Molecular Identification of Cassava Arthropod Pest Complex in the Philippines

Molecular Identification of Cassava Arthropod Pest Complex in the Philippines | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Identification of Cassava Arthropod Pest Complex in the Philippines Michelle Solleza Guerrero, Janice F. Laquinta, Karen P. Ardez, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3327078/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 5 You are reading this latest preprint version Abstract Cassava productivity is severely affected by arthropod pests, which cause damage through feeding and vector transmission. The complex nature of these pests, with morphologically similar species and small sizes, presents challenges in accurately identifying and implementing effective control measures. Accurate identification of arthropod pests infesting cassava in the field is crucial for successful pest management and mitigating the risk of introducing exotic pests through cassava trade and changing climate conditions. Thus, we employed DNA barcoding to generate genetic barcodes of the cassava arthropod pest complex found in major cassava growing areas in the Philippines. Identification to species level was achieved using molecular works with prior morphological identification. Molecular identification offers accurate species resolution of the cassava pest complex even at immature stages, typically hard to identify. cassava arthropod pests DNA barcoding genetic diversity molecular identification Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Cassava ( Manihot esculenta ) is a significant food crop in many parts of the world, particularly in Africa, Asia, and Latin America. Southeast Asia's export market of starch, chips, and other cassava-derived products was valued at $ US 5 billion (Curran & Cooke, 2008 ). It is a significant root crop, bioenergy and industrial crop in developing countries. The Cassava pest complex in SE Asia includes native and non-native species and new and old-time invaders, and some species have coevolved with cassava in native South America. In contrast, others are generalist herbivores that have gradually adapted to the crop (Chaya et al., 2021). Mealybugs (Hemiptera: Pseudococcidae) are soft-bodied sap-feeding insects, with eight species relevant to Southeast Asia. One of which is the cassava mealybug Paracoccus manihoti which is part of the cassava arthropod complex that has rapidly spread into Laos, Vietnam, Cambodia, Malaysia and Indonesia, facilitated by highly suitable local climates in the recent years (Chaya et al., 2021). Paracoccus marginatus Williams and Granara de Willink, or papaya mealybug, is another mealybug that is part of the arthropod pest complex pf cassava and was first reported from Asia in 2008, with records from Indonesia and India, and more recently was detected in Cambodia, Thailand and the Philippines. Mites are among the significant pest of cassava in Southeast Asia, with approximately 50 species of mites that feed on cassava worldwide, one member of the green mite complex and 12 species of red mites (Acari: Tetranychidae) occur in the Asia region (Curran & Cooke, 2008 ). Red mites can cause yield reductions of up to 50% in Indonesia, with the most widespread species, Tetranychus urticae Koch and T. truncatus Ehara. T. cinnabarinus Boisd and the African red mite Eutetranychus africanus (Tucker) are also reported. Whiteflies (Hemiptera: Aleyrodidae) are a global cassava pest that directly and indirectly damages the plant. It transmits cassava mosaic virus (CMV), which causes yield losses of up to 82% and has been reported from Africa, India and Sri Lanka (Chaya et al., 2021). Recent studies show that cassava production in the Philippines has been increasing (Murayama et al., 2014 ; Soria & Preciados, 2018 ). However, invasive insect pests have resulted in severe losses to cassava in Southeast Asia, including the Philippines (Uke et al., 2021 ; Milenovic et al., 2019 ). Whiteflies of the Bemisia tabaci species complex are economically important pests of cassava in the Philippines (Milenovic et al., 2019 ). These pests cause damage to cassava by feeding on the plant sap, leading to stunted growth, reduced yield, and even death of the plant. In addition, cassava phytoplasma disease (CPD) has been identified as a significant threat to cassava production in the Philippines (Plata et al., 2022 ). The problem of identifying these pests and diseases is that they are small and difficult to detect, especially in the early stages of infestation. These challenges have profound implications for food security and livelihoods in the Philippines. With the implementation of the ASEAN Free Trade Agreement and the World Trade Organization-General Agreement on Tariffs and Trade (WTO-GATT), native pests can potentially be explosive/invasive and reach outbreak levels if not immediately monitored and identified; thus, molecular identification is required, particularly concerning plant quarantine protocols and pest management. Although many cassava pests have been reported in recent reports from the Philippines, the molecular data on these insects is highly scarce and understudied. Here, we address the lack of molecular data through the conduct of molecular techniques, offering reliable identification tool for the cassava pest complex, in addition to classical taxonomic identification. The DNA barcodes of generated, which is already available in GenBank in the study major cassava pests essential for pest identification and management, plant quarantine protocols and sanitary phytosanitary (SPS) operations. MATERIALS AND METHODS Collection of cassava arthropod pests Cassava pests were extensively collected from different geographical regions of major cassava growing sites in the Philippines. Selected regions include Region II (Cagayan Valley), Region IV-A (CALABARZON), Region V (Bicol Region), Region VIII (Eastern Visayas), and Region X (Northern Mindanao). Provinces among the selected regions include Isabela and Quirino from Region II; Laguna from Region IV; Camarines Sur and Masbate from Region V; Samar from Region VIII; Bukidnon and Misamis Oriental from Region X. The collection sites were composed of eight provinces (Supp Fig. 1). Three barangays per province were selected per locality. A total of 33 farms served as collection sites. Cassava leaves, and branches infested with arthropod pests were collected and placed in clean plastic bags. Samples for DNA extraction were placed in a vial containing ethanol. All collections were labelled accordingly, and GPS data were recorded (Supp. Table 1 ). The collected samples were brought to the National Crop Protection Center (NCPC) for processing in the laboratory. Morphological Identification of cassava arthropod pests Specimens were viewed in a stereo microscope (ZEISS Stemi 305, Carl Zeiss Microscopy, LLC) and labelled accordingly. Arthropod pests were identified using basic morphological features and classified broadly as mealybugs, whiteflies, red spider mites, scale insects, and beetles. This broad classification was done as a primary identification, prior to molecular works. Genomic DNA Isolation for Various Arthropod Pests of Cassava Genomic DNA isolation for various arthropod pests including its immature stages was performed utilizing a solution-based Animal and Fungi DNA Preparation Kit (Jena Bioscience), following the manufacturer's protocol with modification. The DNA extraction process involved the utilization of specific methodologies tailored for each arthropod group, which are comprehensively described in Table I. These protocols were designed to efficiently extract high-quality genomic DNA from various arthropod pests, ensuring optimal yield and purity for downstream genetic analyses and research applications. Table 1 The ratio of reagents and enzymes used on genomic DNA isolation for various insects in cassava. Insect (whole or body part for larger insects) Cell Lysis Solution (uL) Proteinase K+ (uL) Protein Precipitation Solution (uL) Absolute Isopropanol (uL) Washing Buffer Solution (uL) DNA Hydration Solution (uL) RNase (uL) Scale insects 50 0.3 30 100 100 20 0.3 Whiteflies 50 0.3 30 100 100 20 0.3 Mealybugs 100 0.6 60 200 200 50 1.0 Mites (pooled 3–5 individuals) 30 0.2 15 70 50 20 0.2 5 3 3 Time of Centrifugation at 15,000xg (min) PCR Amplification for Various Arthropod Pests of Cassava Gene amplification was performed through polymerase chain reaction (PCR) to amplify the target COI gene. The 2xTaq Mastermix (Vivantis) was used with some modifications on the number of reagents and DNA templates used. The volume of reagents used for PCR amplification per insect group is detailed in Table 2 . The DNA template used depends on its integrity, preferably at least 50 ng/uL concentration with a 1.5–2.0 purity index. Genomic DNA with high concentrations were diluted with DNA Hydration Solution from the extraction kit to achieve an approximately 50 ng/uL concentration. The PCR conditions and primers used in amplifying a particular insect group, following the literature, were detailed in Table 3 . Table 2 The ratio of reagents (Vivantis) and enzymes used on COI gene amplification for 25 uL PCR volume. Insect 2xTaq (uL) MgCl2+ (uL) Forward Primer [amount and concentration] (uL; pmol/uL) Reverse Primer [amount and concentration] (uL; pmol/uL) Nuclease-Free Water (uL) Scale insects and mealy bugs 12.5 0.5 1; 50 1; 50 5 Whiteflies 12.5 0.5 2.5; 10 2.5; 10 2 Mites 12.5 0.5 1; 10 1; 10 5 Table 3 PCR conditions and primers used on COI gene amplification for various arthropod pests of cassava Insect Samples Primer Gene Region Sequence Thermal Profile Reference Whitefly Btab-F Cytochrome oxidase I 5’GAGGCTGRAAAATTARAAGTATTTGG 3’ 94°C for 2mins, 35 cycles of 94°C for 30secs, 46°C for 60secs, 72°C for 1min and 72°C for 5mins Shatters et al. , 2009 Btab-R 5'CTTAAATTTACTGCACTTTCTGCCARATTAG3' Mites C1-J-1718 Cytochrome oxidase I 5’ GGAGGATTTGGAAATTGATTAGTTCC 3’ 94°C for 3mins, 35 cycles of 94°C for 1min, 45–51°C for 1 min, 72°C for 1min 30secs and 72°C for 10mins Simon et al ., 1994 COI REVA 5’ GATAAAACGTAATGAAAATGAGCTAC 3’ Gotoh et al. , 2009 Scale insect and Mealybug PcoF1 Cytochrome oxidase I 5’CCTTCAACTAATCATAAAAATATYAG3’ 95°C for 2mins, initial 5 cycles of 94°C for 40secs, 45°C for 40secs, 72°C for 1min & 10secs, 40 cycles of 94°C for 40secs, 51°C for 40secs, 72°C for 1min & 10secs and 72°C for 5mins Park et al. , 2010 LepR1 5’TAAACTTCTGGATGTCCAAAAA3’ Molecular Detection of Cassava Arthropod Pests Using COI mtDNA Gene Markers The amplified gene was detected through gel electrophoresis using 1.0% agarose dissolved in TBE and viewed under the Labnet Enduro Touch gel viewer. The amplified COI region of mites samples collected from Bukidnon, showed the expected molecular size of approximately 900 bp. Among the amplified samples in every local population, a minimum of ten amplicons with good and clear bands were chosen for sequencing. RESULTS Molecular identification of cassava arthropods based on COI mtDNA sequences In the present study, we employed molecular techniques to identify various arthropod pests infesting cassava plants based on their COI mtDNA sequences. A total of seven species of hemipteran insects and two species of spider mites were successfully identified using this approach. To ensure the accuracy of our molecular identification, we performed sequence alignment using the BLASTn tool in GenBank, which allowed us to compare our obtained sequences with those deposited in the database (Altschul et al., 1990 ). The percent identity of the nucleotide sequences ranged from 97–100%, indicating a high level of similarity between our samples and the reference sequences in GenBank. The arthropod pests that were molecularly identified in this study included Aleurodicus disperses, Bemisia tabaci, Ferrisia virgata, Maconellicoccus hirsutus, Paracoccus marginatus, Parasaissetia nigra , and Pseudaulacaspis pentagona . We also identified two species of spider mites, namely Tetranychus cinnabarinus and Tetranychus kanzawai , which are known to infest cassava plants and cause damage by piercing plant cells and sucking out the contents. Table 4 and Fig. 1 summarise the identified arthropod pests and their corresponding COI mtDNA sequences. Table 5 presents the GenBank Accession number of Philippine cassava sequence barcodes generated by this research. Table 4 The molecular identity of cassava arthropod pests using partial sequences of COI mtDNA using COI mtDNA through BLASTn alignment in the Genbank database. Species Identity Common Name Query Cover E-value Percent Homology Reference Sequence Collection Site Aleurodicus dispersus Whitefly 100 0 99 KR063274.1 Camarines Sur, Laguna, Bukidnon, Misamis Oriental Bemisia tabaci Whitefly 100 0 98 KY951451.1 Masbate, Quirino, Camirines Sur Ferrisia virgata Mealy bug 100 0 99 LC273485.1 Laguna, Isabela Maconellicoccus hirsutus Mealy bug 100 0 99 KY373158.1 Isabela,Laguna Paracoccus marginatus Mealy bug 97 0 100 KP692579.1 Camarines Sur, Quirino Pseudaulacaspis pentagona Armored scale insect 95 0 100 HM474345.1 Camarines Sur, Misamis Oriental Parasaissetia nigra Black soft scale 98 0 100 KY933367.1 Camarines Sur Tetranichus cinnabarinus Mites 100 0 99 HM753535.1 Isabela; Bukidnon; Quirino; Cagayan De Oro City; Tetranychus kanzawai Mites 100 0 99 KJ729017.1 Camarines Sur; Laguna Table 5 GenBank accession numbers for deposited COI sequences of identified armoured scale insects in the Philippines. GenBank Accession Number Sample Codes COI phylogenetic ID Location MK213555 T_cinnabarinus_AB2_1_contig Tetranychus cinnabarinus Brgy. Sto. Niño, Manolo Fortich, Bukidnon MK213556 T_cinnabarinus_AB2_2_contig Tetranychus cinnabarinus Brgy. Sto. Niño, Manolo Fortich, Bukidnon MK213557 T_cinnabarinus_ABC4_4_contig Tetranychus cinnabarinus Brgy. Imbatug, Baungon, Bukidnon MK213558 T_cinnabarinus_AC3_1_contig Tetranychus cinnabarinus Brgy. Balubal, Cagayan de Oro City MK213559 T_cinnabarinus_AC3_2_contig Tetranychus cinnabarinus Brgy. Balubal, Cagayan de Oro City MK213560 T_cinnabarinus_AI3_2_contig Tetranychus cinnabarinus Brgy. Rangayan, Ilagan City, Isabela MK213561 T_cinnabarinus_AI3_3_contig Tetranychus cinnabarinus Brgy. Rangayan, Ilagan City, Isabela MK213562 T_cinnabarinus_AMQ2_1_contig Tetranychus cinnabarinus Brgy. Lusod, Mandela, Quirino MK213563 T_cinnabarinus_AMQ2_2_contig Tetranychus cinnabarinus Brgy. Lusod, Mandela, Quirino MK213564 T_cinnabarinus_ANVL_20_contig Tetranychus cinnabarinus UP Los Banos, Laguna MK213565 T_cinnabarinus_AS1_1_contig Tetranychus cinnabarinus Brgy. Imbatug, Baungon, Bukidnon MK213566 T_cinnabarinus_AS1_3_contig Tetranychus cinnabarinus Brgy. Imbatug, Baungon, Bukidnon MK213567 T_cinnabarinus_AS3_4_contig Tetranychus cinnabarinus Brgy Balubal, Cagayan De Oro City MK213568 T_cinnabarinus_BS4_4_contig Tetranychus cinnabarinus Brgy. Tinangis, Pili, Camarines Sur MK213569 T_cinnabarinus_HI6_1_contig Tetranychus cinnabarinus Brgy. Cabugao, Cauayan, Isabela MK213570 T_cinnabarinus_HI6_2_contig Tetranychus cinnabarinus Brgy. Cabugao, Cauayan, Isabela MK213572 A_dispersus_BS_3_3_contig Aleurodicus dispersus Brgy Bagumbayan, Baao, Camarines Sur MK213573 A_dispersus_BS_3_4 Aleurodicus dispersus Brgy Bagumbayan, Baao, Camarines Sur MK213574 A_dispersus_VL_10 Aleurodicus disperseus UP Los Banos, Laguna MK213575 A_dispersus_VS_4 Aleurodicus dispersus UP Los Banos, Laguna MK213576 A_dispersus_VS_5 Aleurodicus dispersus UP Los Banos, Laguna MK213577 A_dispersus_VM_consensus Aleurodicus dispersus UP Los Banos, Laguna MK213578 M_hirsutus_HI_S4_1 Maconellicoccus hirsutus Brgy. Cabugao, Cauayan, Isabela MK213579 M_hirsutus_HI_S4_5 Maconellicoccus hirsutus Brgy. Cabugao, Cauayan, Isabela MK213580 M_hirsutus_HI_S4_6 Maconellicoccus hirsutus Brgy. Cabugao, Cauayan, Isabela MK213581 P_marginatus_BS_4_2 Paracoccus marginatus Brgy. Tinangis, Pili, Camarines Sur MK213582 P_marginatus_BS_4_3 Paracoccus marginatus Brgy. Tinangis, Pili, Camarines Sur MK213583 P_marginatus_BS_4_13 Paracoccus marginatus Brgy. Tinangis, Pili, Camarines Sur Genetic diversity was conducted on field-collected mites, Tetranychus cinnabarinus , using COI gene. Insect species were not analyzed for genetic diversity due to apparent sequence similarity across various sampling sites. Five distinct haplotypes were identified among this species, indicating the presence of polymorphic sequences (Table 5 ). The analysis revealed 32 polymorphic sites, consisting of 24 singleton variable sites and eight parsimony informative sites. This variability in nucleotide positions among the haplotypes suggests more genetic heterogeneity within the T. cinnabarinus population. The nucleotide diversity, denoted as Pi, was calculated to be 0.00892 for the T. cinnabarinus mites. This value represents the average proportion of nucleotide differences between the population's randomly selected sequences. The higher Pi value, in this case, suggests a relatively elevated level of genetic variation within the T. cinnabarinus population. Furthermore, the haplotype diversity (Hd) for the T. cinnabarinus mites was determined to be 0.6364, indicating moderate haplotype diversity within the population. Four distinct haplotypes among the T. cinnabarinus mites contribute to the observed haplotype diversity. Similar to the insects, the mites also exhibited an AT-rich COI region. This observation suggests a common characteristic of an AT-biased composition in the COI region among arthropods. Table 5 Haplotype diversity of field-collected mites, Tetranychus cinnabarinus , using COI gene Sequence Haplotypes Haplotype 1 Haplotype2 Haplotype3 Haplotype4 Location Isabela Quirino Laguna Camarines Sur, Bukidnon, Cagayan de Oro City, Bukidnon Zamboanga City Camarines Sur Number of base differences concerning Haplotype Hap 1 9 8 29 Hap 2 9 1 27 Hap 3 8 1 26 Hap 4 24 27 26 Nucleotide Composition A 280 280 280 283 C 105 108 107 103 G 101 100 100 98 T 360 358 359 362 G + C (%) 24.35 24.59 24.47 23.76 A + T (%) 75.65 75.41 75.53 76.24 Phylogeny of cassava arthropod pest The nucleotide sequences of the cassava pests were aligned, and the consensus sequence was used to construct a phylogenetic tree based on the maximum likelihood algorithm of MEGA 7.0 (Kumar et al., 2016 ). A bootstrap with 1000 iterations was included to test the strength of the clustering obtained. The bootstrap value of 100% for mealybugs ( Pa. marginatus, F. virgata, M. hirsutus ) and scale insect P. pentagona , when aligned with GenBank reference sequences, indicates high confidence for the groupings obtained (Fig. 3 ). Molecular phylogenetic analysis of red spider mites of cassava using COI mtDNA with evolutionary history inferred by using by Maximum Likelihood method based on the Tamura 3-parameter model (Tamura, 1992 ) showed the highest log likelihood of -1564.4083. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA7, with 740 positions in the final dataset. Mite species show higher evolutionary differences between species of the same genera, with T. kanazawai and T. cinnabarinus as the closely related ones (Fig. 4 ). DISCUSSION Cassava pests remain a significant challenge for cassava farmers in Asia because of the pest complex nature of these pests. The availability of molecular identification tools such as DNA Barcoding is increasingly essential to support cassava pest management, leading to reduced cassava pest damage (Bellotti, 2001 ; Chavez et al., 2021 ; Paul et al., 2022 ; Bisimwa et al., 2019 ). The molecular identification of these pests contributes to our understanding of the arthropod community associated with cassava and serves as a valuable resource of molecular data. The results presented in this study underscore the significant role that DNA barcoding plays in the identification of cryptic species and the arthropod pest complex in cassava. DNA barcoding was proven to be a highly effective tool, not only for accurate identification of known pests but also for discovering novel potential pest species. This has implications for the sustainable management of cassava, a vital food, and cash crop for millions of people in tropical and subtropical regions. One key aspect of our research revealed the limitations of the morphological identification of arthropod pests, especially in immature stages (Ratnasingham and Hebert, 2007 ). Conventional identification methods have often proven challenging, especially for cryptic species and larval stages (Hebert et al., 2003 ). Our study showed that integrating DNA barcoding can substantially enhance the resolution and accuracy of pest identification. Accurate species-level identification is still paramount to any pest management strategy, as some treatments, such as biological control, are species-specific. Due to the continuing decline of experts among new insect taxonomists, traditional morphological identification has become challenging (Burger and Ulenberg, 1990 ; Hardy, 2013 ). The arthropod pests that are molecularly identified in this study, Aleurodicus disperses, Bemisia tabaci, Ferrisia virgata, Maconellicoccus hirsutus, Paracoccus marginatus, Parasaissetia nigra , and Pseudaulacaspis pentagona are species known to be economically important pests of cassava, causing significant damage to the crop by feeding on its tissues and transmitting viral diseases. Mealybugs are a leading cassava pest, causing global economic damage to the crop (Jankaew et al., 2019 ; Rauwane et al., 2018 ). Ferrisia virgata, M. hirsutus, Pa. marginatus are problematic to differentiate; hence, DNA barcoding of these species is still essential to correctly identify the pests in the field. Due to the minute nature of spider mites and the lack of experts, identifying mite species using molecular tools is necessary. Two species of spider mites, namely Tetranychus cinnabarinus and Tetranychus kanzawai , were identified. Two species of spider mites, Tetranychus cinnabarinus and Tetranychus kanzawai , were identified as pests that could infest cassava plants and cause damage by piercing plant cells and sucking out the contents (Gotoh and Gomi, 2003 ; Liang et al., 2022 ). Both spider mites are small in size and can be incidentally consumed by voracious lepidopteran larvae, leading them to avoid such intraguild predation that could affect their survival and development (Kinto et al., 2022). Tetranychus kanzawai , in particular, is an important pest that threatens many crops and ornamental plants in Far Eastern areas (Gotoh and Gomi, 2003 ). DNA barcoding has potential implications for pest management and biosecurity. Early detection and identification of invasive species can lead to more effective containment and control strategies (Hajibabaei et al., 2007 ). On a different note, our study did not find the invasive mealybug, Phenacoccus manihoti which could pose more significant loss in cassava farming. This research presents that this invasive mealybug is not present in the Philippines as of this writing. Despite these promising results, there are still challenges to be addressed. These include the need for extensive reference databases, the complexities of genetic variation within species, haplotype diversity results depicting only the population studied, and potential technical errors (Meyer and Paulay, 2005 ). Yet, it is clear that the benefits of DNA barcoding in pest identification and management substantially outweigh the limitations. CONCLUSION Implementing DNA barcoding in accurate species identification of cassava arthropod pest complex presents significant information. By enhancing our ability to accurately identify cassava pests in adult and immature stages and identify the pest complex, we can more effectively protect cassava crops and thus safeguard the livelihoods of farmers who depend on them. Our results demonstrate the effectiveness of using COI mtDNA sequences to identify arthropod pests infesting cassava. This approach provides a rapid and accurate means of species identification, contributing to the accurate pest management of this important crop. Abbreviations mtDNA: Mitochondrial DNA, PCR: Polymerase Chain Reaction, COI: Cytochrome Oxidase I, NCPC: National Crop Protection Center Declarations ACKNOWLEDGMENT We thank the Department of Science and Technology- National Research Council of the Philippines (NRCP) for funding the study. Special thanks to Dr Marieta Bañes Sumagaysay for the financial support to the project; to NRCP staff, especially to Beverly Mae N. de la Cruz, Senior Science Research Specialist, Research Development and Management Division, for accommodating all our inquiries and for the valuable assistance she gave to our team from its proposal until its culmination; To the UPLB Foundation, Inc. headed by Dr Casiano S. Abrigo, Jr. for the administrative services provided to the project; To the personnel of different Regional Crop Protection Centers (RCPCs) and the Department of Agriculture- Regional Field Units (DA-RFOs) for the assistance during the collection trips and capacity building seminars. AUTHOR CONTRIBUTIONS MSG and BFC conceptualized the study. MSG and JFL conducted molecular experiments from DNA extraction to sequence analysis. MSG, JFL, BFC, KPA, and MCdLdR, collected the samples. MSG wrote the original draft of the paper. MSG, JFL, CPK and BFC contributed to the manuscript preparation. FUNDING This study is funded by the Department of Science and Technology- National Research Council of the Philippines (NRCP). AVAILABILITY OF DATA AND MATERIALS This published article and its supplementary information file include all data generated or analyzed during this study. ETHICS APPROVAL AND CONSENT TO PARTICIPATE Not applicable. CONSENT FOR PUBLICATION Not applicable. COMPETING INTERESTS The authors declare that they have no competing interests. References Altschul, S., Gish, W., Miller, W., Myers, E., Lipman, D. (1990). basic local alignment search tool. Journal of Molecular Biology, 3(215), 403-410. https://doi.org/10.1016/s0022-2836(05)80360-2 Bellotti, A., 2001. Arthropod pests. In: Bellotti AC, Smith L, editors. Ecology and management of the cassava mealybug, Phenacoccus manihoti Matile-Ferrero (Homoptera: Pseudococcidae), in Africa. Wallingford: CABI Publishing; 2001. p. 209-235. https://doi.org/10.1079/9780851995243.0209 Bisimwa, E., Birindwa, D., Yomeni, M., Rudahaba, N., Byamungu, K., Bragard, C., 2019. Multiple cassava viruses' co-infections and resurgence of pests are leading to severe symptoms and yield losses on cassava in the South-Kivu Region, Democratic Republic of Congo. AJPS, 11(10), 1969-1988. https://doi.org/10.4236/ajps.2019.1011138 Burger H, Ulenberg S. Quarantine problems and procedures. In: Rosen D, editor. Armoured scale insects: their biology, natural enemies, and control. Amsterdam, The Netherlands: Elsevier; 1990. p. 313–27 Chaya, Tao, Green, Baogen, 2021. Impact of climate change on pests of rice and cassava. CABI Reviews, 2021. https://doi.org/10.1079/pavsnnr202116050 Chavez, V., Coleman, K., Bosch, F., Pita, J., McQuaid, C., 2021. Modelling cassava production and pest management under biotic and abiotic constraints. Plant Mol Biol, 3(109), 325-349. https://doi.org/10.1007/s11103-021-01170-8 Curran, S., Cooke, A., 2008. Unexpected outcomes of Thai cassava trade: A case of global complexity and local unsustainability. Globalizations, 2(5), 111-127. https://doi.org/10.1080/14747730802057449 Gotoh, T., Gomi, K., 2003. Life-history traits of the Kanzawa spider mite Tetranychus kanzawai (Acari: Tetranychidae). Appl. Entomol. Zool., 1(38), 7-14. https://doi.org/10.1303/aez.2003.7 Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., & Hebert, P.D.N., 2007. DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Sciences, 104(4), 968-973 Hardy NB. The status and future of scale insect (Coccoidea) systematics. Vol. 38, Systematic Entomology. 2013 Hebert, P.D.N., Cywinska, A., Ball, S.L., & deWaard, J.R., 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512), 313-321 Jankaew, K., Rattanakul, C., Sarika, W., 2019. A delay differential equation model of mealybugs and green lacewings. Adv Differ Equ, 2019. https://doi.org/10.1186/s13662-019-2226 Kinto, S., Akino, T., Yano, S., 2023. Spider mites avoid caterpillar traces to prevent intraguild predation. Sci Rep, 1(13). https://doi.org/10.1038/s41598-023-28861-0 Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870-1874 Liang, X., Chen, Q., Liu, Y., Wu, C., Li, K., Wu, M., … & Geng, Y., 2022. Identification of cassava germplasms resistant to two-spotted spider mite in China: from greenhouse large-scale screening to field validation. Front. Plant Sci., 2022. https://doi.org/10.3389/fpls.2022.1054909 Meyer, C.P., & Paulay, G., 2005. DNA barcoding: error rates based on comprehensive sampling. PLoS Biology, 3(12), e422. DOI: 10.1371/journal. bio.0030422 Milenovic, M., Wosula, E., Rapisarda, C., Legg, J., 2019. Impact of host plant species and whitefly species on feeding behavior of Bemisia tabaci. Front. Plant Sci., 10. https://doi.org/10.3389/fpls.2019.00001 Murayama, D., Kasano, M., Santiago, D., Yamauchi, H., Koaze, H., 2014. Effect of pre-gelatinization on the physicochemical properties of dry flours produced from 5 cassava varieties of the Philippines. FSTR, 6(20), 1131-1140. https://doi.org/10.3136/fstr.20.1131 Gatesy, J. (2002). molecular evolution and phylogenetics (m. nei and s. kumar). Molecular Phylogenetics and Evolution, 3(25), 567-568. https://doi.org/10.1016/s1055-7903(02)00247-6 Paul, M., Sarina, M., Anton, B., Andrew, K., Fred, T., Donald, K., … & John, C., 2022. Impacts of cassava whitefly pests on the productivity of East and Central African smallholder farmers. J. Dev. Agric. Econ., 3(14), 60-78. https://doi.org/10.5897/jdae2022.1330 Plata, I., Panganiban, E., Alado, D., Taracatac, A., Bartolome, B., Labuanan, F., 2022. Drone-based geographical information system (GIS) mapping of cassava pythoplasma disease (CPD) for precision agriculture. IJETAE, 2(12), 1-9. https://doi.org/10.46338/ijetae0222_01 Rauwane, M., Odeny, D., Millar, I., Rey, M., Rees, J., 2018. The early transcriptome response of cassava (Manihot esculenta Crantz) to mealybug (Phenacoccus manihoti) feeding. PLoS ONE, 8(13), e0202541. https://doi.org/10.1371/journal.pone.0202541 Ratnasingham, S., & Hebert, P.D.N., 2007. BOLD: The Barcode of Life Data System www.barcodinglife.org. Molecular Ecology Notes, 7(3), 355-364. DOI: 10.1111/j.1471-8286.2007.01678.x Soria, R., Preciados, L., 2018. Investigating the determinants of cassava domestic supply in the Philippines. ATR, 90-106. https://doi.org/10.32945/atr4028.2018 Tamura, K. (1992). Estimation Of the Number Of Nucleotide Substitutions When There Are Strong Transition-transversion And G+c-content Biases. https://doi.org/10.1093/oxfordjournals.molbev.a040752 Uke, A., Tokunaga, H., Utsumi, Y., Vu, N., Nhan, P., Srean, P., … & Ugaki, M., 2021. Cassava mosaic disease and its management in Southeast Asia. Plant Mol Biol, 3(109), 301-311. https://doi.org/10.1007/s11103-021-01168-2 Supplementary Files SUPPLEMENTARYFIGURES.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Major revisions 16 Mar, 2025 Reviewers agreed at journal 23 Jan, 2024 Reviewers invited by journal 03 Jan, 2024 Editor assigned by journal 07 Sep, 2023 First submitted to journal 05 Sep, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3327078","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":265174683,"identity":"2b55e891-bb49-4b7b-b69f-fae7e4e5cdff","order_by":0,"name":"Michelle Solleza Guerrero","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYHADxsYHYPoAAwMzkVqYmw1I1cLeJkGUFt3+49ckPu65J2fe3thWzbuDQY7vRgLb4wI8Wsxu5JRJznhWbCxz5mDbbd4zDMaSNxLYjWfg1cKTJs1zICFxhkQiUEsbQ+IGoC3SPPi0nD+TJv3nQEI9SEsxUEs9YS0H0o9JMxxISJAAamEGakkwIKjlRg6zZc+BBMMZPAebJeeekTCceeZhuzF+hx1/eOPHgQR5Cfb2hx/e7rCR5zuefOwxPi0MDDwGCDZjAyhqGNvwagDG4ANkLWCKjYCWUTAKRsEoGGEAAGyWTqacCDqCAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-5198-3049","institution":"University of the Philippines Los Banos","correspondingAuthor":true,"prefix":"","firstName":"Michelle","middleName":"Solleza","lastName":"Guerrero","suffix":""},{"id":265174684,"identity":"25c4589c-c80b-4e5b-8819-16d05d5af8b3","order_by":1,"name":"Janice F. Laquinta","email":"","orcid":"","institution":"Research Institute for Tropical Medicine","correspondingAuthor":false,"prefix":"","firstName":"Janice","middleName":"F.","lastName":"Laquinta","suffix":""},{"id":265174685,"identity":"8ba30970-3f9e-4842-a9ef-ab8be555be94","order_by":2,"name":"Karen P. Ardez","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Karen","middleName":"P.","lastName":"Ardez","suffix":""},{"id":265174686,"identity":"8ae1c3da-1e6f-41b1-9e50-d376c928b41b","order_by":3,"name":"Maureen Ceres dL. de Roxas","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Maureen","middleName":"Ceres dL.","lastName":"de Roxas","suffix":""},{"id":265174687,"identity":"32660101-0e59-4de4-9477-934bb5924e27","order_by":4,"name":"Cloe P. Kahayon","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Cloe","middleName":"P.","lastName":"Kahayon","suffix":""},{"id":265174688,"identity":"9d5d4ceb-4478-4ede-aa3d-0f8c59697b3e","order_by":5,"name":"Bonifacio F. Cayabyab","email":"","orcid":"","institution":"University of the Philippines Los Banos","correspondingAuthor":false,"prefix":"","firstName":"Bonifacio","middleName":"F.","lastName":"Cayabyab","suffix":""}],"badges":[],"createdAt":"2023-09-05 09:40:01","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3327078/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3327078/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49328356,"identity":"d2efcb48-16eb-49bf-b780-6497922e0488","added_by":"auto","created_at":"2024-01-08 18:02:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":418771,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure 2. Identified arthropod pests of cassava amplified through \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCOI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sequences with corresponding percent nucleotide homology in Genbank top BLAST hit: (a) spiralling whitefly, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAleurodicus dispersus \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e99%\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e;\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(b) silverleaf whitefly adult and (c) immature, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBemisia tabaci \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e97%\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e; \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(d) striped mealybug, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFerrisia virgata \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e99%; I pink hibiscus mealybug \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eMaconellicoccus hirsutus \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e99%; (f) papaya mealybug (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eParacoccus marginatus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e 100%; (g) soft scale insect, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSaissetia\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sp. 93%; (h) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePseudaulacaspis pentagona \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e100%; (i) tea red spider mites, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eTetranychus kanzawai\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e 99%; (j) carmine spider mites, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eTetranychus cinnabarinus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e 99%.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3327078/v1/7bddfa643351d0adaf2b9ca7.png"},{"id":49328358,"identity":"b933e1d4-07ba-4197-861a-6bf6c1a770bf","added_by":"auto","created_at":"2024-01-08 18:02:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":181348,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure 3. Using the COI mtDNA gene, molecular phylogenetic analysis was conducted on cassava insect pests. The maximum Likelihood method based on the General Time Reversible model (Hebert et al., 2003) was used for evolutionary inference. The tree with the highest log likelihood (-2238.2177) is shown, indicating the percentage of trees where associated taxa clustered together. The analysis included 26 nucleotide sequences, and gaps and missing data positions were eliminated, resulting in a final dataset of 494 positions. Evolutionary analyses were performed in MEGA7 (Kumar et al., 2016).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3327078/v1/43ebf2e566dc1a1fb09c15b4.png"},{"id":49328357,"identity":"71f9b96f-bd2f-45f8-b67e-e86cd51e3027","added_by":"auto","created_at":"2024-01-08 18:02:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":21344,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure 4. Molecular phylogenetic analysis conducted on cassava red spider mites using COI mtDNA. The maximum Likelihood method based on the Tamura 3-parameter model (Tamura, 1992) was used for evolutionary inference. The analysis involved 26 nucleotide sequences, with a final dataset of 740 positions. Evolutionary analyses were performed in MEGA7 (Kumar et al., 2016), considering rate variation and some evolutionarily invariable sites\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3327078/v1/aab3ea4c22e27ee2b65e90f1.png"},{"id":49328561,"identity":"0290187d-c225-4de5-bf98-ffe65c00c00f","added_by":"auto","created_at":"2024-01-08 18:10:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1560496,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3327078/v1/302b4da7-5afc-437b-83f9-a2c462fbcf75.pdf"},{"id":49328359,"identity":"e8f79898-f9ec-4bd0-bac7-d45270d438f7","added_by":"auto","created_at":"2024-01-08 18:02:52","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":73014,"visible":true,"origin":"","legend":"","description":"","filename":"SUPPLEMENTARYFIGURES.docx","url":"https://assets-eu.researchsquare.com/files/rs-3327078/v1/0ff2aa49d38aa88a011123ce.docx"}],"financialInterests":"","formattedTitle":"Molecular Identification of Cassava Arthropod Pest Complex in the Philippines","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eCassava (\u003cem\u003eManihot esculenta\u003c/em\u003e) is a significant food crop in many parts of the world, particularly in Africa, Asia, and Latin America. Southeast Asia's export market of starch, chips, and other cassava-derived products was valued at \u003cspan\u003e$\u003c/span\u003eUS 5\u0026nbsp;billion (Curran \u0026amp; Cooke, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). It is a significant root crop, bioenergy and industrial crop in developing countries. The Cassava pest complex in SE Asia includes native and non-native species and new and old-time invaders, and some species have coevolved with cassava in native South America. In contrast, others are generalist herbivores that have gradually adapted to the crop (Chaya et al., 2021). Mealybugs (Hemiptera: Pseudococcidae) are soft-bodied sap-feeding insects, with eight species relevant to Southeast Asia. One of which is the cassava mealybug \u003cem\u003eParacoccus manihoti\u003c/em\u003e which is part of the cassava arthropod complex that has rapidly spread into Laos, Vietnam, Cambodia, Malaysia and Indonesia, facilitated by highly suitable local climates in the recent years (Chaya et al., 2021). \u003cem\u003eParacoccus marginatus\u003c/em\u003e Williams and Granara de Willink, or papaya mealybug, is another mealybug that is part of the arthropod pest complex pf cassava and was first reported from Asia in 2008, with records from Indonesia and India, and more recently was detected in Cambodia, Thailand and the Philippines. Mites are among the significant pest of cassava in Southeast Asia, with approximately 50 species of mites that feed on cassava worldwide, one member of the green mite complex and 12 species of red mites (Acari: Tetranychidae) occur in the Asia region (Curran \u0026amp; Cooke, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Red mites can cause yield reductions of up to 50% in Indonesia, with the most widespread species, \u003cem\u003eTetranychus urticae\u003c/em\u003e Koch and \u003cem\u003eT. truncatus\u003c/em\u003e Ehara. \u003cem\u003eT. cinnabarinus\u003c/em\u003e Boisd and the African red mite \u003cem\u003eEutetranychus africanus\u003c/em\u003e (Tucker) are also reported. Whiteflies (Hemiptera: Aleyrodidae) are a global cassava pest that directly and indirectly damages the plant. It transmits cassava mosaic virus (CMV), which causes yield losses of up to 82% and has been reported from Africa, India and Sri Lanka (Chaya et al., 2021).\u003c/p\u003e \u003cp\u003eRecent studies show that cassava production in the Philippines has been increasing (Murayama et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Soria \u0026amp; Preciados, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, invasive insect pests have resulted in severe losses to cassava in Southeast Asia, including the Philippines (Uke et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Milenovic et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Whiteflies of the \u003cem\u003eBemisia tabaci\u003c/em\u003e species complex are economically important pests of cassava in the Philippines (Milenovic et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These pests cause damage to cassava by feeding on the plant sap, leading to stunted growth, reduced yield, and even death of the plant. In addition, cassava phytoplasma disease (CPD) has been identified as a significant threat to cassava production in the Philippines (Plata et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The problem of identifying these pests and diseases is that they are small and difficult to detect, especially in the early stages of infestation. These challenges have profound implications for food security and livelihoods in the Philippines. With the implementation of the ASEAN Free Trade Agreement and the World Trade Organization-General Agreement on Tariffs and Trade (WTO-GATT), native pests can potentially be explosive/invasive and reach outbreak levels if not immediately monitored and identified; thus, molecular identification is required, particularly concerning plant quarantine protocols and pest management. Although many cassava pests have been reported in recent reports from the Philippines, the molecular data on these insects is highly scarce and understudied. Here, we address the lack of molecular data through the conduct of molecular techniques, offering reliable identification tool for the cassava pest complex, in addition to classical taxonomic identification. The DNA barcodes of generated, which is already available in GenBank in the study major cassava pests essential for pest identification and management, plant quarantine protocols and sanitary phytosanitary (SPS) operations.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCollection of cassava arthropod pests\u003c/h2\u003e \u003cp\u003eCassava pests were extensively collected from different geographical regions of major cassava growing sites in the Philippines. Selected regions include Region II (Cagayan Valley), Region IV-A (CALABARZON), Region V (Bicol Region), Region VIII (Eastern Visayas), and Region X (Northern Mindanao). Provinces among the selected regions include Isabela and Quirino from Region II; Laguna from Region IV; Camarines Sur and Masbate from Region V; Samar from Region VIII; Bukidnon and Misamis Oriental from Region X. The collection sites were composed of eight provinces (Supp Fig.\u0026nbsp;1). Three barangays per province were selected per locality. A total of 33 farms served as collection sites. Cassava leaves, and branches infested with arthropod pests were collected and placed in clean plastic bags. Samples for DNA extraction were placed in a vial containing ethanol. All collections were labelled accordingly, and GPS data were recorded (Supp. Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The collected samples were brought to the National Crop Protection Center (NCPC) for processing in the laboratory.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMorphological Identification of cassava arthropod pests\u003c/h2\u003e \u003cp\u003eSpecimens were viewed in a stereo microscope (ZEISS Stemi 305, Carl Zeiss Microscopy, LLC) and labelled accordingly. Arthropod pests were identified using basic morphological features and classified broadly as mealybugs, whiteflies, red spider mites, scale insects, and beetles. This broad classification was done as a primary identification, prior to molecular works.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGenomic DNA Isolation for Various Arthropod Pests of Cassava\u003c/h2\u003e \u003cp\u003eGenomic DNA isolation for various arthropod pests including its immature stages was performed utilizing a solution-based Animal and Fungi DNA Preparation Kit (Jena Bioscience), following the manufacturer's protocol with modification. The DNA extraction process involved the utilization of specific methodologies tailored for each arthropod group, which are comprehensively described in Table I. These protocols were designed to efficiently extract high-quality genomic DNA from various arthropod pests, ensuring optimal yield and purity for downstream genetic analyses and research applications.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe ratio of reagents and enzymes used on genomic DNA isolation for various insects in cassava.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInsect\u003c/p\u003e \u003cp\u003e(whole or body part for larger insects)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Lysis Solution (uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProteinase K+\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProtein Precipitation Solution\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAbsolute Isopropanol\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWashing Buffer Solution\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDNA Hydration Solution\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRNase\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eScale insects\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWhiteflies\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMealybugs\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMites (pooled 3\u0026ndash;5 individuals)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c6\" namest=\"c2\"\u003e \u003cp\u003eTime of Centrifugation at 15,000xg (min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePCR Amplification for Various Arthropod Pests of Cassava\u003c/h2\u003e \u003cp\u003eGene amplification was performed through polymerase chain reaction (PCR) to amplify the target \u003cem\u003eCOI\u003c/em\u003e gene. The 2xTaq Mastermix (Vivantis) was used with some modifications on the number of reagents and DNA templates used. The volume of reagents used for PCR amplification per insect group is detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The DNA template used depends on its integrity, preferably at least 50 ng/uL concentration with a 1.5\u0026ndash;2.0 purity index. Genomic DNA with high concentrations were diluted with DNA Hydration Solution from the extraction kit to achieve an approximately 50 ng/uL concentration. The PCR conditions and primers used in amplifying a particular insect group, following the literature, were detailed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe ratio of reagents (Vivantis) and enzymes used on COI gene amplification for 25 uL PCR volume.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInsect\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2xTaq (uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMgCl2+\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003cp\u003e[amount and concentration]\u003c/p\u003e \u003cp\u003e(uL; pmol/uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003cp\u003e[amount and concentration]\u003c/p\u003e \u003cp\u003e(uL; pmol/uL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNuclease-Free Water\u003c/p\u003e \u003cp\u003e(uL)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eScale insects and mealy bugs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1; 50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1; 50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWhiteflies\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.5; 10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.5; 10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMites\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1; 10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1; 10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR conditions and primers used on COI gene amplification for various arthropod pests of cassava\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInsect Samples\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene Region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eThermal Profile\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eWhitefly\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBtab-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCytochrome oxidase I\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026rsquo;GAGGCTGRAAAATTARAAGTATTTGG 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e94\u0026deg;C for 2mins, 35 cycles of 94\u0026deg;C for 30secs, 46\u0026deg;C for 60secs, 72\u0026deg;C for 1min and 72\u0026deg;C for 5mins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eShatters \u003cem\u003eet al.\u003c/em\u003e, 2009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBtab-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5'CTTAAATTTACTGCACTTTCTGCCARATTAG3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eMites\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC1-J-1718\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCytochrome oxidase I\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026rsquo; GGAGGATTTGGAAATTGATTAGTTCC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e94\u0026deg;C for 3mins, 35 cycles of 94\u0026deg;C for 1min, 45\u0026ndash;51\u0026deg;C for 1 min, 72\u0026deg;C for 1min 30secs and 72\u0026deg;C for 10mins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSimon \u003cem\u003eet al\u003c/em\u003e., 1994\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCOI REVA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026rsquo; GATAAAACGTAATGAAAATGAGCTAC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGotoh \u003cem\u003eet al.\u003c/em\u003e, 2009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eScale insect and Mealybug\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePcoF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCytochrome oxidase I\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026rsquo;CCTTCAACTAATCATAAAAATATYAG3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e95\u0026deg;C for 2mins, initial 5 cycles of 94\u0026deg;C for 40secs, 45\u0026deg;C for 40secs, 72\u0026deg;C for 1min \u0026amp; 10secs, 40 cycles of 94\u0026deg;C for 40secs, 51\u0026deg;C for 40secs, 72\u0026deg;C for 1min \u0026amp; 10secs and 72\u0026deg;C for 5mins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePark \u003cem\u003eet al.\u003c/em\u003e, 2010\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLepR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026rsquo;TAAACTTCTGGATGTCCAAAAA3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMolecular Detection of Cassava Arthropod Pests Using COI mtDNA Gene Markers\u003c/h2\u003e \u003cp\u003eThe amplified gene was detected through gel electrophoresis using 1.0% agarose dissolved in TBE and viewed under the Labnet Enduro Touch gel viewer. The amplified \u003cem\u003eCOI\u003c/em\u003e region of mites samples collected from Bukidnon, showed the expected molecular size of approximately 900 bp. Among the amplified samples in every local population, a minimum of ten amplicons with good and clear bands were chosen for sequencing.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMolecular identification of cassava arthropods based on COI mtDNA sequences\u003c/h2\u003e \u003cp\u003eIn the present study, we employed molecular techniques to identify various arthropod pests infesting cassava plants based on their COI mtDNA sequences. A total of seven species of hemipteran insects and two species of spider mites were successfully identified using this approach. To ensure the accuracy of our molecular identification, we performed sequence alignment using the BLASTn tool in GenBank, which allowed us to compare our obtained sequences with those deposited in the database (Altschul et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). The percent identity of the nucleotide sequences ranged from 97\u0026ndash;100%, indicating a high level of similarity between our samples and the reference sequences in GenBank.\u003c/p\u003e \u003cp\u003eThe arthropod pests that were molecularly identified in this study included \u003cem\u003eAleurodicus disperses, Bemisia tabaci, Ferrisia virgata, Maconellicoccus hirsutus, Paracoccus marginatus, Parasaissetia nigra\u003c/em\u003e, and \u003cem\u003ePseudaulacaspis pentagona\u003c/em\u003e. We also identified two species of spider mites, namely \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e and \u003cem\u003eTetranychus kanzawai\u003c/em\u003e, which are known to infest cassava plants and cause damage by piercing plant cells and sucking out the contents. Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Fig.\u0026nbsp;1 summarise the identified arthropod pests and their corresponding COI mtDNA sequences. Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e5\u003c/span\u003e presents the GenBank Accession number of Philippine cassava sequence barcodes generated by this research.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe molecular identity of cassava arthropod pests using partial sequences of COI mtDNA using COI mtDNA through BLASTn alignment in the Genbank database.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies Identity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCommon Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuery Cover\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eE-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePercent Homology\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference Sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCollection Site\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus dispersus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWhitefly\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKR063274.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCamarines Sur, Laguna,\u003c/p\u003e \u003cp\u003eBukidnon, Misamis Oriental\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBemisia tabaci\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWhitefly\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKY951451.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMasbate, Quirino, Camirines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFerrisia virgata\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMealy bug\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLC273485.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eLaguna, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMaconellicoccus hirsutus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMealy bug\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKY373158.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eIsabela,Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eParacoccus marginatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMealy bug\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKP692579.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCamarines Sur, Quirino\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePseudaulacaspis pentagona\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eArmored scale insect\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHM474345.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCamarines Sur, Misamis Oriental\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eParasaissetia nigra\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlack soft scale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKY933367.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCamarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTetranichus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMites\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHM753535.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eIsabela; Bukidnon; Quirino;\u003c/p\u003e \u003cp\u003eCagayan De Oro City;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTetranychus kanzawai\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMites\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKJ729017.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCamarines Sur; Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenBank accession numbers for deposited COI sequences of identified armoured scale insects in the Philippines.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenBank Accession Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSample Codes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCOI\u003c/em\u003e phylogenetic ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLocation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213555\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AB2_1_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Sto. Ni\u0026ntilde;o, Manolo Fortich, Bukidnon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213556\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AB2_2_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Sto. Ni\u0026ntilde;o, Manolo Fortich, Bukidnon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213557\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_ABC4_4_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Imbatug, Baungon, Bukidnon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213558\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AC3_1_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Balubal, Cagayan de Oro City\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213559\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AC3_2_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Balubal, Cagayan de Oro City\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213560\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AI3_2_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Rangayan, Ilagan City, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213561\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AI3_3_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Rangayan, Ilagan City, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213562\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AMQ2_1_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Lusod, Mandela, Quirino\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213563\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AMQ2_2_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Lusod, Mandela, Quirino\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213564\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_ANVL_20_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP Los Banos, Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213565\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AS1_1_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Imbatug, Baungon, Bukidnon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213566\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AS1_3_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Imbatug, Baungon, Bukidnon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213567\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_AS3_4_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy Balubal, Cagayan De Oro City\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213568\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_BS4_4_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Tinangis, Pili, Camarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213569\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_HI6_1_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Cabugao, Cauayan, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213570\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT_cinnabarinus_HI6_2_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Cabugao, Cauayan, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213572\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA_dispersus_BS_3_3_contig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus dispersus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy Bagumbayan, Baao, Camarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213573\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA_dispersus_BS_3_4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus dispersus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy Bagumbayan, Baao, Camarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213574\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA_dispersus_VL_10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus disperseus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP Los Banos, Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213575\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA_dispersus_VS_4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus dispersus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP Los Banos, Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213576\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA_dispersus_VS_5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus dispersus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP Los Banos, Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213577\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA_dispersus_VM_consensus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAleurodicus dispersus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP Los Banos, Laguna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213578\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eM_hirsutus_HI_S4_1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMaconellicoccus hirsutus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Cabugao, Cauayan, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213579\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eM_hirsutus_HI_S4_5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMaconellicoccus hirsutus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Cabugao, Cauayan, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213580\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eM_hirsutus_HI_S4_6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMaconellicoccus hirsutus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Cabugao, Cauayan, Isabela\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213581\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP_marginatus_BS_4_2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eParacoccus marginatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Tinangis, Pili, Camarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213582\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP_marginatus_BS_4_3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eParacoccus marginatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Tinangis, Pili, Camarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMK213583\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP_marginatus_BS_4_13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eParacoccus marginatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBrgy. Tinangis, Pili, Camarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eGenetic diversity was conducted on field-collected mites, \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e, using COI gene. Insect species were not analyzed for genetic diversity due to apparent sequence similarity across various sampling sites. Five distinct haplotypes were identified among this species, indicating the presence of polymorphic sequences (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The analysis revealed 32 polymorphic sites, consisting of 24 singleton variable sites and eight parsimony informative sites. This variability in nucleotide positions among the haplotypes suggests more genetic heterogeneity within the \u003cem\u003eT. cinnabarinus\u003c/em\u003e population. The nucleotide diversity, denoted as Pi, was calculated to be 0.00892 for the \u003cem\u003eT. cinnabarinus\u003c/em\u003e mites. This value represents the average proportion of nucleotide differences between the population's randomly selected sequences. The higher Pi value, in this case, suggests a relatively elevated level of genetic variation within the \u003cem\u003eT. cinnabarinus\u003c/em\u003e population.\u003c/p\u003e \u003cp\u003eFurthermore, the haplotype diversity (Hd) for the T. cinnabarinus mites was determined to be 0.6364, indicating moderate haplotype diversity within the population. Four distinct haplotypes among the T. cinnabarinus mites contribute to the observed haplotype diversity. Similar to the insects, the mites also exhibited an AT-rich COI region. This observation suggests a common characteristic of an AT-biased composition in the COI region among arthropods.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHaplotype diversity of field-collected mites, \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e, using COI gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eSequence Haplotypes\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eHaplotype 1\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eHaplotype2\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eHaplotype3\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eHaplotype4\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLocation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIsabela\u003c/p\u003e \u003cp\u003eQuirino\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLaguna\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCamarines Sur, Bukidnon,\u003c/p\u003e \u003cp\u003eCagayan de Oro City, Bukidnon\u003c/p\u003e \u003cp\u003eZamboanga City\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCamarines Sur\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of base differences concerning Haplotype\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHap 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHap 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHap 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHap 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNucleotide Composition\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e280\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e280\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e280\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e283\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e358\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e359\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e362\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eG\u0026thinsp;+\u0026thinsp;C (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.76\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u0026thinsp;+\u0026thinsp;T (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e75.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e75.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e76.24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePhylogeny of cassava arthropod pest\u003c/h2\u003e \u003cp\u003eThe nucleotide sequences of the cassava pests were aligned, and the consensus sequence was used to construct a phylogenetic tree based on the maximum likelihood algorithm of MEGA 7.0 (Kumar et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). A bootstrap with 1000 iterations was included to test the strength of the clustering obtained. The bootstrap value of 100% for mealybugs (\u003cem\u003ePa. marginatus, F. virgata, M. hirsutus\u003c/em\u003e) and scale insect \u003cem\u003eP. pentagona\u003c/em\u003e, when aligned with GenBank reference sequences, indicates high confidence for the groupings obtained (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMolecular phylogenetic analysis of red spider mites of cassava using COI mtDNA with evolutionary history inferred by using by Maximum Likelihood method based on the Tamura 3-parameter model (Tamura, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1992\u003c/span\u003e) showed the highest log likelihood of -1564.4083. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA7, with 740 positions in the final dataset. Mite species show higher evolutionary differences between species of the same genera, with \u003cem\u003eT. kanazawai\u003c/em\u003e and T. \u003cem\u003ecinnabarinus\u003c/em\u003e as the closely related ones (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eCassava pests remain a significant challenge for cassava farmers in Asia because of the pest complex nature of these pests. The availability of molecular identification tools such as DNA Barcoding is increasingly essential to support cassava pest management, leading to reduced cassava pest damage (Bellotti, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Chavez et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Paul et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Bisimwa et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The molecular identification of these pests contributes to our understanding of the arthropod community associated with cassava and serves as a valuable resource of molecular data. The results presented in this study underscore the significant role that DNA barcoding plays in the identification of cryptic species and the arthropod pest complex in cassava. DNA barcoding was proven to be a highly effective tool, not only for accurate identification of known pests but also for discovering novel potential pest species. This has implications for the sustainable management of cassava, a vital food, and cash crop for millions of people in tropical and subtropical regions.\u003c/p\u003e \u003cp\u003eOne key aspect of our research revealed the limitations of the morphological identification of arthropod pests, especially in immature stages (Ratnasingham and Hebert, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Conventional identification methods have often proven challenging, especially for cryptic species and larval stages (Hebert et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Our study showed that integrating DNA barcoding can substantially enhance the resolution and accuracy of pest identification. Accurate species-level identification is still paramount to any pest management strategy, as some treatments, such as biological control, are species-specific. Due to the continuing decline of experts among new insect taxonomists, traditional morphological identification has become challenging (Burger and Ulenberg, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1990\u003c/span\u003e; Hardy, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe arthropod pests that are molecularly identified in this study, \u003cem\u003eAleurodicus disperses, Bemisia tabaci, Ferrisia virgata, Maconellicoccus hirsutus, Paracoccus marginatus, Parasaissetia nigra\u003c/em\u003e, and \u003cem\u003ePseudaulacaspis pentagona\u003c/em\u003e are species known to be economically important pests of cassava, causing significant damage to the crop by feeding on its tissues and transmitting viral diseases. Mealybugs are a leading cassava pest, causing global economic damage to the crop (Jankaew et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Rauwane et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003eFerrisia virgata, M. hirsutus, Pa. marginatus\u003c/em\u003e are problematic to differentiate; hence, DNA barcoding of these species is still essential to correctly identify the pests in the field. Due to the minute nature of spider mites and the lack of experts, identifying mite species using molecular tools is necessary. Two species of spider mites, namely \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e and \u003cem\u003eTetranychus kanzawai\u003c/em\u003e, were identified. Two species of spider mites, \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e and \u003cem\u003eTetranychus kanzawai\u003c/em\u003e, were identified as pests that could infest cassava plants and cause damage by piercing plant cells and sucking out the contents (Gotoh and Gomi, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Liang et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Both spider mites are small in size and can be incidentally consumed by voracious lepidopteran larvae, leading them to avoid such intraguild predation that could affect their survival and development (Kinto et al., 2022). \u003cem\u003eTetranychus kanzawai\u003c/em\u003e, in particular, is an important pest that threatens many crops and ornamental plants in Far Eastern areas (Gotoh and Gomi, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDNA barcoding has potential implications for pest management and biosecurity. Early detection and identification of invasive species can lead to more effective containment and control strategies (Hajibabaei et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). On a different note, our study did not find the invasive mealybug, \u003cem\u003ePhenacoccus manihoti\u003c/em\u003e which could pose more significant loss in cassava farming. This research presents that this invasive mealybug is not present in the Philippines as of this writing. Despite these promising results, there are still challenges to be addressed. These include the need for extensive reference databases, the complexities of genetic variation within species, haplotype diversity results depicting only the population studied, and potential technical errors (Meyer and Paulay, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Yet, it is clear that the benefits of DNA barcoding in pest identification and management substantially outweigh the limitations.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eImplementing DNA barcoding in accurate species identification of cassava arthropod pest complex presents significant information. By enhancing our ability to accurately identify cassava pests in adult and immature stages and identify the pest complex, we can more effectively protect cassava crops and thus safeguard the livelihoods of farmers who depend on them. Our results demonstrate the effectiveness of using COI mtDNA sequences to identify arthropod pests infesting cassava. This approach provides a rapid and accurate means of species identification, contributing to the accurate pest management of this important crop.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003emtDNA: Mitochondrial DNA, PCR: Polymerase Chain Reaction, \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCOI: Cytochrome Oxidase I,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNCPC: National Crop Protection Center\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Department of Science and Technology- National Research Council of the Philippines (NRCP) for funding the study. Special thanks to Dr Marieta Bañes Sumagaysay for the financial support to the project; to NRCP staff, especially to Beverly Mae N. de la Cruz, \u0026nbsp;Senior Science Research Specialist, Research Development and Management Division, for accommodating all our inquiries and for the valuable assistance she gave to our team from its proposal until its culmination; To the UPLB Foundation, Inc. headed by Dr Casiano S. Abrigo, Jr. for the administrative services provided to the project; To the personnel of different Regional Crop Protection Centers (RCPCs) \u0026nbsp;and the Department of Agriculture- Regional Field Units (DA-RFOs) for the assistance during the collection trips and capacity building seminars.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMSG and BFC conceptualized the study. MSG and JFL conducted molecular experiments from DNA extraction to sequence analysis. MSG, JFL, BFC, KPA, and MCdLdR, collected the samples. MSG wrote the original draft of the paper. MSG, JFL, CPK and BFC contributed to the manuscript preparation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study is funded by the Department of Science and Technology- National Research Council of the Philippines (NRCP).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAVAILABILITY OF DATA AND MATERIALS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis published article and its supplementary information file include all data generated or analyzed during this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS APPROVAL AND CONSENT TO PARTICIPATE\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONSENT FOR PUBLICATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCOMPETING INTERESTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAltschul, S., Gish, W., Miller, W., Myers, E., Lipman, D. (1990). basic local alignment search tool. Journal of Molecular Biology, 3(215), 403-410. https://doi.org/10.1016/s0022-2836(05)80360-2\u003c/li\u003e\n \u003cli\u003eBellotti, A., 2001. Arthropod pests. In: Bellotti AC, Smith L, editors. Ecology and management of the cassava mealybug, Phenacoccus manihoti Matile-Ferrero (Homoptera: Pseudococcidae), in Africa. Wallingford: CABI Publishing; 2001. p. 209-235. https://doi.org/10.1079/9780851995243.0209\u003c/li\u003e\n \u003cli\u003eBisimwa, E., Birindwa, D., Yomeni, M., Rudahaba, N., Byamungu, K., Bragard, C., 2019. Multiple cassava viruses\u0026apos; co-infections and resurgence of pests are leading to severe symptoms and yield losses on cassava in the South-Kivu Region, Democratic Republic of Congo. AJPS, 11(10), 1969-1988. https://doi.org/10.4236/ajps.2019.1011138\u003c/li\u003e\n \u003cli\u003eBurger H, Ulenberg S. Quarantine problems and procedures. In: Rosen D, editor. Armoured scale insects: their biology, natural enemies, and control. Amsterdam, The Netherlands: Elsevier; 1990. p. 313\u0026ndash;27\u003c/li\u003e\n \u003cli\u003eChaya, Tao, Green, Baogen, 2021. Impact of climate change on pests of rice and cassava. CABI Reviews, 2021. https://doi.org/10.1079/pavsnnr202116050\u003c/li\u003e\n \u003cli\u003eChavez, V., Coleman, K., Bosch, F., Pita, J., McQuaid, C., 2021. Modelling cassava production and pest management under biotic and abiotic constraints. Plant Mol Biol, 3(109), 325-349. https://doi.org/10.1007/s11103-021-01170-8\u003c/li\u003e\n \u003cli\u003eCurran, S., Cooke, A., 2008. Unexpected outcomes of Thai cassava trade: A case of global complexity and local unsustainability. Globalizations, 2(5), 111-127. https://doi.org/10.1080/14747730802057449\u003c/li\u003e\n \u003cli\u003eGotoh, T., Gomi, K., 2003. Life-history traits of the Kanzawa spider mite Tetranychus kanzawai (Acari: Tetranychidae). Appl. Entomol. Zool., 1(38), 7-14. https://doi.org/10.1303/aez.2003.7\u003c/li\u003e\n \u003cli\u003eHajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., \u0026amp; Hebert, P.D.N., 2007. DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Sciences, 104(4), 968-973\u003c/li\u003e\n \u003cli\u003eHardy NB. The status and future of scale insect (Coccoidea) systematics. Vol. 38, Systematic Entomology. 2013\u003c/li\u003e\n \u003cli\u003eHebert, P.D.N., Cywinska, A., Ball, S.L., \u0026amp; deWaard, J.R., 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512), 313-321\u003c/li\u003e\n \u003cli\u003eJankaew, K., Rattanakul, C., Sarika, W., 2019. A delay differential equation model of mealybugs and green lacewings. Adv Differ Equ, 2019. https://doi.org/10.1186/s13662-019-2226\u003c/li\u003e\n \u003cli\u003eKinto, S., Akino, T., Yano, S., 2023. Spider mites avoid caterpillar traces to prevent intraguild predation. Sci Rep, 1(13). https://doi.org/10.1038/s41598-023-28861-0\u003c/li\u003e\n \u003cli\u003eKumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870-1874\u003c/li\u003e\n \u003cli\u003eLiang, X., Chen, Q., Liu, Y., Wu, C., Li, K., Wu, M., \u0026hellip; \u0026amp; Geng, Y., 2022. Identification of cassava germplasms resistant to two-spotted spider mite in China: from greenhouse large-scale screening to field validation. Front. Plant Sci., 2022. https://doi.org/10.3389/fpls.2022.1054909\u003c/li\u003e\n \u003cli\u003eMeyer, C.P., \u0026amp; Paulay, G., 2005. DNA barcoding: error rates based on comprehensive sampling. PLoS Biology, 3(12), e422. DOI: 10.1371/journal. bio.0030422\u003c/li\u003e\n \u003cli\u003eMilenovic, M., Wosula, E., Rapisarda, C., Legg, J., 2019. Impact of host plant species and whitefly species on feeding behavior of Bemisia tabaci. Front. Plant Sci., 10. https://doi.org/10.3389/fpls.2019.00001\u003c/li\u003e\n \u003cli\u003eMurayama, D., Kasano, M., Santiago, D., Yamauchi, H., Koaze, H., 2014. Effect of pre-gelatinization on the physicochemical properties of dry flours produced from 5 cassava varieties of the Philippines. FSTR, 6(20), 1131-1140. https://doi.org/10.3136/fstr.20.1131\u003c/li\u003e\n \u003cli\u003eGatesy, J. (2002). molecular evolution and phylogenetics (m. nei and s. kumar). Molecular Phylogenetics and Evolution, 3(25), 567-568. https://doi.org/10.1016/s1055-7903(02)00247-6\u003c/li\u003e\n \u003cli\u003ePaul, M., Sarina, M., Anton, B., Andrew, K., Fred, T., Donald, K., \u0026hellip; \u0026amp; John, C., 2022. Impacts of cassava whitefly pests on the productivity of East and Central African smallholder farmers. J. Dev. Agric. Econ., 3(14), 60-78. https://doi.org/10.5897/jdae2022.1330\u003c/li\u003e\n \u003cli\u003ePlata, I., Panganiban, E., Alado, D., Taracatac, A., Bartolome, B., Labuanan, F., 2022. Drone-based geographical information system (GIS) mapping of cassava pythoplasma disease (CPD) for precision agriculture. IJETAE, 2(12), 1-9. https://doi.org/10.46338/ijetae0222_01\u003c/li\u003e\n \u003cli\u003eRauwane, M., Odeny, D., Millar, I., Rey, M., Rees, J., 2018. The early transcriptome response of cassava (Manihot esculenta Crantz) to mealybug (Phenacoccus manihoti) feeding. PLoS ONE, 8(13), e0202541. https://doi.org/10.1371/journal.pone.0202541\u003c/li\u003e\n \u003cli\u003eRatnasingham, S., \u0026amp; Hebert, P.D.N., 2007. BOLD: The Barcode of Life Data System www.barcodinglife.org. Molecular Ecology Notes, 7(3), 355-364. DOI: 10.1111/j.1471-8286.2007.01678.x\u003c/li\u003e\n \u003cli\u003eSoria, R., Preciados, L., 2018. Investigating the determinants of cassava domestic supply in the Philippines. ATR, 90-106. https://doi.org/10.32945/atr4028.2018\u003c/li\u003e\n \u003cli\u003eTamura, K. (1992). Estimation Of the Number Of Nucleotide Substitutions When There Are Strong Transition-transversion And G+c-content Biases. https://doi.org/10.1093/oxfordjournals.molbev.a040752\u003c/li\u003e\n \u003cli\u003eUke, A., Tokunaga, H., Utsumi, Y., Vu, N., Nhan, P., Srean, P., \u0026hellip; \u0026amp; Ugaki, M., 2021. Cassava mosaic disease and its management in Southeast Asia. Plant Mol Biol, 3(109), 301-311. https://doi.org/10.1007/s11103-021-01168-2\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"cassava, arthropod pests, DNA barcoding, genetic diversity, molecular identification","lastPublishedDoi":"10.21203/rs.3.rs-3327078/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3327078/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCassava productivity is severely affected by arthropod pests, which cause damage through feeding and vector transmission. The complex nature of these pests, with morphologically similar species and small sizes, presents challenges in accurately identifying and implementing effective control measures. Accurate identification of arthropod pests infesting cassava in the field is crucial for successful pest management and mitigating the risk of introducing exotic pests through cassava trade and changing climate conditions. Thus, we employed DNA barcoding to generate genetic barcodes of the cassava arthropod pest complex found in major cassava growing areas in the Philippines. Identification to species level was achieved using molecular works with prior morphological identification. Molecular identification offers accurate species resolution of the cassava pest complex even at immature stages, typically hard to identify.\u003c/p\u003e","manuscriptTitle":"Molecular Identification of Cassava Arthropod Pest Complex in the Philippines","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-08 18:02:46","doi":"10.21203/rs.3.rs-3327078/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2025-03-16T17:51:03+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-01-23T05:27:21+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-03T16:16:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-09-07T15:04:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Journal of Tropical Insect Science","date":"2023-09-05T05:39:50+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"fdebb5d8-4684-4670-a05c-dee62d0faca8","owner":[],"postedDate":"January 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2025-03-16T21:52:42+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-08 18:02:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3327078","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3327078","identity":"rs-3327078","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}