Tumor-associated astrocytes inhibit tumor cell apoptosis through TNF- α-TNF receptor 2-NF-κB pathway in lung cancer brain metastasis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tumor-associated astrocytes inhibit tumor cell apoptosis through TNF- α-TNF receptor 2-NF-κB pathway in lung cancer brain metastasis Shuo Zhang, Jinjin Cai, Yingying Feng, Man Yang, Yuhang Li, Yanghui Qu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7234065/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lung cancer is the most common cause of death among all human cancers with up to 50% of the cancers eventually developing into brain metastasis. The treatment methods of brain metastasis are very limited and the prognosis is poor. Studies have shown that the invasion of tumor cells into brain is related to the local activation of astrocytes, and these tumor-associated astrocytes (TAAs) exert either promoting or resisting effects during this process. However, whether astrocytes play a role after tumor cell colonization remains obscure. In the current study, by using of the lung cancer brain metastasis murine model and in vitro. co-culture system, we found the existence of astrocytes in the tumor microenvironment of both clinical patient and murine model with lung cancer brain metastasis. And in the in vitro. co-culture system, astrocytes promoted the survival but not the proliferation of tumor cells through inhibiting their apoptosis. The mechanistic study showed that astrocytes inhibit the apoptosis of tumor cells by secreting TNF-α, and the NF-κB signaling pathway in tumor cells was activated. Knocking down TNF receptor 2 ( TNFR2 ) gene on tumor cells, as well as the inhibitor of NF-κB pathway counteracted the effect of astrocytes. Further, knockdown of TNFR2 increased the intracranial apoptosis of tumor cells and prolonged the survival of mice in lung cancer brain metastasis model. In conclusion, our research indicates that TAAs in lung cancer brain metastasis inhibit the apoptosis of tumor cells by secreting TNF-α dependent on TNFR2-NF-κB signaling pathway. Astrocyte Lung cancer brain metastasis Apoptosis TNF-α NF-κB signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Cancer brain metastasis refers to the formation of secondary tumors in the brain, which is a common manifestation of cancer and has a very poor clinical prognosis [1, 2]. More than 100,000 new brain metastasis cases are diagnosed annually [3]. Nearly 30% of patients with solid tumors will develop brain metastasis. Lung cancer, breast cancer and skin cancer (melanoma) are the most common types to cause brain metastasis, accounting for 67–80% of cases, among which lung cancer brain metastasis has the largest proportion [4]. Lung cancer is the most common cause of cancer-related mortality in humans [5], and the main reason is the metastasis of lung cancer [6]. The probability of lung cancer developing into brain metastasis is approximately 50% [7, 8]. The treatment methods of lung cancer brain metastasis are very limited, so it remains a severe clinical challenge. The tumor microenvironment plays a crucial role in the occurrence, development, and metastasis of tumors. However, it needs to overcome multiple obstacles for a tumor to metastasize to the brain, such as the blood-brain barrier and the complex natural components that form the tumor microenvironment in the brain [1, 8, 9], and the brain also initiates immune defense to resist the metastasis and colonization of tumor cells [10]. Whereas, along with cancer cells invading and spread, tumors interact with microenvironment cells in complex ways, altering the brain tissue microenvironment and transforming it into a tumor microenvironment that supports tumor growth [11]. The brain is composed of specific cells distinct from other parts of the body, such as astrocytes, oligodendrocytes, microglia, and neurons. The interaction between cancer cells and these specific brain cells is an important factor influencing brain metastasis [9, 12]. Among the specific brain cells, astrocytes are one of the first host cell types that tumor cells interact with. Astrocytes are the most widely distributed type of glial cells in the brain, accounting for 30% of the cells in the central nervous system. Astrocytes express specific markers such as S100β, glial fibrillary acidic protein (GFAP), and so on, among which GFAP is considered a marker of reactive astrocytes [13–15]. Astrocytes play important roles in regulating cerebral blood flow, modulating the response of the central nervous system to inflammation, maintaining the blood-brain barrier, and mediating immune signal transduction [16, 17]. Our previous research found that in primary cerebellar medulloblastoma, astrocytes constitute an important component of the tumor microenvironment. These cells are referred to as tumor-associated astrocytes (TAAs) and play a role in promoting tumor development [18, 19]. Meanwhile some publications showed that in animal models and human patients with metastatic brain tumors, activated astrocytes were observed to cluster around tumor cells [20, 21]; and in studies on breast and lung cancer brain metastasis, local activation of astrocytes was found to be related to the process of tumor invasion into brain parenchyma [22–24], also suggesting that astrocytes are components of the tumor microenvironment in brain metastasis. Remarkably, astrocytes play opposite roles in the process of tumor cell brain metastasis: some studies have shown that astrocytes resist tumor cells from entering brain parenchyma and limit brain metastasis [25], and they could secrete Fas ligand to kill infiltrating tumor cells [26]; while other studies have indicated that astrocytes promote tumor occurrence and development in the brain [27, 28], such as promoting the colonization of breast cancer and melanoma in the brain [29–34]. However, the role that astrocytes play in brain metastasis after tumor cell colonization remains unclear. Therefore, our current study focuses on elucidating the role of astrocytes on tumor development in brain metastasis after colonization by using a colonized lung brain metastasis animal model. Tumor necrosis factor-α (TNF-α) can be produced by tumors and the tumor microenvironment, exerting multifunctional effects on tumor occurrence and progression [35]. TNF-α is a multifunctional cytokine that participates in regulating various functions including regulating cell growth, inflammatory responses, and tumor development [36]. These functions depend on the binding of TNF-α to two different membrane receptors on target cells, namely TNFR1 (TNF receptor1, also known as p55, TNFRSF1A) and TNFR2 (also known as p75, TNFRSF1B). TNF-α induces cell death signals through TNFR1 [37]. The TNFR1 transduces pro-apoptotic signals via its death domain [38] which includes TNFR-related death domain proteins (TRADD), Fas-related death domain proteins (FADD) and TNFR-related factor 1 (TRAF1) [39, 40]. Different from TNFR1, TNFR2 does not have a death domain [41]. It contains a TRAF2-binding site, which recruits TRAF2 and sequentially assembles a complex comprising TRAF1, TRAF2, cIAP1, and cIAP2 [42, 43]. The complex subsequently activates downstream signaling molecules and triggers NF-κB to be released from its cytoplasmic inhibitor IκBα, translocate to the nucleus, and function as a transcription factor to upregulate target genes and promote cell survival [44]. In our previous study, it was found that astrocytes in the tumor microenvironment of primary cerebellar tumor can promote tumor cell proliferation by secreting TNF-α [19]. In the current study, we extend these findings to brain metastasis, exploring the influence of astrocyte-derived TNF-α on brain metastasis progression. 2. Materials and Methods 2.1. Animal and lung cancer brain metastasis model C57BL/6 wildtype mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd, and were maintained in the SPF animal facility of Soochow University. All animal experiments were approved by and conducted in accordance with the Ethical and Welfare Committee of Soochow University. Murine cell line Lewis lung carcinoma (LLC) was used in our study. To conduct the animal model mimicking the lung cancer brain metastasis after tumor cells colonization, stereotactic injection was performed as reported [45]. Briefly, 2 ⅹ 10 5 LLC cells /5 µL PBS/ mouse were injected into brain parenchyma of 4–6 weeks old mice. Brain tumor tissues were collected on day 7, 11 or as indicated. 2.2. Cell preparation LLC cells were provided by Dr. Yue Chinn and cultured with Dulbecco’s modified Eagle’s medium (DMEM, HyClone) containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin. For astrocyte preparation, the brain of wildtype mice at postnatal day 2 were dissected and digested in papain buffer consisting of 10 U/mL papain (Worthington), 250 U/mL DNase (Sigma) and 200 µg/mL l-cysteine (Sigma) for 30 minutes at 37°C to acquire a single-cell suspension, as described previously [19], and cells were cultured in DMEM/F12 medium (HyClone) containing 10% FBS and 1% penicillin/streptomycin. When the cells grew to 80% confluence, they were digested with 0.25% trypsin-EDTA (Beyotime) for passage. Cells were usually passed to two to three generations before experiments. For non-reactive astrocyte culture, the cells were maintained in serum-free medium. To isolate tumor-associated astrocytes (TAAs), a single-cell suspension of lung cancer brain metastasis tumor tissue was obtained as above. The cells were stained with APC-conjugated anti-ACSA-2 (astrocyte cell surface antigen-2) antibody (1:20, Miltenyi), and then TAAs were sorted and collected by flow cytometry (Aria II, BD Bioscience) according to APC positive staining. Similarly, primary astrocytes (pAS) were isolated from the normal brains of neonatal mice. 2.3. Immunohistochemistry and immunofluorescent staining Human lung cancer brain metastasis paraffin sections were provided by Dr. Minghua Wu at Xiangya Hospital. The use of the sections was reviewed and approved by the Ethics Committee of Soochow University. The paraffin sections were sent to Wuhan Servicebio Technology for immunohistochemistry staining of GFAP and Hematoxylin-eosin (H&E). For immunofluorescent staining, brain tissues of murine lung cancer brain metastasis model were harvested, frozen in Tissue Tek-OCT (Thermo Fisher Scientific), and then sectioned at 10–12 µm thickness. Sections were blocked with PBS containing 0.2% Triton X-100 (Biosharp) and 1% bovine serum albumin (BSA, Fisher bioreagents) for 1 hour at room temperature. Then, the sections were incubated with primary antibody overnight at 4°C. The next day, sections were exposed to secondary antibody conjugated with the appropriate fluorescein for 2 hours at room temperature. DAPI (Beyotime) staining was performed for 10 minutes. Immunofluorescent staining for cells followed the same protocol. Before staining, cells were fixed in 4% PFA for 15 minutes and permeabilized with PBS containing 0.2% Triton X-100 for 10 minutes at room temperature. Finally, slides were mounted with Fluoromount-G (Southern Biotechnology) and visualized by a Nikon microscope. All antibodies were diluted in PBS containing 0.2% Triton X-100 and 1% BSA. The antibodies and dilution ratios were as follows: anti-S100β (1:300, Sigma), anti-cleaved caspase-3 (1:200, Cell Signaling Technology), and anti-GFAP (1:200, BD Bioscience,), goat anti-rabbit-Alexa Fluor 594 (1:200, Proteintech), goat anti-mouse-Alexa Fluor 488 (1:200, Proteintech), goat anti-rabbit-Alexa Fluor 488 (1:200, Proteintech), and goat anti-mouse-Alexa Fluor 594 (1:200, Proteintech). 2.4. Co-culture of astrocytes and LLC cells Astrocytes were collected and mixed with LLC cells at a ratio of 1:10 and co-cultured in LLC medium (DMEM) for cell viability experiment. In some experiments, LLC cells were treated with astrocyte-conditioned medium for 24 hours or indicated time. To collect astrocyte-conditioned medium, astrocytes were cultured in DMEM/F12 for 24 hours and the supernatant was removed before fresh DMEM medium was added. The astrocytes were cultured for another 24 hours with DMEM to collect the supernatant, and the supernatant was centrifuged to remove any cells and cell debris to obtain the astrocyte-conditioned medium. The control medium was the supernatant collected from pure DMEM for 24 hours kept in CO 2 incubator. In certain experiments, when LLC cells were treated with astrocyte-conditioned medium, anti-TNF-α antibody or control rat IgG (2 µg/mL, Cell Signaling Technology), or the NF-ᴋB signaling pathway inhibitor, JSH-23 (20 µM and 50 µM, Seleck) was added for treatment. In other experiments, LLC cells were treated with recombinant mouse TNF-α (Novoprotein) at 0.1 ng/mL or 10 ng/mL. 2.5. Cell counting kit-8 (CCK-8) assay CCK-8 assay was performed to detect cell viability. LLC cells were cultured in serum-free medium for 9–12 hours in advance and then inoculated into 96-well plates at 2 ⅹ10 3 / well density and cultured with indicated treatment. The cells were incubated with 10 µL of CCK-8 reagent for 1 hour to detect optical density (OD) at 450 nm wave length (λ = 450 nm). 2.6. 5-ethynyl-29-deoxyuridine (EdU) incorporation and detection LLC cells were plated on coverslips with indicated treatments, and the cells were pulsed with EdU (10 µM, Beyotime) for 2 hours before cells were fixed in 4% PFA, then followed by the immunofluorescent staining procedure for EdU labelled cells detection. 2.7. Cell apoptosis assessment Cell samples were prepared by using Annexin V-APC/PI apoptosis kit (MultiSciences) according to the manufacturer's instruction, and detected by flow cytometry (Aria II, BD Bioscience). 2.8. Enzyme-linked immunosorbent assay (ELISA) Non-reactive, reactive and tumor-associated astrocytes were cultured in vitro for 24 hours, and the supernatant was harvested, then mouse TNF-α ELISA kit (MultiSciences) was used to evaluated the TNF-α protein levels in the supernatant according to the manufacturer's instruction. 2.9. Knockdown of TNFR2 in LLC cells shRNAs were used to knock down the expression of TNFR2 in LLC cells. The sequences for shRNAs are below: sh TNFR2 #1, CCGGCCAAGGACACTCTACGTATCTCGAGATACGTAGAGTGTCCTTGGTTTTTGAATT; sh TNFR2 #2, CCGGGAACCAGTTTCGTACATGTCTCGAGACATGTACGAAACTGGTTCTTTTTGAATT; sh TNFR2 #3, CCGGGGGACGTTCTCTGACACCACATCATCTCGAGATGATGTGGTGTCAGAGAACGTCCCTTTTTGAATT. 2.10. Western blotting Cell lysate was prepared in RIPA buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitor cocktail (Roche), and the total protein concentration was evaluated using a BCA Protein Assay Kit (Beyotime). Then, equal amounts of protein samples were loaded and separated by 10% SDS-PAGE (Beyotime) and transferred onto PVDF membranes (Millipore). The membranes were blocked with TBS containing 0.05% Tween-20 and 5% defatted milk powder and incubated overnight at 4°C with primary antibodies: anti-GAPDH (1:5000, Proteintech), anti-total NF-ᴋB p65 (1:1000, Cell Signaling Technology), and anti-phosphorylated NF-ᴋB p65 (1:1000, Cell Signaling Technology). The following day, the membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibodies, anti-mouse IgG (1:5000, CST) and anti-rabbit IgG (1:5000, CST), at room temperature for 2 hours. Bands were visualized using high-signal ECL substrate (Beyotime) and exposed on a ChemiScope 3300 mini (Clinx). 2.11. Real-time quantitative PCR (qPCR) Total RNA was extracted from cell lysate using TRIzol reagent (Sigma) in RNase-free conditions. cDNA was synthesized using oligo (dT) and Superscript II reverse transcriptase (Vazyme). qPCR was performed in triplicate using SYBR qPCR Master Mix (Vazyme) and the ABI 7500 TaqMan Real-Time PCR Detection System. The differences in mRNA expression were calculated by the 2 -ΔΔCt method. The primers (all for mouse species) used in the experiments included GAPDH (forward: 5-CATCACTGCCACCCAGAAGACTG-3; reverse: 5-ATGCCAGTGAGCTTCCCGTTCAG-3); CCND1 (forward: 5-GCGTACCCTGACACCAATCTC-3; reverse: 5-CTCCTCTTCGCACTTCTGCTC-3); CDK1 (forward: 5-AGAAGGTACTTACGGTGTGGT-3; reverse: 5- GAGAGATTTCCCGAATTGCAGT-3); CCNB1 (forward: 5-AAGGTGCCTGTGTGTGAACC-3; reverse: 5-GTCAGCCCCATCATCTGCG-3); IL-1β (forward: 5- GGTCAAAGGTTTGGAAGCAG-3); reverse: 5-TGTGAAATGCCACCTTTTGA-3); IL-6 (forward: 5-CTCTGCAAGAGACTTCCATCCAGT-3; reverse: 5-GAAGTAGGGAAGGCCGTGG-3); TNF-α (forward: 5-AGGGTCTGGGCCATAGAACT-3; reverse: 5-CCACCACGCTCTTCTGTCTAC-3); and TNFR2 (forward: 5-CTGCGCCTTGAAAACCCATT-3; reverse: 5-GATGCTACAGATGCGGTGGG-3). 2.12. Statistical analysis Experimental data were analyzed using GraphPad Prism software. The Shapiro-Wilk test was used to test for data distribution normality. For experiments containing two groups, unpaired Student’s t test was used to calculate the difference when data exhibit Gaussian distribution. Data that do not exhibit Gaussian distribution was analyzed via a non-parametric Student’s t test. For experiments containing three or more groups, one way ANOVA was used to determine the levels of difference and Bonferroni was used to perform the posttest of all pairs of data. Differences were considered to be significant when the value was less than 0.05 ( p < 0.05). Values are expressed as mean ± SEM from at least three independent experiments. 3. Results 3.1. Tumor-associated astrocytes (TAAs) exist in the tumor microenvironment of lung cancer brain metastasis To investigate astrocytes’ role in lung cancer brain metastasis after metastatic colonization, we first detected the presence of TAAs in the tumor microenvironment. Immunohistochemical staining of tumor sections from patients with lung cancer brain metastasis was performed. The results showed that TAAs were present in the tumor microenvironment of lung cancer brain metastasis in the patients (Fig. 1 A). To investigate whether TAAs also exist in the tumor microenvironment of lung cancer brain metastasis animal model, we injected mouse lung adenocarcinoma cells, LLC cells, into the brain parenchyma to establish a colonized lung cancer brain metastasis model in mice as previously reported [45] (Fig. 1 B). Immunofluorescence staining of astrocyte markers, GFAP and S100β, on the tumor tissues frozen sections was performed. The results showed that astrocytes were present in the tumor microenvironment at both the earlier stage (seven days post-injection) and the later stage (eleven days post-injection) of tumor induction (Fig. 1 C). 3.2. Astrocytes promote the survival but not the proliferation of LLC cells in vitro. To explore the role of astrocytes in the tumor microenvironment of colonized brain metastatic tumor, we first used an in vitro . co-culture system to examine their impact on the viability of LLC cells. Astrocytes and LLC cells were co-cultured at a ratio of 1:10, with LLC cells cultured alone as the control group. The viability of LLC cells was detected by the CCK-8 method. The results showed that the viability of LLC cells co-cultured with astrocytes was significantly higher than that of the control (Fig. 2 A). To investigate whether direct contact with tumor cells is essential for astrocytes to exert their effects, we treated LLC cells with astrocyte-conditioned medium (AS-CM) and detected the cell viability. The results indicated that AS-CM significantly promoted the viability of LLC cells compared with control (Fig. 2 B), suggesting that astrocytes exert their effects through a contact-independent, paracrine signaling. To further investigate whether astrocytes promote the viability of lung cancer cells by directly affecting their proliferation, EdU incorporation assay was performed to detect the proliferation of LLC cells with AS-CM treatment. The results showed that AS-CM did not directly promote the proliferation of LLC cells compared with the control group (Fig. 2 C-D). Furthermore, we also used qPCR to detect the expression levels of genes related to cell cycle, such as CDK1 , CCNB1 , and CCND1 . The results indicated that AS-CM did not alter the expression of these cell cycle-related genes in LLC cells (Fig. 2 E). In conclusion, astrocytes can promote the survival of LLC cells, but not their proliferation. 3.3. Astrocytes inhibit the apoptosis of LLC cells Since astrocytes promoted the viability but not the proliferation of LLC cells, we hypothesized that astrocytes might promote the survival of lung cancer cells by affecting their apoptosis. To verify our hypothesis, we detect the effect of AS-CM on the apoptosis of lung cancer cells in vitro. As shown in Fig. 3 A-B, the apoptotic cells were labeled with the apoptosis marker cleaved caspase 3 (CC3) and the number of positive cells was counted. The results showed that AS-CM significantly decreased the proportion of CC3-positive cells. Additionally, flow cytometry analysis indicated that the proportion of apoptotic LLC cells treated with AS-CM was significantly lower than that of the control group (Fig. 3 C-D). Next, we tried to explore whether astrocytes have the same effect on tumor cells in vivo. We investigated the distribution of astrocytes and the occurrence of apoptosis in tumor cells using immunofluorescence staining of tumor tissue sections. The staining results showed that the apoptosis of tumor cells was negatively correlated with the distribution density of astrocytes in the tumor microenvironment, that is, there were much less apoptotic tumor cells in the astrocyte-rich area than that of the astrocyte-rare area (Fig. 3 E-F). The results above indicated that astrocytes inhibit the apoptosis of LLC cells. 3.4. Astrocytes inhibit LLC cell apoptosis through secreting TNF-ɑ The experiments above indicated that astrocytes inhibit the apoptosis of LLC cells through their secreted molecules. We then explored through which secreted molecules the role of astrocytes was exerted. As we know that astrocytes gain their reactive status in certain physiological and pathological conditions with increased proinflammatory factors secretion such as IL-1β, IL-6 and TNF-ɑ, therefore, we attempted to find out whether TAAs in the tumor microenvironment of brain metastasis also became reactive and contributed to tumor cell survival through these factors. We first isolated primary astrocytes (pAS) from normal mouse brain tissue and TAAs from mouse lung cancer brain metastasis tumors, respectively, using flow cytometry, then detected the gene expression levels of IL-1β , IL-6 and TNF-ɑ using qPCR. It showed that only TNF-ɑ was significantly upregulated in TAAs compared with primary astrocyte (supplementary Fig. 1 and Fig. 4 A). Also, we tried to compare the protein levels of TNF-α secreted by astrocytes with different status. We prepared the non-reactive astrocytes cultured with serum free medium, reactive astrocytes cultured with regular medium and TAAs. The protein levels of TNF-α in the culture supernatant was evaluated by ELISA, with a serum-free medium as the control group. The results showed that reactive astrocytes secreted more TNF-α than non-reactive astrocytes, and TAAs produced much higher TNF-α than other two groups (Fig. 4 B). It is consistent with our previous research showing that TAAs in the primary brain tumor, medulloblastoma, can promote tumor development by producing TNF-α. Regarding the role of TNF-α in tumors, studies have shown that it has a dual effect on tumor cells. On one hand, TNF-α can kill certain tumor cells or inhibit their proliferation in vivo. and in vitro. ; on the other hand, TNF-α has a growth factor-like effect on certain tumor cells, promoting their proliferation and survival [26, 43, 44]. To investigate whether astrocytes can also affect the survival and apoptosis of tumor cells by secreting TNF-α, we first verified the effect of TNF-α on the apoptosis of LLC cells. We treated LLC cells with different concentrations of recombinant mouse TNF-α in vitro. and detected the apoptosis of LLC cells. The results showed that compared with the control group, the proportion of apoptotic LLC cells treated with recombinant TNF-α decreased significantly (Fig. 4 C-D). To confirm whether astrocytes exert their effect on the apoptosis of LLC cells by secreting TNF-α, LLC cells were treated with AS-CM in the presence or absence of TNF-α neutralizing antibody followed by the apoptosis examination. As shown in Fig. 4 E-F, the inhibitory effect of AS-CM on tumor cell apoptosis was counteracted by the TNF-α neutralizing antibody. Taken together, the results indicate that astrocytes inhibit the apoptosis of LLC cells by secreting TNF-α. 3.5. Astrocytes inhibit the apoptosis of LLC cells through the downstream signaling pathway of TNFR2 TNF-α functions by binding to TNFR1 and TNFR2. Studies have shown that TNFR1 mainly activates apoptotic signaling pathways [37], while TNFR2 mainly activates cell survival signaling pathways [34, 35]. We therefore hypothesize that the regulation of LLC cell apoptosis by astrocyte derived TNF-α is mediated by the downstream signaling pathway of TNFR2. Firstly, we detected the expression levels of TNFR2 in primary and metastatic LLC cells. The results showed that the expression level of TNFR2 in metastatic tumor cells was higher than that in primary tumor cells (Fig. 5 A). Next, we knocked down TNFR2 in LLC cells using shRNA, and verified the knockdown efficiency of sh TNFR2 #2 and sh TNFR2 #3 as above 60% compared to the scrambled control (Fig. 5 B). Then, to verify our hypothesis, these LLC cells were treated with AS-CM. The results showed that compared with scrambled control, knocking down TNFR2 increased the apoptosis of LLC cells, and the inhibitory effect of AS-CM on LLC cell apoptosis was dampened (Fig. 5 C-D). To further verify that the astrocyte derived TNF-α regulates LLC cell survival through the TNFR2 downstream signaling pathway, TNFR 2 knocked down and control LLC cells were treated with AS-CM, cell viability was evaluated by CCK-8 assay. The results showed that compared with the control group, knocking down TNFR2 counteracted the promoting effect of AS-CM on LLC cell viability (Fig. 5 E-F). Moreover, to verify the contribution of TNFR2 signaling pathway to the development of lung cancer brain metastasis tumor development in vivo. , TNFR2 knocked down and control LLC cells were injected intracranially into mouse brain to establish colonized metastatic tumor model, then the survival rate of tumor-bearing mice and the apoptosis of tumor cells in vivo. was detected. The results showed that knocking down TNFR2 prolonged the survival of tumor-bearing mice and increased the apoptosis of tumor cells in the brain (Fig. 5 G-I). Based on the above results, we conclude that astrocytes secreted TNF-α inhibit LLC cell apoptosis through TNFR2 downstream signaling pathway. 3.6. Astrocytes inhibit LLC cell apoptosis through TNF-α-TNFR2-NF-κB signaling pathway We further explored the mechanism by which astrocytes inhibit LLC cell apoptosis following TNF-α-TNFR2 interaction. Some studies have shown that TNFR2 promotes cell survival by activating the NF-κB signaling pathway [37]. Therefore, to investigate whether astrocyte regulate LLC cell apoptosis through the NF-κB signaling pathway, we detected the activation of the NF-κB signaling pathway in LLC cells treated with AS-CM using Western blotting. The results showed that the phosphorylation level of NF-κB p65 in LLC cells treated with AS-CM was significantly increased, indicating the activation of this signaling pathway (Fig. 6 A-B). Additionally, to confirm whether astrocytes activate the NF-κB signaling pathway in LLC cells by producing TNF-α, we treated LLC cells with AS-CM in the presence of TNF-α neutralizing antibody or control IgG and detected the activation of the NF-κB signaling pathway. As shown in Fig. 6 C-D, the activation of the NF-κB signaling pathway in LLC cells caused by AS-CM could be blocked by TNF-α neutralizing antibody. To further verify whether astrocytes activate the NF-κB signaling pathway through TNFR2, the activation of the NF-κB signaling pathway in TNFR2 knocking down LLC cells was detected. The results showed that the activation of the NF-κB signaling pathway in LLC cells caused by AS-CM was significantly inhibited after TNFR2 knockdown (Fig. 6 E-F). Finally, to verify whether astrocytes affect the apoptosis of LLC cells through the NF-κB signaling pathway, we treated LLC cells with AS-CM in the presence or absence of NF-κB inhibitor JSH-23 and detected the apoptosis of LLC cells using flow cytometry. We found that the JSH-23 treatment blocked the inhibitory effect of AS-CM on LLC cell apoptosis (Fig. 6 G-H). In conclusion, astrocytes inhibit LLC cell apoptosis through TNF-α-TNFR2-NF-κB signaling pathway. Discussion The regulation of tumor metastasis by the tumor microenvironment has been demonstrated. For instance, studies have found that inflammatory immune cells in the tumor microenvironment can induce cancer cells to undergo EMT and acquire a migratory phenotype by producing cytokines [46, 47]; cells in the microenvironment can produce proteases to break down the basement membrane to support vascular co-option [48]; and cytokines secreted by innate immune cells can induce the expression of vascular endothelial cell adhesion molecules (CAM), promoting the occurrence and development of tumor in the microenvironment [49-51]; chemokines produced by endothelial cells and macrophages can mediate the migration of tumor cells through the chemokine receptor CXCR4 [52]. The complexity of the brain's composition makes the regulatory mechanism of brain metastasis even more enigmatic. As the most widely distributed type of glial cells in the brain, astrocytes have received some attention for their role in brain metastasis. Publications show that astrocytes produce IL-6 and TGF-β to promote the growth of breast cancer cells [29]; astrocytes can also secrete brain-derived neurotrophic factor (BDNF) to stimulate the proliferation of tumor cells [53]; during the brain colonization of melanoma, astrocytes can stimulate and produce more heparanase, thereby promoting melanoma colonization [31, 54]; Qing Chen et al.'s research shows that lung cancer cells establish gap junctions with astrocytes through protocadherin 7, allowing the second messenger cGAMP to transfer from tumor cells to astrocytes, thereby activating the STING pathway and promoting astrocytes to secrete inflammatory cytokines, supporting tumor growth [55]. On the contrary, some other studies indicate that astrocytes have opposite roles in brain metastasis: reactive astrocytes produce Serpins to resist tumor cells from entering the brain, while brain metastatic cancer cells can counter this defense, allowing tumor cells to pass through the blood-brain barrier and enter the brain [25]; astrocytes kill infiltrating tumor cells by secreting Fas ligand [26]; they can also cause tumor cell death by producing nitric oxide, thereby limiting the metastasis of adjacent tumor cells [30]. The above studies have clearly expounded the role of astrocytes in the process of tumor cells invading the brain, but there is a lack of in-depth research on whether astrocytes can constitute the tumor microenvironment of brain metastasis and regulate tumor development after metastatic tumor cells colonization. Therefore, our current study investigates the influence and mechanism of astrocytes on tumor development after brain metastasis is established. Firstly, we found that astrocytes were present in the tumor microenvironment of clinical patients and our post-colonization lung cancer brain metastasis animal model. Next, we utilized an in vitro. co-culture system and discovered that astrocytes and their conditioned medium could enhance the viability of lung cancer cells, but did not promote cell proliferation. This finding is inconsistent with previous reports that co-culture of astrocytes and lung cancer cells upregulated survival genes in cancer cells [56], which might be due to differences in experimental conditions. We therefore hypothesized that astrocytes might affect the viability of lung cancer cells by influencing their apoptosis. We confirmed this by immunofluorescence staining of the apoptosis marker cleaved caspase 3 and flow cytometry analysis, which showed that the conditioned medium of astrocytes could inhibit the apoptosis of lung cancer cells, suggesting that astrocytes regulate the apoptosis of lung cancer cells through their secreted factors. We then compared the gene expression levels of certain cytokines in TAAs and primary astrocytes and found that only TNF-α was significantly upregulated in TAAs. Studies have reported that TNF-α can inhibit the apoptosis of certain tumor cells, and our previous research also found that astrocytes could promote the development of medulloblastoma by secreting TNF-α [19]. Therefore, we raised the scientific question: Can astrocytes in the tumor microenvironment of lung cancer brain metastasis affect tumor cell apoptosis and tumor development by secreting TNF-α? To answer this question, we conducted a series of experiments, and the results indicated that astrocytes in the tumor microenvironment of lung cancer brain metastasis upregulated the expression of TNF-α, and exogenous recombinant TNF-α inhibited the apoptosis of lung cancer cells; the effect of astrocyte-conditioned medium on the apoptosis of lung cancer cells was blocked by TNF-α neutralizing antibody. These results suggest that astrocytes inhibit the apoptosis of lung cancer cells by secreting TNF-α. Definitely, we cannot rule out the possibility that TNF-α derives from other cells, such as microglia in the tumor microenvironment in vivo., Additionally, our study cannot either exclude the influence of other cells in the brain metastasis tumor microenvironment, as there are reports showing that other cells, such as neurons [57, 58], macrophages/microglia [59, 60], and T cells [61, 62], are also involved in the regulation of brain metastasis. Moreover, astrocytes may also indirectly affect brain metastasis by interacting with these cells. Next, we further explored the downstream mechanism by which astrocytes derived TNF-α regulates lung cancer cell apoptosis. TNF-α exert opposite effects by combining two different receptors: TNFR1 mainly acts to activate the apoptotic signaling pathway. While TNFR2 mainly activates the cell survival signaling pathway [35]. We knocked down TNFR2 in lung cancer cells and found that the inhibitory effect of astrocyte-conditioned medium on cancer cell apoptosis was weakened. Through in vivo. experiments, we proved that knocking down TNFR2 prolonged the survival of mice bearing lung cancer brain metastasis and increased the apoptosis of lung cancer cells in the brain. Some studies have shown that TNFR2 affects TNF-α-mediated cell apoptosis by activating the NF-κB signaling pathway [38]. Through experiments, we found that the treatment with astrocyte-conditioned medium increased the phosphorylation level of NF-κB p65 in lung cancer cells, and the TNF-α neutralizing antibody could block the activation of this signaling pathway. Similarly, after knocking down TNFR2 , the activation of the NF-κB signaling pathway was significantly inhibited. Additionally, the NF-κB signaling pathway inhibitor, JSH-23, can block the effect of the astrocyte-conditioned medium in inhibiting lung cancer cell apoptosis. Due to the inability of JSH-23 to cross the blood-brain barrier, we did not detect the effect of JSH-23 treatment on tumor progression in the lung cancer brain metastasis mouse model. In conclusion, our study has shown that the tumor microenvironment of lung cancer brain metastasis contains astrocytes, and astrocytes inhibit tumor cell apoptosis; the TNF-α produced by astrocytes regulates tumor cell apoptosis through the TNFR2-NF-κB signaling pathway. Our research provides a new clue from the perspective of the tumor microenvironment on the development of brain metastases, and is helpful for finding new targets to inhibit the occurrence and development of brain metastasis. Abbreviations APC, allophycocyanin; AS-CM, astrocyte-conditioned medium; CC3, cleaved caspase 3; cIAP, cellular inhibitor of apoptosis; Ctrl-CM, control conditioned medium; DMEM, Dulbecco's modified eagle medium; DMSO, dimethyl sulfoxide; EdU, 5-ethynyl-2'-deoxyuridine; EMT, epithelial-mesenchymal transition; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFAP, glial fibrillary acid protein; IgG, immunoglobulin G; IL, interleukin; NF-κB, nuclear factor-kappa B; PFA, polyformaldehyde; PBS, phosphate buffered saline; PI, propidium iodide, qPCR, real-time quantitative polymerase chain reaction; RIPA, radio immunoprecipitation assay; shRNA, short hairpin RNA; S100β, S100 calcium-binding protein β; TME, tumor microenvironment; TNF-α, tumor necrosis factor-α; TNFR2, tumor necrosis factor receptor 2. Declarations CRediT authorship contribution statement Shuo Zhang: Methodology, Investigation, Data curation, Project administration, Visualization, Writing – original draft. Jinjin Cai: Methodology, Investigation, Visualization, Data curation. Yingying Feng: Methodology, Investigation, Data curation. Man Yang: Methodology, Investigation, Data curation. Yuhang Li: Methodology, Investigation. Yanghui Qu: Methodology. Li Zhang: Conceptualization, Funding acquisition, Methodology, Formal analysis, Writing – review & editing. Chaonan Zheng: Conceptualization, Methodology, Formal analysis, Writing – review & editing. Yuan Wang: Conceptualization, Funding acquisition, Formal analysis, Data curation, Project administration, Writing – original draft, Writing – review & editing, Validation, Supervision. Ethics statement All usage of patient pathological sections and animal experiments were approved by and conducted in accordance with the Ethical and Welfare Committee of Soochow University. Funding sources This research was supported by National Natural Science Foundation of China (82373900 and 82073873 to Yuan Wang, 82072798 to Li Zhang), and the Priority Academic Program Development of the Jiangsu Higher Education Institutes. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgment This research was supported by National Natural Science Foundation of China (82373900 and 82073873 to Yuan Wang, 82072798 to Li Zhang), and the Priority Academic Program Development of the Jiangsu Higher Education Institutes. We would like to thank Prof. Xue-chu Zhen at Jiangsu Key Laboratory of Neuropsychiatric Diseases and Department of Pharmacology, College of Pharmaceutical Sciences, Soochow University for supervision. Data availability Data will be made available on request. References Achrol, A.S., et al., Brain metastases. Nat Rev Dis Primers, 2019. 5 (1): p. 5. Lauko, A., Y. Rauf, and M.S. Ahluwalia, Medical management of brain metastases. Neurooncol Adv, 2020. 2 (1): p. vdaa015. Gomez, D., et al., Incidence of brain metastasis according to patient race and primary cancer origin: a systematic review. J Neurooncol, 2024. 169 (3): p. 457-467. Nayak, L., E.Q. Lee, and P.Y. Wen, Epidemiology of brain metastases. Curr Oncol Rep, 2012. 14 (1): p. 48-54. Siegel, R., et al., Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin, 2011. 61 (4): p. 212-36. Sul, J. and J.B. Posner, Brain metastases: epidemiology and pathophysiology. Cancer Treat Res, 2007. 136 : p. 1-21. Mujoomdar, A., et al., Clinical predictors of metastatic disease to the brain from non-small cell lung carcinoma: primary tumor size, cell type, and lymph node metastases. Radiology, 2007. 242 (3): p. 882-8. Souza, V.G.P., et al., Advances in the Molecular Landscape of Lung Cancer Brain Metastasis. Cancers (Basel), 2023. 15 (3). Srinivasan, E.S., et al., The microenvironment of brain metastases from solid tumors. Neurooncol Adv, 2021. 3 (Suppl 5): p. v121-v132. Massague, J. and A.C. Obenauf, Metastatic colonization by circulating tumour cells. Nature, 2016. 529 (7586): p. 298-306. Fidler, I.J., et al., The seed and soil hypothesis: vascularisation and brain metastases. Lancet Oncol, 2002. 3 (1): p. 53-7. Valiente, M., et al., The Evolving Landscape of Brain Metastasis. Trends Cancer, 2018. 4 (3): p. 176-196. Ghandour, M.S., et al., A biochemical and immunohistological study of S100 protein in developing rat cerebellum. Dev Neurosci, 1981. 4 (2): p. 98-109. Hol, E.M. and M. Pekny, Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system. Curr Opin Cell Biol, 2015. 32 : p. 121-30. Myer, D.J., et al., Essential protective roles of reactive astrocytes in traumatic brain injury. Brain, 2006. 129 (Pt 10): p. 2761-72. Barres, B.A., The mystery and magic of glia: a perspective on their roles in health and disease. Neuron, 2008. 60 (3): p. 430-40. Nedergaard, M., B. Ransom, and S.A. Goldman, New roles for astrocytes: redefining the functional architecture of the brain. Trends Neurosci, 2003. 26 (10): p. 523-30. Liu, Y., et al., Astrocytes Promote Medulloblastoma Progression through Hedgehog Secretion. Cancer Res, 2017. 77 (23): p. 6692-6703. Gong, B., et al., Complement C3a activates astrocytes to promote medulloblastoma progression through TNF-alpha. J Neuroinflammation, 2022. 19 (1): p. 159. Zhang, M. and Y. Olsson, Reactions of astrocytes and microglial cells around hematogenous metastases of the human brain. Expression of endothelin-like immunoreactivity in reactive astrocytes and activation of microglial cells. J Neurol Sci, 1995. 134 (1-2): p. 26-32. Zhang, M. and Y. Olsson, Hematogenous metastases of the human brain--characteristics of peritumoral brain changes: a review. J Neurooncol, 1997. 35 (1): p. 81-9. Seike, T., et al., Interaction between lung cancer cells and astrocytes via specific inflammatory cytokines in the microenvironment of brain metastasis. Clin Exp Metastasis, 2011. 28 (1): p. 13-25. Fitzgerald, D.P., et al., Reactive glia are recruited by highly proliferative brain metastases of breast cancer and promote tumor cell colonization. Clin Exp Metastasis, 2008. 25 (7): p. 799-810. Lorger, M. and B. Felding-Habermann, Capturing changes in the brain microenvironment during initial steps of breast cancer brain metastasis. Am J Pathol, 2010. 176 (6): p. 2958-71. Valiente, M., et al., Serpins promote cancer cell survival and vascular co-option in brain metastasis. Cell, 2014. 156 (5): p. 1002-16. Wang, X., et al., Astrocytic Fas ligand expression is required to induce T-cell apoptosis and recovery from experimental autoimmune encephalomyelitis. Eur J Immunol, 2013. 43 (1): p. 115-24. Obenauf, A.C., et al., Therapy-induced tumour secretomes promote resistance and tumour progression. Nature, 2015. 520 (7547): p. 368-72. David, C.J., et al., TGF-beta Tumor Suppression through a Lethal EMT. Cell, 2016. 164 (5): p. 1015-30. Sierra, A., et al., Astrocyte-derived cytokines contribute to the metastatic brain specificity of breast cancer cells. Lab Invest, 1997. 77 (4): p. 357-68. Placone, A.L., A. Quinones-Hinojosa, and P.C. Searson, The role of astrocytes in the progression of brain cancer: complicating the picture of the tumor microenvironment. Tumour Biol, 2016. 37 (1): p. 61-9. Marchetti, D., et al., Brain-metastatic melanoma: a neurotrophic perspective. Pathol Oncol Res, 2003. 9 (3): p. 147-58. Jandial, R., et al., Astrocyte-induced Reelin expression drives proliferation of Her2(+) breast cancer metastases. Clin Exp Metastasis, 2017. 34 (2): p. 185-196. Xing, F., et al., Activation of the c-Met Pathway Mobilizes an Inflammatory Network in the Brain Microenvironment to Promote Brain Metastasis of Breast Cancer. Cancer Res, 2016. 76 (17): p. 4970-80. Xing, F., et al., Reactive astrocytes promote the metastatic growth of breast cancer stem-like cells by activating Notch signalling in brain. EMBO Mol Med, 2013. 5 (3): p. 384-96. Sasi, S.P., et al., Breaking the 'harmony' of TNF-alpha signaling for cancer treatment. Oncogene, 2012. 31 (37): p. 4117-27. Aggarwal, B.B., S.C. Gupta, and J.H. Kim, Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood, 2012. 119 (3): p. 651-65. Liu, Z.G., et al., Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell, 1996. 87 (3): p. 565-76. Tartaglia, L.A., et al., A novel domain within the 55 kd TNF receptor signals cell death. Cell, 1993. 74 (5): p. 845-53. Hsu, H., et al., TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell, 1996. 84 (2): p. 299-308. Hsu, H., J. Xiong, and D.V. Goeddel, The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell, 1995. 81 (4): p. 495-504. Naude, P.J., et al., Tumor necrosis factor receptor cross-talk. FEBS J, 2011. 278 (6): p. 888-98. Rothe, M., et al., TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science, 1995. 269 (5229): p. 1424-7. Rothe, M., et al., A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell, 1994. 78 (4): p. 681-92. Gehr, G., et al., Both tumor necrosis factor receptor types mediate proliferative signals in human mononuclear cell activation. J Immunol, 1992. 149 (3): p. 911-7. Yoo, J.Y., et al., E-cadherin as a predictive marker of brain metastasis in non-small-cell lung cancer, and its regulation by pioglitazone in a preclinical model. J Neurooncol, 2012. 109 (2): p. 219-27. Fuxe, J. and M.C. Karlsson, TGF-beta-induced epithelial-mesenchymal transition: a link between cancer and inflammation. Semin Cancer Biol, 2012. 22 (5-6): p. 455-61. Ren, G., et al., CCR2-dependent recruitment of macrophages by tumor-educated mesenchymal stromal cells promotes tumor development and is mimicked by TNFalpha. Cell Stem Cell, 2012. 11 (6): p. 812-24. Vasiljeva, O., et al., Tumor cell-derived and macrophage-derived cathepsin B promotes progression and lung metastasis of mammary cancer. Cancer Res, 2006. 66 (10): p. 5242-50. Wu, T.C., The role of vascular cell adhesion molecule-1 in tumor immune evasion. Cancer Res, 2007. 67 (13): p. 6003-6. Khatib, A.M., et al., Characterization of the host proinflammatory response to tumor cells during the initial stages of liver metastasis. Am J Pathol, 2005. 167 (3): p. 749-59. Okahara, H., et al., Involvement of very late activation antigen 4 (VLA-4) and vascular cell adhesion molecule 1 (VCAM-1) in tumor necrosis factor alpha enhancement of experimental metastasis. Cancer Res, 1994. 54 (12): p. 3233-6. Dragoj, M., et al., Targeting CXCR4 and FAK reverses doxorubicin resistance and suppresses invasion in non-small cell lung carcinoma. Cell Oncol (Dordr), 2017. 40 (1): p. 47-62. Choy, C., et al., Cooperation of neurotrophin receptor TrkB and Her2 in breast cancer cells facilitates brain metastases. Breast Cancer Res, 2017. 19 (1): p. 51. Denkins, Y., et al., Brain metastases in melanoma: roles of neurotrophins. Neuro Oncol, 2004. 6 (2): p. 154-65. Chen, Q., et al., Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer. Nature, 2016. 533 (7604): p. 493-498. Ganesh, B.S. and S.K. Chintala, Inhibition of reactive gliosis attenuates excitotoxicity-mediated death of retinal ganglion cells. PLoS One, 2011. 6 (3): p. e18305. Mancusi, R. and M. Monje, The neuroscience of cancer. Nature, 2023. 618 (7965): p. 467-479. Zeng, Q., et al., Synaptic proximity enables NMDAR signalling to promote brain metastasis. Nature, 2019. 573 (7775): p. 526-531. da Fonseca, A.C., et al., The impact of microglial activation on blood-brain barrier in brain diseases. Front Cell Neurosci, 2014. 8 : p. 362. Seano, G., et al., Solid stress in brain tumours causes neuronal loss and neurological dysfunction and can be reversed by lithium. Nat Biomed Eng, 2019. 3 (3): p. 230-245. Berghoff, A.S., et al., Density of tumor-infiltrating lymphocytes correlates with extent of brain edema and overall survival time in patients with brain metastases. Oncoimmunology, 2016. 5 (1): p. e1057388. Sevenich, L., et al., Analysis of tumour- and stroma-supplied proteolytic networks reveals a brain-metastasis-promoting role for cathepsin S. Nat Cell Biol, 2014. 16 (9): p. 876-88. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7234065","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492615614,"identity":"ce79b57f-893b-4344-9431-ceae393861b6","order_by":0,"name":"Shuo Zhang","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Zhang","suffix":""},{"id":492615615,"identity":"cfc1a10f-7765-4c43-a8f6-5674a9eaae0a","order_by":1,"name":"Jinjin Cai","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Jinjin","middleName":"","lastName":"Cai","suffix":""},{"id":492615616,"identity":"adac10a8-2da7-4c1b-9a4f-26f57039c4b2","order_by":2,"name":"Yingying Feng","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yingying","middleName":"","lastName":"Feng","suffix":""},{"id":492615617,"identity":"8244311c-b28c-4c22-a654-663c5761a9a4","order_by":3,"name":"Man Yang","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Man","middleName":"","lastName":"Yang","suffix":""},{"id":492615618,"identity":"965c45ab-57df-4287-abef-2d71f176433a","order_by":4,"name":"Yuhang Li","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yuhang","middleName":"","lastName":"Li","suffix":""},{"id":492615619,"identity":"7393eaa3-1444-4be3-a3a7-bcfb0c0c31f5","order_by":5,"name":"Yanghui Qu","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yanghui","middleName":"","lastName":"Qu","suffix":""},{"id":492615620,"identity":"947571ea-76db-4bba-beeb-b6a6ae000f25","order_by":6,"name":"Li Zhang","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Zhang","suffix":""},{"id":492615621,"identity":"c312e684-bf00-401b-bc8d-d6167d812e00","order_by":7,"name":"Chaonan Zheng","email":"","orcid":"","institution":"Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Chaonan","middleName":"","lastName":"Zheng","suffix":""},{"id":492615622,"identity":"7d7c7776-caf8-4083-866a-2aae25112ac2","order_by":8,"name":"Yuan Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYNCCCiA+AMQ8xGs5Q7IWxjZStBjcSH72mHdeXWLf8QOMD962McibE9aSZm7Mu+1w4swzCcyGc9sYDHc2ENSSYCadu+1A4oYDCWzSvG0MCQYHCGpJ/yadO6cuccP5B+y/idSSA7SlgTlxw40ENmaitEieeVMm/efYYeOZNx42S845J2G4gZAWvuPp2yRn1NTJ9p1PPvjhTZmNPEFbFBAKGBuAhAQB9UAg30BYzSgYBaNgFIx0AABBxkV0tem8QgAAAABJRU5ErkJggg==","orcid":"","institution":"Soochow University","correspondingAuthor":true,"prefix":"","firstName":"Yuan","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2025-07-28 12:53:16","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-7234065/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7234065/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88096866,"identity":"15f240de-4e34-4c93-baf7-b9deb0807b31","added_by":"auto","created_at":"2025-08-01 11:02:13","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":11569334,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytes exist in the tumor microenvironment of lung cancer brain metastasis. \u0026nbsp;(A) Representative immunohistochemical staining of GFAP in clinical patient’s lung cancer brain metastasis tumor tissue sections, brown color displays the positive staining. Tumor: tumor area, Peri-Tumor: the adjacent tissue. The blue dotted line defines the boundary between tumor and the adjacent area. H\u0026amp;E: Hematoxylin-eosin. (B-C) 2 ⅹ 10\u003csup\u003e5\u003c/sup\u003e LLC cells/mouse were injected into the brain parenchyma of mice, and the tumor tissues were collected on day 11 (B and lower panel of C) or day 7 (upper panel of C) post injection to prepared the frozen sections. Then immunofluorescence staining of GFAP (in red) and S100β (in red) was performed. DAPI counterstained cell nucleus in blue color.\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/eebcb3d4b45275fcf3f6b9dd.jpg"},{"id":88096861,"identity":"25a4b8e0-1569-4041-a0f8-122ef5ddca78","added_by":"auto","created_at":"2025-08-01 11:02:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3053849,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytes promote the survival but not the proliferation of LLC cells \u003cem\u003ein vitro. \u003c/em\u003e(A) LLC cells were co-cultured with astrocytes at a ratio of 10:1 or cultured alone as control for indicated hours. Cell viability was determined by the CCK-8 assay. (B) LLC cells were treated with astrocyte-conditioned medium (AS-CM) or control conditioned medium (Ctrl-CM) for indicated hours. Cell viability was determined by the CCK-8 assay. (C-E) LLC cells were treated with AS-CM or Ctrl-CM for 24 hours. (C) Cell proliferation was determined by EdU incorporation and immunofluorescent staining. (D) Statistical quantification of the percentage of EdU-positive cells among the live cells in panel C. (E) qPCR was used to detect the expression levels of representative cell cycle related genes. ns: no statistical significance; * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/be7ebf99f6170ab6a6b40021.jpg"},{"id":88098685,"identity":"dced7426-66a6-4e1c-a1c3-134069deb1ae","added_by":"auto","created_at":"2025-08-01 11:10:13","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6913249,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytes inhibit the apoptosis of LLC cells. (A-D) LLC cells were treated with AS-CM or Ctrl-CM for 24 hours. (A) Representative immunofluorescent staining images of the apoptosis marker cleaved caspase 3 (CC3, in red), DAPI counterstained cell nucleus. (B) Statistical quantification of the percentage of CC3-positive cells among the live cells in panel A. (C) Representative flow cytometry result of apoptosis detection labeled with PI and Annexin Ⅴ. (D) Statistical quantification of the percentage of PI /Annexin Ⅴ-double positive plus Annexin Ⅴ-single positive cells in panel C. (E) Representative immunofluorescent staining images of lung cancer brain metastasis mouse model (day 11) tumor sections labeled with CC3 (in green) and GFAP (in red). The frames indicate the astrocyte rich area (upper right) or rare area (lower left). AS: astroctye. (F) Statistical quantification of the percentage of CC3-positive cells among the live cells in panel E. *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/47b35979d19abc79d3e5eb18.jpg"},{"id":88096867,"identity":"9c859e6b-2b08-41ee-9a1a-26fa0033f4bc","added_by":"auto","created_at":"2025-08-01 11:02:13","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5611865,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytes inhibit LLC cell apoptosis through secreting TNF-ɑ. (A) Primary astrocytes (pAS) and TAAs were isolated from normal mouse brain and mouse lung cancer brain metastasis tumors, respectively, gene expression levels of \u003cem\u003eTNF-ɑ\u003c/em\u003e in these cells were determined using qPCR. (B) Non-reactive astrocytes, reactive astrocytes and TAAs were cultured with serum free medium for 24 hours, and the protein levels of TNF-α in the culture supernatant was evaluated by ELISA method, a serum-free medium served as control. (C) LLC cells were treated with indicated concentrations of recombinant mouse TNF-α \u003cem\u003ein vitro. \u003c/em\u003efor 24 hours, and the cell apoptosis was determined by flow cytometry according to PI/Annexin Ⅴ staining. (D) Statistical quantification of the percentage of PI /Annexin Ⅴ-double positive plus Annexin Ⅴ-single positive cells in panel C. (E) LLC cells were treated with AS-CM or control CM in the presence of TNF-α neutralizing antibody or control IgG (2 µg/mL) for 24 hours, and the cell apoptosis was determined by flow cytometry. (F) Statistical quantification of the percentage of PI /Annexin Ⅴ-double positive plus Annexin Ⅴ-single positive cells in panel E. * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/a6c85ba47f35674365d6714e.jpg"},{"id":88098688,"identity":"ca81fc76-c80f-4058-aee1-4af53943ba24","added_by":"auto","created_at":"2025-08-01 11:10:13","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7988974,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytes inhibit LLC cell apoptosis through the downstream signaling pathway of TNFR2. (A) The expression of \u003cem\u003eTNFR2\u003c/em\u003e in primary and brain metastatic LLC cells was evaluated by qPCR. (B) the knockdown efficiency of sh\u003cem\u003eTNFR\u003c/em\u003e2 in LLC cells was verified by qPCR. (C-F) \u003cem\u003eTNFR2 \u003c/em\u003eknocked down\u003cem\u003e \u003c/em\u003eand control LLC cells were treated with AS-CM for 24 or indicated hours, cell apoptosis (C) and viability (E-F) was determined by flow cytometry and CCK-8 assay, respectively. (D) Statistical quantification of the percentage of PI /Annexin Ⅴ-double positive plus Annexin Ⅴ-single positive cells in panel C. (G) \u003cem\u003eTNFR2 \u003c/em\u003eknocked down\u003cem\u003e \u003c/em\u003eand control LLC cells were injected intracranially into mouse brain to establish colonized brain metastatic tumor model, and survival curve was plotted. n=6. (H) \u003cem\u003eTNFR2 \u003c/em\u003eknocked down\u003cem\u003e \u003c/em\u003eand control LLC cells induced tumors (day 21) were prepared for frozen sections and immunofluorescence staining of cleaved caspase 3(CC3, in green) was performed to detect tumor cell apoptosis. (I) Statistical quantification of the numbers of CC3-positive cells per vision field in panel H. ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/9b002a8ac16a25a6dc9bb641.jpg"},{"id":88098687,"identity":"b34708ce-c539-4eaa-a3f6-fe70dfdb5611","added_by":"auto","created_at":"2025-08-01 11:10:13","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6420655,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytes inhibit LLC cell apoptosis through TNF-α-TNFR2-NF-κB signaling pathway. (A-F) LLC cells were treated with AS-CM or control CM for indicated (A) or 30 minutes (min) with the presence or absence of TNF-α neutralizing antibody (C) or knocking down of \u003cem\u003eTNFR2\u003c/em\u003ein LLC cells (E), and the levels of total p65 (T-NF-κB p65) and phosphorylated p65 (p-NF-κB p65) was detected by Western blotting, GAPDH served as the internal reference. (B, D, F) Statistical quantification of the relative gray density of the protein bands in panel A, C, and E, respectively. (G) LLC cells were treated with AS-CM or control CM with the presence or absence of NF-κB pathway inhibitor JSH-23 at indicated doses for 24 hours, and cell apoptosis was detected by flow cytometry. (H) Statistical quantification of the percentage of PI /Annexin Ⅴ-double positive plus Annexin Ⅴ-single positive cells in panel G. \u0026nbsp;*** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001. In panel B, *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001 vs (0 min) group.\u003c/p\u003e","description":"","filename":"Fig.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/2ebe071fc4169141096ca174.jpg"},{"id":89150055,"identity":"ff1aacd9-b6f8-4953-aa25-ad2796427c00","added_by":"auto","created_at":"2025-08-15 12:31:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":42660196,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/900e3426-fc63-4ff6-b5cf-a2fc3c71025c.pdf"},{"id":88096862,"identity":"97c3bc46-d5eb-47b7-8183-8add4c934831","added_by":"auto","created_at":"2025-08-01 11:02:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":197299,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7234065/v1/f7d433aad48a113b8ddc9a8f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tumor-associated astrocytes inhibit tumor cell apoptosis through TNF- α-TNF receptor 2-NF-κB pathway in lung cancer brain metastasis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCancer brain metastasis refers to the formation of secondary tumors in the brain, which is a common manifestation of cancer and has a very poor clinical prognosis [1, 2]. More than 100,000 new brain metastasis cases are diagnosed annually [3]. Nearly 30% of patients with solid tumors will develop brain metastasis. Lung cancer, breast cancer and skin cancer (melanoma) are the most common types to cause brain metastasis, accounting for 67\u0026ndash;80% of cases, among which lung cancer brain metastasis has the largest proportion [4]. Lung cancer is the most common cause of cancer-related mortality in humans [5], and the main reason is the metastasis of lung cancer [6]. The probability of lung cancer developing into brain metastasis is approximately 50% [7, 8]. The treatment methods of lung cancer brain metastasis are very limited, so it remains a severe clinical challenge.\u003c/p\u003e\u003cp\u003eThe tumor microenvironment plays a crucial role in the occurrence, development, and metastasis of tumors. However, it needs to overcome multiple obstacles for a tumor to metastasize to the brain, such as the blood-brain barrier and the complex natural components that form the tumor microenvironment in the brain [1, 8, 9], and the brain also initiates immune defense to resist the metastasis and colonization of tumor cells [10]. Whereas, along with cancer cells invading and spread, tumors interact with microenvironment cells in complex ways, altering the brain tissue microenvironment and transforming it into a tumor microenvironment that supports tumor growth [11]. The brain is composed of specific cells distinct from other parts of the body, such as astrocytes, oligodendrocytes, microglia, and neurons. The interaction between cancer cells and these specific brain cells is an important factor influencing brain metastasis [9, 12]. Among the specific brain cells, astrocytes are one of the first host cell types that tumor cells interact with.\u003c/p\u003e\u003cp\u003eAstrocytes are the most widely distributed type of glial cells in the brain, accounting for 30% of the cells in the central nervous system. Astrocytes express specific markers such as S100β, glial fibrillary acidic protein (GFAP), and so on, among which GFAP is considered a marker of reactive astrocytes [13\u0026ndash;15]. Astrocytes play important roles in regulating cerebral blood flow, modulating the response of the central nervous system to inflammation, maintaining the blood-brain barrier, and mediating immune signal transduction [16, 17]. Our previous research found that in primary cerebellar medulloblastoma, astrocytes constitute an important component of the tumor microenvironment. These cells are referred to as tumor-associated astrocytes (TAAs) and play a role in promoting tumor development [18, 19]. Meanwhile some publications showed that in animal models and human patients with metastatic brain tumors, activated astrocytes were observed to cluster around tumor cells [20, 21]; and in studies on breast and lung cancer brain metastasis, local activation of astrocytes was found to be related to the process of tumor invasion into brain parenchyma [22\u0026ndash;24], also suggesting that astrocytes are components of the tumor microenvironment in brain metastasis. Remarkably, astrocytes play opposite roles in the process of tumor cell brain metastasis: some studies have shown that astrocytes resist tumor cells from entering brain parenchyma and limit brain metastasis [25], and they could secrete Fas ligand to kill infiltrating tumor cells [26]; while other studies have indicated that astrocytes promote tumor occurrence and development in the brain [27, 28], such as promoting the colonization of breast cancer and melanoma in the brain [29\u0026ndash;34]. However, the role that astrocytes play in brain metastasis after tumor cell colonization remains unclear. Therefore, our current study focuses on elucidating the role of astrocytes on tumor development in brain metastasis after colonization by using a colonized lung brain metastasis animal model.\u003c/p\u003e\u003cp\u003eTumor necrosis factor-α (TNF-α) can be produced by tumors and the tumor microenvironment, exerting multifunctional effects on tumor occurrence and progression [35]. TNF-α is a multifunctional cytokine that participates in regulating various functions including regulating cell growth, inflammatory responses, and tumor development [36]. These functions depend on the binding of TNF-α to two different membrane receptors on target cells, namely TNFR1 (TNF receptor1, also known as p55, TNFRSF1A) and TNFR2 (also known as p75, TNFRSF1B). TNF-α induces cell death signals through TNFR1 [37]. The TNFR1 transduces pro-apoptotic signals via its death domain [38] which includes TNFR-related death domain proteins (TRADD), Fas-related death domain proteins (FADD) and TNFR-related factor 1 (TRAF1) [39, 40]. Different from TNFR1, TNFR2 does not have a death domain [41]. It contains a TRAF2-binding site, which recruits TRAF2 and sequentially assembles a complex comprising TRAF1, TRAF2, cIAP1, and cIAP2 [42, 43]. The complex subsequently activates downstream signaling molecules and triggers NF-κB to be released from its cytoplasmic inhibitor IκBα, translocate to the nucleus, and function as a transcription factor to upregulate target genes and promote cell survival [44]. In our previous study, it was found that astrocytes in the tumor microenvironment of primary cerebellar tumor can promote tumor cell proliferation by secreting TNF-α [19]. In the current study, we extend these findings to brain metastasis, exploring the influence of astrocyte-derived TNF-α on brain metastasis progression.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Animal and lung cancer brain metastasis model\u003c/h2\u003e\u003cp\u003e\u003cem\u003eC57BL/6\u003c/em\u003e wildtype mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd, and were maintained in the SPF animal facility of Soochow University. All animal experiments were approved by and conducted in accordance with the Ethical and Welfare Committee of Soochow University.\u003c/p\u003e\u003cp\u003eMurine cell line Lewis lung carcinoma (LLC) was used in our study. To conduct the animal model mimicking the lung cancer brain metastasis after tumor cells colonization, stereotactic injection was performed as reported [45]. Briefly, 2 ⅹ 10\u003csup\u003e5\u003c/sup\u003e LLC cells /5 \u0026micro;L PBS/ mouse were injected into brain parenchyma of 4\u0026ndash;6 weeks old mice. Brain tumor tissues were collected on day 7, 11 or as indicated.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Cell preparation\u003c/h2\u003e\u003cp\u003eLLC cells were provided by Dr. Yue Chinn and cultured with Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM, HyClone) containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin.\u003c/p\u003e\u003cp\u003eFor astrocyte preparation, the brain of wildtype mice at postnatal day 2 were dissected and digested in papain buffer consisting of 10 U/mL papain (Worthington), 250 U/mL DNase (Sigma) and 200 \u0026micro;g/mL l-cysteine (Sigma) for 30 minutes at 37\u0026deg;C to acquire a single-cell suspension, as described previously [19], and cells were cultured in DMEM/F12 medium (HyClone) containing 10% FBS and 1% penicillin/streptomycin. When the cells grew to 80% confluence, they were digested with 0.25% trypsin-EDTA (Beyotime) for passage. Cells were usually passed to two to three generations before experiments. For non-reactive astrocyte culture, the cells were maintained in serum-free medium.\u003c/p\u003e\u003cp\u003eTo isolate tumor-associated astrocytes (TAAs), a single-cell suspension of lung cancer brain metastasis tumor tissue was obtained as above. The cells were stained with APC-conjugated anti-ACSA-2 (astrocyte cell surface antigen-2) antibody (1:20, Miltenyi), and then TAAs were sorted and collected by flow cytometry (Aria II, BD Bioscience) according to APC positive staining. Similarly, primary astrocytes (pAS) were isolated from the normal brains of neonatal mice.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Immunohistochemistry and immunofluorescent staining\u003c/h2\u003e\u003cp\u003eHuman lung cancer brain metastasis paraffin sections were provided by Dr. Minghua Wu at Xiangya Hospital. The use of the sections was reviewed and approved by the Ethics Committee of Soochow University. The paraffin sections were sent to Wuhan Servicebio Technology for immunohistochemistry staining of GFAP and Hematoxylin-eosin (H\u0026amp;E).\u003c/p\u003e\u003cp\u003eFor immunofluorescent staining, brain tissues of murine lung cancer brain metastasis model were harvested, frozen in Tissue Tek-OCT (Thermo Fisher Scientific), and then sectioned at 10\u0026ndash;12 \u0026micro;m thickness. Sections were blocked with PBS containing 0.2% Triton X-100 (Biosharp) and 1% bovine serum albumin (BSA, Fisher bioreagents) for 1 hour at room temperature. Then, the sections were incubated with primary antibody overnight at 4\u0026deg;C. The next day, sections were exposed to secondary antibody conjugated with the appropriate fluorescein for 2 hours at room temperature. DAPI (Beyotime) staining was performed for 10 minutes. Immunofluorescent staining for cells followed the same protocol. Before staining, cells were fixed in 4% PFA for 15 minutes and permeabilized with PBS containing 0.2% Triton X-100 for 10 minutes at room temperature. Finally, slides were mounted with Fluoromount-G (Southern Biotechnology) and visualized by a Nikon microscope. All antibodies were diluted in PBS containing 0.2% Triton X-100 and 1% BSA. The antibodies and dilution ratios were as follows: anti-S100β (1:300, Sigma), anti-cleaved caspase-3 (1:200, Cell Signaling Technology), and anti-GFAP (1:200, BD Bioscience,), goat anti-rabbit-Alexa Fluor 594 (1:200, Proteintech), goat anti-mouse-Alexa Fluor 488 (1:200, Proteintech), goat anti-rabbit-Alexa Fluor 488 (1:200, Proteintech), and goat anti-mouse-Alexa Fluor 594 (1:200, Proteintech).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Co-culture of astrocytes and LLC cells\u003c/h2\u003e\u003cp\u003eAstrocytes were collected and mixed with LLC cells at a ratio of 1:10 and co-cultured in LLC medium (DMEM) for cell viability experiment. In some experiments, LLC cells were treated with astrocyte-conditioned medium for 24 hours or indicated time. To collect astrocyte-conditioned medium, astrocytes were cultured in DMEM/F12 for 24 hours and the supernatant was removed before fresh DMEM medium was added. The astrocytes were cultured for another 24 hours with DMEM to collect the supernatant, and the supernatant was centrifuged to remove any cells and cell debris to obtain the astrocyte-conditioned medium. The control medium was the supernatant collected from pure DMEM for 24 hours kept in CO\u003csub\u003e2\u003c/sub\u003e incubator. In certain experiments, when LLC cells were treated with astrocyte-conditioned medium, anti-TNF-α antibody or control rat IgG (2 \u0026micro;g/mL, Cell Signaling Technology), or the NF-ᴋB signaling pathway inhibitor, JSH-23 (20 \u0026micro;M and 50 \u0026micro;M, Seleck) was added for treatment. In other experiments, LLC cells were treated with recombinant mouse TNF-α (Novoprotein) at 0.1 ng/mL or 10 ng/mL.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Cell counting kit-8 (CCK-8) assay\u003c/h2\u003e\u003cp\u003eCCK-8 assay was performed to detect cell viability. LLC cells were cultured in serum-free medium for 9\u0026ndash;12 hours in advance and then inoculated into 96-well plates at 2 ⅹ10\u003csup\u003e3\u003c/sup\u003e/ well density and cultured with indicated treatment. The cells were incubated with 10 \u0026micro;L of CCK-8 reagent for 1 hour to detect optical density (OD) at 450 nm wave length (λ\u0026thinsp;=\u0026thinsp;450 nm).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. 5-ethynyl-29-deoxyuridine (EdU) incorporation and detection\u003c/h2\u003e\u003cp\u003e LLC cells were plated on coverslips with indicated treatments, and the cells were pulsed with EdU (10 \u0026micro;M, Beyotime) for 2 hours before cells were fixed in 4% PFA, then followed by the immunofluorescent staining procedure for EdU labelled cells detection.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Cell apoptosis assessment\u003c/h2\u003e\u003cp\u003eCell samples were prepared by using Annexin V-APC/PI apoptosis kit (MultiSciences) according to the manufacturer's instruction, and detected by flow cytometry (Aria II, BD Bioscience).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Enzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e\u003cp\u003e Non-reactive, reactive and tumor-associated astrocytes were cultured in vitro for 24 hours, and the supernatant was harvested, then mouse TNF-α ELISA kit (MultiSciences) was used to evaluated the TNF-α protein levels in the supernatant according to the manufacturer's instruction.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. \u003cem\u003eKnockdown of TNFR2 in LLC cells\u003c/em\u003e\u003c/h2\u003e\u003cp\u003eshRNAs were used to knock down the expression of \u003cem\u003eTNFR2\u003c/em\u003e in LLC cells. The sequences for shRNAs are below:\u003c/p\u003e\u003cp\u003esh\u003cem\u003eTNFR2\u003c/em\u003e#1, CCGGCCAAGGACACTCTACGTATCTCGAGATACGTAGAGTGTCCTTGGTTTTTGAATT; sh\u003cem\u003eTNFR2\u003c/em\u003e#2, CCGGGAACCAGTTTCGTACATGTCTCGAGACATGTACGAAACTGGTTCTTTTTGAATT; sh\u003cem\u003eTNFR2\u003c/em\u003e#3, CCGGGGGACGTTCTCTGACACCACATCATCTCGAGATGATGTGGTGTCAGAGAACGTCCCTTTTTGAATT.\u003cem\u003e2.10. Western blotting\u003c/em\u003e\u003c/p\u003e\u003cp\u003eCell lysate was prepared in RIPA buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitor cocktail (Roche), and the total protein concentration was evaluated using a BCA Protein Assay Kit (Beyotime). Then, equal amounts of protein samples were loaded and separated by 10% SDS-PAGE (Beyotime) and transferred onto PVDF membranes (Millipore). The membranes were blocked with TBS containing 0.05% Tween-20 and 5% defatted milk powder and incubated overnight at 4\u0026deg;C with primary antibodies: anti-GAPDH (1:5000, Proteintech), anti-total NF-ᴋB p65 (1:1000, Cell Signaling Technology), and anti-phosphorylated NF-ᴋB p65 (1:1000, Cell Signaling Technology). The following day, the membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibodies, anti-mouse IgG (1:5000, CST) and anti-rabbit IgG (1:5000, CST), at room temperature for 2 hours. Bands were visualized using high-signal ECL substrate (Beyotime) and exposed on a ChemiScope 3300 mini (Clinx).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.11. Real-time quantitative PCR (qPCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from cell lysate using TRIzol reagent (Sigma) in RNase-free conditions. cDNA was synthesized using oligo (dT) and Superscript II reverse transcriptase (Vazyme). qPCR was performed in triplicate using SYBR qPCR Master Mix (Vazyme) and the ABI 7500 TaqMan Real-Time PCR Detection System. The differences in mRNA expression were calculated by the 2\u003csup\u003e-ΔΔCt\u003c/sup\u003e method. The primers (all for mouse species) used in the experiments included \u003cem\u003eGAPDH\u003c/em\u003e (forward: 5-CATCACTGCCACCCAGAAGACTG-3; reverse: 5-ATGCCAGTGAGCTTCCCGTTCAG-3); \u003cem\u003eCCND1\u003c/em\u003e (forward: 5-GCGTACCCTGACACCAATCTC-3; reverse: 5-CTCCTCTTCGCACTTCTGCTC-3); \u003cem\u003eCDK1\u003c/em\u003e (forward: 5-AGAAGGTACTTACGGTGTGGT-3; reverse: 5- GAGAGATTTCCCGAATTGCAGT-3); \u003cem\u003eCCNB1\u003c/em\u003e (forward: 5-AAGGTGCCTGTGTGTGAACC-3; reverse: 5-GTCAGCCCCATCATCTGCG-3); \u003cem\u003eIL-1β\u003c/em\u003e (forward: 5- GGTCAAAGGTTTGGAAGCAG-3); reverse: 5-TGTGAAATGCCACCTTTTGA-3); \u003cem\u003eIL-6\u003c/em\u003e (forward: 5-CTCTGCAAGAGACTTCCATCCAGT-3; reverse: 5-GAAGTAGGGAAGGCCGTGG-3); \u003cem\u003eTNF-α\u003c/em\u003e (forward: 5-AGGGTCTGGGCCATAGAACT-3; reverse: 5-CCACCACGCTCTTCTGTCTAC-3); and \u003cem\u003eTNFR2\u003c/em\u003e (forward: 5-CTGCGCCTTGAAAACCCATT-3; reverse: 5-GATGCTACAGATGCGGTGGG-3).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Statistical analysis\u003c/h2\u003e\u003cp\u003eExperimental data were analyzed using GraphPad Prism software. The Shapiro-Wilk test was used to test for data distribution normality. For experiments containing two groups, unpaired \u003cem\u003eStudent\u0026rsquo;s t\u003c/em\u003e test was used to calculate the difference when data exhibit Gaussian distribution. Data that do not exhibit Gaussian distribution was analyzed via a non-parametric \u003cem\u003eStudent\u0026rsquo;s t\u003c/em\u003e test. For experiments containing three or more groups, one way ANOVA was used to determine the levels of difference and Bonferroni was used to perform the posttest of all pairs of data. Differences were considered to be significant when the value was less than 0.05 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Values are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM from at least three independent experiments.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Tumor-associated astrocytes (TAAs) exist in the tumor microenvironment of lung cancer brain metastasis\u003c/h2\u003e\u003cp\u003eTo investigate astrocytes\u0026rsquo; role in lung cancer brain metastasis after metastatic colonization, we first detected the presence of TAAs in the tumor microenvironment. Immunohistochemical staining of tumor sections from patients with lung cancer brain metastasis was performed. The results showed that TAAs were present in the tumor microenvironment of lung cancer brain metastasis in the patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To investigate whether TAAs also exist in the tumor microenvironment of lung cancer brain metastasis animal model, we injected mouse lung adenocarcinoma cells, LLC cells, into the brain parenchyma to establish a colonized lung cancer brain metastasis model in mice as previously reported [45] (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Immunofluorescence staining of astrocyte markers, GFAP and S100β, on the tumor tissues frozen sections was performed. The results showed that astrocytes were present in the tumor microenvironment at both the earlier stage (seven days post-injection) and the later stage (eleven days post-injection) of tumor induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Astrocytes promote the survival but not the proliferation of LLC cells in vitro.\u003c/h2\u003e\u003cp\u003eTo explore the role of astrocytes in the tumor microenvironment of colonized brain metastatic tumor, we first used an \u003cem\u003ein vitro\u003c/em\u003e. co-culture system to examine their impact on the viability of LLC cells. Astrocytes and LLC cells were co-cultured at a ratio of 1:10, with LLC cells cultured alone as the control group. The viability of LLC cells was detected by the CCK-8 method. The results showed that the viability of LLC cells co-cultured with astrocytes was significantly higher than that of the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). To investigate whether direct contact with tumor cells is essential for astrocytes to exert their effects, we treated LLC cells with astrocyte-conditioned medium (AS-CM) and detected the cell viability. The results indicated that AS-CM significantly promoted the viability of LLC cells compared with control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), suggesting that astrocytes exert their effects through a contact-independent, paracrine signaling. To further investigate whether astrocytes promote the viability of lung cancer cells by directly affecting their proliferation, EdU incorporation assay was performed to detect the proliferation of LLC cells with AS-CM treatment. The results showed that AS-CM did not directly promote the proliferation of LLC cells compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D). Furthermore, we also used qPCR to detect the expression levels of genes related to cell cycle, such as \u003cem\u003eCDK1\u003c/em\u003e, \u003cem\u003eCCNB1\u003c/em\u003e, and \u003cem\u003eCCND1\u003c/em\u003e. The results indicated that AS-CM did not alter the expression of these cell cycle-related genes in LLC cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In conclusion, astrocytes can promote the survival of LLC cells, but not their proliferation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.3. Astrocytes inhibit the apoptosis of LLC cells\u003c/h2\u003e\u003cp\u003eSince astrocytes promoted the viability but not the proliferation of LLC cells, we hypothesized that astrocytes might promote the survival of lung cancer cells by affecting their apoptosis. To verify our hypothesis, we detect the effect of AS-CM on the apoptosis of lung cancer cells \u003cem\u003ein vitro.\u003c/em\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B, the apoptotic cells were labeled with the apoptosis marker cleaved caspase 3 (CC3) and the number of positive cells was counted. The results showed that AS-CM significantly decreased the proportion of CC3-positive cells. Additionally, flow cytometry analysis indicated that the proportion of apoptotic LLC cells treated with AS-CM was significantly lower than that of the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). Next, we tried to explore whether astrocytes have the same effect on tumor cells \u003cem\u003ein vivo.\u003c/em\u003e We investigated the distribution of astrocytes and the occurrence of apoptosis in tumor cells using immunofluorescence staining of tumor tissue sections. The staining results showed that the apoptosis of tumor cells was negatively correlated with the distribution density of astrocytes in the tumor microenvironment, that is, there were much less apoptotic tumor cells in the astrocyte-rich area than that of the astrocyte-rare area (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-F). The results above indicated that astrocytes inhibit the apoptosis of LLC cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Astrocytes inhibit LLC cell apoptosis through secreting TNF-ɑ\u003c/h2\u003e\u003cp\u003eThe experiments above indicated that astrocytes inhibit the apoptosis of LLC cells through their secreted molecules. We then explored through which secreted molecules the role of astrocytes was exerted. As we know that astrocytes gain their reactive status in certain physiological and pathological conditions with increased proinflammatory factors secretion such as IL-1β, IL-6 and TNF-ɑ, therefore, we attempted to find out whether TAAs in the tumor microenvironment of brain metastasis also became reactive and contributed to tumor cell survival through these factors. We first isolated primary astrocytes (pAS) from normal mouse brain tissue and TAAs from mouse lung cancer brain metastasis tumors, respectively, using flow cytometry, then detected the gene expression levels of \u003cem\u003eIL-1β\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e and \u003cem\u003eTNF-ɑ\u003c/em\u003e using qPCR. It showed that only \u003cem\u003eTNF-ɑ\u003c/em\u003e was significantly upregulated in TAAs compared with primary astrocyte (supplementary Fig.\u0026nbsp;1 and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Also, we tried to compare the protein levels of TNF-α secreted by astrocytes with different status. We prepared the non-reactive astrocytes cultured with serum free medium, reactive astrocytes cultured with regular medium and TAAs. The protein levels of TNF-α in the culture supernatant was evaluated by ELISA, with a serum-free medium as the control group. The results showed that reactive astrocytes secreted more TNF-α than non-reactive astrocytes, and TAAs produced much higher TNF-α than other two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). It is consistent with our previous research showing that TAAs in the primary brain tumor, medulloblastoma, can promote tumor development by producing TNF-α. Regarding the role of TNF-α in tumors, studies have shown that it has a dual effect on tumor cells. On one hand, TNF-α can kill certain tumor cells or inhibit their proliferation \u003cem\u003ein vivo.\u003c/em\u003e and \u003cem\u003ein vitro.\u003c/em\u003e; on the other hand, TNF-α has a growth factor-like effect on certain tumor cells, promoting their proliferation and survival [26, 43, 44]. To investigate whether astrocytes can also affect the survival and apoptosis of tumor cells by secreting TNF-α, we first verified the effect of TNF-α on the apoptosis of LLC cells. We treated LLC cells with different concentrations of recombinant mouse TNF-α \u003cem\u003ein vitro.\u003c/em\u003e and detected the apoptosis of LLC cells. The results showed that compared with the control group, the proportion of apoptotic LLC cells treated with recombinant TNF-α decreased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D). To confirm whether astrocytes exert their effect on the apoptosis of LLC cells by secreting TNF-α, LLC cells were treated with AS-CM in the presence or absence of TNF-α neutralizing antibody followed by the apoptosis examination. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-F, the inhibitory effect of AS-CM on tumor cell apoptosis was counteracted by the TNF-α neutralizing antibody. Taken together, the results indicate that astrocytes inhibit the apoptosis of LLC cells by secreting TNF-α.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.5. Astrocytes inhibit the apoptosis of LLC cells through the downstream signaling pathway of TNFR2\u003c/h2\u003e\u003cp\u003eTNF-α functions by binding to TNFR1 and TNFR2. Studies have shown that TNFR1 mainly activates apoptotic signaling pathways [37], while TNFR2 mainly activates cell survival signaling pathways [34, 35]. We therefore hypothesize that the regulation of LLC cell apoptosis by astrocyte derived TNF-α is mediated by the downstream signaling pathway of TNFR2. Firstly, we detected the expression levels of \u003cem\u003eTNFR2\u003c/em\u003e in primary and metastatic LLC cells. The results showed that the expression level of \u003cem\u003eTNFR2\u003c/em\u003e in metastatic tumor cells was higher than that in primary tumor cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Next, we knocked down \u003cem\u003eTNFR2\u003c/em\u003e in LLC cells using shRNA, and verified the knockdown efficiency of sh\u003cem\u003eTNFR2\u003c/em\u003e#2 and sh\u003cem\u003eTNFR2\u003c/em\u003e#3 as above 60% compared to the scrambled control (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Then, to verify our hypothesis, these LLC cells were treated with AS-CM. The results showed that compared with scrambled control, knocking down \u003cem\u003eTNFR2\u003c/em\u003e increased the apoptosis of LLC cells, and the inhibitory effect of AS-CM on LLC cell apoptosis was dampened (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). To further verify that the astrocyte derived TNF-α regulates LLC cell survival through the TNFR2 downstream signaling pathway, TNFR\u003cem\u003e2\u003c/em\u003e knocked down and control LLC cells were treated with AS-CM, cell viability was evaluated by CCK-8 assay. The results showed that compared with the control group, knocking down \u003cem\u003eTNFR2\u003c/em\u003e counteracted the promoting effect of AS-CM on LLC cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-F). Moreover, to verify the contribution of TNFR2 signaling pathway to the development of lung cancer brain metastasis tumor development \u003cem\u003ein vivo.\u003c/em\u003e, \u003cem\u003eTNFR2\u003c/em\u003e knocked down and control LLC cells were injected intracranially into mouse brain to establish colonized metastatic tumor model, then the survival rate of tumor-bearing mice and the apoptosis of tumor cells \u003cem\u003ein vivo.\u003c/em\u003e was detected. The results showed that knocking down \u003cem\u003eTNFR2\u003c/em\u003e prolonged the survival of tumor-bearing mice and increased the apoptosis of tumor cells in the brain (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-I). Based on the above results, we conclude that astrocytes secreted TNF-α inhibit LLC cell apoptosis through TNFR2 downstream signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.6. Astrocytes inhibit LLC cell apoptosis through TNF-α-TNFR2-NF-κB signaling pathway\u003c/h2\u003e\u003cp\u003eWe further explored the mechanism by which astrocytes inhibit LLC cell apoptosis following TNF-α-TNFR2 interaction. Some studies have shown that TNFR2 promotes cell survival by activating the NF-κB signaling pathway [37]. Therefore, to investigate whether astrocyte regulate LLC cell apoptosis through the NF-κB signaling pathway, we detected the activation of the NF-κB signaling pathway in LLC cells treated with AS-CM using Western blotting. The results showed that the phosphorylation level of NF-κB p65 in LLC cells treated with AS-CM was significantly increased, indicating the activation of this signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B). Additionally, to confirm whether astrocytes activate the NF-κB signaling pathway in LLC cells by producing TNF-α, we treated LLC cells with AS-CM in the presence of TNF-α neutralizing antibody or control IgG and detected the activation of the NF-κB signaling pathway. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-D, the activation of the NF-κB signaling pathway in LLC cells caused by AS-CM could be blocked by TNF-α neutralizing antibody. To further verify whether astrocytes activate the NF-κB signaling pathway through TNFR2, the activation of the NF-κB signaling pathway in \u003cem\u003eTNFR2\u003c/em\u003e knocking down LLC cells was detected. The results showed that the activation of the NF-κB signaling pathway in LLC cells caused by AS-CM was significantly inhibited after \u003cem\u003eTNFR2\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-F). Finally, to verify whether astrocytes affect the apoptosis of LLC cells through the NF-κB signaling pathway, we treated LLC cells with AS-CM in the presence or absence of NF-κB inhibitor JSH-23 and detected the apoptosis of LLC cells using flow cytometry. We found that the JSH-23 treatment blocked the inhibitory effect of AS-CM on LLC cell apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-H). In conclusion, astrocytes inhibit LLC cell apoptosis through TNF-α-TNFR2-NF-κB signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe regulation of tumor metastasis by the tumor microenvironment has been demonstrated. For instance, studies have found that inflammatory immune cells in the tumor microenvironment can induce cancer cells to undergo EMT and acquire a migratory phenotype by producing cytokines [46, 47]; cells in the microenvironment can produce proteases to break down the basement membrane to support vascular co-option [48]; and cytokines secreted by innate immune cells can induce the expression of vascular endothelial cell adhesion molecules (CAM), promoting the occurrence and development of tumor in the microenvironment [49-51]; chemokines produced by endothelial cells and macrophages can mediate the migration of tumor cells through the chemokine receptor CXCR4 [52]. The complexity of the brain\u0026apos;s composition makes the regulatory mechanism of brain metastasis even more enigmatic. As the most widely distributed type of glial cells in the brain, astrocytes have received some attention for their role in brain metastasis. Publications show that astrocytes produce IL-6 and TGF-\u0026beta; to promote the growth of breast cancer cells [29]; astrocytes can also secrete brain-derived neurotrophic factor (BDNF) to stimulate the proliferation of tumor cells [53]; during the brain colonization of melanoma, astrocytes can stimulate and produce more heparanase, thereby promoting melanoma colonization [31, 54]; Qing Chen et al.\u0026apos;s research shows that lung cancer cells establish gap junctions with astrocytes through protocadherin 7, allowing the second messenger cGAMP to transfer from tumor cells to astrocytes, thereby activating the STING pathway and promoting astrocytes to secrete inflammatory cytokines, supporting tumor growth [55]. On the contrary, some other studies indicate that astrocytes have opposite roles in brain metastasis: reactive astrocytes produce Serpins to resist tumor cells from entering the brain, while brain metastatic cancer cells can counter this defense, allowing tumor cells to pass through the blood-brain barrier and enter the brain [25]; astrocytes kill infiltrating tumor cells by secreting Fas ligand [26]; they can also cause tumor cell death by producing nitric oxide, thereby limiting the metastasis of adjacent tumor cells [30]. The above studies have clearly expounded the role of astrocytes in the process of tumor cells invading the brain, but there is a lack of in-depth research on whether astrocytes can constitute the tumor microenvironment of brain metastasis and regulate tumor development after metastatic tumor cells colonization. Therefore, our current study investigates the influence and mechanism of astrocytes on tumor development after brain metastasis is established.\u003c/p\u003e\n\u003cp\u003eFirstly, we found that astrocytes were present in the tumor microenvironment of clinical patients and our post-colonization lung cancer brain metastasis animal model. Next, we utilized an \u003cem\u003ein vitro.\u003c/em\u003e co-culture system and discovered that astrocytes and their conditioned medium could enhance the viability of lung cancer cells, but did not promote cell proliferation. This finding is inconsistent with previous reports that co-culture of astrocytes and lung cancer cells upregulated survival genes in cancer cells [56], which might be due to differences in experimental conditions. We therefore hypothesized that astrocytes might affect the viability of lung cancer cells by influencing their apoptosis. We confirmed this by immunofluorescence staining of the apoptosis marker cleaved caspase 3 and flow cytometry analysis, which showed that the conditioned medium of astrocytes could inhibit the apoptosis of lung cancer cells, suggesting that astrocytes regulate the apoptosis of lung cancer cells through their secreted factors. We then compared the gene expression levels of certain cytokines in TAAs and primary astrocytes and found that only TNF-\u0026alpha; was significantly upregulated in TAAs. Studies have reported that TNF-\u0026alpha; can inhibit the apoptosis of certain tumor cells, and our previous research also found that astrocytes could promote the development of medulloblastoma by secreting TNF-\u0026alpha; [19]. Therefore, we raised the scientific question: Can astrocytes in the tumor microenvironment of lung cancer brain metastasis affect tumor cell apoptosis and tumor development by secreting TNF-\u0026alpha;? To answer this question, we conducted a series of experiments, and the results indicated that astrocytes in the tumor microenvironment of lung cancer brain metastasis upregulated the expression of TNF-\u0026alpha;, and exogenous recombinant TNF-\u0026alpha; inhibited the apoptosis of lung cancer cells; the effect of astrocyte-conditioned medium on the apoptosis of lung cancer cells was blocked by TNF-\u0026alpha; neutralizing antibody. These results suggest that astrocytes inhibit the apoptosis of lung cancer cells by secreting TNF-\u0026alpha;. Definitely, we cannot rule out the possibility that TNF-\u0026alpha; derives from other cells, such as microglia in the tumor microenvironment \u003cem\u003ein vivo.,\u003c/em\u003e Additionally, our study cannot either exclude the influence of other cells in the brain metastasis tumor microenvironment, as there are reports showing that other cells, such as neurons [57, 58], macrophages/microglia [59, 60], and T cells [61, 62], are also involved in the regulation of brain metastasis. \u0026nbsp;Moreover, astrocytes may also indirectly affect brain metastasis by interacting with these cells.\u003c/p\u003e\n\u003cp\u003eNext, we further explored the downstream mechanism by which astrocytes derived TNF-\u0026alpha; regulates lung cancer cell apoptosis. TNF-\u0026alpha; exert opposite effects by combining two different receptors: TNFR1 mainly acts to activate the apoptotic signaling pathway. While TNFR2 mainly activates the cell survival signaling pathway [35]. We knocked down \u003cem\u003eTNFR2\u003c/em\u003e in lung cancer cells and found that the inhibitory effect of astrocyte-conditioned medium on cancer cell apoptosis was weakened. Through \u003cem\u003ein vivo.\u003c/em\u003e experiments, we proved that knocking down \u003cem\u003eTNFR2\u003c/em\u003e prolonged the survival of mice bearing lung cancer brain metastasis and increased the apoptosis of lung cancer cells in the brain. Some studies have shown that TNFR2 affects TNF-\u0026alpha;-mediated cell apoptosis by activating the NF-\u0026kappa;B signaling pathway [38]. Through experiments, we found that the treatment with astrocyte-conditioned medium increased the phosphorylation level of NF-\u0026kappa;B p65 in lung cancer cells, and the TNF-\u0026alpha; neutralizing antibody could block the activation of this signaling pathway. Similarly, after knocking down \u003cem\u003eTNFR2\u003c/em\u003e, the activation of the NF-\u0026kappa;B signaling pathway was significantly inhibited. Additionally, the NF-\u0026kappa;B signaling pathway inhibitor, JSH-23, can block the effect of the astrocyte-conditioned medium in inhibiting lung cancer cell apoptosis. Due to the inability of JSH-23 to cross the blood-brain barrier, we did not detect the effect of JSH-23 treatment on tumor progression in the lung cancer brain metastasis mouse model.\u003c/p\u003e\n\u003cp\u003eIn conclusion, our study has shown that the tumor microenvironment of lung cancer brain metastasis contains astrocytes, and astrocytes inhibit tumor cell apoptosis; the TNF-\u0026alpha; produced by astrocytes regulates tumor cell apoptosis through the TNFR2-NF-\u0026kappa;B signaling pathway. Our research provides a new clue from the perspective of the tumor microenvironment on the development of brain metastases, and is helpful for finding new targets to inhibit the occurrence and development of brain metastasis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAPC, allophycocyanin; AS-CM, astrocyte-conditioned medium; CC3, cleaved caspase 3; cIAP, cellular inhibitor of apoptosis; Ctrl-CM, control conditioned medium; DMEM, Dulbecco's modified eagle medium; DMSO, dimethyl sulfoxide; EdU, 5-ethynyl-2'-deoxyuridine; EMT, epithelial-mesenchymal transition; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFAP, glial fibrillary acid protein; IgG, immunoglobulin G; IL, interleukin; NF-κB, nuclear factor-kappa B; PFA, polyformaldehyde; PBS, phosphate buffered saline; PI, propidium iodide, qPCR, real-time quantitative polymerase chain reaction; RIPA, radio immunoprecipitation assay; shRNA, short hairpin RNA; S100β, S100 calcium-binding protein β; TME, tumor microenvironment; TNF-α, tumor necrosis factor-α; TNFR2, \u0026nbsp;tumor necrosis factor receptor 2.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShuo Zhang:\u0026nbsp;\u003c/strong\u003eMethodology, Investigation, Data curation, Project administration, Visualization, Writing – original draft. \u003cstrong\u003eJinjin Cai:\u003c/strong\u003e Methodology, Investigation, Visualization, Data curation. \u003cstrong\u003eYingying Feng:\u003c/strong\u003e Methodology, Investigation, Data curation. \u003cstrong\u003eMan Yang:\u003c/strong\u003e Methodology, Investigation, Data curation. \u003cstrong\u003eYuhang Li:\u003c/strong\u003e Methodology, Investigation.\u0026nbsp;\u003cstrong\u003eYanghui Qu:\u003c/strong\u003e Methodology. \u003cstrong\u003eLi Zhang:\u003c/strong\u003e Conceptualization, Funding acquisition, Methodology, Formal analysis, Writing – review \u0026amp; editing. \u003cstrong\u003eChaonan Zheng:\u003c/strong\u003e Conceptualization, Methodology, Formal analysis, Writing – review \u0026amp; editing. \u003cstrong\u003eYuan Wang:\u0026nbsp;\u003c/strong\u003eConceptualization, Funding acquisition, Formal analysis, Data curation, Project administration, Writing – original draft, Writing – review \u0026amp; editing, Validation, Supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll usage of patient pathological sections and animal experiments were approved by and conducted in accordance with the Ethical and Welfare Committee of Soochow University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by National Natural Science Foundation of China (82373900 and 82073873 to Yuan Wang, 82072798 to Li Zhang), and the Priority Academic Program Development of the Jiangsu Higher Education Institutes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by National Natural Science Foundation of China (82373900 and 82073873 to Yuan Wang, 82072798 to Li Zhang), and the Priority Academic Program Development of the Jiangsu Higher Education Institutes.\u003c/p\u003e\n\u003cp\u003eWe would like to thank Prof. Xue-chu Zhen at Jiangsu Key Laboratory of Neuropsychiatric Diseases and Department of Pharmacology, College of Pharmaceutical Sciences, Soochow University for supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAchrol, A.S., et al., Brain metastases. Nat Rev Dis Primers, 2019. \u003cstrong\u003e5\u003c/strong\u003e(1): p. 5.\u003c/li\u003e\n \u003cli\u003eLauko, A., Y. Rauf, and M.S. Ahluwalia, Medical management of brain metastases. Neurooncol Adv, 2020. \u003cstrong\u003e2\u003c/strong\u003e(1): p. vdaa015.\u003c/li\u003e\n \u003cli\u003eGomez, D., et al., Incidence of brain metastasis according to patient race and primary cancer origin: a systematic review. J Neurooncol, 2024. \u003cstrong\u003e169\u003c/strong\u003e(3): p. 457-467.\u003c/li\u003e\n \u003cli\u003eNayak, L., E.Q. Lee, and P.Y. Wen, Epidemiology of brain metastases. Curr Oncol Rep, 2012. \u003cstrong\u003e14\u003c/strong\u003e(1): p. 48-54.\u003c/li\u003e\n \u003cli\u003eSiegel, R., et al., Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin, 2011. \u003cstrong\u003e61\u003c/strong\u003e(4): p. 212-36.\u003c/li\u003e\n \u003cli\u003eSul, J. and J.B. Posner, Brain metastases: epidemiology and pathophysiology. Cancer Treat Res, 2007. \u003cstrong\u003e136\u003c/strong\u003e: p. 1-21.\u003c/li\u003e\n \u003cli\u003eMujoomdar, A., et al., Clinical predictors of metastatic disease to the brain from non-small cell lung carcinoma: primary tumor size, cell type, and lymph node metastases. Radiology, 2007. \u003cstrong\u003e242\u003c/strong\u003e(3): p. 882-8.\u003c/li\u003e\n \u003cli\u003eSouza, V.G.P., et al., Advances in the Molecular Landscape of Lung Cancer Brain Metastasis. Cancers (Basel), 2023. \u003cstrong\u003e15\u003c/strong\u003e(3).\u003c/li\u003e\n \u003cli\u003eSrinivasan, E.S., et al., The microenvironment of brain metastases from solid tumors. Neurooncol Adv, 2021. \u003cstrong\u003e3\u003c/strong\u003e(Suppl 5): p. v121-v132.\u003c/li\u003e\n \u003cli\u003eMassague, J. and A.C. Obenauf, Metastatic colonization by circulating tumour cells. Nature, 2016. \u003cstrong\u003e529\u003c/strong\u003e(7586): p. 298-306.\u003c/li\u003e\n \u003cli\u003eFidler, I.J., et al., The seed and soil hypothesis: vascularisation and brain metastases. Lancet Oncol, 2002. \u003cstrong\u003e3\u003c/strong\u003e(1): p. 53-7.\u003c/li\u003e\n \u003cli\u003eValiente, M., et al., The Evolving Landscape of Brain Metastasis. Trends Cancer, 2018. \u003cstrong\u003e4\u003c/strong\u003e(3): p. 176-196.\u003c/li\u003e\n \u003cli\u003eGhandour, M.S., et al., A biochemical and immunohistological study of S100 protein in developing rat cerebellum. Dev Neurosci, 1981. \u003cstrong\u003e4\u003c/strong\u003e(2): p. 98-109.\u003c/li\u003e\n \u003cli\u003eHol, E.M. and M. Pekny, Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system. Curr Opin Cell Biol, 2015. \u003cstrong\u003e32\u003c/strong\u003e: p. 121-30.\u003c/li\u003e\n \u003cli\u003eMyer, D.J., et al., Essential protective roles of reactive astrocytes in traumatic brain injury. Brain, 2006. \u003cstrong\u003e129\u003c/strong\u003e(Pt 10): p. 2761-72.\u003c/li\u003e\n \u003cli\u003eBarres, B.A., The mystery and magic of glia: a perspective on their roles in health and disease. Neuron, 2008. \u003cstrong\u003e60\u003c/strong\u003e(3): p. 430-40.\u003c/li\u003e\n \u003cli\u003eNedergaard, M., B. Ransom, and S.A. Goldman, New roles for astrocytes: redefining the functional architecture of the brain. Trends Neurosci, 2003. \u003cstrong\u003e26\u003c/strong\u003e(10): p. 523-30.\u003c/li\u003e\n \u003cli\u003eLiu, Y., et al., Astrocytes Promote Medulloblastoma Progression through Hedgehog Secretion. Cancer Res, 2017. \u003cstrong\u003e77\u003c/strong\u003e(23): p. 6692-6703.\u003c/li\u003e\n \u003cli\u003eGong, B., et al., Complement C3a activates astrocytes to promote medulloblastoma progression through TNF-alpha. J Neuroinflammation, 2022. \u003cstrong\u003e19\u003c/strong\u003e(1): p. 159.\u003c/li\u003e\n \u003cli\u003eZhang, M. and Y. Olsson, Reactions of astrocytes and microglial cells around hematogenous metastases of the human brain. Expression of endothelin-like immunoreactivity in reactive astrocytes and activation of microglial cells. J Neurol Sci, 1995. \u003cstrong\u003e134\u003c/strong\u003e(1-2): p. 26-32.\u003c/li\u003e\n \u003cli\u003eZhang, M. and Y. Olsson, Hematogenous metastases of the human brain--characteristics of peritumoral brain changes: a review. J Neurooncol, 1997. \u003cstrong\u003e35\u003c/strong\u003e(1): p. 81-9.\u003c/li\u003e\n \u003cli\u003eSeike, T., et al., Interaction between lung cancer cells and astrocytes via specific inflammatory cytokines in the microenvironment of brain metastasis. Clin Exp Metastasis, 2011. \u003cstrong\u003e28\u003c/strong\u003e(1): p. 13-25.\u003c/li\u003e\n \u003cli\u003eFitzgerald, D.P., et al., Reactive glia are recruited by highly proliferative brain metastases of breast cancer and promote tumor cell colonization. Clin Exp Metastasis, 2008. \u003cstrong\u003e25\u003c/strong\u003e(7): p. 799-810.\u003c/li\u003e\n \u003cli\u003eLorger, M. and B. Felding-Habermann, Capturing changes in the brain microenvironment during initial steps of breast cancer brain metastasis. Am J Pathol, 2010. \u003cstrong\u003e176\u003c/strong\u003e(6): p. 2958-71.\u003c/li\u003e\n \u003cli\u003eValiente, M., et al., Serpins promote cancer cell survival and vascular co-option in brain metastasis. Cell, 2014. \u003cstrong\u003e156\u003c/strong\u003e(5): p. 1002-16.\u003c/li\u003e\n \u003cli\u003eWang, X., et al., Astrocytic Fas ligand expression is required to induce T-cell apoptosis and recovery from experimental autoimmune encephalomyelitis. Eur J Immunol, 2013. \u003cstrong\u003e43\u003c/strong\u003e(1): p. 115-24.\u003c/li\u003e\n \u003cli\u003eObenauf, A.C., et al., Therapy-induced tumour secretomes promote resistance and tumour progression. Nature, 2015. \u003cstrong\u003e520\u003c/strong\u003e(7547): p. 368-72.\u003c/li\u003e\n \u003cli\u003eDavid, C.J., et al., TGF-beta Tumor Suppression through a Lethal EMT. Cell, 2016. \u003cstrong\u003e164\u003c/strong\u003e(5): p. 1015-30.\u003c/li\u003e\n \u003cli\u003eSierra, A., et al., Astrocyte-derived cytokines contribute to the metastatic brain specificity of breast cancer cells. Lab Invest, 1997. \u003cstrong\u003e77\u003c/strong\u003e(4): p. 357-68.\u003c/li\u003e\n \u003cli\u003ePlacone, A.L., A. Quinones-Hinojosa, and P.C. Searson, The role of astrocytes in the progression of brain cancer: complicating the picture of the tumor microenvironment. Tumour Biol, 2016. \u003cstrong\u003e37\u003c/strong\u003e(1): p. 61-9.\u003c/li\u003e\n \u003cli\u003eMarchetti, D., et al., Brain-metastatic melanoma: a neurotrophic perspective. Pathol Oncol Res, 2003. \u003cstrong\u003e9\u003c/strong\u003e(3): p. 147-58.\u003c/li\u003e\n \u003cli\u003eJandial, R., et al., Astrocyte-induced Reelin expression drives proliferation of Her2(+) breast cancer metastases. Clin Exp Metastasis, 2017. \u003cstrong\u003e34\u003c/strong\u003e(2): p. 185-196.\u003c/li\u003e\n \u003cli\u003eXing, F., et al., Activation of the c-Met Pathway Mobilizes an Inflammatory Network in the Brain Microenvironment to Promote Brain Metastasis of Breast Cancer. Cancer Res, 2016. \u003cstrong\u003e76\u003c/strong\u003e(17): p. 4970-80.\u003c/li\u003e\n \u003cli\u003eXing, F., et al., Reactive astrocytes promote the metastatic growth of breast cancer stem-like cells by activating Notch signalling in brain. EMBO Mol Med, 2013. \u003cstrong\u003e5\u003c/strong\u003e(3): p. 384-96.\u003c/li\u003e\n \u003cli\u003eSasi, S.P., et al., Breaking the \u0026apos;harmony\u0026apos; of TNF-alpha signaling for cancer treatment. Oncogene, 2012. \u003cstrong\u003e31\u003c/strong\u003e(37): p. 4117-27.\u003c/li\u003e\n \u003cli\u003eAggarwal, B.B., S.C. Gupta, and J.H. Kim, Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood, 2012. \u003cstrong\u003e119\u003c/strong\u003e(3): p. 651-65.\u003c/li\u003e\n \u003cli\u003eLiu, Z.G., et al., Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell, 1996. \u003cstrong\u003e87\u003c/strong\u003e(3): p. 565-76.\u003c/li\u003e\n \u003cli\u003eTartaglia, L.A., et al., A novel domain within the 55 kd TNF receptor signals cell death. Cell, 1993. \u003cstrong\u003e74\u003c/strong\u003e(5): p. 845-53.\u003c/li\u003e\n \u003cli\u003eHsu, H., et al., TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell, 1996. \u003cstrong\u003e84\u003c/strong\u003e(2): p. 299-308.\u003c/li\u003e\n \u003cli\u003eHsu, H., J. Xiong, and D.V. Goeddel, The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell, 1995. \u003cstrong\u003e81\u003c/strong\u003e(4): p. 495-504.\u003c/li\u003e\n \u003cli\u003eNaude, P.J., et al., Tumor necrosis factor receptor cross-talk. FEBS J, 2011. \u003cstrong\u003e278\u003c/strong\u003e(6): p. 888-98.\u003c/li\u003e\n \u003cli\u003eRothe, M., et al., TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science, 1995. \u003cstrong\u003e269\u003c/strong\u003e(5229): p. 1424-7.\u003c/li\u003e\n \u003cli\u003eRothe, M., et al., A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell, 1994. \u003cstrong\u003e78\u003c/strong\u003e(4): p. 681-92.\u003c/li\u003e\n \u003cli\u003eGehr, G., et al., Both tumor necrosis factor receptor types mediate proliferative signals in human mononuclear cell activation. J Immunol, 1992. \u003cstrong\u003e149\u003c/strong\u003e(3): p. 911-7.\u003c/li\u003e\n \u003cli\u003eYoo, J.Y., et al., E-cadherin as a predictive marker of brain metastasis in non-small-cell lung cancer, and its regulation by pioglitazone in a preclinical model. J Neurooncol, 2012. \u003cstrong\u003e109\u003c/strong\u003e(2): p. 219-27.\u003c/li\u003e\n \u003cli\u003eFuxe, J. and M.C. Karlsson, TGF-beta-induced epithelial-mesenchymal transition: a link between cancer and inflammation. Semin Cancer Biol, 2012. \u003cstrong\u003e22\u003c/strong\u003e(5-6): p. 455-61.\u003c/li\u003e\n \u003cli\u003eRen, G., et al., CCR2-dependent recruitment of macrophages by tumor-educated mesenchymal stromal cells promotes tumor development and is mimicked by TNFalpha. Cell Stem Cell, 2012. \u003cstrong\u003e11\u003c/strong\u003e(6): p. 812-24.\u003c/li\u003e\n \u003cli\u003eVasiljeva, O., et al., Tumor cell-derived and macrophage-derived cathepsin B promotes progression and lung metastasis of mammary cancer. Cancer Res, 2006. \u003cstrong\u003e66\u003c/strong\u003e(10): p. 5242-50.\u003c/li\u003e\n \u003cli\u003eWu, T.C., The role of vascular cell adhesion molecule-1 in tumor immune evasion. Cancer Res, 2007. \u003cstrong\u003e67\u003c/strong\u003e(13): p. 6003-6.\u003c/li\u003e\n \u003cli\u003eKhatib, A.M., et al., Characterization of the host proinflammatory response to tumor cells during the initial stages of liver metastasis. Am J Pathol, 2005. \u003cstrong\u003e167\u003c/strong\u003e(3): p. 749-59.\u003c/li\u003e\n \u003cli\u003eOkahara, H., et al., Involvement of very late activation antigen 4 (VLA-4) and vascular cell adhesion molecule 1 (VCAM-1) in tumor necrosis factor alpha enhancement of experimental metastasis. Cancer Res, 1994. \u003cstrong\u003e54\u003c/strong\u003e(12): p. 3233-6.\u003c/li\u003e\n \u003cli\u003eDragoj, M., et al., Targeting CXCR4 and FAK reverses doxorubicin resistance and suppresses invasion in non-small cell lung carcinoma. Cell Oncol (Dordr), 2017. \u003cstrong\u003e40\u003c/strong\u003e(1): p. 47-62.\u003c/li\u003e\n \u003cli\u003eChoy, C., et al., Cooperation of neurotrophin receptor TrkB and Her2 in breast cancer cells facilitates brain metastases. Breast Cancer Res, 2017. \u003cstrong\u003e19\u003c/strong\u003e(1): p. 51.\u003c/li\u003e\n \u003cli\u003eDenkins, Y., et al., Brain metastases in melanoma: roles of neurotrophins. Neuro Oncol, 2004. \u003cstrong\u003e6\u003c/strong\u003e(2): p. 154-65.\u003c/li\u003e\n \u003cli\u003eChen, Q., et al., Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer. Nature, 2016. \u003cstrong\u003e533\u003c/strong\u003e(7604): p. 493-498.\u003c/li\u003e\n \u003cli\u003eGanesh, B.S. and S.K. Chintala, Inhibition of reactive gliosis attenuates excitotoxicity-mediated death of retinal ganglion cells. PLoS One, 2011. \u003cstrong\u003e6\u003c/strong\u003e(3): p. e18305.\u003c/li\u003e\n \u003cli\u003eMancusi, R. and M. Monje, The neuroscience of cancer. Nature, 2023. \u003cstrong\u003e618\u003c/strong\u003e(7965): p. 467-479.\u003c/li\u003e\n \u003cli\u003eZeng, Q., et al., Synaptic proximity enables NMDAR signalling to promote brain metastasis. Nature, 2019. \u003cstrong\u003e573\u003c/strong\u003e(7775): p. 526-531.\u003c/li\u003e\n \u003cli\u003eda Fonseca, A.C., et al., The impact of microglial activation on blood-brain barrier in brain diseases. Front Cell Neurosci, 2014. \u003cstrong\u003e8\u003c/strong\u003e: p. 362.\u003c/li\u003e\n \u003cli\u003eSeano, G., et al., Solid stress in brain tumours causes neuronal loss and neurological dysfunction and can be reversed by lithium. Nat Biomed Eng, 2019. \u003cstrong\u003e3\u003c/strong\u003e(3): p. 230-245.\u003c/li\u003e\n \u003cli\u003eBerghoff, A.S., et al., Density of tumor-infiltrating lymphocytes correlates with extent of brain edema and overall survival time in patients with brain metastases. Oncoimmunology, 2016. \u003cstrong\u003e5\u003c/strong\u003e(1): p. e1057388.\u003c/li\u003e\n \u003cli\u003eSevenich, L., et al., Analysis of tumour- and stroma-supplied proteolytic networks reveals a brain-metastasis-promoting role for cathepsin S. Nat Cell Biol, 2014. \u003cstrong\u003e16\u003c/strong\u003e(9): p. 876-88.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Astrocyte, Lung cancer brain metastasis, Apoptosis, TNF-α, NF-κB signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-7234065/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7234065/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLung cancer is the most common cause of death among all human cancers with up to 50% of the cancers eventually developing into brain metastasis. The treatment methods of brain metastasis are very limited and the prognosis is poor. Studies have shown that the invasion of tumor cells into brain is related to the local activation of astrocytes, and these tumor-associated astrocytes (TAAs) exert either promoting or resisting effects during this process. However, whether astrocytes play a role after tumor cell colonization remains obscure. In the current study, by using of the lung cancer brain metastasis murine model and \u003cem\u003ein vitro.\u003c/em\u003e co-culture system, we found the existence of astrocytes in the tumor microenvironment of both clinical patient and murine model with lung cancer brain metastasis. And in the \u003cem\u003ein vitro.\u003c/em\u003e co-culture system, astrocytes promoted the survival but not the proliferation of tumor cells through inhibiting their apoptosis. The mechanistic study showed that astrocytes inhibit the apoptosis of tumor cells by secreting TNF-α, and the NF-κB signaling pathway in tumor cells was activated. Knocking down TNF receptor 2 (\u003cem\u003eTNFR2\u003c/em\u003e) gene on tumor cells, as well as the inhibitor of NF-κB pathway counteracted the effect of astrocytes. Further, knockdown of \u003cem\u003eTNFR2\u003c/em\u003e increased the intracranial apoptosis of tumor cells and prolonged the survival of mice in lung cancer brain metastasis model. In conclusion, our research indicates that TAAs in lung cancer brain metastasis inhibit the apoptosis of tumor cells by secreting TNF-α dependent on TNFR2-NF-κB signaling pathway.\u003c/p\u003e","manuscriptTitle":"Tumor-associated astrocytes inhibit tumor cell apoptosis through TNF- α-TNF receptor 2-NF-κB pathway in lung cancer brain metastasis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-01 11:02:09","doi":"10.21203/rs.3.rs-7234065/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e403f683-f51b-4e12-b63d-06229935768a","owner":[],"postedDate":"August 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-15T12:23:12+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-01 11:02:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7234065","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7234065","identity":"rs-7234065","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.