firefly luciferase (F-luc). Then, HEK293T cells transfected with HIF-1α promoter region reporter vectors and were further co-transfected with WT and mutant METTL3 in cells. The Dual Luciferase Reporter kit (Promega) was used to detect luciferase activity. Statistical analysis Three or four biologically repeats were performed for each experiment. The data were shown as the mean ± SEM and analyzed by two-tailed Student’s t test. Excel 2016 and GraphPad Prism 7 software were used to statistical analysis. Statistically significant differences were considered as *P < 0.05 or **P < 0.01 and ***P < 0.001. Results m6A was highly expressed in glioma tissues To examine the expression of m6A in glioma tissue, we used Elisa and dot blots to detect the mRNA and protein of mA6. Our result shown that the mRNA level of m6A was increased in glioma tissues compared with paracancerous (P < 0.01, Fig. 1 A and 1 B). Also, m6A protein was highly expressed in glioma tissue (P < 0.01, Fig. 1 C and D). Function enrichment analysis To explore the function of the regulator and targeted genes of glioma related m6A RNA methylation, we carried out bioinformatics analysis. We found 892 genes including METTL3 and HIF-1αwere also differentially expressed in glioma and paracancerous tissues(Fig. 2 A). Furthermore, volcanic pot results showed that there differential genes were related to cell metabolic function (Fig. 2 B). To further understand the role of these differential genes in the occurrence and development of glioma, we analyzed the association between these genes and cancer-related pathways by KEGG and GO enrichment analysis (Fig. 2 C and 2 D). The results show that these genes are involved in 110 molecular functions and signal pathways. At the same time, these genes were involved in the biological process of the multiple nervous system, including synaptic membrane, chemical synaptic transmission and nervous system development. Increased level of HIF-1α mRNA and protein in glioma We further verified the expression level of METTL3 and HIF-1α in glioma. First, we used QPCR to detect the mRNA level of METTL3 and HIF-1α in glioma. As shown in Fig. 3 A and 3 B, the mRNA levels of METTL3 and HIF-1α increased significantly in glioma compared with paracancerous. Subsequently, western blotting results shown that HIF-1αprotein in glioma was dramatically higher than that in paracancerous (Fig. 3 C and 3 D). However, there was no significantly difference in METTL3 protein between two groups (Fig. 3 C and 3 E). These results suggested that HIF-1 α plays an important role in glioma. Sh-RNA targeting METTL3 and HIF-1α rescued the cell growth in cell model of glioma. To further analyze the role of METTL3 and HIF-1 α in the growth of gliomas, we first used sh-RNA to konckdown METTL3 and HIF-1 RNA level, and then detected the cell growth. The results showed that either METTL3 or HIF-1 knockdown can significantly decrease the cell invasion in glioma cells(Fig. 4 ). Identification of m6A RNA methylation of HIF-1αin glioma To detect the m6A RNA methylation sites of HIF-1αin glioma, we analyzed the sites using UCSU database. We predicted three highly correlated m6A RNA methylation sites on HIF-1 α (Fig. 5 A). And m6A-RIP-MMP-6 analysis also validated the prediction results (Fig. 5 B and 5 C). METTL3-meditated regulation of HIF-1α depended on the m6A methylation activity. To evaluate the target mRNA m6A modifications of HIF-1α for METTL3 mediated gene regulation, we performed luciferase reporter and mutagenesis assays. As shown in Fig. 5 C-D, METTL3-WT significantly increased the luciferase activity of HIF-1α compared with mutant-METTL3 and control. The mutation of m6A modification of HIF-1α eliminated the promoting of METTL3. To verify whether the above results were related to m6A modification, we detected the m6A level of UTR fragments of WT and mutant HIF-1α in HEK293T cells that used for luciferase reporter assays. qPCR the UTR fragments of wild-type and mutant HIF in HEK293T cells for the detection of luciferase reporter gene (Fig. 6 E). Consistent with expected, we found that overexpression of WT-HIF1-αinduced the m6A level, but the mutant-HIF-1α contain the minimal m6A level.More importantly, the co-transfected HIF-1α and METTL3 significantly increased m6A level compared with co-transfected with METTL3 mutant and vector in HEK293 T cell (Fig. 5 F). Furthermore, we detected the RNA stability after overexpression of WT and mutant METTL3. METTL3 enhanced the RNA stability of HIF-1α(Fig. 5 G). Collectively, we demonstrated that METTL3 mediated HIF-1α regulation relied on its m6A modification activity. Discussion Glioma was a common neuroepithelial cancer with the characteristics of rapid growth, strong invasiveness, poor prognosis and high degree of malignancy[ 27 , 28 ]. Studies have shown that m6A RNA methylation regulators regulated the proliferation, growth and infiltration of glioma cells. M6A methylation regulation targeted- genes provided reliable support for gliomas[ 13 , 29 ]. Recent studies have found that pyroptosis can promote the occurrence and development of early tumor, which was induced by the up-regulation of HIF-1 α[ 30 ]. However, the effect of m6A methylation on HIF-1 α and its mechanism were not clear. To determine the effect of m6A methylation of HIF-1 α in the development of glioma, we systematically analyzed the level of m6A RNA methylation and its potential targets in gliomas. The results of Elisa and dot blot showed that the expression level of m6A were significantly increased in glioma tissue compared with the paracancerous tissues. We observed that there was a variety of differential genes related to cell metabolism and neural system biological processes in gliomas and paracancerous tissues by bioinformatics analysis. Glioma was positively correlated with HIF-1 α[ 19 , 31 ]. To verify this, we examined the level of HIF-1 α in gliomas. Our data showed that the mRNA and protein of HIF-1 α were significantly related to glioma. Of interest was that low level of Mellt3 and HIF-1 α reduced the cell growth of glioma. Moreover, the m6A methylation of HIF-1 α. These finding were consistent with the previous reported[ 24 , 26 ]. Next, we detected the correlation of m6A methylation and HIF-1 α. Mechanistically, the m6A methylation sites of HIF-1 α were detected in glioma. Moreover, we demonstrate that the biological function of HIF-1α relies on its m6A methylation activity regulated by METTL3.Our results demonstrated that m6A methylation of HIF-1 α played a key role in gliomas, which was mediated by METTL3. The effect of METTL3 on m6A methylation of HIF-1 α should be carefully considered, because there were many causes of gliomas. Therefore, in the follow-up study, we will further study the biological function of HIF-1 α in the occurrence and development of gliomas. At the same time, in our study, we have predicted and proved the m6A methylation sites of HIF-1 α. We will try to screen the methods to regulate HIF-1 α methylation to provide new ideas for the treatment of gliomas. Conclusion In summary, we confirmed that m6A methylation of HIF-1 α was mediated by METTL3 and may involved in the occurrence of gliomas, and reported the m6A methylation sites of HIF-1 α, which suggested that HIF-1 α methylation may be a potential target for the treatment of gliomas. Our results will contribute to the customization and clinical decision-making of clinical treatment of gliomas and central nervous system malignant cancer. Declarations Ethics approval The protocol was approved by the institutional review board at the second affiliated hospital of Xian Jiaotong University. According to the examination of the Life Science Ethics Committee of t the second affiliated hospital of Xian Jiaotong University (No. 2022255), the contents and process of the project follow the international and national ethical requirements for biomedical research. All subjects gave written informed consent in accordance with the Declaration of Helsinki. Founding This work was supported by grants from Free Exploration Project for Basic Scientific Research of Xi’an Jiaotong University, Grant/Award Number: xjj2018136; General Projects of Key R&D Programs of Shaanxi Province, Grant/Award Number: 2020SF-257. Competing interests The authors have no relevant financial or non-financial interests to disclose. Data availability The datasets generated during and/or analyzed during the current study are not publicly available due to the information protection of patients but are available from the corresponding author upon reasonable request. Author contributions JBW designed research; JBW Funding acquisition; JBW,PYR,YQ, and YL performed re-search and analyzed data; JBW, and PYR, drafted the manuscript. JBW,PYR,YQ, and YL analyzed data and edited the manuscript. Consent to participate Informed consent was obtained from all individual participants included in the study. Consent to publish The authors affirm that human research participants provided informed consent for the publication of all data. Acknowledgements The authors are grateful to Jubo for their guidance on writing articles. This work was supported by grants from Free Exploration Project for Basic Scientific Research of Xi’an Jiaotong University, Grant/Award Number: xjj2018136; General Projects of Key R&D Programs of Shaanxi Province, Grant/Award Number: 2020SF-257. References Tang, T., et al., Nanoprobe-mediated precise imaging and therapy of glioma. Nanoscale Horiz, 2021. 6 (8): p. 634-650. Hu, Y., et al., The antibiotic clofoctol suppresses glioma stem cell proliferation by activating KLF13. J Clin Invest, 2019. 129 (8): p. 3072-3085. Wu, Y., et al., P4HA2 promotes cell proliferation and migration in glioblastoma. Oncol Lett, 2021. 22 (2): p. 601. Cong, P., et al., Identification of the Role and Clinical Prognostic Value of Target Genes of m6A RNA Methylation Regulators in Glioma. Front Cell Dev Biol, 2021. 9 : p. 709022. Aditya, R., et al., A Review on SIRtuins in Diabetes. Curr Pharm Des, 2017. 23 (16): p. 2299-2307. Yu, B., et al., Methylation Modification, Alternative Splicing, and Noncoding RNA Play a Role in Cancer Metastasis through Epigenetic Regulation. Biomed Res Int, 2021. 2021 : p. 4061525. Sun, T., R. Wu, and L. Ming, The role of m6A RNA methylation in cancer. Biomed Pharmacother, 2019. 112 : p. 108613. Dominissini, D., et al., Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature, 2012. 485 (7397): p. 201-6. Jiang, X., et al., The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther, 2021. 6 (1): p. 74. Lee, Y., et al., Molecular Mechanisms Driving mRNA Degradation by m(6)A Modification. Trends Genet, 2020. 36 (3): p. 177-188. Tao, N., et al., Interaction between m6A methylation and noncoding RNA in glioma. Cell Death Discov, 2022. 8 (1): p. 283. Pan, T., et al., The role m(6)A RNA methylation is CNS development and glioma pathogenesis. Mol Brain, 2021. 14 (1): p. 119. Zhang, Y., et al., m6A modification in RNA: biogenesis, functions and roles in gliomas. J Exp Clin Cancer Res, 2020. 39 (1): p. 192. Tang, Y.A., et al., Hypoxic tumor microenvironment activates GLI2 via HIF-1α and TGF-β2 to promote chemoresistance in colorectal cancer. Proc Natl Acad Sci U S A, 2018. 115 (26): p. E5990-e5999. Korbecki, J., et al., The Effect of Hypoxia on the Expression of CXC Chemokines and CXC Chemokine Receptors-A Review of Literature. Int J Mol Sci, 2021. 22 (2). Rashid, M., et al., Up-down regulation of HIF-1α in cancer progression. Gene, 2021. 798 : p. 145796. Xu, D., W. Dai, and C. Li, Polo-like kinase 3, hypoxic responses, and tumorigenesis. Cell Cycle, 2017. 16 (21): p. 2032-2036. Das, L. and M. Vinayak, Curcumin Modulates Glycolytic Metabolism and Inflammatory Cytokines via Nrf 2 in Dalton's Lymphoma Ascites Cells In Vivo. Anticancer Agents Med Chem, 2018. 18 (12): p. 1779-1791. Ding, X.C., et al., The relationship between expression of PD-L1 and HIF-1α in glioma cells under hypoxia. J Hematol Oncol, 2021. 14 (1): p. 92. Domènech, M., et al., Hypoxia: The Cornerstone of Glioblastoma. Int J Mol Sci, 2021. 22 (22). Li, J., et al., Hypoxic Glioma Stem Cell-Derived Exosomes Containing Linc01060 Promote Progression of Glioma by Regulating the MZF1/c-Myc/HIF1α Axis. Cancer Res, 2021. 81 (1): p. 114-128. Miska, J., et al., HIF-1α Is a Metabolic Switch between Glycolytic-Driven Migration and Oxidative Phosphorylation-Driven Immunosuppression of Tregs in Glioblastoma. Cell Rep, 2019. 27 (1): p. 226-237.e4. Liu, N., et al., Lactate inhibits ATP6V0d2 expression in tumor-associated macrophages to promote HIF-2α-mediated tumor progression. J Clin Invest, 2019. 129 (2): p. 631-646. Bao, L., et al., Methylation of hypoxia-inducible factor (HIF)-1α by G9a/GLP inhibits HIF-1 transcriptional activity and cell migration. Nucleic Acids Res, 2018. 46 (13): p. 6576-6591. Zhang, K., et al., UBQLN2-HSP70 axis reduces poly-Gly-Ala aggregates and alleviates behavioral defects in the C9ORF72 animal model. Neuron, 2021. 109 (12): p. 1949-1962.e6. Li, Z., et al., FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell, 2017. 31 (1): p. 127-141. Wu, D. and C. Wang, miR-155 Regulates the Proliferation of Glioma Cells Through PI3K/AKT Signaling. Front Neurol, 2020. 11 : p. 297. Gusyatiner, O. and M.E. Hegi, Glioma epigenetics: From subclassification to novel treatment options. Semin Cancer Biol, 2018. 51 : p. 50-58. Chen, F., et al., The Potential Value of m6A RNA Methylation in the Development of Cancers Focus on Malignant Glioma. Front Immunol, 2022. 13 : p. 917153. Gulluoglu, S., et al., Simultaneous miRNA and mRNA transcriptome profiling of glioblastoma samples reveals a novel set of OncomiR candidates and their target genes. Brain Res, 2018. 1700 : p. 199-210. Li, J., et al., ELTD1 facilitates glioma proliferation, migration and invasion by activating JAK/STAT3/HIF-1α signaling axis. Sci Rep, 2019. 9 (1): p. 13904. Additional Declarations No competing interests reported. Supplementary Files Graph.jpg The schematic model of the role and underlying mechanism of HIF-1α in glioma. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3231271","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":224084002,"identity":"19a71586-c834-42e5-bd62-ae18ec7bf497","order_by":0,"name":"Jubo Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABL0lEQVRIie2RMUsDMRTHcwTS5ZVbU7T1KwQOTodiv0oO4aarS5dDRCKFm6RzC/0Q9xHeEajL1bnQpSDUpeBJwVFNBh3qXWfB/Kbkz/sleS+EOBx/kpJglfKef/b6tiGEn5pI2txTzYpXTMt+0FEyEEYBE0XquAJUt7M4EihDbrff1Y2KKJaoodSSIMY3q9sLIFy+PAPpd3Ok202dgk+ymKf62rtXi3WyMA8DjMZA4iBHdi5qlBBLgbtSjyj1snXCjNJSVtFRjsB4k9LOdJQxykbJh1EoscrnUaWw7T8AY3SY/dyCjcrA9mKHzDnQk+GEAzO9zObiKphpFtYpnelSV/YrByvw9sn7Xc/niax26WV38jje1imE40HACEgzSbOidfUGX/2KWoenOBwOxz/nCw2ybK/Zy7I8AAAAAElFTkSuQmCC","orcid":"","institution":"The Second Affiliated Hospital of Xi'an Jiaotong University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jubo","middleName":"","lastName":"Wang","suffix":""},{"id":224084003,"identity":"562b6002-7735-420f-91fa-19d4526df393","order_by":1,"name":"Pengyu Ren","email":"","orcid":"","institution":"The Second Affiliated Hospital of Xi'an Jiaotong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pengyu","middleName":"","lastName":"Ren","suffix":""},{"id":224084004,"identity":"00925eef-dd28-4fe5-9c83-abe00de81cd0","order_by":2,"name":"Yu Quan","email":"","orcid":"","institution":"The Second Affiliated Hospital of Xi'an Jiaotong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Quan","suffix":""},{"id":224084005,"identity":"8acd64b0-60b2-46ad-a82d-0d674f07580a","order_by":3,"name":"Lv Jian","email":"","orcid":"","institution":"The Second Affiliated Hospital of Xi'an Jiaotong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lv","middleName":"","lastName":"Jian","suffix":""}],"badges":[],"createdAt":"2023-08-03 12:14:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3231271/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3231271/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":41371007,"identity":"f7ebe203-0e79-40e6-8600-e65a078d618e","added_by":"auto","created_at":"2023-08-10 14:07:56","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":391276,"visible":true,"origin":"","legend":"\u003cp\u003eM6A was highly expressed in glioma. (A) mRNA standard curve of m6A was determined using Elisa in OD 450nm. (B) mRNA level of m6A in human glioma tissue and paracancerous was detected using Elisa. (C) m6A protein was detected using dot blot in glioma tissue and paracancerous. (D) The Statistics in figure 1A. N =3. The experiment was repeated 3 times independently.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/3e1f81d692daf6f5f66467a7.jpg"},{"id":41371011,"identity":"173154f8-660b-44f5-91d4-1a56f9bb05a7","added_by":"auto","created_at":"2023-08-10 14:07:56","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":142933,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of changed genes, biological pathway and gene ontology involved in glioma and paracancerous tissue. (A) Heatmap of mRNA expressions in glioma and paracancerous tissue. (B) Volcano plot to visualize differential metabolites of significance between glioma and paracancerous tissue. (C) KEGG pathway enrichment analyses of glioma and paracancerous tissue. (D) GO enrichment analysis of glioma and paracancerous.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/d6ab2ecc0b0895071125c225.jpg"},{"id":41371009,"identity":"c8d55c95-9eb1-4e94-9038-5f827de0e9ff","added_by":"auto","created_at":"2023-08-10 14:07:56","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":558462,"visible":true,"origin":"","legend":"\u003cp\u003eIncreased level of HIF-1αmRNA and protein in glioma. (A-B) qPCR analyses of the mRNA levels of METTL3 and HIF-1αin glioma and paracancerous tissues. (C) western blotting analyses of the protein levels of METTL3 and HIF-1αin glioma and paracancerous tissues.(D-E) The Statistics in 3C.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/458e2bb85354f09a1ecaf262.jpg"},{"id":41371766,"identity":"310dae66-03a7-4d72-89e6-befd43e76dc5","added_by":"auto","created_at":"2023-08-10 14:15:56","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1107698,"visible":true,"origin":"","legend":"\u003cp\u003eSh-RNA targeting METTL3 and HIF-1αrescued the cell growth in cell model of glioma. (A) Western blot analysis of U87MG cells with sh-METTL3 treatments. (B) The Statistics in 4A. (C) Western blot analysis of U87MG cells with sh-HIF-1αtreatments. (D) The Statistics in 4C. (E)The HE staining of U87MG from control, sh-METTL3 and sh-HIF-1α.(F) The Statistics in 4E.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/c1c91a7d75b030a0c268d8d7.jpg"},{"id":41371012,"identity":"67710c36-9b5e-4f23-a5d6-d518bbd0e376","added_by":"auto","created_at":"2023-08-10 14:07:56","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":567467,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of m6A RNA methylation in glioma. (A) m6A prediction score distribution along the query sequence of HIF-1α. The X axis represents the m6A methylation site and the Y axis represents the score. (B) m6A-RIP-MMP-6 analysis of HIF-1α. (C) The Statistics in 4C.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/2848fb2c3808a0fc2b6bf379.jpg"},{"id":41371765,"identity":"df65116e-48a7-4b8b-8534-768dc79893ab","added_by":"auto","created_at":"2023-08-10 14:15:56","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":505328,"visible":true,"origin":"","legend":"\u003cp\u003eMETTL3-meditated regulation of HIF-1α depended on the m6A methylation activity. (A-B) The firefly luciferase activity analysis. (C-D) The m6A qPCR analysis of m6A levels. (E) the RNA stability analysis of HIF-1α.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/6071217f09ce2c215969887c.jpg"},{"id":42555008,"identity":"740e79bd-a9d3-4667-b716-327ec4233eb5","added_by":"auto","created_at":"2023-09-03 18:37:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":856935,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/492cb447-f548-4017-bb07-f7e0c8eeac89.pdf"},{"id":41371764,"identity":"0d104c02-44b6-456c-a94d-bd1047a9c4d5","added_by":"auto","created_at":"2023-08-10 14:15:56","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":69951,"visible":true,"origin":"","legend":"\u003cp\u003eThe schematic model of the role and underlying mechanism of HIF-1α in glioma.\u003c/p\u003e","description":"","filename":"Graph.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3231271/v1/c8c58a925bc398cfb716037c.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"METTL3 mediated m6A methylation of HIF-1 α promoted progression in glioma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlioma is a primary malignant tumor of the central nervous system, accounting for about 80% of all brain tumors[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Glioma is characterized by rapid cell proliferation, infiltration of surrounding tissue and angiogenesis[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Tumor cells diffuse invade the surrounding brain and hinder the effect of drug therapy, resulting in poor prognosis and high recurrence rate of glioma patients[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Therefore, it is very important to find direct and closely related targets so that gliomas can be diagnosed early and explore the potential mechanism of gliomas.\u003c/p\u003e \u003cp\u003eRNA methylation is an epigenetic modification[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. N6-methyladenosine (M6A) modification is the most common and well-studied one of RNA methylation[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. M6A exists throughout the life cycle of RNA and exerts its biological functions by affecting RNA metabolism, including mRNA splicing, 3'- terminal processing, nucleic acid clearance and output, translation regulation, mRNA decay and non-coding RNA processing[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The regulators of m6A regulate the growth, progression and invasion of glioma cells by regulating target genes, which provides a reliable basis for M6A regulation target axis as a new therapeutic target and clinical prognosis index for glioma[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHypoxia inducible factor 1 α (HIF 1 α) is a key transcription factor in the regulation of tumor microenvironment[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In an anaerobic environment, HIF1 α escapes proteasome system degradation, enters the nucleus, and then up-regulates genes associated with cancer progression[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. It has been reported that HIF-1 α is abnormally expressed in glioma[\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. HIF-1 α supports tumor progression by regulating its downstream genes, including angiogenesis, cell proliferation and survival, invasion and metastasis[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The expression of HIF-1 α is considered to be positively correlated with the grade, invasion and progression of gliomas[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Therefore, the occurrence and development of glioma can be regulated by targeting HIF-1 α and its downstream signal molecules. However, the mechanism of m6A mediated HIF-1 α expression in the malignant progression of gliomas has not been reported before.\u003c/p\u003e \u003cp\u003eThe aim of this study is to explore the co-mechanism of HIF-1 α and m6A on the survival and progression of glioma, hoping to provide the theoretical basis for the treatment of gliomas.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eRNA was isolated with Trizol (Invitrogen, USA)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The level of m6A was detected using the Epiquik m6A RNA methylation quantication kit (Epigentek, P9005). In briefly, The RNA solution was measure according to the instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDot blot\u003c/h2\u003e \u003cp\u003eTo detect the level of M6a in glioma and paracancerous, dot blot was used to in m6A analysis[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Briefly, Equal amount of RNA of each sample were transferred to a Amersham Hybond-N\u0026thinsp;+\u0026thinsp;membrane (BIO EXCELLENCE; RPN1732B) using a Bio-Dot apparatus (Bio-red, #170\u0026ndash;6545) and UV crosslinked membrane.After blocking in 5% skim milk (solved in PTBS) for 1h at room temperature and incubated with m6A antibodies (1:1000; Abcam;ab151230 ) overnight at 4℃. The membrane was exposed to HRP-conjugated goat anti-rabbit IgG secondary antibodies (1:5000; Proteintech) at room temperature for 1h. Immunoreactive blots were visualized with ECL detection kit (Sangon). The images were captured by ChemiDoc Touch imaging system (Bio-Rad) and the relative signal density was analyzed by Image J.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using Trizol (Invitrogen, USA) for RNA-seq analysis throughput sequencing on the Illumina MiSeq platform. Sequencing data were processed and analyzed by Personalbio Technology Company (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR (qPCR)\u003c/h2\u003e \u003cp\u003eThe mRNA level was detected by Quantitative real-time PCR (qPCR) as described previously [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The total RNA of samples was extracted using EZ-press Tissue RNA Purification Kit (RN001-plus, EZBioscience, USA). An 4\u0026times; Reverse Transcription Master Mix (EZBioscience) was used for reverse transcription reaction at 42˚C for 15 min, 95˚C for 3 min. The 2\u0026times; SYBR Green qPCR Master Mix (EZBioscience) was used to perform qPCR following this protocol: denaturation(5min, 95\u0026deg;C), and 40 amplification cycles(10S at 95\u0026deg;C, and 30S at 60\u0026deg;C) by using the Strata Gene Mx3000p (Agilent Technologies, Inc., Santa Clara, CA). The 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method was used to evaluate the expression levels of examined genes. Each gene of interest was normalized to GAPDH and the fold change was compared relative to the control sample. Each assay was performed in triplicate and experiments were repeated in at least three pooled tissue samples.\u003c/p\u003e \u003cp\u003eThe primers used:\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGAPDH:\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e5\u0026rsquo; -GGAGCGAGATCCCTCCAAAAT-3\u0026rsquo;\u003c/h2\u003e \u003cp\u003e5\u0026rsquo;-GGCTGTTGTCATACTTCTCATGG-3\u0026rsquo;;\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMETTL3:\u003c/h2\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e5\u0026rsquo; -TTGTCTCCAACCTTCCGTAGT-3\u0026rsquo;\u003c/h2\u003e \u003cp\u003e5\u0026rsquo; -CCAGATCAGAGAGGTGGTGTAG-3\u0026rsquo;;\u003c/p\u003e \u003cp\u003eHIF-1α:\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e5\u0026rsquo;- AAAGCGCAAGTCCTCAAAGC-3\u0026rsquo;\u003c/h2\u003e \u003cp\u003e5\u0026rsquo;- TCTGTTTGGTGAGGCTGTCC \u0026minus;\u0026thinsp;3\u0026rsquo;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eTo detect the level of proteins, cells and tissues were lysed in lysis buffer. Equal amount of Proteins (20\u0026micro;g) of each sample were resolved by 12% SDS-PAGE, and the gel were transferred to PVDF membranes for immunoblotting. After blocking in buffer (5% skim milk in TBS) for 1h at room temperature and incubated with primary antibodies overnight at 4℃. The PVDF membranes were washed with TBST three times for 10min/times, and exposed to HRP-conjugated goat anti-mouse or anti-rabbit IgG secondary antibodies for 1h at room temperature. Immunoreactive bands were visualized with ECL detection kit (Sangon). The images were captured by ChemiDoc Touch imaging system (Bio-Rad) and analyzed by Image J. The primary antibodies were as followed: anti-Mettl3 (1:1000; Abcam; ab195352); anti- HIF-1α (1:1000; Abcam; ab16066); and anti-GAPDH (1:1000; Abcam; ab181602). HRP-conjugated goat anti-mouse or anti-rabbit IgG secondary antibodies were used from Proteintech (1:2000 dilution).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological analysis\u003c/h2\u003e \u003cp\u003eU87MG cells slices were fixed in 4% paraformaldehyde for 15 min and stained with heatoxylin and eosin(H\u0026amp;E). Briefly, cells slices were deparaffinized with xylene for 30 min and rehydrated through gradient alcohol. After staining in heatoxylin for 5min, cells slices were incubated with HCl-alcohol for 10s, washed with H\u003csub\u003e2\u003c/sub\u003eO for 50min. Then, cells slices were stained with eosin for 5min, dehydrated through gradient alcohol, and cleared with xylene twice. Finally, the slices were mounted with neutral balsam for light microscope observations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMethylation analysis\u003c/h2\u003e \u003cp\u003eThe sequence of HIF-1α promoter region was predicted using the University of California, Santa Cruz (UCSC) genome browser (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://genome.ucsc.edu/\u003c/span\u003e\u003cspan address=\"http://genome.ucsc.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Methylation primers of HIF-1α were designed using PrimerBank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pga.mgh.harvard.edu/primerbank/\u003c/span\u003e\u003cspan address=\"https://pga.mgh.harvard.edu/primerbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) with the CpG island criteria. The MSP primers were: forward༚ 5\u0026rsquo;- AAAGCGCAAGTCCTCAAAGC\u003c/p\u003e \u003cp\u003e-3\u0026rsquo; and reverse: 5\u0026rsquo;- TCTGTTTGGTGAGGCTGTCC \u0026minus;\u0026thinsp;3\u0026rsquo;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003em6A RNA immunoprecipitation (MeRIP) assay\u003c/h2\u003e \u003cp\u003eMeRIP was using EpiQuik CUT\u0026amp;RUN m6A RNA Enrichment (MeRIP) Kit(Epigentek;p-9018-24) to detect the m6A level of HIF-1α as performed previously[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].In brief, total RNA was extracted with Trizol reagent from glioma and paracanerous tissue and incubated with anti-m6A antibody (1:500;Abcam; ab208577) and protein A/G magnetic beads (Santa Cruz ;sc2003) with rotation at 4℃ overnight. Then, the beads were wash with the buffer and subjected to isolate RNA for RT-qPCR.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLuciferase reporter assay\u003c/h2\u003e \u003cp\u003eThe sequence was cloned into a luciferase expression vector (GenePharma, Shanghai, China) containing Renilla luciferase (R-luc) and firefly luciferase (F-luc). Then, HEK293T\u003c/p\u003e \u003cp\u003ecells transfected with HIF-1α promoter region reporter vectors and were further co-transfected with WT and mutant METTL3 in cells. The Dual Luciferase Reporter kit (Promega) was used to detect luciferase activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThree or four biologically repeats were performed for each experiment. The data were shown as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM and analyzed by two-tailed Student\u0026rsquo;s t test. Excel 2016 and GraphPad Prism 7 software were used to statistical analysis. Statistically significant differences were considered as *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003em6A was highly expressed in glioma tissues\u003c/h2\u003e \u003cp\u003eTo examine the expression of m6A in glioma tissue, we used Elisa and dot blots to detect the mRNA and protein of mA6. Our result shown that the mRNA level of m6A was increased in glioma tissues compared with paracancerous (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Also, m6A protein was highly expressed in glioma tissue (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eFunction enrichment analysis\u003c/h2\u003e \u003cp\u003eTo explore the function of the regulator and targeted genes of glioma related m6A RNA methylation, we carried out bioinformatics analysis. We found 892 genes including METTL3 and HIF-1αwere also differentially expressed in glioma and paracancerous tissues(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Furthermore, volcanic pot results showed that there differential genes were related to cell metabolic function (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). To further understand the role of these differential genes in the occurrence and development of glioma, we analyzed the association between these genes and cancer-related pathways by KEGG and GO enrichment analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The results show that these genes are involved in 110 molecular functions and signal pathways. At the same time, these genes were involved in the biological process of the multiple nervous system, including synaptic membrane, chemical synaptic transmission and nervous system development.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eIncreased level of HIF-1α mRNA and protein in glioma\u003c/h2\u003e \u003cp\u003eWe further verified the expression level of METTL3 and HIF-1α in glioma. First, we used QPCR to detect the mRNA level of METTL3 and HIF-1α in glioma. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, the mRNA levels of METTL3 and HIF-1α increased significantly in glioma compared with paracancerous. Subsequently, western blotting results shown that HIF-1αprotein in glioma was dramatically higher than that in paracancerous (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). However, there was no significantly difference in METTL3 protein between two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). These results suggested that HIF-1 α plays an important role in glioma.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSh-RNA targeting METTL3 and HIF-1α rescued the cell growth in cell model of glioma.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further analyze the role of METTL3 and HIF-1 α in the growth of gliomas, we first used sh-RNA to konckdown METTL3 and HIF-1 RNA level, and then detected the cell growth. The results showed that either METTL3 or HIF-1 knockdown can significantly decrease the cell invasion in glioma cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of m6A RNA methylation of HIF-1αin glioma\u003c/h2\u003e \u003cp\u003eTo detect the m6A RNA methylation sites of HIF-1αin glioma, we analyzed the sites using UCSU database. We predicted three highly correlated m6A RNA methylation sites on HIF-1 α (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). And m6A-RIP-MMP-6 analysis also validated the prediction results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMETTL3-meditated regulation of HIF-1α depended on the m6A methylation activity.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the target mRNA m6A modifications of HIF-1α for METTL3 mediated gene regulation, we performed luciferase reporter and mutagenesis assays. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D, METTL3-WT significantly increased the luciferase activity of HIF-1α compared with mutant-METTL3 and control. The mutation of m6A modification of HIF-1α eliminated the promoting of METTL3. To verify whether the above results were related to m6A modification, we detected the m6A level of UTR fragments of WT and mutant HIF-1α in HEK293T cells that used for luciferase reporter assays. qPCR the UTR fragments of wild-type and mutant HIF in HEK293T cells for the detection of luciferase reporter gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Consistent with expected, we found that overexpression of WT-HIF1-αinduced the m6A level, but the mutant-HIF-1α contain the minimal m6A level.More importantly, the co-transfected HIF-1α and METTL3 significantly increased m6A level compared with co-transfected with METTL3 mutant and vector in HEK293 T cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). Furthermore, we detected the RNA stability after overexpression of WT and mutant METTL3. METTL3 enhanced the RNA stability of HIF-1α(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). Collectively, we demonstrated that METTL3 mediated HIF-1α regulation relied on its m6A modification activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGlioma was a common neuroepithelial cancer with the characteristics of rapid growth, strong invasiveness, poor prognosis and high degree of malignancy[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Studies have shown that m6A RNA methylation regulators regulated the proliferation, growth and infiltration of glioma cells. M6A methylation regulation targeted- genes provided reliable support for gliomas[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Recent studies have found that pyroptosis can promote the occurrence and development of early tumor, which was induced by the up-regulation of HIF-1 α[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. However, the effect of m6A methylation on HIF-1 α and its mechanism were not clear. To determine the effect of m6A methylation of HIF-1 α in the development of glioma, we systematically analyzed the level of m6A RNA methylation and its potential targets in gliomas.\u003c/p\u003e \u003cp\u003eThe results of Elisa and dot blot showed that the expression level of m6A were significantly increased in glioma tissue compared with the paracancerous tissues. We observed that there was a variety of differential genes related to cell metabolism and neural system biological processes in gliomas and paracancerous tissues by bioinformatics analysis. Glioma was positively correlated with HIF-1 α[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. To verify this, we examined the level of HIF-1 α in gliomas. Our data showed that the mRNA and protein of HIF-1 α were significantly related to glioma. Of interest was that low level of Mellt3 and HIF-1 α reduced the cell growth of glioma. Moreover, the m6A methylation of HIF-1 α. These finding were consistent with the previous reported[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Next, we detected the correlation of m6A methylation and HIF-1 α. Mechanistically, the m6A methylation sites of HIF-1 α were detected in glioma. Moreover, we demonstrate that the biological function of HIF-1α relies on its m6A methylation activity regulated by METTL3.Our results demonstrated that m6A methylation of HIF-1 α played a key role in gliomas, which was mediated by METTL3.\u003c/p\u003e \u003cp\u003eThe effect of METTL3 on m6A methylation of HIF-1 α should be carefully considered, because there were many causes of gliomas. Therefore, in the follow-up study, we will further study the biological function of HIF-1 α in the occurrence and development of gliomas. At the same time, in our study, we have predicted and proved the m6A methylation sites of HIF-1 α. We will try to screen the methods to regulate HIF-1 α methylation to provide new ideas for the treatment of gliomas.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, we confirmed that m6A methylation of HIF-1 α was mediated by METTL3 and may involved in the occurrence of gliomas, and reported the m6A methylation sites of HIF-1 α, which suggested that HIF-1 α methylation may be a potential target for the treatment of gliomas. Our results will contribute to the customization and clinical decision-making of clinical treatment of gliomas and central nervous system malignant cancer.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protocol was approved by the institutional review board at the second affiliated hospital of Xian Jiaotong University. According to the examination of the Life Science Ethics Committee of t the second affiliated hospital of Xian Jiaotong University (No. 2022255), the contents and process of the project follow the international and national ethical requirements for biomedical research. All subjects gave written informed consent in accordance with the Declaration of Helsinki.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFounding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from Free Exploration Project for Basic Scientific Research of Xi\u0026rsquo;an Jiaotong University, Grant/Award Number: xjj2018136; General Projects of Key R\u0026amp;D Programs of Shaanxi Province, Grant/Award Number: 2020SF-257.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analyzed during the current study are not publicly available due to the information protection of patients but are available from the corresponding author upon reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJBW designed research; JBW Funding acquisition; JBW,PYR,YQ, and YL performed re-search and analyzed data; JBW, and PYR, drafted the manuscript. JBW,PYR,YQ, and YL analyzed data and edited the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all individual participants included in the study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors affirm that human research participants provided informed consent for the publication of all data.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are grateful to Jubo for their guidance on writing articles. This work was supported by grants from Free Exploration Project for Basic Scientific Research of Xi\u0026rsquo;an Jiaotong University, Grant/Award Number: xjj2018136; General Projects of Key R\u0026amp;D Programs of Shaanxi Province, Grant/Award Number: 2020SF-257.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTang, T., et al., \u003cem\u003eNanoprobe-mediated precise imaging and therapy of glioma.\u003c/em\u003e Nanoscale Horiz, 2021. \u003cstrong\u003e6\u003c/strong\u003e(8): p. 634-650.\u003c/li\u003e\n\u003cli\u003eHu, Y., et al., \u003cem\u003eThe antibiotic clofoctol suppresses glioma stem cell proliferation by activating KLF13.\u003c/em\u003e J Clin Invest, 2019. \u003cstrong\u003e129\u003c/strong\u003e(8): p. 3072-3085.\u003c/li\u003e\n\u003cli\u003eWu, Y., et al., \u003cem\u003eP4HA2 promotes cell proliferation and migration in glioblastoma.\u003c/em\u003e Oncol Lett, 2021. \u003cstrong\u003e22\u003c/strong\u003e(2): p. 601.\u003c/li\u003e\n\u003cli\u003eCong, P., et al., \u003cem\u003eIdentification of the Role and Clinical Prognostic Value of Target Genes of m6A RNA Methylation Regulators in Glioma.\u003c/em\u003e Front Cell Dev Biol, 2021. \u003cstrong\u003e9\u003c/strong\u003e: p. 709022.\u003c/li\u003e\n\u003cli\u003eAditya, R., et al., \u003cem\u003eA Review on SIRtuins in Diabetes.\u003c/em\u003e Curr Pharm Des, 2017. \u003cstrong\u003e23\u003c/strong\u003e(16): p. 2299-2307.\u003c/li\u003e\n\u003cli\u003eYu, B., et al., \u003cem\u003eMethylation Modification, Alternative Splicing, and Noncoding RNA Play a Role in Cancer Metastasis through Epigenetic Regulation.\u003c/em\u003e Biomed Res Int, 2021. \u003cstrong\u003e2021\u003c/strong\u003e: p. 4061525.\u003c/li\u003e\n\u003cli\u003eSun, T., R. Wu, and L. Ming, \u003cem\u003eThe role of m6A RNA methylation in cancer.\u003c/em\u003e Biomed Pharmacother, 2019. \u003cstrong\u003e112\u003c/strong\u003e: p. 108613.\u003c/li\u003e\n\u003cli\u003eDominissini, D., et al., \u003cem\u003eTopology of the human and mouse m6A RNA methylomes revealed by m6A-seq.\u003c/em\u003e Nature, 2012. \u003cstrong\u003e485\u003c/strong\u003e(7397): p. 201-6.\u003c/li\u003e\n\u003cli\u003eJiang, X., et al., \u003cem\u003eThe role of m6A modification in the biological functions and diseases.\u003c/em\u003e Signal Transduct Target Ther, 2021. \u003cstrong\u003e6\u003c/strong\u003e(1): p. 74.\u003c/li\u003e\n\u003cli\u003eLee, Y., et al., \u003cem\u003eMolecular Mechanisms Driving mRNA Degradation by m(6)A Modification.\u003c/em\u003e Trends Genet, 2020. \u003cstrong\u003e36\u003c/strong\u003e(3): p. 177-188.\u003c/li\u003e\n\u003cli\u003eTao, N., et al., \u003cem\u003eInteraction between m6A methylation and noncoding RNA in glioma.\u003c/em\u003e Cell Death Discov, 2022. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 283.\u003c/li\u003e\n\u003cli\u003ePan, T., et al., \u003cem\u003eThe role m(6)A RNA methylation is CNS development and glioma pathogenesis.\u003c/em\u003e Mol Brain, 2021. \u003cstrong\u003e14\u003c/strong\u003e(1): p. 119.\u003c/li\u003e\n\u003cli\u003eZhang, Y., et al., \u003cem\u003em6A modification in RNA: biogenesis, functions and roles in gliomas.\u003c/em\u003e J Exp Clin Cancer Res, 2020. \u003cstrong\u003e39\u003c/strong\u003e(1): p. 192.\u003c/li\u003e\n\u003cli\u003eTang, Y.A., et al., \u003cem\u003eHypoxic tumor microenvironment activates GLI2 via HIF-1\u0026alpha; and TGF-\u0026beta;2 to promote chemoresistance in colorectal cancer.\u003c/em\u003e Proc Natl Acad Sci U S A, 2018. \u003cstrong\u003e115\u003c/strong\u003e(26): p. E5990-e5999.\u003c/li\u003e\n\u003cli\u003eKorbecki, J., et al., \u003cem\u003eThe Effect of Hypoxia on the Expression of CXC Chemokines and CXC Chemokine Receptors-A Review of Literature.\u003c/em\u003e Int J Mol Sci, 2021. \u003cstrong\u003e22\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eRashid, M., et al., \u003cem\u003eUp-down regulation of HIF-1\u0026alpha; in cancer progression.\u003c/em\u003e Gene, 2021. \u003cstrong\u003e798\u003c/strong\u003e: p. 145796.\u003c/li\u003e\n\u003cli\u003eXu, D., W. Dai, and C. Li, \u003cem\u003ePolo-like kinase 3, hypoxic responses, and tumorigenesis.\u003c/em\u003e Cell Cycle, 2017. \u003cstrong\u003e16\u003c/strong\u003e(21): p. 2032-2036.\u003c/li\u003e\n\u003cli\u003eDas, L. and M. Vinayak, \u003cem\u003eCurcumin Modulates Glycolytic Metabolism and Inflammatory Cytokines via Nrf 2 in Dalton\u0026apos;s Lymphoma Ascites Cells In Vivo.\u003c/em\u003e Anticancer Agents Med Chem, 2018. \u003cstrong\u003e18\u003c/strong\u003e(12): p. 1779-1791.\u003c/li\u003e\n\u003cli\u003eDing, X.C., et al., \u003cem\u003eThe relationship between expression of PD-L1 and HIF-1\u0026alpha; in glioma cells under hypoxia.\u003c/em\u003e J Hematol Oncol, 2021. \u003cstrong\u003e14\u003c/strong\u003e(1): p. 92.\u003c/li\u003e\n\u003cli\u003eDom\u0026egrave;nech, M., et al., \u003cem\u003eHypoxia: The Cornerstone of Glioblastoma.\u003c/em\u003e Int J Mol Sci, 2021. \u003cstrong\u003e22\u003c/strong\u003e(22).\u003c/li\u003e\n\u003cli\u003eLi, J., et al., \u003cem\u003eHypoxic Glioma Stem Cell-Derived Exosomes Containing Linc01060 Promote Progression of Glioma by Regulating the MZF1/c-Myc/HIF1\u0026alpha; Axis.\u003c/em\u003e Cancer Res, 2021. \u003cstrong\u003e81\u003c/strong\u003e(1): p. 114-128.\u003c/li\u003e\n\u003cli\u003eMiska, J., et al., \u003cem\u003eHIF-1\u0026alpha; Is a Metabolic Switch between Glycolytic-Driven Migration and Oxidative Phosphorylation-Driven Immunosuppression of Tregs in Glioblastoma.\u003c/em\u003e Cell Rep, 2019. \u003cstrong\u003e27\u003c/strong\u003e(1): p. 226-237.e4.\u003c/li\u003e\n\u003cli\u003eLiu, N., et al., \u003cem\u003eLactate inhibits ATP6V0d2 expression in tumor-associated macrophages to promote HIF-2\u0026alpha;-mediated tumor progression.\u003c/em\u003e J Clin Invest, 2019. \u003cstrong\u003e129\u003c/strong\u003e(2): p. 631-646.\u003c/li\u003e\n\u003cli\u003eBao, L., et al., \u003cem\u003eMethylation of hypoxia-inducible factor (HIF)-1\u0026alpha; by G9a/GLP inhibits HIF-1 transcriptional activity and cell migration.\u003c/em\u003e Nucleic Acids Res, 2018. \u003cstrong\u003e46\u003c/strong\u003e(13): p. 6576-6591.\u003c/li\u003e\n\u003cli\u003eZhang, K., et al., \u003cem\u003eUBQLN2-HSP70 axis reduces poly-Gly-Ala aggregates and alleviates behavioral defects in the C9ORF72 animal model.\u003c/em\u003e Neuron, 2021. \u003cstrong\u003e109\u003c/strong\u003e(12): p. 1949-1962.e6.\u003c/li\u003e\n\u003cli\u003eLi, Z., et al., \u003cem\u003eFTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase.\u003c/em\u003e Cancer Cell, 2017. \u003cstrong\u003e31\u003c/strong\u003e(1): p. 127-141.\u003c/li\u003e\n\u003cli\u003eWu, D. and C. Wang, \u003cem\u003emiR-155 Regulates the Proliferation of Glioma Cells Through PI3K/AKT Signaling.\u003c/em\u003e Front Neurol, 2020. \u003cstrong\u003e11\u003c/strong\u003e: p. 297.\u003c/li\u003e\n\u003cli\u003eGusyatiner, O. and M.E. Hegi, \u003cem\u003eGlioma epigenetics: From subclassification to novel treatment options.\u003c/em\u003e Semin Cancer Biol, 2018. \u003cstrong\u003e51\u003c/strong\u003e: p. 50-58.\u003c/li\u003e\n\u003cli\u003eChen, F., et al., \u003cem\u003eThe Potential Value of m6A RNA Methylation in the Development of Cancers Focus on Malignant Glioma.\u003c/em\u003e Front Immunol, 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 917153.\u003c/li\u003e\n\u003cli\u003eGulluoglu, S., et al., \u003cem\u003eSimultaneous miRNA and mRNA transcriptome profiling of glioblastoma samples reveals a novel set of OncomiR candidates and their target genes.\u003c/em\u003e Brain Res, 2018. \u003cstrong\u003e1700\u003c/strong\u003e: p. 199-210.\u003c/li\u003e\n\u003cli\u003eLi, J., et al., \u003cem\u003eELTD1 facilitates glioma proliferation, migration and invasion by activating JAK/STAT3/HIF-1\u0026alpha; signaling axis.\u003c/em\u003e Sci Rep, 2019. \u003cstrong\u003e9\u003c/strong\u003e(1): p. 13904.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"glioma, m6A, methylation, HIF 1 α, METTL3","lastPublishedDoi":"10.21203/rs.3.rs-3231271/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3231271/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eGlioma was a malignant tumor of the central nervous system. m6A methylation and HIF-1α were related to the occurrence and development of gliomas. However, the co-mechanism of m6A methylation and HIF-1α in glioma is unclear.\u003c/p\u003e\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis aim was to determine the m6A methylation of HIF-1α in glioma.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eElisa and dot blot were used to detect m6A level. The changes of related genes, biological pathways and gene ontology were analyzed by bioinformatics. METTL3 and HIF-1α were knockdown by sh-RNA, and the mRNA and protein level were detected by qPCR and western blot. In addition, the m6A RNA methylation sites were predicted and verified by m6A-RIP-MMP-6 analysis༎\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWe found that compared with paracancerous, the mRNA and protein levels of m6A were dramatically increased in glioma. The biological different were found in glioma and paracancerous. Moreover, glioma had highly mRNA and protein level of HIF-1α. METTL3 and HIF- 1α knockdown can significantly decrease the growth of glioma cells. Furthermore, we confirmed the m6A RNA methylation site in HIF-1α. Finally, we found that METTL3 regulated the m6A level and RNA stability of HIF-1α.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur finding demonstrated that the co-mechanism of m6A methylation of HIF-1α and METTL3 in glioma, and may be helpful in the treatment of glioma.\u003c/p\u003e","manuscriptTitle":"METTL3 mediated m6A methylation of HIF-1 α promoted progression in glioma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-08-10 14:07:51","doi":"10.21203/rs.3.rs-3231271/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b0c62e2e-8f90-4969-9dc2-172734846848","owner":[],"postedDate":"August 10th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-12T13:44:41+00:00","versionOfRecord":[],"versionCreatedAt":"2023-08-10 14:07:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3231271","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3231271","identity":"rs-3231271","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00