Targeting the Highly Invasive Malaria Vector Anopheles stephensi using Yeast RNAi Pesticides

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Apart from widespread resistance of malaria mosquitoes to insecticides, Plasmodium parasite resistance to frontline anti-malaria drugs, and challenges in malaria diagnosis, the World Health Organization (WHO) has described the highly invasive Anopheles stephensi as a major threat to malaria control. New classes of insecticides are vitally needed for integrated control of the dangerous malaria vector that continues to spread across African countries. Yeast RNAi insecticides are promising novel pesticides that could prove effective for integrated responses to A. stephensi. Here we explore the use of RNAi yeast pesticides for control of this invasive malaria vector. Methods Sh.463, a modified Saccharomyces cerevisiae baker’s yeast RNAi pesticide corresponding to the A. stephensi Shaker gene, was evaluated in A. stephensi . A scalable attractive targeted sugar bait (ATSB)-based system for delivery of Sh interfering RNA pesticides (IRPs) to adult A. stephensi under insectary conditions is examined, and a yeast-based system for delivery of Sh IRP to larvae is developed and evaluated. Additionally, female-specific yeast RNAi-larvicides targeting putative A. stephensi female-specific genes for male mosquito sorting are also developed and evaluated in laboratory assays. Results We demonstrate that the treatment of A. stephensi larvae and adults with Sh.463-56.10R yeast silences the mosquito Shaker gene, resulting in high levels of mortality in laboratory studies. Additionally, our siRNA screens of putative female-specific genes in A. stephensi using female-specific RNAi yeast larvicides resulted in significant female mortality in cup bioassays leading to significantly higher male: female ratios in the resulting offspring. Conclusion The results of these studies suggest that an RNAi pesticide targeting mosquito Shaker genes may represent a novel biorational intervention that can be used in integrated A. stephensi control programs while also targeting other species of disease vector mosquitoes. The potential of A. stephensi female-specific RNAi yeast larvicides in male mosquito sorting is also described.
Full text 205,869 characters · extracted from preprint-html · click to expand
Targeting the Highly Invasive Malaria Vector Anopheles stephensi using Yeast RNAi Pesticides | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Targeting the Highly Invasive Malaria Vector Anopheles stephensi using Yeast RNAi Pesticides Teresia M. Njoroge, Majidah Hamid-Adiamoh, Keshava Mysore, Akilah T. M. Stewart, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8982626/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Apart from widespread resistance of malaria mosquitoes to insecticides, Plasmodium parasite resistance to frontline anti-malaria drugs, and challenges in malaria diagnosis, the World Health Organization (WHO) has described the highly invasive Anopheles stephensi as a major threat to malaria control. New classes of insecticides are vitally needed for integrated control of the dangerous malaria vector that continues to spread across African countries. Yeast RNAi insecticides are promising novel pesticides that could prove effective for integrated responses to A. stephensi. Here we explore the use of RNAi yeast pesticides for control of this invasive malaria vector. Methods Sh.463, a modified Saccharomyces cerevisiae baker’s yeast RNAi pesticide corresponding to the A. stephensi Shaker gene, was evaluated in A. stephensi . A scalable attractive targeted sugar bait (ATSB)-based system for delivery of Sh interfering RNA pesticides (IRPs) to adult A. stephensi under insectary conditions is examined, and a yeast-based system for delivery of Sh IRP to larvae is developed and evaluated. Additionally, female-specific yeast RNAi-larvicides targeting putative A. stephensi female-specific genes for male mosquito sorting are also developed and evaluated in laboratory assays. Results We demonstrate that the treatment of A. stephensi larvae and adults with Sh.463-56.10R yeast silences the mosquito Shaker gene, resulting in high levels of mortality in laboratory studies. Additionally, our siRNA screens of putative female-specific genes in A. stephensi using female-specific RNAi yeast larvicides resulted in significant female mortality in cup bioassays leading to significantly higher male: female ratios in the resulting offspring. Conclusion The results of these studies suggest that an RNAi pesticide targeting mosquito Shaker genes may represent a novel biorational intervention that can be used in integrated A. stephensi control programs while also targeting other species of disease vector mosquitoes. The potential of A. stephensi female-specific RNAi yeast larvicides in male mosquito sorting is also described. RNAi yeast insecticide larvicide ATSB Anopheles stephensi sex-separation malaria Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Malaria, a serious and sometimes fatal illness, is a huge economic and public health burden globally, with an estimated 263 million cases and approximately 600,000 malaria deaths annually [ 1 ]. Although malaria affects at least 80 countries worldwide, the African region carries a proportionately high share of the global malaria burden, with 94% of malaria cases occurring there, and children under age five accounting for about 76% of all malaria deaths [ 1 ]. Malaria is transmitted by the bite of infective female Anopheles mosquitoes that vector protozoan parasites of the genus Plasmodium . Although about 60 species of Anopheles are known competent vectors of the Plasmodium parasites, under natural conditions only 30 are of major significance [ 2 ]. Historically, the Anopheles gambiae complex and Anopheles funestus species, occur predominantly in Africa and are responsible for malaria transmission in the highly malaria endemic region [ 3 – 5 ]. In Latin America, A. darlingi and A. marajoara are among the primary vectors of malaria [ 6 – 9 ]. In the Asian-pacific region that includes South Asia and the Middle East, several dozen malaria vector species exist, both zoophilic and exophilic [ 10 ], and A. stephensi has been recognized as an important vector of malaria in urban areas across the region [ 10 – 12 ]. A. stephensi is domicile to the Asian continent where it has been reported as one of the major drivers of malaria in the region. The malaria mosquito has also colonized at least eight countries in sub-Saharan Africa (SSA) since 2012 and is now spreading at an alarming rate [ 13 ]. A. stephensi is a competent vector of Plasmodium falciparum and Plasmodium vivax , which are the primary malaria parasites in SSA, and has been implicated in malaria epidemics in Djibouti [ 14 ],[ 15 ] and Ethiopia [ 16 ]. Unlike other malaria vectors, A. stephensi exhibits high ecological plasticity and is considered both an urban and peri-urban adapted malaria vector, which breeds in artificial water containers such as overhead tanks, cisterns, ditches and canals [ 17 ], [ 18 ]. Although malaria in Africa has been predominantly a rural disease, it is expected that transmission will rise in the rapidly growing urban areas where A. stephensi populations establish, calling for an urgent need for integrated responses to control the invasive malaria vector. In 2023, the WHO[ 19 ] released a threat notice highlighting the spread of A. stephensi in the Horn of Africa and advised public health authorities to heighten vector surveillance efforts. New tools are vitally needed to combat the dangerous malaria vector. Vector-targeted interventions that mostly involve use of chemical insecticides have proven effective in preventing malaria transmission [ 20 ], but this vector control approach is currently faced with challenges that warrant the discovery of new tools for integrated vector management. Just like other disease vector mosquitoes, the A. stephensi strains that were detected in Africa are largely resistant to commonly used insecticides and prefer to bite people outdoors, making bed nets and indoor residual spraying, the mainstays of malaria vector control, less effective for combatting the invasive malaria vector [ 21 ]. Furthermore, there are serious concerns regarding public health and the environmental safety of chemical-based pesticides [ 22 , 23 ] and hence new classes of pesticides that are effective and environmentally safe are vitally needed. RNA interference (RNAi)-based pesticides are promising novel insect pest management tools with the potential to be both safe and effective. These pesticides employ RNAi, an innate regulatory mechanism occurring in eukaryotes, that enables targeted gene silencing in many organisms, including mosquitoes. For the past 25 years, RNAi technology has advanced as a useful research tool with the potential to translate innovative bench research into practical pest control strategies [ 24 , 25 ]. The objective of this research was to evaluate the potential for RNAi yeast-based technologies to facilitate the control of A. stephensi. In recent years, we have pursued larvicide[ 26 ] and adulticide[ 27 ] screens for RNAi insecticides. In the present study, we evaluate a novel mosquito control technology in A. stephensi , in which we investigate the insecticidal activity of Sh.463, an RNAi pesticide consisting of a short hairpin RNA (shRNA) expressed in yeast that targets the mosquito Shaker ( Sh ) gene [ 28 ]. The insecticidal yeast is propagated, heat killed and lyophilized then evaluated in larvae and adult A. stephensi . Mosquito larvae consume the yeast readily as part of their diet, and for the adults, the insecticidal yeast is mixed with sugar and presented to sugar seeking adults as an ATSB. Following mosquito consumption, the RNAi yeast was designed to silence the Sh gene, which is expressed widely in Dipteran nervous systems. The neuron-specific gene encodes an evolutionarily conserved subunit of a voltage-gated potassium channel responsible for membrane repolarization and release of neurotransmitters in the brain [ 29 ]. Sh.463 recognizes a conserved Sh target site found in Aedes, Culex , and Anopheles mosquitoes, including A. stephensi [ 28 ], but not in non-target organisms. Based on previous analyses of the insecticidal activity of Sh.463 yeast, as well as Sh.463-56.10R, a robust strain with enhanced Sh.463 shRNA production [ 30 ], in larvae and adult A. gambiae, Aedes , and Culex mosquitoes [ 28 ], it was hypothesized that Sh.463-56.10R would silence the A. stephensi Sh gene, resulting in death of both larvae and adults. In addition to identifying genes to be targeted for killing larvae and adults, we also performed screens in Aedes aegypti that identified female-specific RNAi larvicides [ 31 , 32 ], some of which target female larval lethal genes such as MtnB [ 31 ] and GGT [ 32 ] that are conserved in different mosquito species, to facilitate male sex separation. It is hypothesized that targeting the A. stephensi orthologs of these or other female-specific larval lethal genes might enable male sex separation. This would facilitate deployment of the sterile insect technique (SIT) or other population control methods. Although other methods for male sex sorting of mosquitoes have been developed [ 33 – 35 ], the use of female-specific yeast methodology requires only the addition of dried RNAi yeast to the larval diet during rearing, which yields female deaths and up to 5 male:1 female sex ratios in adults. The adult males produced by this technology have shown no loss of fitness in laboratory experiments [ 31 ]. RNAi yeast-based diets that facilitate scaled rearing and separation of Aedes and Culex males have been developed [ 31 ], [ 32 , 35 ], suggesting that this technology can be adapted for use in A. stephensi. In summary, the goals of this study are to assess whether RNAi yeast technology can be applied for larviciding, adulticiding (through ATSBs), and male sex separation in the malaria vector mosquito A. stephensi. METHODS Mosquito rearing The A. stephen s i strain used in this investigation was obtained from BEI Resources (NIAID, NIH: A. stephensi , Strain STE2, Eggs, MRA-128, contributed by Mark Q. Benedict). This mosquito strain was reared as described [ 36 ], except that the adult females were blood fed using a Hemotek artificial membrane feeding system (Hemotek Limited, Blackburn, UK) to deliver sheep blood that was purchased from HemoStat Laboratories, Dixon, CA. The insectary used for mosquito rearing and insecticidal assays was maintained at 26°C, ~ 80% relative humidity, with a 12 hr dark/12 hr light cycle that included 1hr crepuscular periods at the beginning and end of each cycle. 2. Yeast preparation The Sh.463-56.10R yeast strain previously described by Brizzee et al. [ 30 ] was used in this investigation. This second-generation yeast strain of the original Sh.463 strain [ 28 ] bears multiple copies of a high-expression Sh.463 short hairpin expression cassette, allowing for scaled production of the Sh.463 shRNA, which corresponds to the following target sequence: 5’- AUUUAAAUUAUCUAGGCAUUCGAAA − 3’ in the A. stephensi Shaker gene. DMT347.1R, the control RNAi strain used in this investigation, was previously described by Brizzee et al. [ 30 ] and recognizes 5’-GAAGAGCACUGAUAGAUGUUAGCGU-3’, a target site that has not been identified in any of the mosquito species [ 28 ]. The DMT347.1R yeast strain (hereafter referred to as the control) contains multiple integrations of the shRNA expression cassette [ 30 ]. Both the Sh.463-56.10R and control RNAi yeast strains are suitable for scaled RNAi yeast production [ 30 ]. Yeast was cultured and prepared for insecticide assays as previously described [ 37 ] except that production was scaled in a bioreactor (Chemglass Life Sciences, Vineland, New Jersey, USA) and dried using a freeze-dryer (Labconco, Kansas City, Missouri, USA). 3. Larvicide assays Laboratory larvicide assays were performed according to WHO[ 38 ] mosquito larvicidal testing guidelines. A previously described protocol[ 30 ] was followed using Sh.463-56.10R insecticidal or control yeast fed to 20 first instar larvae reared in 500 mL plastic cups with 50 mL distilled water according to the WHO protocol. Mortality, pupariation, and adult emergence data were collected. Three biological trials, each with six replicates, were performed for each treatment (total of 360 larvae for each treatment group), and the mortality data were analyzed using SPSS 25 (IBM, Armonk, NY USA) software with the Mann-Whitney U-test. 4. Adulticide Studies The Sh.463-56.10R insecticidal yeast or control yeast was mixed with Westham sugar matrix (Westham LLC, Israel) to make a yeast ATSB insecticide and presented to five-day old adult female A. stephensi in the insectary according to a protocol described previously [ 30 ]. LC 50 and LC 90 concentrations of Sh.463-56.10R yeast ATSB were determined previously [ 30 ], and these data were used to select the appropriate dosage for the present investigation. For each feeding treatment of 25 adult female mosquitoes, 20 mg of lyophilized yeast (treatment or control) were placed on a 6 cm × 6 cm piece of a porous Westham membrane (Westham LLC, Israel). A volume of 100 µL of Westham sugar matrix was added to the pre-weighed yeast (20mg) and mixed thoroughly with a toothpick to create a paste on top of the membrane. A second piece of membrane was placed over the yeast and sealed with a heat sealer to create a sachet containing yeast insecticide. The method for preparation of the RNAi yeast sachet is shown in Fig. S1 . The sachet containing the yeast-ATSB pesticide or control was delivered to mosquitoes in insectary sugar bait trials by placing it at the bottom of a cage containing 25 five-day old adult females that had been starved overnight. Engorged females were assessed daily for behavioral phenotypes, mortality, and morbidity for six days. Three biological trials, each with three replicates, were conducted for each treatment (total of 225 adult mosquitoes for each treatment), and data were analyzed using SPSS 25 (IBM, Armonk, NY USA) software with Kruskal-Wallis test. 5. Attractive sugar bait (ASB) choice assays in adult 5. Attractive sugar bait (ASB) choice assays in adult A. stephensi To identify the most attractive sugar bait for effective delivery of RNAi yeast to adult A. stephensi , choice assays were conducted in the insectary using a 10% sucrose solution, Westham sugar matrix or soda (Coca-cola™) as a sugar source. To achieve this, dual-choice experiments were performed to evaluate mosquito feeding preference which was determined using adult mosquito mortality. The choice experiments were conducted in 3.75 L (30 cm × 30 cm x 30 cm) BugDorm-1 insect rearing cages (MegaView Science Co., Ltd, Taichung, Taiwan) using both treatment yeast and control yeast mixed with either of two sugar sources and simultaneously placed in the cage. An ASB sugar control for each sugar type was also included in separate cages to verify that sugar feeding occurred. All the yeast-sugar bait formulations (yeast-10% sugar, yeast-soda, and yeast-Westham sugar bait) were prepared to a final sugar-yeast concentration of 333.3 µg/µL as described[ 28 ] and presented to 25 adult female A. stephensi per cage that were allowed to feed on the treatments overnight. For the yeast-10% sugar vs. yeast-soda formulation adult feeding trials, the treatments were administered using MUDUODUO automatic bird drinker cups (Amazon, Seattle Washington) custom-designed as ATSB feeders as described [ 39 ]. For the yeast-soda vs. yeast-Westham bait formulation trials, the treatments were presented in the well of an inverted 2 oz transparent polypropylene plastic condiment container with the yeast ATSB covered by a perforated stretched parafilm to facilitate adult mosquito probing. Two yeast treatments bearing different sugar baits were positioned in opposite corners of the experimental cages to ensure equal exposure and unbiased access by the mosquitoes. Each treatment pair was tested in three biological trials, with two replicates each, giving a total of 150 adult A. stephensi per treatment group. The location of the treatment and control baits was permutated in these trials. Mortality and morbidity were monitored and recorded for six days. The mortality data were statistically analyzed using SPSS 25 (IBM, Armonk, NY USA) software with the Mann-Whitney U test. 6. Confirmation of Shaker gene silencing in larvae and adult 6. Confirmation of Shaker gene silencing in larvae and adult A. stephensi Silencing of the Shaker gene target in A. stephensi larvae and adults following consumption of Sh.463-56.10R yeast was verified using RT-qPCR, which was performed on mosquitoes that had been treated with control or insecticidal yeast. For the larval assays, total RNA was extracted from pools of 20 third instar larvae that had been treated with Sh.463-56.10R yeast or control yeast. Three biological trials, each with three replicates (total of nine replicates) were conducted for the assay. For the adult assays, total RNA was extracted from individual females (n = 15, generated in three biological replicate trials) that had consumed Sh.463-56.10R yeast ATSB or control yeast ATSB for 96 hours. TRIzol (Invitrogen, Carlsbad, CA) was used to extract total RNA as described in the manufacturer’s instructions; the RNA was then treated with DNase 1 using the DNA-free kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions. The High Capacity RNA to cDNA Kit (Applied Biosystems, Foster City, CA) was used to generate cDNA, the amplification of which was performed in a CFX Opus 96 Real-time PCR System (Bio-Rad, Hercules, CA) using the Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the following primers: Sh F9 for: 5’ GGCACAAAGATCGAGGAGG 3’ and Sh F9 rev: 5’ CCTCTTCTTCGGCGACTAC 3’. The amplification of A. stephensi ribosomal protein 7 (rps7) was performed with the primers 5′ AGCAGCAGCAGCACTTGATTTG 3′ (forward) and 5′ TAAACGGCTTTCTGCGTCACCC 3′ (reverse)[ 40 ] and used for data normalization. The qPCR reactions were performed in three technical replicate wells in each of three separate biological replicate trials. Results from these assays were quantified through standardization of reactions to levels of rps7 using the ΔΔCt method as described [ 41 ]. Treatment and control data were statistically analyzed using Microsoft Excel 365 software with the Student’s t-test. 7. Development and evaluation of A. stephensi female-specific larvicides A. stephensi female-specific yeast RNAi pesticides were prepared through characterization of putative A. stephensi female-specific larval lethal genes. An siRNA (small interfering RNA) screen was performed using orthologs of A. aegypti and A. gambiae female-specific larval lethal genes [ 31 ], [ 32 ],[ 42 ] in A. stephensi. Custom siRNAs corresponding to the orthologous genes were selected using the Integrated DNA Technologies (IDT) Custom Dicer-Substrate siRNA (DsiRNA) tool [ 43 ]. Custom siRNAs, including a control siRNA with no known target in mosquitoes, were purchased from Integrated DNA Technologies (Coralville, IA). In summary, short hairpin RNA expression cassettes corresponding to putative target sites in each gene were designed as described [ 37 ]. Custom DNA oligonucleotides corresponding to these sequences were purchased from Invitrogen (Carlsbad, CA) and cloned into pRS426 GPD, a non-integrating bacteria-yeast shuttle vector bearing a URA3 marker that permits constitutive expression of inserts cloned downstream of a GPD promoter [ 44 ]. Following sequencing to confirm the inserted sequences, the plasmids were transformed into the S. cerevisiae CEN.PK strain yeast [genotype MATa/α ura3-52/ura3-52 trp1-289/trp1-289 leu2-3_112/leu2-3_112 his3 Δ1/his3 Δ1 MAL2- 8C/MAL2-8C SUC2/SUC2] [ 45 ], and the transformants were selected by growth on minimal media lacking uracil. The yeast IRPs were then cultured, heat-killed, and dried for larval feedings as described [ 37 ]. The A. stephensi female-specific IRPs produced were used to perform larvicidal bioassays in accordance with WHO [ 38 ] guidelines in the insectary (see above). Adult male and female emergence rates and sexes were evaluated, and data were statistically analyzed with the Chi-square test. The success of population-based mosquito control programs such as SIT depends on male fitness which determines the ability of the released sterile males to compete with the existing wild-type male populations for wild-type females and induce sterility in the target population. To assess A. stephensi male fitness following consumption of female-specific yeast larvicides, A. stephensi female-specific doublesex ( dsx F) larvicide, which resulted in significant female larval deaths in lab assays was evaluated. A. stephensi male fitness following consumption of dsx F yeast larvicide was examined through wing length measurements and mating competitiveness assays in the laboratory: a) A. stephensi males wing length assays To evaluate A. stephensi adult males’ fitness following consumption of larval rearing diet containing female-specific yeast larvicides, male wing lengths were estimated compared to mosquitoes grown on the normal rearing diet (food control). A. stephensi adult males that had been fed with control diet, dsx F.744 or dsx F.745 yeasts during the larval stage were generated as described in section ( 3 ) above. For each of the three treatment groups, three biological trials were conducted, each with 40 males per treatment. Individual adult males’ wings were then mounted on specimen slides in pairs using a clear nail polish. Pictures were taken under a stereo microscope and analyzed using FIJI ImageJ software [ 46 ] to determine their wing lengths. The data from the control and two treatment groups were statistically analyzed using ANOVA. b) Competitive mating assays The mating competitiveness of A. stephensi males following consumption of the male sorting dsxF yeast during larval rearing was conducted using Rhodamine B (RhB) (CAS: 81889, ThermoFisher Scientific, Waltham, Massachusetts, USA), a fluorescent dye used as a marker to trace mating. Briefly, virgin adult female A. stephensi were crossed with dsx F - A.744 or dsx F - A.745 yeast-treated and marked (RhB+) and control unmarked males (RhB-) for copulation and their spermathecae dissected and examined for fluorescence to determine the mating partner using a fluorescent microscope following the methodology previously described [ 47 ], [ 48 ]. Both adult males and females were generated by rearing first instar A. stephensi larvae to pupal stage (as described in section 3 above) using the standard mass-rearing (MR) diet, which served as a control (food control), dsx F.744 or dsx F.745 yeasts. For each treatment, the pupae were placed in individual vials to separate adult males from females. Newly emerged adult mosquitoes from the three treatments were then maintained with 10% sucrose solution with or without RhB for three days in 2 L (16.2 cm × 16.2 cm x 15.5 cm) cages. Specifically, dsx F.744 and dsx F.745 treated males were marked through sugar feeding using 0.1% w/v RhB-sucrose solution made by dissolving 100mg of RhB powder for 100 mL of 10% w/v sucrose solution, for 3 days. The control males and females reared on their normal diets, hereafter referred to as “wild-type males and females” were each maintained using 10% sucrose solution for three days as well. The mating assays were conducted three days following sugar feeding by crossing 20 RhB marked males (RhB+), 20 unmarked wild-type males (RhB-) with 40 virgin wild-type female mosquitoes for three nights. Three biological replicate trials for each treatment were conducted (a total of 120 females were examined). The females’ spermathecae were then dissected using a dissecting microscope, and their insemination and fluorescence status were determined using a fluorescent microscope. The spermathecae of the inseminated females were then examined for fluorescence to determine the mating partner. The spermathecae containing RhB+ seminal fluid was examined under the florescence microscope equipped with an RFP filter. The spermathecae for females that had mated with an RHB+ (treated) male fluoresced bright orange; those that mated with an unmarked (RhB-) wild type male had a spermathecae which did not fluoresce. The data from the control and two treatment groups were statistically analyzed with the Chi-square test. RESULTS AND DISCUSSION High levels of mortality are induced in A. stephensi larvae following consumption of Sh.463-56.10R yeast larvicide Our previous high-throughput screens identified hundreds of IRPs, a number of which have target sites that are conserved in many species of disease vector mosquitoes, but not in humans or other non-target organisms, and which kill both larvae and adult mosquitoes [ 27 ], [ 28 ], [ 49 – 51 ]. Sh.463, one of these IRPs, is an shRNA that can be delivered to mosquitoes in S. cerevisiae that are cultured to enable RNA propagation, and then heat-killed, dried, and fed to larvae. Laboratory trials have demonstrated that the yeast kills mosquito larvae of multiple species [ 27 , 28 ], [ 50 – 52 ], yet did not harm non-target organisms, suggesting that the insecticides could enable eco-friendly A. stephensi control. Laboratory trials were therefore conducted on A. stephensi larvae using the Sh.463-56.10R[ 30 ] yeast strain. As predicted, these laboratory larvicidal assays demonstrated that consumption of the heat-inactivated Sh.463-56.10R yeast effectively killed A. stephensi larvae (Fig. 1 a). When treated with the yeast beginning in the first instar, A. stephensi larval death occurred during the third or fourth instar stages (Fig. 1 c), resulting in mortality rates of 88.2 ± 1% in the treated larvae (compared to control with 3.1 ± 3.4%, P < 0.001; Mann-Whitney U t-test). Furthermore, this larval lethality was achieved at dosages that were half (20 mg per 20 larvae) of those used in assays completed with the original first-generation Sh.463 laboratory yeast strain (40 mg per 20 larvae; [ 28 ]), which is consistent with recent findings in Aedes and Culex larvae [ 30 ]. That is because the Sh.463-56.10R strain, which was created using Cas-Clover and Super PiggyBac (sPB) transposase/transposon engineering systems, has multiple Sh.463 shRNA expression cassettes that were integrated into the yeast genome [ 30 ], enabling increased expression levels of shRNA in each yeast cell, permitting the use of smaller amounts of yeast, which is anticipated to cut the costs for use by mosquito control programs. Moreover, unlike the laboratory Sh.463 yeast strain, the production of Sh.463-56.10R is readily scaled, which would prove invaluable if large-scale field trials and the eventual launching of yeast larvicide distribution were to be pursued [ 30 ]. A previous study[ 39 ] demonstrated that death of A. aegypti mosquito larvae correlated with silencing of the Sh gene, which coincided with significant neural defects. It was therefore hypothesized that silencing of the Sh gene in A. stephensi larvae was responsible for mosquito larval mortality. RT-qPCR assays confirmed 62% silencing of Sh gene expression in the Sh. 463-56.10R yeast-treated larvae ( P < 0.001; Student’s t-test; (Fig. 1 b), indicating that the mode of action for this insecticide in A. stephensi larvae is through silencing of the Sh gene. A. stephensi has adapted to breeding in a wide variety of man-made containers including water storage tanks, discarded tires, ditches and canals[ 21 ] indicating that larviciding, a less commonly used Anopheles mosquito control method in Africa, could prove effective for A. stephensi control. The WHO, which recommends that larviciding be considered for malaria control in areas where breeding sites are few, fixed, and findable, suggested that larviciding may be a leading method for malaria vector control in urban areas [ 53 ]. In 1994, Kumar et al[ 54 ] reported decreased A. stephensi densities and malaria incidence following Bacillus sphaericus larvicide treatment campaigns in India. B. thuringiensis israelensis (Bti) and temephos have also been used to target A. stephensi larvae [ 55 ]. Thus, it is anticipated that Sh.463 larvicides, which are also species-specific, could prove useful in A. stephensi larviciding programs. Additionally, RNAi yeast larvicide has been prepared in large slow-release briquette formulations[ 30 ] that have demonstrated five months residual activity in semi-field trials conducted on A. aegypti larvae in large water storage containers located on a rooftop laboratory in Trinidad [ 56 ]. Such formulations might prove useful for treatment of A. stephensi , which also inhabit large water storage containers. This could be evaluated in future field trials. 2. Consumption of Sh.463-56.10R yeast ATSB induced high levels of adult mortality: 2. Consumption of Sh.463-56.10R yeast ATSB induced high levels of adult A. stephensi mortality: ATSBs, which capitalize on the natural sugar feeding behavior of adult mosquitoes that can be lured to feed on sugar bait that has been laced with an insecticide [ 57 ], have proven to be effective in the delivery of insecticides to target adult Aedes [ 58 – 62 ], Culex [ 63 – 65 ], and Anopheles [ 61 ] [ 66 ],[ 67 ] mosquitoes. Despite the potential utility of this intervention, challenges such as optimization of the delivery methods, insecticide resistance, and potential non-target effects threaten the prospective adoption and long-term use of ATSBs [ 57 ], [ 68 ]. Moreover, the attractiveness of ATSBs to adult mosquitoes compared to available plant sugar sources remains critical. Mosquito-specific Sh.463-56.10R yeast can be delivered in sachet bait stations. The yeast has been shown to increase mosquito attraction to the bait stations that have been successfully used in semi-field trials on adult Aedes and Culex mosquitoes [ 69 ]. In addition to deployment of Sh.463-56.10R yeast as a larvicide, the yeast could therefore also potentially prove beneficial to A. stephensi adult control programs, but the yeast has not yet been evaluated in this mosquito species. The Sh.463-56.10R yeast was suspended in Westham sugar bait and fed to adult A. stephensi females. Sh.463-56.10R yeast resulted in significant adult mortality with respect to sugar control (Westham bait alone), and control yeast (prepared with Westham bait) treatments, inducing mortality rates of 93.2 ± 1.7% in the treatment compared to 5.3 ± 3% in Westham sugar and 3.6 ± 4% in control yeast bait stations (Fig. 2 a; P < 0.001 vs. both Westham sugar and yeast control, the mortality of which were not significantly different from each other). Similar observations were made in previous studies involving adult Aedes and Culex mosquitoes[ 30 ] [ 69 ]. As illustrated in the survival curve ( Fig. 2 c ) , adult A. stephensi treated with Sh.463-56.10R - ATSB died beginning on day two until day six, when the trial was concluded. Survival curve comparisons with the log-rank (Mantel–Cox) test revealed significant differences in survival times between Sh.463-56.10R yeast ATSB vs sugar and yeast control treatments ( P < 0.001). Silencing of the Shaker gene was observed in adults that had been treated with Sh.463-56.10R yeast ATSB (57% reduction of the Shaker gene transcript, P < 0.001; Student’s t-test; (Fig. 2 b). Shaker gene silencing has resulted in neural defects, including a shaking phenotype that precedes death in A. aegypti [ 28 ]. In addition to loss of flying, Sh.463-56.10R yeast also resulted in a shaking phenotype similar to those observed in A. aegypti [ 28 ], suggesting that silencing of Sh results in neural defects that contribute to the death of A. stephensi. If RNAi-ATSBs are to be useful for control of A. stephensi , it is critical that the yeast-bait stations successfully attract these mosquitoes away from natural sugar sources. It was hypothesized that Coca-cola™ (hereafter referred to as soda), which has proven to be an excellent sugar bait for Aedes japonicus [ 70 ] and Drosophila suzukii [ 39 ], might prove to be a highly attractive sugar bait for A. stephensi. The attractiveness of 10% sucrose solution (commonly used in laboratory sugar feeding assays), Westham bait, and soda for the delivery of Sh.463-56.10R yeast pesticide to adult A. stephensi was examined as a function of mortality. Compared to the yeast-Westham bait or 10% sucrose-yeast formulation, significantly higher levels of adult female mortality were observed when the yeast insecticide was delivered using soda as a sugar bait (Fig. 3 a, soda vs. 10% sugar, 96%± 4%, vs. 39%±4%, P = 0.002; Fig. 3 b, soda vs. Westham sugar, 99%±1% vs. 11%±2%, P = 0.002). The higher mortality rates in treatment cages with soda-yeast ATSB vs. other sugar baits demonstrate the adult females’ higher preference for soda as a sugar source. Similar results observed in Aedes , Culex and A. gambiae adults, which will be discussed elsewhere, suggest that the use of soda for the delivery of RNAi yeast may be beneficial for control of many different disease vector mosquitoes. The results of these trials suggest that Sh.463-56.10R yeast could be deployed in bait stations to kill A. stephensi adult mosquitoes, and that soda may effectively compete against natural sugar sources, which must still be assessed in the field. Plant sugar feeding is a dietary requirement for both male and female adult mosquitoes [ 71 ], and plant sugar feeding in the home environment, both indoors and outdoors, has been described in malaria mosquitoes [ 72 ]. Moreover, A. stephensi obtains blood meals from both humans and animals and exhibits more outdoor feeding[ 73 ], suggesting that the use of RNAi yeast ATSBs could prove effective for mosquito control in the home environment. 3. Female-specific yeast larvicides facilitate male mosquito sorting in 3. Female-specific yeast larvicides facilitate male mosquito sorting in A. stephensi In addition to insecticides, population-based control strategies such as SIT or release of insects carrying a dominant lethal (RIDL) [ 74 ], [ 75 ], could prove valuable in the fight against A. stephensi. However, these strategies often rely on the release of mating-competitive adult males, and efficient, effective, and globally deployable methods for scaled production of males can be a barrier to the development of such programs [ 78 – 81 ]. Previous studies demonstrated that yeast RNAi-mediated silencing of genes such as MtnB and GGT in the M/m sex-determining locus region of A. aegypti during larval development resulted in death of female larvae. Moreover, silencing the orthologs of these genes in A. albopictus and Culex spp. larvae killed females [ 31 ],[ 32 ] leading to the hypothesis that silencing of the A. stephensi MtnB and GGT orthologs would kill female larvae. To test this, yeast larvicides corresponding to the A. stephensi MtnB and GGT genes were prepared and fed to A. stephensi larvae. Larval consumption of Mtn B.715, and MtnB .716 yeasts (targeting the MtnB gene), GGT -A.699, and GGT -B.700 (targeting the GGT gene) yeasts resulted in significant female deaths with respect to control yeast treatment (Fig. 4 a, Chi- square, ***= P < 0.001). These deaths occurred during the third instar stage. However, targeting the MtnB or GGT genes also resulted in significant death of males (Fig. 4 a, Chi- square, ***= P < 0.001), indicating that these larvicides were not good choices for use as sex-separation tools. This was somewhat surprising given that silencing of these genes, which are located adjacent to the A. aegypti sex-determining M/m locus, results in female-specific larval lethality in Aedes, Culex , and A. gambiae mosquitoes and production of fit adult males [ 31 , 32 ]. It is possible that these genes are required in A. stephensi male larvae, or perhaps the larvicides, which were designed to be as gene-specific as possible, have unintended off-targeting effects on other necessary loci. The doublesex (dsx) gene, a key regulator of sex-specific development[ 80 ][ 81 ] in many insects including A. stephensi , has both male ( dsx M) and female-specific ( dsx F) transcripts (Gene Bank, dsx M: KP257287.1; dsx F: KP257286.1). In Drosophila , the differential splicing of the female-specific dsxF transcript is regulated by transformer (Tra) and transformer 2 (Tra2) [ 82 ], [ 83 ]. Yeast larvicides corresponding to the female A. stephensi dsx transcript, dsx F.744 and dsx F.745 as well as larvicides corresponding to the tra ( Tra .717 and Tra .718) and tra2 genes ( Tra2 .721, Tra2 .722) were generated and assessed through larval feedings in the lab. Although silencing of dsxF resulted in female-specific lethality, silencing of tra and tra2 resulted in death of both A. stephensi males and females (Fig. 4 a, Chi- square, *** = P < 0.001). It is possible that off-targeting by the Tra.717, Tra.718, Tra2 .721, and Tra2 .722 larvicides leads to silencing of genes other than Tra and Tra2 . Alternatively, perhaps Tra and Tra2 have taken on additional critical roles in A. stephensi males. Of the putative female-specific larvicides tested, the dsx F.744 and dsx F.745 larvicides resulted in the highest male: female ratios, with 4 female: 1 male ratios in the surviving offspring. Moreover, no significant male death was detected, and no significant impact on male survival (Fig. 4 a, P 0.05, dsx F vs . food control treated males) and competitive mating (Fig. 4 b, P > 0.05, dsx F vs . food control treated males), were found. Similar results were obtained when Taracena et al.[ 84 ] used a bacterial system that targeted the female transcript of A. gambiae . Additionally, Whyard et al.[ 85 ] successfully used RNAi to silence the female-specific dsx transcript in A. aegypti larvae through oral feeding assays conducted using an E. coli dsRNA expression system, which resulted in female-specific deaths following larval consumption. The inclusion of these female-specific yeast larvicides in A. stephensi control programs that rely on large-scale male releases could be valuable. As demonstrated in Culex mosquitoes [ 35 ], scaled production of female-specific yeast larvicides can be achieved using industrial-scale robust yeast strains that may enhance the efficacy, efficiency, and cost-effectiveness of male sorting technology. Although the female-specific larvicide clearly cannot serve as a standalone technique for sex separation, it could likely be used in conjunction with other sex separation techniques to increase productivity and speed of the sorting process. Moreover, given that it acts during the third instar, it could help reduce costs associated with mass rearing mosquitoes. In this manner, the use of yeast RNAi female-specific larvicides targeting dsxF in A. stephensi could promote the design of globally deployable strategies to improve male sex separation, which is often required for population-based mosquito control strategies [ 74 ]. CONCLUSIONS Here we demonstrated that RNAi yeast can be used as an effective larvicide, adulticide, or male sex separator in A. stephensi. Larviciding is a key method for controlling A. stephensi larvae, and the generation of a new class of eco-friendly RNAi yeast larvicides, which could be used in rotations with existing larvicides, is likely to benefit long-term larviciding campaigns. Moreover, it could be used in conjunction with RNAi yeast ATSBs for integrated mosquito control. Given the outcomes of the recent field trials conducted with the Westham bait station in Africa, which indicated that the ATSB stations did not reduce the incidence of malaria [ 86 ], [ 87 ], the increased attractiveness of the yeast-soda combination (in ATSB bait stations) could prove to be useful in integrated A. stephensi control programs, but this will need to be further assessed in future field trials, in which the residual activity of the yeast sugar baits can be further evaluated. Finally, the addition of a male sex separator in mass larval rearing diets is likely to facilitate SIT campaigns. Weng et al.[ 88 ] have elegantly pursued generation of a separator strain that enables precise male selection from the first instar larval stages. However, the yeast method is more portable and doesn’t require the use or alteration of transgenic strains. In summary, we have succeeded in the generation of new RNAi yeast strains for the control of A. stephensi mosquitoes. Our studies demonstrated that the RNAi yeast can be used for successful larviciding, adulticiding, and sex-separation in support of mosquito control programs. Abbreviations ANOVA Analysis of Variance ASB Attractive Sugar Bait ATSB Attractive Targeted Sugar Bait cDNA complementary DNA DNA Deoxyribonucleic acid dsRNA double stranded RNA dsx F Female-specific doublesex dsx M Male-specific doublesex GGT Gamma-glutamyltransferase IRP Interference RNA pesticide LC 50 Lethal Concentration which kills 50% of test the animals LC 90 Lethal Concentration which kills 90% of test the animals MR Mass Rearing MtnB Metallothionein B PCR Polymerase chain reaction qPCR Quantitative PCR RFP Red Fluorescent Protein RhB Rhodamine B RIDL Release of Insects carrying a Dominant Lethal RNA Ribonucleic acid RNAi RNA interference rps7 ribosomal protein 7 RT-qPCR Reverse Transcription quantitative PCR SEM Standard Error of the Mean Sh Shaker shRNA short hairpin RNA siRNA small interfering RNA SIT Sterile Insect Technique SSA Sub-Saharan Africa Tra Transformer Tra2 Transformer 2 WH Westham WHO World Health Organization Declarations Ethics approval and consent to participate: Not applicable Consent for publication: Not applicable Availability of data and materials: All data generated or analyzed during this study are included in this published article [and its supplementary information files]. Competing Interests: Indiana University holds US patent US12302904B2, on which MDS is listed as the Inventor. She is also inventor on Indiana University’s pending application US20220248690A1. The patent and pending application did not influence her interpretation of the data or the decision to submit this work for publication. All the other authors declare no competing interests. Funding This work was supported by NIH/NIAID Awards 1R21AI180409 and R21AI182680 to MDS. Teresia Njoroge was also supported in part by the Indiana Center for Translational Science Initiative through a Global Health Reciprocal Innovation Demonstration award funded in part by Grant Number UM1TR004402 from the National Institutes of Health, National Center for Advancing Translational Sciences, Clinical and Translational Sciences Award. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Authors’ contributions T.M.N and M.D.S. conceived and designed the study; T.M.N., M.H.A., K.M., A.T.M.S., L.S. and D.D.A. performed all the lab studies; T.M.N and M.D.S. analyzed the data and wrote the manuscript; M.D.S obtained the funding and supervised the project. T.M.N. also obtained funding. All authors have read and agreed to the published version of the manuscript. Acknowledgements We thank our lab technician Britton Sofhauser for helping to make the yeast pesticides used in this project. We also thank Westham Company for supplying their sugar bait and membrane for the ATSB studies. References World malaria report. 2025 [Internet]. [cited 2026 Jan 27]. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2025 . Accessed 27 Jan 2026. Tuteja R. Malaria - An overview. FEBS Journal [Internet]. John Wiley, Sons L. 2007 [cited 2025 Nov 27];274:4670–9. https://doi.org/10.1111/J.1742-4658. 2007.05997.X;CTYPE:STRING:JOURNAL. White GB. Anopheles gambiae complex and disease transmission in Africa. Trans R Soc Trop Med Hyg [Internet]. Trans R Soc Trop Med Hyg; 1974 [cited 2025 Aug 4];68:278–98. https://doi.org/10.1016/0035-9203(74)90035-2 . Coetzee M, Craig M, Le Sueur D. Distribution of African malaria mosquitoes belonging to the Anopheles gambiae complex. Parasitology Today [Internet]. Parasitol Today; 2000 [cited 2025 Aug 4];16:74–7. https://doi.org/10.1016/S0169-4758(99)01563-X Dia I, Guelbeogo MW, Ayala D, Dia I, Guelbeogo MW, Ayala D. Advances and Perspectives in the Study of the Malaria Mosquito Anopheles funestus. Anopheles mosquitoes - New insights into malaria vectors [Internet]. IntechOpen; 2013 [cited 2025 Aug 4]; https://doi.org/10.5772/55389 Rubio-Palis Y, Zimmerman RH. Ecoregional Classification of Malaria Vectors in the Neotropics. J Med Entomol [Internet]. Entomological Society of America; 1997 [cited 2025 Aug 4];34:499–510. https://doi.org/10.1093/JMEDENT/34.5.499 . Laporta GZ, Linton YM, Wilkerson RC, Bergo ES, Nagaki SS, Sant’Ana DC, et al. Malaria vectors in South America: Current and future scenarios. Parasit Vectors [Internet]. Volume 8. BioMed Central Ltd.; 2015. pp. 1–13. [cited 2025 Aug 4];. https://doi.org/10.1186/S13071-015-1038-4/TABLES/2 . Arevalo-Herrera M, Quiñones ML, Guerra C, Céspedes N, Giron S, Ahumada M, et al. Malaria in selected non-Amazonian countries of Latin America. Acta Trop [Internet] Acta Trop. 2012;121:303–14. https://doi.org/10.1016/j.actatropica.2011.06.008 . [cited 2025 Aug 4];. Conn JE, Grillet ME, Correa M, Sallum MAM, Conn JE, Grillet ME et al. Malaria Transmission in South America—Present Status and Prospects for Elimination. Towards Malaria Elimination - A Leap Forward [Internet]. IntechOpen; 2018 [cited 2025 Aug 4]; https://doi.org/10.5772/INTECHOPEN.76964 . Sinka ME, Bangs MJ, Manguin S, Coetzee M, Mbogo CM, Hemingway J et al. The dominant Anopheles vectors of human malaria in Africa, Europe and the Middle East: Occurrence data, distribution maps and bionomic précis. Parasit Vectors [Internet]. Parasit Vectors; 2010 [cited 2025 Aug 4];3. https://doi.org/10.1186/1756-3305-3-117 . Surendran SN, Sivabalakrishnan K, Sivasingham A, Jayadas TTP, Karvannan K, Santhirasegaram S, et al. Anthropogenic Factors Driving Recent Range Expansion of the Malaria Vector Anopheles stephensi . Front Public Health [Internet] Front Media S A. 2019;7:53. https://doi.org/10.3389/FPUBH.2019.00053 . [cited 2025 Aug 4];. Anopheline species complexes in South. and South-East Asia [Internet]. [cited 2025 Aug 4]. https://iris.who.int/handle/10665/204779 . Accessed 4 Aug 2025. Taylor R, Messenger LA, Abeku TA, Clarke SE, Yadav RS, Lines J. Invasive Anopheles stephensi in Africa: insights from Asia. Volume 40. Elsevier Ltd; 2024. pp. 731–43. [cited 2025 Aug 4];. https://doi.org/10.1016/j.pt.2024.06.008 . Trends Parasitol [Internet]. Faulde MK, Rueda LM, Khaireh BA. First record of the Asian malaria vector Anopheles stephensi and its possible role in the resurgence of malaria in Djibouti, Horn of Africa. Acta Trop [Internet] Elsevier. 2014;139:39–43. https://doi.org/10.1016/j.actatropica.2014.06.016 . [cited 2025 Aug 4];. de Santi VP, Khaireh BA, Chiniard T, Pradines B, Taudon N, Larréché S, et al. Role of Anopheles stephensi Mosquitoes in Malaria Outbreak, Djibouti, 2019. Emerg Infect Dis [Internet]. Volume 27. Centers for Disease Control and Prevention (CDC); 2021. p. 1697. [cited 2025 Aug 4];. https://doi.org/10.3201/EID2706.204557 . Emiru T, Getachew D, Murphy M, Sedda L, Ejigu LA, Bulto MG, et al. Evidence for a role of Anopheles stephensi in the spread of drug- and diagnosis-resistant malaria in Africa. Nat Med [Internet] Nat Res. 2023;29:3203–11. https://doi.org/10.1038/S41591-023-02641-9 . [cited 2025 Aug 4];. Balkew M, Mumba P, Dengela D, Yohannes G, Getachew D, Yared S, et al. Geographical distribution of Anopheles stephensi in eastern Ethiopia. Parasit Vectors [Internet]. BioMed Central Ltd.; 2020. [cited 2025 Aug 4];13. https://doi.org/10.1186/S13071-020-3904-Y . Balkew M, Mumba P, Yohannes G, Abiy E, Getachew D, Yared S et al. An update on the distribution, bionomics, and insecticide susceptibility of Anopheles stephensi in Ethiopia, 2018–2020. Malar J [Internet]. BioMed Central Ltd; 2021 [cited 2025 Aug 4];20. https://doi.org/10.1186/S12936-021-03801-3 . WHO initiative to stop the spread of Anopheles stephensi in Africa. 2023 update [Internet]. [cited 2025 Nov 27]. https://www.who.int/publications/i/item/WHO-UCN-GMP-2022.06 . Accessed 27 Nov 2025. Pucca MB, de Sousa TN, Cardoso de Melo G, Viana GMR, Editorial. Challenges for diagnosis, treatment, and elimination of malaria. Front Trop Dis Front Media SA. 2024;5. https://doi.org/10.3389/FITD.2024.1394693/PDF . Mnzava A, Monroe AC, Okumu F. Anopheles stephensi in Africa requires a more integrated response. Malar J [Internet]. BioMed Central Ltd; 2022 [cited 2025 Aug 4];21:1–6. https://doi.org/10.1186/S12936-022-04197-4/METRICS Hodgson E, Levi PE. Pesticides: an important but underused model for the environmental health sciences. Environ Health Perspect [Internet]. Environ Health Perspect; 1996 [cited 2025 Nov 27];104 Suppl 1:97–106. https://doi.org/10.1289/EHP.96104S197 Pesticides | US EPA [Internet]. [cited 2025 Aug 4]. https://www.epa.gov/pesticides . Accessed 4 Aug 2025. Airs PM, Bartholomay LC. RNA Interference for Mosquito and Mosquito-Borne Disease Control. Insects [Internet]. Insects; 2017 [cited 2025 Nov 27];8. https://doi.org/10.3390/INSECTS8010004 Wiltshire RM, Duman-Scheel M. Advances in oral RNAi for disease vector mosquito research and control. Volume 40. Elsevier Inc.; 2020. pp. 18–23. [cited 2025 Nov 27];. https://doi.org/10.1016/j.cois.2020.05.002 . Curr Opin Insect Sci [Internet]. Hapairai LK, Mysore K, Chen Y, Harper EI, Scheel MP, Lesnik AM et al. Lure-and-Kill Yeast Interfering RNA Larvicides Targeting Neural Genes in the Human Disease Vector Mosquito Aedes aegypti. Scientific Reports 2017 7:1 [Internet]. Nature Publishing Group; 2017 [cited 2025 Nov 27];7:13223-. https://doi.org/10.1038/s41598-017-13566-y Hapairai LK, Mysore K, Sun L, Li P, Wang CW, Scheel ND, et al. Characterization of an adulticidal and larvicidal interfering RNA pesticide that targets a conserved sequence in mosquito G protein-coupled dopamine 1 receptor genes. Insect Biochem Mol Biol [Internet]. Elsevier Ltd; 2020. [cited 2025 Aug 4];120. https://doi.org/10.1016/j.ibmb.2020.103359 . Mysore K, Hapairai LK, Sun L, Li P, Wang CW, Scheel ND, et al. Characterization of a dual-action adulticidal and larvicidal interfering RNA pesticide targeting the Shaker gene of multiple disease vector mosquitoes. PLoS Negl Trop Dis [Internet] Public Libr Sci. 2020;14:e0008479. https://doi.org/10.1371/JOURNAL.PNTD.0008479 . [cited 2025 Aug 4];. Kamb A, Iverson LE, Tanouye MA. Molecular characterization of Shaker , a Drosophila gene that encodes a potassium channel. Cell [Internet]. Cell; 1987 [cited 2025 Aug 4];50:405–13. https://doi.org/10.1016/0092-8674(87)90494-6 Brizzee C, Mysore K, Njoroge TM, McConnell S, Hamid-Adiamoh M, Stewart ATM et al. Targeting Mosquitoes through Generation of an Insecticidal RNAi Yeast Strain Using Cas-CLOVER and Super PiggyBac Engineering in Saccharomyces cerevisiae. Journal of Fungi [Internet]. Multidisciplinary Digital Publishing Institute (MDPI); 2023 [cited 2025 Aug 4];9. https://doi.org/10.3390/JOF9111056 . Mysore K, Sun L, Roethele JB, Li P, Igiede J, Misenti JK et al. A conserved female-specific larval requirement for MtnB function facilitates sex separation in multiple species of disease vector mosquitoes. Parasit Vectors [Internet]. BioMed Central Ltd; 2021 [cited 2025 Aug 4];14:1–11. https://doi.org/10.1186/S13071-021-04844-W/FIGURES/3 Mysore K, Sun L, Li P, Roethele JB, Misenti JK, Kosmach J et al. A Conserved Female-Specific Requirement for the GGT Gene in Mosquito Larvae Facilitates RNAi-Mediated Sex Separation in Multiple Species of Disease Vector Mosquitoes. Pathogens [Internet]. MDPI; 2022 [cited 2025 Aug 4];11. https://doi.org/10.3390/PATHOGENS11020169 . Criscione F, Qi Y, Tu Z. GUY1 confers complete female lethality and is a strong candidate for a male-determining factor in Anopheles stephensi. Elife [Internet]. Volume 5. eLife Sciences Publications Ltd; 2016. p. e19281. [cited 2025 Nov 27];. https://doi.org/10.7554/ELIFE.19281 . Catteruccia F, Benton JP, Crisanti A. An Anopheles transgenic sexing strain for vector control. Nature Biotechnology. 2005 23:11 [Internet]. Nature Publishing Group; 2005 [cited 2025 Nov 27];23:1414–7. https://doi.org/10.1038/nbt1152 Brizzee C, Mysore K, Njoroge TM, McConnell S, Crawford J, Duman-Scheel M. Generation of a Culex Male Mosquito Sex-Separation RNAi Yeast Strain Using Cas-CLOVER and Super PiggyBac Engineering in Saccharomyces cerevisiae. Fermentation. 2023, Vol 9, Page 999 [Internet]. Multidisciplinary Digital Publishing Institute; 2023 [cited 2025 Nov 27];9:999. https://doi.org/10.3390/FERMENTATION9120999 Methods in Anopheles Research - MR. 4 [Internet]. [cited 2025 Aug 4]. https://www.yumpu.com/en/document/view/49409322/methods-in-anopheles-research-mr4 . Accessed 4 Aug 2025. Mysore K, Hapairai LK, Wei N, Realey JS, Scheel ND, Severson DW, et al. Preparation and Use of a Yeast shRNA Delivery System for Gene Silencing in Mosquito Larvae. Volume 1858. Humana Press Inc.; 2019. p. 213. [cited 2025 Aug 4];. https://doi.org/10.1007/978-1-4939-8775-7_15 . Methods Mol Biol [Internet]. Handbook for integrated. vector management [Internet]. [cited 2025 Aug 4]. https://www.who.int/publications/i/item/9789241502801 . Accessed 4 Aug 2025. Mysore K, Graham J, Njoroge TM, Stewart ATM, Nelaturi S, Duman-Scheel M. Development of an eco-friendly RNAi yeast attractive targeted sugar bait that silences the shaker gene in spotted-wing drosophila, Drosophila suzukii . John Wiley and Sons Ltd; 2025. Pest Manag Sci [Internet]. https://doi.org/10.1002/PS.70228;REQUESTEDJOURNAL:JOURNAL:15264998;WGROUP:STRING:PUBLICATION . [cited 2025 Nov 27]. Epis S, Porretta D, Mastrantonio V, Comandatore F, Sassera D, Rossi P, et al. ABC transporters are involved in defense against permethrin insecticide in the malaria vector Anopheles stephensi. Parasit Vectors [Internet]. BioMed Central Ltd; 2014. [cited 2025 Aug 4];7. https://doi.org/10.1186/1756-3305-7-349 . Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods [Internet]. Academic Press Inc.; 2001 [cited 2025 Aug 4];25:402–8. https://doi.org/10.1006/meth.2001.1262 Krzywinska E, Ferretti L, Li J, Li JC, Chen CH, Krzywinski J. femaleless Controls Sex Determination and Dosage Compensation Pathways in Females of Anopheles Mosquitoes. Current Biology [Internet]. Cell Press; 2021 [cited 2025 Aug 4];31:1084–1091.e4. https://doi.org/10.1016/j.cub.2020.12.014 Custom Dicer-Substrate siRNA. (DsiRNA) | IDT [Internet]. [cited 2025 Aug 4]. https://www.idtdna.com/site/order/designtool/index/CRISPRCUSTOM . Accessed 4 Aug 2025. Mumberg D, Müller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene [Internet] Gene. 1995;156:119–22. https://doi.org/10.1016/0378-1119(95)00037-7 . [cited 2025 Aug 4];. Van Dijken JP, Bauer J, Brambilla L, Duboc P, Francois JM, Gancedo C, et al. An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb Technol [Internet]. Volume 26. Elsevier Science Inc; 2000. pp. 706–14. [cited 2025 Nov 27];. https://doi.org/10.1016/S0141-0229(00)00162-9 . Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T et al. Fiji: an open-source platform for biological-image analysis. Nature Methods 2012 9:7 [Internet]. Nature Publishing Group; 2012 [cited 2025 Nov 27];9:676–82. https://doi.org/10.1038/nmeth.2019 Aviles EI, Rotenberry RD, Collins CM, Dotson EM, Benedict MQ. Fluorescent markers rhodamine B and uranine for Anopheles gambiae adults and matings. Malaria Journal 2020 19:1 [Internet]. BioMed Central; 2020 [cited 2025 Nov 27];19:236-. https://doi.org/10.1186/S12936-020-03306-5 Li I, Mak KW, Wong J, Tan CH. Using the Fluorescent Dye, Rhodamine B, to Study Mating Competitiveness in Male Aedes aegypti Mosquitoes. J Vis Exp [Internet] J Vis Exp. 2021. https://doi.org/10.3791/62432 . [cited 2025 Nov 27];2021. Mysore K, Sun L, Hapairai LK, Wang CW, Igiede J, Roethele JB et al. A yeast RNA-interference pesticide targeting the Irx gene functions as a broad-based mosquito larvicide and adulticide. Insects [Internet]. MDPI; 2021 [cited 2025 Nov 27];12:986. https://doi.org/10.3390/INSECTS12110986/S1 Mysore K, Sun L, Hapairai LK, Wang CW, Roethele JB, Igiede J, et al. A broad-based mosquito yeast interfering rna pesticide targeting Rbfox1 represses notch signaling and kills both larvae and adult mosquitoes. Pathogens [Internet] MDPI. 2021. https://doi.org/10.3390/PATHOGENS10101251 . [cited 2025 Aug 4];10. Mysore K, Sun L, Hapairai LK, Wang CW, Igiede J, Roethele JB, et al. A yeast RNA-interference pesticide targeting the Irx gene functions as a broad-based mosquito larvicide and adulticide. Insects [Internet] MDPI. 2021. https://doi.org/10.3390/INSECTS12110986 . [cited 2025 Aug 4];12. Mysore K, Njoroge TM, Stewart ATM, Winter N, Hamid-Adiamoh M, Sun L et al. Characterization of a novel RNAi yeast insecticide that silences mosquito 5-HT1 receptor genes. Scientific Reports 2023 13:1 [Internet]. Nature Publishing Group; 2023 [cited 2025 Aug 4];13:1–17. https://doi.org/10.1038/s41598-023-49799-3 WHO’s interim position statement on larviciding for. malaria control in Africa [Internet]. [cited 2025 Nov 27]. https://www.malariaworld.org/blogs/whos-interim-position-statement-larviciding-malaria-control-africa . Accessed 27 Nov 2025. Kumar A, Sharma VP, Sumodan PK, Thavaselvam D, Kamat RH. Malaria control utilizing Bacillus sphaericus against Anopheles stephensi in Panaji, Goa. J Am Mosq Control Assoc [Internet]. 1994 [cited 2025 Nov 28];10:534–9. https://europepmc.org/article/med/7707060 . Accessed 28 Nov 2025. Walker K, Lynch M. Contributions of Anopheles larval control to malaria suppression in tropical Africa: Review of achievements and potential. Med Vet Entomol [Internet]. Med Vet Entomol; 2007 [cited 2025 Aug 4];21:2–21. https://doi.org/10.1111/J.1365-2915.2007.00674.X . Mysore K, Oxley JD, Duckham C, Castilla-Gutierrez C, Stewart ATM, Winter N et al. Development of a controlled-release mosquito RNAi yeast larvicide suitable for the sustained control of large water storage containers. Scientific Reports 2024 14:1 [Internet]. Nature Publishing Group; 2024 [cited 2025 Nov 27];14:30186-. https://doi.org/10.1038/s41598-024-81800-5 Fiorenzano JM, Koehler PG, Xue R, De. Attractive Toxic Sugar Bait (ATSB) For Control of Mosquitoes and Its Impact on Non-Target Organisms: A Review. Int J Environ Res Public Health 2017. 2017;14:398. https://doi.org/10.3390/IJERPH14040398 . Page 398 [Internet][cited 2025 Nov 28];. Multidisciplinary Digital Publishing Institute. Khallaayoune K, Qualls WA, Revay EE, Allan SA, Arheart KL, Kravchenko VD, et al. Attractive Toxic Sugar Baits: Control of Mosquitoes With the Low-Risk Active Ingredient Dinotefuran and Potential Impacts on Nontarget Organisms in Morocco. Environ Entomol [Internet]. 2013;42:1040. https://doi.org/10.1603/EN13119 . [cited 2025 Aug 4];. Fulcher A, Scott JM, Qualls WA, Müller GC, Xue R, De. Attractive toxic sugar baits mixed with pyriproxyfen sprayed on plants against adult and larval Aedes albopictus (Diptera: Culicidae). J Med Entomol [Internet] Entomol Soc Am. 2014;51:896–9. https://doi.org/10.1603/ME13243 . [cited 2025 Aug 4];. Qualls WA, Müller GC, Revay EE, Allan SA, Arheart KL, Beier JC, et al. Evaluation of attractive toxic sugar bait (ATSB)-Barrier for control of vector and nuisance mosquitoes and its effect on non-target organisms in sub-tropical environments in Florida. Acta Trop [Internet] Acta Trop. 2014;131:104–10. https://doi.org/10.1016/j.actatropica.2013.12.004 . [cited 2025 Aug 4];. Junnila A, Revay EE, Müller GC, Kravchenko V, Qualls WA, de Xue R, et al. Efficacy of attractive toxic sugar baits (ATSB) against Aedes albopictus with garlic oil encapsulated in beta-cyclodextrin as the active ingredient. Acta Trop [Internet] Elsevier B V. 2015;152:195. https://doi.org/10.1016/J.ACTATROPICA.2015.09.006 . [cited 2025 Aug 4];. Sissoko F, Junnila A, Traore MM, Traore SF, Doumbia S, Dembele SM, et al. Frequent sugar feeding behavior by Aedes aegypti in Bamako, Mali makes them ideal candidates for control with attractive toxic sugar baits (ATSB). PLoS One [Internet]. Volume 14. Public Library of Science; 2019. p. e0214170. [cited 2025 Aug 4];. https://doi.org/10.1371/JOURNAL.PONE.0214170 . Müller GC, Junnila A, Qualls W, Revay EE, Kline DL, Allan S, et al. Control of Culex quinquefasciatus in a storm drain system in Florida using attractive toxic sugar baits. Med Vet Entomol [Internet] Med. 2010;24:346–51. https://doi.org/10.1111/J.1365-2915.2010.00876.X . [cited 2025 Aug 4];. Vet Entomol. Müller GC, Junnila A, Schlein Y. Effective control of adult Culex pipiens by spraying an attractive toxic sugar bait solution in the vegetation near larval habitats. J Med Entomol [Internet] J Med Entomol. 2010;47:63–6. https://doi.org/10.1603/033.047.0108 . [cited 2025 Aug 4];. Qualls WA, Scott-Fiorenzano J, Müller GC, Arheart KL, Beier JC, Xue R, De. Evaluation and Adaptation of Attractive Toxic Sugar Baits for Culex tarsalis and Culex quinquefasciatus Control in the Coachella Valley, Southern California. J Am Mosq Control Assoc Am Mosq Control Association. 2016;32:292–9. https://doi.org/10.2987/16-6589.1 . Beier JC, Müller GC, Gu W, Arheart KL, Schlein Y. Attractive toxic sugar bait (ATSB) methods decimate populations of Anopheles malaria vectors in arid environments regardless of the local availability of favoured sugar-source blossoms. Malar J [Internet] Malar J. 2012. https://doi.org/10.1186/1475-2875-11-31 . [cited 2025 Aug 4];11. Traore MM, Junnila A, Traore SF, Doumbia S, Revay EE, Kravchenko VD, et al. Large-scale field trial of attractive toxic sugar baits (ATSB) for the control of malaria vector mosquitoes in Mali, West Africa. Volume 19. BioMed Central Ltd.; 2020. pp. 1–16. [cited 2025 Aug 4];. https://doi.org/10.1186/S12936-020-3132-0/TABLES/8 . Njoroge TM, Hamid-Adiamoh M, Duman-Scheel M. Maximizing the Potential of Attractive Targeted Sugar Baits (ATSBs) for Integrated Vector Management. Insects 2023. Volume 14. Multidisciplinary Digital Publishing Institute; 2023. p. 585. [cited 2025 Nov 28];. https://doi.org/10.3390/INSECTS14070585 . Page 585 [Internet]. Stewart ATM, Mysore K, Njoroge TM, Winter N, Feng RS, Singh S et al. Demonstration of RNAi Yeast Insecticide Activity in Semi-Field Larvicide and Attractive Targeted Sugar Bait Trials Conducted on Aedes and Culex Mosquitoes. Insects 2023, Vol 14, Page 950 [Internet]. Multidisciplinary Digital Publishing Institute; 2023 [cited 2025 Aug 4];14:950. https://doi.org/10.3390/INSECTS14120950 Fryzlewicz L, Vanwinkle A, Lahondère C. Development of an Attractive Toxic Sugar Bait for the Control of Aedes j. japonicus (Diptera: Culicidae). Volume 59. Oxford University Press; 2022. pp. 308–13. [cited 2025 Aug 4];. https://doi.org/10.1093/JME/TJAB151 . J Med Entomol [Internet]. Foster WA. Mosquito sugar feeding and reproductive energetics. Annu Rev Entomol [Internet]. Annu Rev Entomol. 1995;40:443–74. https://doi.org/10.1146/ANNUREV.EN.40.010195.002303 . [cited 2025 Aug 4];. Omondi S, Kosgei J, Agumba S, Polo B, Yalla N, Moshi V et al. Natural sugar feeding rates of Anopheles mosquitoes collected by different methods in western Kenya. Scientific Reports 2022 12:1 [Internet]. Nature Publishing Group; 2022 [cited 2023 Mar 9];12:1–9. https://doi.org/10.1038/s41598-022-25004-9 Tadesse FG, Ashine T, Teka H, Esayas E, Messenger LA, Chali W et al. Anopheles stephensi Mosquitoes as Vectors of Plasmodium vivax and falciparum , Horn of Africa, 2019. Emerg Infect Dis [Internet]. Centers for Disease Control and Prevention (CDC); 2021 [cited 2025 Aug 4];27:603. https://doi.org/10.3201/EID2702.200019 Papathanos PA, Bourtzis K, Tripet F, Bossin H, Virginio JF, Capurro ML et al. A perspective on the need and current status of efficient sex separation methods for mosquito genetic control. Parasit Vectors [Internet]. BioMed Central; 2018 [cited 2025 Aug 4];11. https://doi.org/10.1186/S13071-018-3222-9 . Nolan T, Papathanos P, Windbichler N, Magnusson K, Benton J, Catteruccia F, et al. Developing transgenic Anopheles mosquitoes for the sterile insect technique. Genetica [Internet] Genetica. 2011;139:33–9. https://doi.org/10.1007/S10709-010-9482-8 . [cited 2025 Nov 28];. Benedict MQ, Robinson AS. The first releases of transgenic mosquitoes: An argument for the sterile insect technique. Trends Parasitol [Internet]. Volume 19. Elsevier Ltd; 2003. pp. 349–55. [cited 2025 Nov 27];. https://doi.org/10.1016/S1471-4922(03)00144-2 . Papathanos PA, Bossin HC, Benedict MQ, Catteruccia F, Malcolm CA, Alphey L, et al. Sex separation strategies: past experience and new approaches. Malar J [Internet] Malar J. 2009. https://doi.org/10.1186/1475-2875-8-S2-S5 . [cited 2025 Nov 27];8 Suppl 2. Alphey L, Benedict M, Bellini R, Clark GG, Dame DA, Service MW et al. Sterile-Insect Methods for Control of Mosquito-Borne Diseases: An Analysis. Vector Borne and Zoonotic Diseases [Internet]. 2010 [cited 2025 Nov 27];10:295. https://doi.org/10.1089/VBZ.2009.0014 Soma DD, Maïga H, Mamai W, Bimbile-Somda NS, Venter N, Ali AB, et al. Does mosquito mass-rearing produce an inferior mosquito? Malar J [Internet] Malar J. 2017. https://doi.org/10.1186/S12936-017-2012-8 . [cited 2025 Nov 27];16. Baker BS, Wolfner MF. A molecular analysis of doublesex , a bifunctional gene that controls both male and female sexual differentiation in Drosophila melanogaster . Genes Dev [Internet] Genes Dev. 1988;2:477–89. https://doi.org/10.1101/GAD.2.4.477 . [cited 2025 Nov 27];. Verhulst EC, Van de zande L. Double nexus–Doublesex is the connecting element in sex determination. Brief Funct Genomics [Internet]. Brief Funct Genomics; 2015 [cited 2025 Nov 27];14:396–406. https://doi.org/10.1093/BFGP/ELV005 Verhulst EC, van de Zande L, Beukeboom LW. Insect sex determination: It all evolves around transformer. Curr Opin Genet Dev [Internet]. Curr Opin Genet Dev. 2010;20:376–83. https://doi.org/10.1016/j.gde.2010.05.001 . [cited 2025 Nov 27];. Clough E, Jimenez E, Kim YA, Whitworth C, Neville MC, Hempel LU, et al. Sex- and tissue-specific functions of Drosophila doublesex transcription factor target genes. Dev Cell [Internet] Cell Press. 2014;31:761–73. https://doi.org/10.1016/j.devcel.2014.11.021 . [cited 2025 Nov 27];. Taracena ML, Hunt CM, Benedict MQ, Pennington PM, Dotson EM. Downregulation of female doublesex expression by oral-mediated RNA interference reduces number and fitness of Anopheles gambiae adult females. Parasites & Vectors 2019 12:1 [Internet]. BioMed Central; 2019 [cited 2025 Nov 27];12:170-. https://doi.org/10.1186/S13071-019-3437-4 Whyard S, Erdelyan CNG, Partridge AL, Singh AD, Beebe NW, Capina R. Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs. Parasites & Vectors 2015 8:1 [Internet]. BioMed Central; 2015 [cited 2025 Nov 27];8:96-. https://doi.org/10.1186/S13071-015-0716-6 Ogwang C, Samuels AM, McDermott DP, Kamau A, Lesosky M, Obiet K, et al. Attractive targeted sugar baits for malaria control in western Kenya (ATSB-Kenya) – Effect of ATSBs on epidemiologic and entomologic indicators: A Phase III, open-label, cluster-randomised, controlled trial. PLOS Global Public Health [Internet] Public Libr Sci. 2025;5:e0004230. https://doi.org/10.1371/JOURNAL.PGPH.0004230 . [cited 2025 Nov 27];. Sarrassat S, Toure M, Diarra A, Keita M, Coulibaly H, Arou AZ, et al. Evaluation of Attractive Targeted Sugar Baits, a new outdoor vector control strategy against malaria: Results from a cluster randomised open-label parallel arm controlled trial in Southwestern Mali. Journal of Infection [Internet]. Volume 91. W.B. Saunders; 2025. p. 106524. [cited 2025 Nov 27];. https://doi.org/10.1016/J.JINF.2025.106524 . Weng SC, Chen F, Li M, Lee S, Gerry C, Turksoy DC et al. Establishing a dominant early larval sex-selection strain in the Asian malaria vector Anopheles stephensi. Infectious Diseases of Poverty 2024 13:1 [Internet]. BioMed Central; 2024 [cited 2025 Nov 27];13:83-. https://doi.org/10.1186/S40249-024-01256-7 Additional Declarations Competing interest reported. Indiana University holds US patent US12302904B2, on which MDS is listed as the Inventor. She is also inventor on Indiana University’s pending application US20220248690A1. The patent and pending application did not influence her interpretation of the data or the decision to submit this work for publication. All the other authors declare no competing interests. Supplementary Files FigureS1.jpg Figure S1. Method for preparation of the RNAi yeast sachet for delivery of ATSBs to adult mosquitoes. RNAi-Yeast ATSB is delivered to adult mosquitoes in a sachet that is comprised of a black porous Westham membrane and plastic backing. Dried heat-inactivated RNAi yeast is mixed with Westham (WH) sugar bait on plastic attached to a porous WH membrane (A) to make a yeast ATSB suspension (B). The sachet is sealed (C) and presented to adult mosquitoes (porous side up) for ATSB probing (D).​ Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 07 Mar, 2026 Reviewers agreed at journal 05 Mar, 2026 Reviewers agreed at journal 05 Mar, 2026 Reviewers invited by journal 05 Mar, 2026 Editor assigned by journal 27 Feb, 2026 Submission checks completed at journal 27 Feb, 2026 First submitted to journal 26 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8982626","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":597997015,"identity":"33e8143d-0c4c-43da-bd95-eee7ecc008db","order_by":0,"name":"Teresia M. Njoroge","email":"","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Teresia","middleName":"M.","lastName":"Njoroge","suffix":""},{"id":597997016,"identity":"bee3eeca-ff19-4490-973c-a09d2acc0610","order_by":1,"name":"Majidah Hamid-Adiamoh","email":"","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Majidah","middleName":"","lastName":"Hamid-Adiamoh","suffix":""},{"id":597997017,"identity":"191f9d23-cc1d-4c8a-8468-5ce713de48ed","order_by":2,"name":"Keshava Mysore","email":"","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Keshava","middleName":"","lastName":"Mysore","suffix":""},{"id":597997018,"identity":"3c004cf0-ba48-46b2-a041-fb06ca094bce","order_by":3,"name":"Akilah T. M. Stewart","email":"","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Akilah","middleName":"T. M.","lastName":"Stewart","suffix":""},{"id":597997019,"identity":"ac0f0004-96cd-4a64-ace3-a22f940a57e2","order_by":4,"name":"Longhua Sun","email":"","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Longhua","middleName":"","lastName":"Sun","suffix":""},{"id":597997020,"identity":"c25aff83-37a8-4f2b-a333-5599e857a3b2","order_by":5,"name":"Darlene D. Akaiso","email":"","orcid":"","institution":"University of Notre Dame","correspondingAuthor":false,"prefix":"","firstName":"Darlene","middleName":"D.","lastName":"Akaiso","suffix":""},{"id":597997021,"identity":"fe465b00-9ac6-4cdb-9f43-c7a9cc857ffa","order_by":6,"name":"Molly Duman-Scheel","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAq0lEQVRIiWNgGAWjYHACNiC2kGNgSGBg4CFBi4Qx6VoSG4jWott/+NmDDxUS6dvZExgfvG0jQovZjTRzwxlnJHJ39jxgNpxLnBYeNmneNoncDTcSQAxitJw/wyb9959EusGNBPbfxGk5kMMmzdggkQDUwsZMnJYbaWaSPcckDDecedgsOeccUQ47/EziR42NvMHx5IMf3pQRoQUJMDaQpn4UjIJRMApGAW4AAPXsNOx4005cAAAAAElFTkSuQmCC","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Molly","middleName":"","lastName":"Duman-Scheel","suffix":""}],"badges":[],"createdAt":"2026-02-27 02:38:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8982626/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8982626/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104400016,"identity":"22bbcd40-392b-4638-8b85-f38f6fd3ff96","added_by":"auto","created_at":"2026-03-11 12:08:33","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":365542,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOral consumption of Sh.463-56.10R yeast induces \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. stephensi \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003elarval death.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eA. stephensi \u003c/em\u003elarval consumption of inactivated dried Sh.463-56.10R yeast induced significant mortality in lab assays. (\u003cstrong\u003eA\u003c/strong\u003e) Larvicide trials with data represented as mean percentage mortality; error bars represent standard error of the mean (SEM), and *** = \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 (Mann-Whitney U test) in comparison to control yeast-treated larvae; (\u003cstrong\u003eB\u003c/strong\u003e) Silencing of the \u003cem\u003eSh\u003c/em\u003e gene target following larval consumption of Sh.463-56.10R yeast. Data represent mean relative quantity (RQ); error bars represent SEM, and *** = \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 (Student’s t-test) in comparison to control yeast-treated larvae. (\u003cstrong\u003eC\u003c/strong\u003e) Survival curves for 1\u003csup\u003est\u003c/sup\u003e instar larvae treated with Sh.463-56.10R yeast or control yeast. Consumption of the yeast larvicide induced larval mortality in the third and fourth instars (L3 and L4), days 6–13; compared to larvae fed with control yeast that survived and pupariated). Comparison of the survival curves with the log-rank (Mantel–Cox) test revealed significant differences in survival times between the treatment and control (\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;0.001).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8982626/v1/f0af98a5050236d6d46d2c05.jpg"},{"id":103718022,"identity":"171e4982-afb2-4d8f-8fcd-28ed162a1221","added_by":"auto","created_at":"2026-03-02 06:27:01","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":357529,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConsumption of Sh.463-56.10R yeast as an ATSB induces high levels of adult \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. stephensi \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003edeaths.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOral consumption of inactivated dried Sh.463-56.10R yeast as an ATSB by adult \u003cem\u003eA. stephensi \u003c/em\u003einduced significant mortality in lab assays. (\u003cstrong\u003eA\u003c/strong\u003e) Adulticide trials; data are represented as mean percentage mortality; error bars represent SEM, and *** = \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 (Kruskal-Wallis test) in comparison to both Westham sugar and control yeast-treated adults. (\u003cstrong\u003eB\u003c/strong\u003e) Silencing of the \u003cem\u003eSh\u003c/em\u003e gene following consumption of Sh.463-56.10R yeast ATSB by adult \u003cem\u003eA. stephensi\u003c/em\u003e after 96h. Data are represented as mean relative quantity (RQ); error bars represent SEM, and *** = \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 (Student’s t-test) in comparison to control yeast-ATSB treated adults. (\u003cstrong\u003eC\u003c/strong\u003e) Survival curves for adult \u003cem\u003eA. stephensi\u003c/em\u003e treated with Sh.463-56.10R yeast-ATSB, Westham bait (ASB) or yeast control-ATSB. Consumption of Sh.463-56.10R yeast-ATSB induced adult mortality on days 3–6; compared to adult \u003cem\u003eA. stephensi\u003c/em\u003e fed with Westham ASB and control yeast-ATSB, that survived and pupariated. Comparisons of the survival curves with the log-rank (Mantel–Cox) test revealed significant differences in survival times between the treatment and control groups (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8982626/v1/1eee7b07269b17fabb6a08ec.jpg"},{"id":103718023,"identity":"9bf4e1b4-23dd-423a-a4bc-28b3aeeb3466","added_by":"auto","created_at":"2026-03-02 06:27:01","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":215408,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSoda is the preferred sugar bait in adult \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. stephensi\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e ASB choice assays.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe attractiveness of 10% sugar, Westham bait, and soda for the delivery of Sh.463-56.10R\u003cstrong\u003e \u003c/strong\u003eyeast\u003cstrong\u003e \u003c/strong\u003eas an ATSB to adult \u003cem\u003eA. stephensi\u003c/em\u003e is demonstrated as a function of mortality. Compared to the Sh.463-56.10R-Westham bait or Sh.463-56.10R-10% sugar-yeast formulations, significantly higher levels of adult female mortality were observed when Sh.463-56.10R insecticidal yeast was delivered using soda as a sugar bait (\u003cstrong\u003eFig. 3a\u003c/strong\u003e, 10% sugar-Sh.463-56.10R ATSB vs. soda-Sh.463-56.10R ATSB; \u003cstrong\u003eFig. 3b\u003c/strong\u003e, Westham sugar-Sh.463-56.10R ATSB vs soda-Sh.463-56.10R ATSB; error bars represent SEM, and \u003cem\u003eP \u003c/em\u003e= 0.002, Mann-Whitney U test). ASB: attractive sugar bait; ATSB: attractive targeted sugar bait.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8982626/v1/41ec29666ac99ab297686b06.jpg"},{"id":103718019,"identity":"63660752-30dc-4a25-b3b2-697a0fe29c78","added_by":"auto","created_at":"2026-03-02 06:27:01","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":468192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLarvicidal screen of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. stephensi\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e putative female-specific larval lethal genes for male mosquito sorting.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLarval consumption of the \u003cem\u003eGGT\u003c/em\u003e.699, \u003cem\u003eGGT\u003c/em\u003e.700, \u003cem\u003eMtnB\u003c/em\u003e.715, \u003cem\u003eMtnB\u003c/em\u003e.716, \u003cem\u003eTra\u003c/em\u003e.717, \u003cem\u003eTra\u003c/em\u003e.718, \u003cem\u003eTra2\u003c/em\u003e.721, and \u003cem\u003eTra2\u003c/em\u003e.722 yeast larvicides resulted in significant female and male deaths with respect to control yeast (\u003cstrong\u003eFig. 4a\u003c/strong\u003e, Chi- square, ***= \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001). \u003cem\u003eA. stephensi\u003c/em\u003e larval treatment with \u003cem\u003edsx\u003c/em\u003eF.744 and \u003cem\u003edsx\u003c/em\u003eF.745 yeast larvicides targeting the female-specific \u003cem\u003edsx\u003c/em\u003e gene resulted in the highest male: female ratios, with 4 female: 1 male ratios in the surviving offspring (\u003cstrong\u003eFig. 4a\u003c/strong\u003e, Chi- square, ***= \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001). Larval consumption of \u003cem\u003edsx\u003c/em\u003eF.744 and \u003cem\u003edsx\u003c/em\u003eF.745 yeast larvicides did not significantly impact \u003cem\u003eA. stephensi\u003c/em\u003e males’ mating competitiveness (\u003cstrong\u003eFig. 4b\u003c/strong\u003e, and \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05 (Chi- square for each of three experiments in which males of the indicated treatments competed for mating with wild type females), or wing lengths (\u003cstrong\u003eFig. 4c\u003c/strong\u003e, \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05, with respect to food control. Error bars represent SEM.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8982626/v1/51463f408c7393f2dd9630d8.jpg"},{"id":104407827,"identity":"d84c5ab3-9d88-4d34-8726-b33fbfd6b1bc","added_by":"auto","created_at":"2026-03-11 12:40:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2636621,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8982626/v1/7e57880f-8dda-4acd-bdfb-bcf3b205cc0c.pdf"},{"id":103718021,"identity":"faf0faad-3bd1-43f9-bffa-4082fd654d2f","added_by":"auto","created_at":"2026-03-02 06:27:01","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":270371,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S1. Method for preparation of the RNAi yeast sachet for delivery of ATSBs to adult mosquitoes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNAi-Yeast ATSB is delivered to adult mosquitoes in a sachet that is comprised of a black porous Westham membrane and plastic backing. Dried heat-inactivated RNAi yeast is mixed with Westham (WH) sugar bait on plastic attached to a porous WH membrane \u003cstrong\u003e(A)\u003c/strong\u003e to make a yeast ATSB suspension \u003cstrong\u003e(B).\u003c/strong\u003e The sachet is sealed \u003cstrong\u003e(C)\u003c/strong\u003e and presented to adult mosquitoes (porous side up) for ATSB probing \u003cstrong\u003e(D).​\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"FigureS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8982626/v1/fcf438bba6664d4708c80851.jpg"}],"financialInterests":"Competing interest reported. Indiana University holds US patent US12302904B2, on which MDS is listed as the Inventor. She is also inventor on Indiana University’s pending application US20220248690A1. The patent and pending application did not influence her interpretation of the data or the decision to submit this work for publication. All the other authors declare no competing interests.","formattedTitle":"Targeting the Highly Invasive Malaria Vector Anopheles stephensi using Yeast RNAi Pesticides","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eMalaria, a serious and sometimes fatal illness, is a huge economic and public health burden globally, with an estimated 263\u0026nbsp;million cases and approximately 600,000 malaria deaths annually [\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e]. Although malaria affects at least 80 countries worldwide, the African region carries a proportionately high share of the global malaria burden, with 94% of malaria cases occurring there, and children under age five accounting for about 76% of all malaria deaths [\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e]. Malaria is transmitted by the bite of infective female \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes that vector protozoan parasites of the genus \u003cem\u003ePlasmodium\u003c/em\u003e. Although about 60 species of \u003cem\u003eAnopheles\u003c/em\u003e are known competent vectors of the \u003cem\u003ePlasmodium\u003c/em\u003e parasites, under natural conditions only 30 are of major significance [\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e]. Historically, the \u003cem\u003eAnopheles gambiae complex\u003c/em\u003e and \u003cem\u003eAnopheles funestus\u003c/em\u003e species, occur predominantly in Africa and are responsible for malaria transmission in the highly malaria endemic region [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e–\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. In Latin America, \u003cem\u003eA. darlingi\u003c/em\u003e and \u003cem\u003eA. marajoara\u003c/em\u003e are among the primary vectors of malaria [\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e–\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. In the Asian-pacific region that includes South Asia and the Middle East, several dozen malaria vector species exist, both zoophilic and exophilic [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e], and \u003cem\u003eA. stephensi\u003c/em\u003e has been recognized as an important vector of malaria in urban areas across the region [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e–\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eA. stephensi\u003c/em\u003e is domicile to the Asian continent where it has been reported as one of the major drivers of malaria in the region. The malaria mosquito has also colonized at least eight countries in sub-Saharan Africa (SSA) since 2012 and is now spreading at an alarming rate [\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]. \u003cem\u003eA. stephensi\u003c/em\u003e is a competent vector of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e and \u003cem\u003ePlasmodium vivax\u003c/em\u003e, which are the primary malaria parasites in SSA, and has been implicated in malaria epidemics in Djibouti [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e],[\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e] and Ethiopia [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]. Unlike other malaria vectors, \u003cem\u003eA. stephensi\u003c/em\u003e exhibits high ecological plasticity and is considered both an urban and peri-urban adapted malaria vector, which breeds in artificial water containers such as overhead tanks, cisterns, ditches and canals [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e], [\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]. Although malaria in Africa has been predominantly a rural disease, it is expected that transmission will rise in the rapidly growing urban areas where \u003cem\u003eA. stephensi\u003c/em\u003e populations establish, calling for an urgent need for integrated responses to control the invasive malaria vector. In 2023, the WHO[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e] released a threat notice highlighting the spread of \u003cem\u003eA. stephensi\u003c/em\u003e in the Horn of Africa and advised public health authorities to heighten vector surveillance efforts. New tools are vitally needed to combat the dangerous malaria vector.\u003c/p\u003e \u003cp\u003eVector-targeted interventions that mostly involve use of chemical insecticides have proven effective in preventing malaria transmission [\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e], but this vector control approach is currently faced with challenges that warrant the discovery of new tools for integrated vector management. Just like other disease vector mosquitoes, the \u003cem\u003eA. stephensi\u003c/em\u003e strains that were detected in Africa are largely resistant to commonly used insecticides and prefer to bite people outdoors, making bed nets and indoor residual spraying, the mainstays of malaria vector control, less effective for combatting the invasive malaria vector [\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, there are serious concerns regarding public health and the environmental safety of chemical-based pesticides [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e] and hence new classes of pesticides that are effective and environmentally safe are vitally needed. RNA interference (RNAi)-based pesticides are promising novel insect pest management tools with the potential to be both safe and effective. These pesticides employ RNAi, an innate regulatory mechanism occurring in eukaryotes, that enables targeted gene silencing in many organisms, including mosquitoes. For the past 25 years, RNAi technology has advanced as a useful research tool with the potential to translate innovative bench research into practical pest control strategies [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]. The objective of this research was to evaluate the potential for RNAi yeast-based technologies to facilitate the control of \u003cem\u003eA. stephensi.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn recent years, we have pursued larvicide[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e] and adulticide[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e] screens for RNAi insecticides. In the present study, we evaluate a novel mosquito control technology in \u003cem\u003eA. stephensi\u003c/em\u003e, in which we investigate the insecticidal activity of Sh.463, an RNAi pesticide consisting of a short hairpin RNA (shRNA) expressed in yeast that targets the mosquito \u003cem\u003eShaker\u003c/em\u003e (\u003cem\u003eSh\u003c/em\u003e) gene [\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. The insecticidal yeast is propagated, heat killed and lyophilized then evaluated in larvae and adult \u003cem\u003eA. stephensi\u003c/em\u003e. Mosquito larvae consume the yeast readily as part of their diet, and for the adults, the insecticidal yeast is mixed with sugar and presented to sugar seeking adults as an ATSB. Following mosquito consumption, the RNAi yeast was designed to silence the \u003cem\u003eSh\u003c/em\u003e gene, which is expressed widely in Dipteran nervous systems. The neuron-specific gene encodes an evolutionarily conserved subunit of a voltage-gated potassium channel responsible for membrane repolarization and release of neurotransmitters in the brain [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. Sh.463 recognizes a conserved \u003cem\u003eSh\u003c/em\u003e target site found in \u003cem\u003eAedes, Culex\u003c/em\u003e, and \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes, including \u003cem\u003eA. stephensi\u003c/em\u003e [\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e], but not in non-target organisms. Based on previous analyses of the insecticidal activity of Sh.463 yeast, as well as Sh.463-56.10R, a robust strain with enhanced Sh.463 shRNA production [\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e], in larvae and adult \u003cem\u003eA. gambiae, Aedes\u003c/em\u003e, and \u003cem\u003eCulex\u003c/em\u003e mosquitoes [\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e], it was hypothesized that Sh.463-56.10R would silence the \u003cem\u003eA. stephensi Sh\u003c/em\u003e gene, resulting in death of both larvae and adults.\u003c/p\u003e \u003cp\u003eIn addition to identifying genes to be targeted for killing larvae and adults, we also performed screens in \u003cem\u003eAedes aegypti\u003c/em\u003e that identified female-specific RNAi larvicides [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e], some of which target female larval lethal genes such as \u003cem\u003eMtnB\u003c/em\u003e[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e] and \u003cem\u003eGGT\u003c/em\u003e[\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e] that are conserved in different mosquito species, to facilitate male sex separation. It is hypothesized that targeting the \u003cem\u003eA. stephensi\u003c/em\u003e orthologs of these or other female-specific larval lethal genes might enable male sex separation. This would facilitate deployment of the sterile insect technique (SIT) or other population control methods. Although other methods for male sex sorting of mosquitoes have been developed [\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e–\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e], the use of female-specific yeast methodology requires only the addition of dried RNAi yeast to the larval diet during rearing, which yields female deaths and up to 5 male:1 female sex ratios in adults. The adult males produced by this technology have shown no loss of fitness in laboratory experiments [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]. RNAi yeast-based diets that facilitate scaled rearing and separation of \u003cem\u003eAedes\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e males have been developed [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e], [\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e], suggesting that this technology can be adapted for use in \u003cem\u003eA. stephensi.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn summary, the goals of this study are to assess whether RNAi yeast technology can be applied for larviciding, adulticiding (through ATSBs), and male sex separation in the malaria vector mosquito \u003cem\u003eA. stephensi.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e\u003c/p\u003e "},{"header":"METHODS","content":"\u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003eMosquito rearing\u003c/b\u003e \u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e\u003cp\u003eThe \u003cem\u003eA. stephen\u003c/em\u003es\u003cem\u003ei\u003c/em\u003e strain used in this investigation was obtained from BEI Resources (NIAID, NIH: \u003cem\u003eA. stephensi\u003c/em\u003e, Strain STE2, Eggs, MRA-128, contributed by Mark Q. Benedict). This mosquito strain was reared as described [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e], except that the adult females were blood fed using a Hemotek artificial membrane feeding system (Hemotek Limited, Blackburn, UK) to deliver sheep blood that was purchased from HemoStat Laboratories, Dixon, CA. The insectary used for mosquito rearing and insecticidal assays was maintained at 26°C, ~ 80% relative humidity, with a 12 hr dark/12 hr light cycle that included 1hr crepuscular periods at the beginning and end of each cycle.\u003c/p\u003e\n\u003ch3\u003e2. Yeast preparation\u003c/h3\u003e\n\u003cp\u003eThe Sh.463-56.10R yeast strain previously described by Brizzee et al. [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] was used in this investigation. This second-generation yeast strain of the original Sh.463 strain [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] bears multiple copies of a high-expression \u003cem\u003eSh.463\u003c/em\u003e short hairpin expression cassette, allowing for scaled production of the Sh.463 shRNA, which corresponds to the following target sequence: 5\u0026rsquo;- AUUUAAAUUAUCUAGGCAUUCGAAA\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo; in the \u003cem\u003eA. stephensi Shaker\u003c/em\u003e gene. DMT347.1R, the control RNAi strain used in this investigation, was previously described by Brizzee et al. [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and recognizes 5\u0026rsquo;-GAAGAGCACUGAUAGAUGUUAGCGU-3\u0026rsquo;, a target site that has not been identified in any of the mosquito species [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The DMT347.1R yeast strain (hereafter referred to as the control) contains multiple integrations of the shRNA expression cassette [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Both the Sh.463-56.10R and control RNAi yeast strains are suitable for scaled RNAi yeast production [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Yeast was cultured and prepared for insecticide assays as previously described [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] except that production was scaled in a bioreactor (Chemglass Life Sciences, Vineland, New Jersey, USA) and dried using a freeze-dryer (Labconco, Kansas City, Missouri, USA).\u003c/p\u003e\n\u003ch3\u003e3. Larvicide assays\u003c/h3\u003e\n\u003cp\u003eLaboratory larvicide assays were performed according to WHO[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] mosquito larvicidal testing guidelines. A previously described protocol[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] was followed using Sh.463-56.10R insecticidal or control yeast fed to 20 first instar larvae reared in 500 mL plastic cups with 50 mL distilled water according to the WHO protocol. Mortality, pupariation, and adult emergence data were collected. Three biological trials, each with six replicates, were performed for each treatment (total of 360 larvae for each treatment group), and the mortality data were analyzed using SPSS 25 (IBM, Armonk, NY USA) software with the Mann-Whitney U-test.\u003c/p\u003e\n\u003ch3\u003e4. Adulticide Studies\u003c/h3\u003e\n\u003cp\u003eThe Sh.463-56.10R insecticidal yeast or control yeast was mixed with Westham sugar matrix (Westham LLC, Israel) to make a yeast ATSB insecticide and presented to five-day old adult female \u003cem\u003eA. stephensi\u003c/em\u003e in the insectary according to a protocol described previously [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. LC\u003csub\u003e50\u003c/sub\u003e and LC\u003csub\u003e90\u003c/sub\u003e concentrations of Sh.463-56.10R yeast ATSB were determined previously [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], and these data were used to select the appropriate dosage for the present investigation. For each feeding treatment of 25 adult female mosquitoes, 20 mg of lyophilized yeast (treatment or control) were placed on a 6 cm \u0026times; 6 cm piece of a porous Westham membrane (Westham LLC, Israel). A volume of 100 \u0026micro;L of Westham sugar matrix was added to the pre-weighed yeast (20mg) and mixed thoroughly with a toothpick to create a paste on top of the membrane. A second piece of membrane was placed over the yeast and sealed with a heat sealer to create a sachet containing yeast insecticide. The method for preparation of the RNAi yeast sachet is shown in \u003cb\u003eFig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e. The sachet containing the yeast-ATSB pesticide or control was delivered to mosquitoes in insectary sugar bait trials by placing it at the bottom of a cage containing 25 five-day old adult females that had been starved overnight. Engorged females were assessed daily for behavioral phenotypes, mortality, and morbidity for six days. Three biological trials, each with three replicates, were conducted for each treatment (total of 225 adult mosquitoes for each treatment), and data were analyzed using SPSS 25 (IBM, Armonk, NY USA) software with Kruskal-Wallis test.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e5. Attractive sugar bait (ASB) choice assays in adult \u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e5. Attractive sugar bait (ASB) choice assays in adult \u003cem\u003eA. stephensi\u003c/em\u003e\u003c/div\u003e \u003cp\u003eTo identify the most attractive sugar bait for effective delivery of RNAi yeast to adult \u003cem\u003eA. stephensi\u003c/em\u003e, choice assays were conducted in the insectary using a 10% sucrose solution, Westham sugar matrix or soda (Coca-cola\u0026trade;) as a sugar source. To achieve this, dual-choice experiments were performed to evaluate mosquito feeding preference which was determined using adult mosquito mortality. The choice experiments were conducted in 3.75 L (30 cm \u0026times; 30 cm x 30 cm) BugDorm-1 insect rearing cages (MegaView Science Co., Ltd, Taichung, Taiwan) using both treatment yeast and control yeast mixed with either of two sugar sources and simultaneously placed in the cage. An ASB sugar control for each sugar type was also included in separate cages to verify that sugar feeding occurred. All the yeast-sugar bait formulations (yeast-10% sugar, yeast-soda, and yeast-Westham sugar bait) were prepared to a final sugar-yeast concentration of 333.3 \u0026micro;g/\u0026micro;L as described[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] and presented to 25 adult female \u003cem\u003eA. stephensi\u003c/em\u003e per cage that were allowed to feed on the treatments overnight. For the yeast-10% sugar vs. yeast-soda formulation adult feeding trials, the treatments were administered using MUDUODUO automatic bird drinker cups (Amazon, Seattle Washington) custom-designed as ATSB feeders as described [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. For the yeast-soda vs. yeast-Westham bait formulation trials, the treatments were presented in the well of an inverted 2 oz transparent polypropylene plastic condiment container with the yeast ATSB covered by a perforated stretched parafilm to facilitate adult mosquito probing. Two yeast treatments bearing different sugar baits were positioned in opposite corners of the experimental cages to ensure equal exposure and unbiased access by the mosquitoes. Each treatment pair was tested in three biological trials, with two replicates each, giving a total of 150 adult \u003cem\u003eA. stephensi\u003c/em\u003e per treatment group. The location of the treatment and control baits was permutated in these trials. Mortality and morbidity were monitored and recorded for six days. The mortality data were statistically analyzed using SPSS 25 (IBM, Armonk, NY USA) software with the Mann-Whitney U test.\u003c/p\u003e\n\u003ch3\u003e6. Confirmation of Shaker gene silencing in larvae and adult \u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e6. Confirmation of Shaker gene silencing in larvae and adult \u003cem\u003eA. stephensi\u003c/em\u003e\u003c/div\u003e \u003cp\u003eSilencing of the \u003cem\u003eShaker\u003c/em\u003e gene target in \u003cem\u003eA. stephensi\u003c/em\u003e larvae and adults following consumption of Sh.463-56.10R yeast was verified using RT-qPCR, which was performed on mosquitoes that had been treated with control or insecticidal yeast. For the larval assays, total RNA was extracted from pools of 20 third instar larvae that had been treated with Sh.463-56.10R yeast or control yeast. Three biological trials, each with three replicates (total of nine replicates) were conducted for the assay. For the adult assays, total RNA was extracted from individual females (n\u0026thinsp;=\u0026thinsp;15, generated in three biological replicate trials) that had consumed Sh.463-56.10R yeast ATSB or control yeast ATSB for 96 hours. TRIzol (Invitrogen, Carlsbad, CA) was used to extract total RNA as described in the manufacturer\u0026rsquo;s instructions; the RNA was then treated with DNase 1 using the DNA-free kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA) according to the manufacturer\u0026rsquo;s instructions. The High Capacity RNA to cDNA Kit (Applied Biosystems, Foster City, CA) was used to generate cDNA, the amplification of which was performed in a CFX Opus 96 Real-time PCR System (Bio-Rad, Hercules, CA) using the Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the following primers: \u003cem\u003eSh\u003c/em\u003eF9 for: 5\u0026rsquo; GGCACAAAGATCGAGGAGG 3\u0026rsquo; and \u003cem\u003eSh\u003c/em\u003eF9 rev: 5\u0026rsquo; CCTCTTCTTCGGCGACTAC 3\u0026rsquo;. The amplification of \u003cem\u003eA. stephensi ribosomal protein\u003c/em\u003e 7 \u003cem\u003e(rps7)\u003c/em\u003e was performed with the primers 5\u0026prime; AGCAGCAGCAGCACTTGATTTG 3\u0026prime; (forward) and 5\u0026prime; TAAACGGCTTTCTGCGTCACCC 3\u0026prime; (reverse)[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and used for data normalization. The qPCR reactions were performed in three technical replicate wells in each of three separate biological replicate trials. Results from these assays were quantified through standardization of reactions to levels of \u003cem\u003erps7\u003c/em\u003e using the ΔΔCt method as described [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Treatment and control data were statistically analyzed using Microsoft Excel 365 software with the Student\u0026rsquo;s t-test.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003e7. Development and evaluation of\u003c/strong\u003e \u003cstrong\u003eA. stephensi\u003c/strong\u003e \u003cstrong\u003efemale-specific larvicides\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e \u003cem\u003eA. stephensi\u003c/em\u003e female-specific yeast RNAi pesticides were prepared through characterization of putative \u003cem\u003eA. stephensi\u003c/em\u003e female-specific larval lethal genes. An siRNA (small interfering RNA) screen was performed using orthologs of \u003cem\u003eA. aegypti\u003c/em\u003e and \u003cem\u003eA. gambiae\u003c/em\u003e female-specific larval lethal genes [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e],[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] in \u003cem\u003eA. stephensi.\u003c/em\u003e Custom siRNAs corresponding to the orthologous genes were selected using the Integrated DNA Technologies (IDT) Custom Dicer-Substrate siRNA (DsiRNA) tool [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Custom siRNAs, including a control siRNA with no known target in mosquitoes, were purchased from Integrated DNA Technologies (Coralville, IA). In summary, short hairpin RNA expression cassettes corresponding to putative target sites in each gene were designed as described [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Custom DNA oligonucleotides corresponding to these sequences were purchased from Invitrogen (Carlsbad, CA) and cloned into pRS426 GPD, a non-integrating bacteria-yeast shuttle vector bearing a \u003cem\u003eURA3\u003c/em\u003e marker that permits constitutive expression of inserts cloned downstream of a GPD promoter [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Following sequencing to confirm the inserted sequences, the plasmids were transformed into the \u003cem\u003eS. cerevisiae CEN.PK\u003c/em\u003e strain yeast [genotype \u003cem\u003eMATa/α ura3-52/ura3-52 trp1-289/trp1-289 leu2-3_112/leu2-3_112 his3 Δ1/his3 Δ1 MAL2- 8C/MAL2-8C SUC2/SUC2]\u003c/em\u003e [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], and the transformants were selected by growth on minimal media lacking uracil. The yeast IRPs were then cultured, heat-killed, and dried for larval feedings as described [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eA. stephensi\u003c/em\u003e female-specific IRPs produced were used to perform larvicidal bioassays in accordance with WHO [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] guidelines in the insectary (see above). Adult male and female emergence rates and sexes were evaluated, and data were statistically analyzed with the Chi-square test. The success of population-based mosquito control programs such as SIT depends on male fitness which determines the ability of the released sterile males to compete with the existing wild-type male populations for wild-type females and induce sterility in the target population. To assess \u003cem\u003eA. stephensi\u003c/em\u003e male fitness following consumption of female-specific yeast larvicides, \u003cem\u003eA. stephensi\u003c/em\u003e female-specific \u003cem\u003edoublesex\u003c/em\u003e (\u003cem\u003edsx\u003c/em\u003eF) larvicide, which resulted in significant female larval deaths in lab assays was evaluated. \u003cem\u003eA. stephensi\u003c/em\u003e male fitness following consumption of \u003cem\u003edsx\u003c/em\u003eF yeast larvicide was examined through wing length measurements and mating competitiveness assays in the laboratory:\u003c/p\u003e \u003cp\u003e \u003cb\u003ea)\u003c/b\u003e \u003cb\u003eA. stephensi\u003c/b\u003e \u003cb\u003emales wing length assays\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo evaluate \u003cem\u003eA. stephensi\u003c/em\u003e adult males\u0026rsquo; fitness following consumption of larval rearing diet containing female-specific yeast larvicides, male wing lengths were estimated compared to mosquitoes grown on the normal rearing diet (food control). \u003cem\u003eA. stephensi\u003c/em\u003e adult males that had been fed with control diet, \u003cem\u003edsx\u003c/em\u003eF.744 or \u003cem\u003edsx\u003c/em\u003eF.745 yeasts during the larval stage were generated as described in section (\u003cb\u003e3\u003c/b\u003e) above. For each of the three treatment groups, three biological trials were conducted, each with 40 males per treatment. Individual adult males\u0026rsquo; wings were then mounted on specimen slides in pairs using a clear nail polish. Pictures were taken under a stereo microscope and analyzed using FIJI ImageJ software [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] to determine their wing lengths. The data from the control and two treatment groups were statistically analyzed using ANOVA.\u003c/p\u003e \u003cp\u003e \u003cb\u003eb) Competitive mating assays\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe mating competitiveness of \u003cem\u003eA. stephensi\u003c/em\u003e males following consumption of the male sorting dsxF yeast during larval rearing was conducted using Rhodamine B (RhB) (CAS: 81889, ThermoFisher Scientific, Waltham, Massachusetts, USA), a fluorescent dye used as a marker to trace mating. Briefly, virgin adult female \u003cem\u003eA. stephensi\u003c/em\u003e were crossed with \u003cem\u003edsx\u003c/em\u003eF\u003cem\u003e-\u003c/em\u003eA.744 or \u003cem\u003edsx\u003c/em\u003eF\u003cem\u003e-\u003c/em\u003eA.745 yeast-treated and marked (RhB+) and control unmarked males (RhB-) for copulation and their spermathecae dissected and examined for fluorescence to determine the mating partner using a fluorescent microscope following the methodology previously described [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBoth adult males and females were generated by rearing first instar \u003cem\u003eA. stephensi\u003c/em\u003e larvae to pupal stage (as described in section 3 above) using the standard mass-rearing (MR) diet, which served as a control (food control), \u003cem\u003edsx\u003c/em\u003eF.744 or \u003cem\u003edsx\u003c/em\u003eF.745 yeasts. For each treatment, the pupae were placed in individual vials to separate adult males from females. Newly emerged adult mosquitoes from the three treatments were then maintained with 10% sucrose solution with or without RhB for three days in 2 L (16.2 cm \u0026times; 16.2 cm x 15.5 cm) cages. Specifically, \u003cem\u003edsx\u003c/em\u003eF.744 and \u003cem\u003edsx\u003c/em\u003eF.745 treated males were marked through sugar feeding using 0.1% w/v RhB-sucrose solution made by dissolving 100mg of RhB powder for 100 mL of 10% w/v sucrose solution, for 3 days. The control males and females reared on their normal diets, hereafter referred to as \u0026ldquo;wild-type males and females\u0026rdquo; were each maintained using 10% sucrose solution for three days as well. The mating assays were conducted three days following sugar feeding by crossing 20 RhB marked males (RhB+), 20 unmarked wild-type males (RhB-) with 40 virgin wild-type female mosquitoes for three nights. Three biological replicate trials for each treatment were conducted (a total of 120 females were examined). The females\u0026rsquo; spermathecae were then dissected using a dissecting microscope, and their insemination and fluorescence status were determined using a fluorescent microscope. The spermathecae of the inseminated females were then examined for fluorescence to determine the mating partner. The spermathecae containing RhB+ seminal fluid was examined under the florescence microscope equipped with an RFP filter. The spermathecae for females that had mated with an RHB+ (treated) male fluoresced bright orange; those that mated with an unmarked (RhB-) wild type male had a spermathecae which did not fluoresce. The data from the control and two treatment groups were statistically analyzed with the Chi-square test.\u003c/p\u003e"},{"header":"RESULTS AND DISCUSSION","content":"\u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003eHigh levels of mortality are induced in\u003c/b\u003e \u003cb\u003eA. stephensi\u003c/b\u003e \u003cb\u003elarvae following consumption of Sh.463-56.10R yeast larvicide\u003c/b\u003e\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eOur previous high-throughput screens identified hundreds of IRPs, a number of which have target sites that are conserved in many species of disease vector mosquitoes, but not in humans or other non-target organisms, and which kill both larvae and adult mosquitoes [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], [\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Sh.463, one of these IRPs, is an shRNA that can be delivered to mosquitoes in \u003cem\u003eS. cerevisiae\u003c/em\u003e that are cultured to enable RNA propagation, and then heat-killed, dried, and fed to larvae. Laboratory trials have demonstrated that the yeast kills mosquito larvae of multiple species [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], [\u003cspan additionalcitationids=\"CR51\" citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], yet did not harm non-target organisms, suggesting that the insecticides could enable eco-friendly \u003cem\u003eA. stephensi\u003c/em\u003e control. Laboratory trials were therefore conducted on \u003cem\u003eA. stephensi\u003c/em\u003e larvae using the Sh.463-56.10R[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] yeast strain. As predicted, these laboratory larvicidal assays demonstrated that consumption of the heat-inactivated Sh.463-56.10R yeast effectively killed \u003cem\u003eA. stephensi\u003c/em\u003e larvae (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWhen treated with the yeast beginning in the first instar, \u003cem\u003eA. stephensi\u003c/em\u003e larval death occurred during the third or fourth instar stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ec), resulting in mortality rates of 88.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1% in the treated larvae (compared to control with 3.1\u0026thinsp;\u0026plusmn;\u0026thinsp;3.4%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Mann-Whitney U t-test). Furthermore, this larval lethality was achieved at dosages that were half (20 mg per 20 larvae) of those used in assays completed with the original first-generation Sh.463 laboratory yeast strain (40 mg per 20 larvae; [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]), which is consistent with recent findings in \u003cem\u003eAedes\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e larvae [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. That is because the Sh.463-56.10R strain, which was created using Cas-Clover and Super PiggyBac (sPB) transposase/transposon engineering systems, has multiple Sh.463 shRNA expression cassettes that were integrated into the yeast genome [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], enabling increased expression levels of shRNA in each yeast cell, permitting the use of smaller amounts of yeast, which is anticipated to cut the costs for use by mosquito control programs. Moreover, unlike the laboratory Sh.463 yeast strain, the production of Sh.463-56.10R is readily scaled, which would prove invaluable if large-scale field trials and the eventual launching of yeast larvicide distribution were to be pursued [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA previous study[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] demonstrated that death of \u003cem\u003eA. aegypti\u003c/em\u003e mosquito larvae correlated with silencing of the \u003cem\u003eSh\u003c/em\u003e gene, which coincided with significant neural defects. It was therefore hypothesized that silencing of the \u003cem\u003eSh\u003c/em\u003e gene in \u003cem\u003eA. stephensi\u003c/em\u003e larvae was responsible for mosquito larval mortality. RT-qPCR assays confirmed 62% silencing of \u003cem\u003eSh\u003c/em\u003e gene expression in the \u003cem\u003eSh.\u003c/em\u003e463-56.10R yeast-treated larvae (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Student\u0026rsquo;s t-test; (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eb), indicating that the mode of action for this insecticide in \u003cem\u003eA. stephensi\u003c/em\u003e larvae is through silencing of the \u003cem\u003eSh\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003e \u003cem\u003eA. stephensi\u003c/em\u003e has adapted to breeding in a wide variety of man-made containers including water storage tanks, discarded tires, ditches and canals[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] indicating that larviciding, a less commonly used \u003cem\u003eAnopheles\u003c/em\u003e mosquito control method in Africa, could prove effective for \u003cem\u003eA. stephensi\u003c/em\u003e control. The WHO, which recommends that larviciding be considered for malaria control in areas where breeding sites are few, fixed, and findable, suggested that larviciding may be a leading method for malaria vector control in urban areas [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In 1994, Kumar et al[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] reported decreased \u003cem\u003eA. stephensi\u003c/em\u003e densities and malaria incidence following \u003cem\u003eBacillus sphaericus\u003c/em\u003e larvicide treatment campaigns in India. \u003cem\u003eB. thuringiensis israelensis\u003c/em\u003e (Bti) and temephos have also been used to target \u003cem\u003eA. stephensi\u003c/em\u003e larvae [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Thus, it is anticipated that Sh.463 larvicides, which are also species-specific, could prove useful in \u003cem\u003eA. stephensi\u003c/em\u003e larviciding programs. Additionally, RNAi yeast larvicide has been prepared in large slow-release briquette formulations[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] that have demonstrated five months residual activity in semi-field trials conducted on \u003cem\u003eA. aegypti\u003c/em\u003e larvae in large water storage containers located on a rooftop laboratory in Trinidad [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Such formulations might prove useful for treatment of \u003cem\u003eA. stephensi\u003c/em\u003e, which also inhabit large water storage containers. This could be evaluated in future field trials.\u003c/p\u003e\n\u003ch3\u003e2. Consumption of Sh.463-56.10R yeast ATSB induced high levels of adult mortality:\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e2. Consumption of Sh.463-56.10R yeast ATSB induced high levels of adult \u003cem\u003eA. stephensi\u003c/em\u003e mortality:\u003c/div\u003e \u003cp\u003eATSBs, which capitalize on the natural sugar feeding behavior of adult mosquitoes that can be lured to feed on sugar bait that has been laced with an insecticide [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], have proven to be effective in the delivery of insecticides to target adult \u003cem\u003eAedes\u003c/em\u003e [\u003cspan additionalcitationids=\"CR59 CR60 CR61\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e], \u003cem\u003eCulex\u003c/em\u003e [\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e], and \u003cem\u003eAnopheles\u003c/em\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e] [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e],[\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e] mosquitoes. Despite the potential utility of this intervention, challenges such as optimization of the delivery methods, insecticide resistance, and potential non-target effects threaten the prospective adoption and long-term use of ATSBs [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Moreover, the attractiveness of ATSBs to adult mosquitoes compared to available plant sugar sources remains critical. Mosquito-specific Sh.463-56.10R yeast can be delivered in sachet bait stations. The yeast has been shown to increase mosquito attraction to the bait stations that have been successfully used in semi-field trials on adult \u003cem\u003eAedes\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e mosquitoes [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. In addition to deployment of Sh.463-56.10R yeast as a larvicide, the yeast could therefore also potentially prove beneficial to \u003cem\u003eA. stephensi\u003c/em\u003e adult control programs, but the yeast has not yet been evaluated in this mosquito species.\u003c/p\u003e \u003cp\u003eThe Sh.463-56.10R yeast was suspended in Westham sugar bait and fed to adult \u003cem\u003eA. stephensi\u003c/em\u003e females. Sh.463-56.10R yeast resulted in significant adult mortality with respect to sugar control (Westham bait alone), and control yeast (prepared with Westham bait) treatments, inducing mortality rates of 93.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7% in the treatment compared to 5.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3% in Westham sugar and 3.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4% in control yeast bait stations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ea; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 vs. both Westham sugar and yeast control, the mortality of which were not significantly different from each other). Similar observations were made in previous studies involving adult \u003cem\u003eAedes\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e mosquitoes[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. As illustrated in the survival curve \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e, adult \u003cem\u003eA. stephensi\u003c/em\u003e treated with Sh.463-56.10R\u003cem\u003e-\u003c/em\u003eATSB died beginning on day two until day six, when the trial was concluded. Survival curve comparisons with the log-rank (Mantel\u0026ndash;Cox) test revealed significant differences in survival times between Sh.463-56.10R yeast ATSB vs sugar and yeast control treatments (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSilencing of the \u003cem\u003eShaker\u003c/em\u003e gene was observed in adults that had been treated with Sh.463-56.10R yeast ATSB (57% reduction of the \u003cem\u003eShaker\u003c/em\u003e gene transcript, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Student\u0026rsquo;s t-test; (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). \u003cem\u003eShaker\u003c/em\u003e gene silencing has resulted in neural defects, including a shaking phenotype that precedes death in \u003cem\u003eA. aegypti\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In addition to loss of flying, Sh.463-56.10R yeast also resulted in a shaking phenotype similar to those observed in \u003cem\u003eA. aegypti\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], suggesting that silencing of \u003cem\u003eSh\u003c/em\u003e results in neural defects that contribute to the death of \u003cem\u003eA. stephensi.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIf RNAi-ATSBs are to be useful for control of \u003cem\u003eA. stephensi\u003c/em\u003e, it is critical that the yeast-bait stations successfully attract these mosquitoes away from natural sugar sources. It was hypothesized that Coca-cola\u0026trade; (hereafter referred to as soda), which has proven to be an excellent sugar bait for \u003cem\u003eAedes japonicus\u003c/em\u003e[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e] and \u003cem\u003eDrosophila suzukii\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], might prove to be a highly attractive sugar bait for \u003cem\u003eA. stephensi.\u003c/em\u003e The attractiveness of 10% sucrose solution (commonly used in laboratory sugar feeding assays), Westham bait, and soda for the delivery of Sh.463-56.10R yeast pesticide to adult \u003cem\u003eA. stephensi\u003c/em\u003e was examined as a function of mortality. Compared to the yeast-Westham bait or 10% sucrose-yeast formulation, significantly higher levels of adult female mortality were observed when the yeast insecticide was delivered using soda as a sugar bait (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, soda vs. 10% sugar, 96%\u0026plusmn; 4%, vs. 39%\u0026plusmn;4%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, soda vs. Westham sugar, 99%\u0026plusmn;1% vs. 11%\u0026plusmn;2%, \u003cem\u003eP\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.002). The higher mortality rates in treatment cages with soda-yeast ATSB vs. other sugar baits demonstrate the adult females\u0026rsquo; higher preference for soda as a sugar source. Similar results observed in \u003cem\u003eAedes\u003c/em\u003e, \u003cem\u003eCulex\u003c/em\u003e and \u003cem\u003eA. gambiae\u003c/em\u003e adults, which will be discussed elsewhere, suggest that the use of soda for the delivery of RNAi yeast may be beneficial for control of many different disease vector mosquitoes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe results of these trials suggest that Sh.463-56.10R yeast could be deployed in bait stations to kill \u003cem\u003eA. stephensi\u003c/em\u003e adult mosquitoes, and that soda may effectively compete against natural sugar sources, which must still be assessed in the field. Plant sugar feeding is a dietary requirement for both male and female adult mosquitoes [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e], and plant sugar feeding in the home environment, both indoors and outdoors, has been described in malaria mosquitoes [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. Moreover, \u003cem\u003eA. stephensi\u003c/em\u003e obtains blood meals from both humans and animals and exhibits more outdoor feeding[\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], suggesting that the use of RNAi yeast ATSBs could prove effective for mosquito control in the home environment.\u003c/p\u003e\n\u003ch3\u003e3. Female-specific yeast larvicides facilitate male mosquito sorting in \u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e3. Female-specific yeast larvicides facilitate male mosquito sorting in \u003cem\u003eA. stephensi\u003c/em\u003e\u003c/div\u003e \u003cp\u003eIn addition to insecticides, population-based control strategies such as SIT or release of insects carrying a dominant lethal (RIDL) [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e], [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], could prove valuable in the fight against \u003cem\u003eA. stephensi.\u003c/em\u003e However, these strategies often rely on the release of mating-competitive adult males, and efficient, effective, and globally deployable methods for scaled production of males can be a barrier to the development of such programs [\u003cspan additionalcitationids=\"CR79 CR80\" citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]. Previous studies demonstrated that yeast RNAi-mediated silencing of genes such as \u003cem\u003eMtnB\u003c/em\u003e and \u003cem\u003eGGT\u003c/em\u003e in the M/m sex-determining locus region of \u003cem\u003eA. aegypti\u003c/em\u003e during larval development resulted in death of female larvae. Moreover, silencing the orthologs of these genes in \u003cem\u003eA. albopictus\u003c/em\u003e and \u003cem\u003eCulex spp. larvae\u003c/em\u003e killed females [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e],[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] leading to the hypothesis that silencing of the \u003cem\u003eA. stephensi MtnB\u003c/em\u003e and \u003cem\u003eGGT\u003c/em\u003e orthologs would kill female larvae. To test this, yeast larvicides corresponding to the \u003cem\u003eA. stephensi MtnB\u003c/em\u003e and \u003cem\u003eGGT\u003c/em\u003e genes were prepared and fed to \u003cem\u003eA. stephensi\u003c/em\u003e larvae. Larval consumption of \u003cem\u003eMtn\u003c/em\u003eB.715, and \u003cem\u003eMtnB\u003c/em\u003e.716 yeasts (targeting the \u003cem\u003eMtnB\u003c/em\u003e gene), \u003cem\u003eGGT\u003c/em\u003e-A.699, and \u003cem\u003eGGT\u003c/em\u003e-B.700 (targeting the \u003cem\u003eGGT\u003c/em\u003e gene) yeasts resulted in significant female deaths with respect to control yeast treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, Chi- square, ***= \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). These deaths occurred during the third instar stage. However, targeting the \u003cem\u003eMtnB\u003c/em\u003e or \u003cem\u003eGGT\u003c/em\u003e genes also resulted in significant death of males (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, Chi- square, ***= \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), indicating that these larvicides were not good choices for use as sex-separation tools. This was somewhat surprising given that silencing of these genes, which are located adjacent to the \u003cem\u003eA. aegypti\u003c/em\u003e sex-determining M/m locus, results in female-specific larval lethality in \u003cem\u003eAedes, Culex\u003c/em\u003e, and \u003cem\u003eA. gambiae\u003c/em\u003e mosquitoes and production of fit adult males [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. It is possible that these genes are required in \u003cem\u003eA. stephensi\u003c/em\u003e male larvae, or perhaps the larvicides, which were designed to be as gene-specific as possible, have unintended off-targeting effects on other necessary loci.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003edoublesex (dsx)\u003c/em\u003e gene, a key regulator of sex-specific development[\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e][\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e] in many insects including \u003cem\u003eA. stephensi\u003c/em\u003e, has both male (\u003cem\u003edsx\u003c/em\u003eM) and female-specific (\u003cem\u003edsx\u003c/em\u003eF) transcripts (Gene Bank, \u003cem\u003edsx\u003c/em\u003eM: KP257287.1; \u003cem\u003edsx\u003c/em\u003eF: KP257286.1). In \u003cem\u003eDrosophila\u003c/em\u003e, the differential splicing of the female-specific \u003cem\u003edsxF\u003c/em\u003e transcript is regulated by \u003cem\u003etransformer\u003c/em\u003e (Tra) and \u003cem\u003etransformer\u003c/em\u003e2 (Tra2) [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e], [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. Yeast larvicides corresponding to the female \u003cem\u003eA. stephensi dsx\u003c/em\u003e transcript, \u003cem\u003edsx\u003c/em\u003eF.744 and \u003cem\u003edsx\u003c/em\u003eF.745 as well as larvicides corresponding to the \u003cem\u003etra\u003c/em\u003e (\u003cem\u003eTra\u003c/em\u003e.717 and \u003cem\u003eTra\u003c/em\u003e.718) and \u003cem\u003etra2\u003c/em\u003e genes (\u003cem\u003eTra2\u003c/em\u003e.721, \u003cem\u003eTra2\u003c/em\u003e.722) were generated and assessed through larval feedings in the lab. Although silencing of \u003cem\u003edsxF\u003c/em\u003e resulted in female-specific lethality, silencing of \u003cem\u003etra\u003c/em\u003e and \u003cem\u003etra2\u003c/em\u003e resulted in death of both \u003cem\u003eA. stephensi\u003c/em\u003e males and females (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, Chi- square, *** = \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). It is possible that off-targeting by the Tra.717, Tra.718, \u003cem\u003eTra2\u003c/em\u003e.721, and \u003cem\u003eTra2\u003c/em\u003e.722 larvicides leads to silencing of genes other than \u003cem\u003eTra\u003c/em\u003e and \u003cem\u003eTra2\u003c/em\u003e. Alternatively, perhaps \u003cem\u003eTra\u003c/em\u003e and \u003cem\u003eTra2\u003c/em\u003e have taken on additional critical roles in \u003cem\u003eA. stephensi\u003c/em\u003e males.\u003c/p\u003e \u003cp\u003eOf the putative female-specific larvicides tested, the \u003cem\u003edsx\u003c/em\u003eF.744 and \u003cem\u003edsx\u003c/em\u003eF.745 larvicides resulted in the highest male: female ratios, with 4 female: 1 male ratios in the surviving offspring. Moreover, no significant male death was detected, and no significant impact on male survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) or fitness, as assessed by the estimation of wing lengths (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, \u003cem\u003edsx\u003c/em\u003eF \u003cem\u003evs\u003c/em\u003e. food control treated males) and competitive mating (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, \u003cem\u003edsx\u003c/em\u003eF \u003cem\u003evs\u003c/em\u003e. food control treated males), were found. Similar results were obtained when Taracena et al.[\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e] used a bacterial system that targeted the female transcript of \u003cem\u003eA. gambiae\u003c/em\u003e. Additionally, Whyard et al.[\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e] successfully used RNAi to silence the female-specific \u003cem\u003edsx\u003c/em\u003e transcript in \u003cem\u003eA. aegypti\u003c/em\u003e larvae through oral feeding assays conducted using an \u003cem\u003eE. coli\u003c/em\u003e dsRNA expression system, which resulted in female-specific deaths following larval consumption.\u003c/p\u003e \u003cp\u003eThe inclusion of these female-specific yeast larvicides in \u003cem\u003eA. stephensi\u003c/em\u003e control programs that rely on large-scale male releases could be valuable. As demonstrated in \u003cem\u003eCulex\u003c/em\u003e mosquitoes [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], scaled production of female-specific yeast larvicides can be achieved using industrial-scale robust yeast strains that may enhance the efficacy, efficiency, and cost-effectiveness of male sorting technology. Although the female-specific larvicide clearly cannot serve as a standalone technique for sex separation, it could likely be used in conjunction with other sex separation techniques to increase productivity and speed of the sorting process. Moreover, given that it acts during the third instar, it could help reduce costs associated with mass rearing mosquitoes. In this manner, the use of yeast RNAi female-specific larvicides targeting \u003cem\u003edsxF\u003c/em\u003e in \u003cem\u003eA. stephensi\u003c/em\u003e could promote the design of globally deployable strategies to improve male sex separation, which is often required for population-based mosquito control strategies [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eHere we demonstrated that RNAi yeast can be used as an effective larvicide, adulticide, or male sex separator in \u003cem\u003eA. stephensi.\u003c/em\u003e Larviciding is a key method for controlling \u003cem\u003eA. stephensi\u003c/em\u003e larvae, and the generation of a new class of eco-friendly RNAi yeast larvicides, which could be used in rotations with existing larvicides, is likely to benefit long-term larviciding campaigns. Moreover, it could be used in conjunction with RNAi yeast ATSBs for integrated mosquito control. Given the outcomes of the recent field trials conducted with the Westham bait station in Africa, which indicated that the ATSB stations did not reduce the incidence of malaria [\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e], [\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e], the increased attractiveness of the yeast-soda combination (in ATSB bait stations) could prove to be useful in integrated \u003cem\u003eA. stephensi\u003c/em\u003e control programs, but this will need to be further assessed in future field trials, in which the residual activity of the yeast sugar baits can be further evaluated. Finally, the addition of a male sex separator in mass larval rearing diets is likely to facilitate SIT campaigns. Weng et al.[\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e] have elegantly pursued generation of a separator strain that enables precise male selection from the first instar larval stages. However, the yeast method is more portable and doesn\u0026rsquo;t require the use or alteration of transgenic strains. In summary, we have succeeded in the generation of new RNAi yeast strains for the control of \u003cem\u003eA. stephensi\u003c/em\u003e mosquitoes. Our studies demonstrated that the RNAi yeast can be used for successful larviciding, adulticiding, and sex-separation in support of mosquito control programs.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eANOVA Analysis of Variance\u003c/p\u003e\n\u003cp\u003eASB Attractive Sugar Bait\u003c/p\u003e\n\u003cp\u003eATSB Attractive Targeted Sugar Bait\u003c/p\u003e\n\u003cp\u003ecDNA complementary DNA\u003c/p\u003e\n\u003cp\u003eDNA Deoxyribonucleic acid\u003c/p\u003e\n\u003cp\u003edsRNA double stranded RNA\u003c/p\u003e\n\u003cp\u003e\u003cem\u003edsx\u003c/em\u003eF Female-specific doublesex\u003c/p\u003e\n\u003cp\u003e\u003cem\u003edsx\u003c/em\u003eM Male-specific doublesex\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGGT \u003c/em\u003eGamma-glutamyltransferase\u003c/p\u003e\n\u003cp\u003eIRP Interference RNA pesticide\u003c/p\u003e\n\u003cp\u003eLC\u003csub\u003e50 \u003c/sub\u003eLethal Concentration which kills 50% of test the animals \u003c/p\u003e\n\u003cp\u003eLC\u003csub\u003e90 \u003c/sub\u003eLethal Concentration which kills 90% of test the animals\u003c/p\u003e\n\u003cp\u003eMR Mass Rearing\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMtnB\u003c/em\u003e Metallothionein B\u003c/p\u003e\n\u003cp\u003ePCR Polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eqPCR Quantitative PCR\u003c/p\u003e\n\u003cp\u003eRFP Red Fluorescent Protein\u003c/p\u003e\n\u003cp\u003eRhB Rhodamine B\u003c/p\u003e\n\u003cp\u003eRIDL Release of Insects carrying a Dominant Lethal\u003c/p\u003e\n\u003cp\u003eRNA Ribonucleic acid \u003c/p\u003e\n\u003cp\u003eRNAi RNA interference\u003c/p\u003e\n\u003cp\u003e\u003cem\u003erps7 \u003c/em\u003eribosomal protein 7\u003c/p\u003e\n\u003cp\u003eRT-qPCR Reverse Transcription quantitative PCR\u003c/p\u003e\n\u003cp\u003eSEM Standard Error of the Mean\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSh \u003c/em\u003eShaker\u003c/p\u003e\n\u003cp\u003eshRNA short hairpin RNA\u003c/p\u003e\n\u003cp\u003esiRNA small interfering RNA\u003c/p\u003e\n\u003cp\u003eSIT Sterile Insect Technique\u003c/p\u003e\n\u003cp\u003eSSA Sub-Saharan Africa\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTra\u003c/em\u003e \u003cem\u003eTransformer\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTra2 Transformer 2\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWH Westham\u003c/p\u003e\n\u003cp\u003eWHO World Health Organization\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e\u0026nbsp; Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e\u0026nbsp; \u0026nbsp;Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003e All data generated or analyzed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u003c/strong\u003e\u0026nbsp; Indiana University holds US patent US12302904B2, on which MDS is listed as the Inventor. \u0026nbsp;She is also inventor on Indiana University\u0026rsquo;s pending application US20220248690A1. \u0026nbsp;The patent and pending application did not influence her interpretation of the data or the decision to submit this work for publication. \u0026nbsp;All the other authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by NIH/NIAID Awards 1R21AI180409 and R21AI182680 to MDS. Teresia Njoroge was also supported in part by the Indiana Center for Translational Science Initiative through a Global Health Reciprocal Innovation Demonstration award funded in part by Grant Number UM1TR004402 from the National Institutes of Health, National Center for Advancing Translational Sciences, Clinical and Translational Sciences Award. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eT.M.N and M.D.S. conceived and designed the study; T.M.N., M.H.A., K.M., A.T.M.S., L.S. and D.D.A. performed all the lab studies; T.M.N and M.D.S. analyzed the data and wrote the manuscript; M.D.S obtained the funding and supervised the project. T.M.N. also obtained funding. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank our lab technician Britton Sofhauser for helping to make the yeast pesticides used in this project. We also thank Westham Company for supplying their sugar bait and membrane for the ATSB studies.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWorld malaria report. 2025 [Internet]. [cited 2026 Jan 27]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2025\u003c/span\u003e\u003cspan address=\"https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2025\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 27 Jan 2026.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuteja R. Malaria - An overview. FEBS Journal [Internet]. John Wiley, Sons L. 2007 [cited 2025 Nov 27];274:4670\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/J.1742-4658.\u003c/span\u003e\u003cspan address=\"10.1111/J.1742-4658.\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e2007.05997.X;CTYPE:STRING:JOURNAL.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite GB. \u003cem\u003eAnopheles gambiae\u003c/em\u003e complex and disease transmission in Africa. Trans R Soc Trop Med Hyg [Internet]. Trans R Soc Trop Med Hyg; 1974 [cited 2025 Aug 4];68:278\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0035-9203(74)90035-2\u003c/span\u003e\u003cspan address=\"10.1016/0035-9203(74)90035-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoetzee M, Craig M, Le Sueur D. Distribution of African malaria mosquitoes belonging to the \u003cem\u003eAnopheles gambiae\u003c/em\u003e complex. Parasitology Today [Internet]. Parasitol Today; 2000 [cited 2025 Aug 4];16:74\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0169-4758(99)01563-X\u003c/span\u003e\u003cspan address=\"10.1016/S0169-4758(99)01563-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDia I, Guelbeogo MW, Ayala D, Dia I, Guelbeogo MW, Ayala D. Advances and Perspectives in the Study of the Malaria Mosquito \u003cem\u003eAnopheles funestus. Anopheles\u003c/em\u003e mosquitoes - New insights into malaria vectors [Internet]. IntechOpen; 2013 [cited 2025 Aug 4]; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5772/55389\u003c/span\u003e\u003cspan address=\"10.5772/55389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubio-Palis Y, Zimmerman RH. Ecoregional Classification of Malaria Vectors in the Neotropics. J Med Entomol [Internet]. Entomological Society of America; 1997 [cited 2025 Aug 4];34:499\u0026ndash;510. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/JMEDENT/34.5.499\u003c/span\u003e\u003cspan address=\"10.1093/JMEDENT/34.5.499\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaporta GZ, Linton YM, Wilkerson RC, Bergo ES, Nagaki SS, Sant\u0026rsquo;Ana DC, et al. Malaria vectors in South America: Current and future scenarios. Parasit Vectors [Internet]. Volume 8. BioMed Central Ltd.; 2015. pp. 1\u0026ndash;13. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13071-015-1038-4/TABLES/2\u003c/span\u003e\u003cspan address=\"10.1186/S13071-015-1038-4/TABLES/2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArevalo-Herrera M, Qui\u0026ntilde;ones ML, Guerra C, C\u0026eacute;spedes N, Giron S, Ahumada M, et al. Malaria in selected non-Amazonian countries of Latin America. Acta Trop [Internet] Acta Trop. 2012;121:303\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.actatropica.2011.06.008\u003c/span\u003e\u003cspan address=\"10.1016/j.actatropica.2011.06.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConn JE, Grillet ME, Correa M, Sallum MAM, Conn JE, Grillet ME et al. Malaria Transmission in South America\u0026mdash;Present Status and Prospects for Elimination. Towards Malaria Elimination - A Leap Forward [Internet]. IntechOpen; 2018 [cited 2025 Aug 4]; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5772/INTECHOPEN.76964\u003c/span\u003e\u003cspan address=\"10.5772/INTECHOPEN.76964\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinka ME, Bangs MJ, Manguin S, Coetzee M, Mbogo CM, Hemingway J et al. The dominant \u003cem\u003eAnopheles\u003c/em\u003e vectors of human malaria in Africa, Europe and the Middle East: Occurrence data, distribution maps and bionomic pr\u0026eacute;cis. Parasit Vectors [Internet]. Parasit Vectors; 2010 [cited 2025 Aug 4];3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1756-3305-3-117\u003c/span\u003e\u003cspan address=\"10.1186/1756-3305-3-117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSurendran SN, Sivabalakrishnan K, Sivasingham A, Jayadas TTP, Karvannan K, Santhirasegaram S, et al. Anthropogenic Factors Driving Recent Range Expansion of the Malaria Vector \u003cem\u003eAnopheles stephensi\u003c/em\u003e. Front Public Health [Internet] Front Media S A. 2019;7:53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/FPUBH.2019.00053\u003c/span\u003e\u003cspan address=\"10.3389/FPUBH.2019.00053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnopheline species complexes in South. and South-East Asia [Internet]. [cited 2025 Aug 4]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://iris.who.int/handle/10665/204779\u003c/span\u003e\u003cspan address=\"https://iris.who.int/handle/10665/204779\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 4 Aug 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor R, Messenger LA, Abeku TA, Clarke SE, Yadav RS, Lines J. Invasive \u003cem\u003eAnopheles stephensi\u003c/em\u003e in Africa: insights from Asia. Volume 40. Elsevier Ltd; 2024. pp. 731\u0026ndash;43. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pt.2024.06.008\u003c/span\u003e\u003cspan address=\"10.1016/j.pt.2024.06.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Trends Parasitol [Internet].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaulde MK, Rueda LM, Khaireh BA. First record of the Asian malaria vector \u003cem\u003eAnopheles stephensi\u003c/em\u003e and its possible role in the resurgence of malaria in Djibouti, Horn of Africa. Acta Trop [Internet] Elsevier. 2014;139:39\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.actatropica.2014.06.016\u003c/span\u003e\u003cspan address=\"10.1016/j.actatropica.2014.06.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Santi VP, Khaireh BA, Chiniard T, Pradines B, Taudon N, Larr\u0026eacute;ch\u0026eacute; S, et al. Role of \u003cem\u003eAnopheles stephensi\u003c/em\u003e Mosquitoes in Malaria Outbreak, Djibouti, 2019. Emerg Infect Dis [Internet]. Volume 27. Centers for Disease Control and Prevention (CDC); 2021. p. 1697. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3201/EID2706.204557\u003c/span\u003e\u003cspan address=\"10.3201/EID2706.204557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmiru T, Getachew D, Murphy M, Sedda L, Ejigu LA, Bulto MG, et al. Evidence for a role of \u003cem\u003eAnopheles stephensi\u003c/em\u003e in the spread of drug- and diagnosis-resistant malaria in Africa. Nat Med [Internet] Nat Res. 2023;29:3203\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/S41591-023-02641-9\u003c/span\u003e\u003cspan address=\"10.1038/S41591-023-02641-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalkew M, Mumba P, Dengela D, Yohannes G, Getachew D, Yared S, et al. Geographical distribution of \u003cem\u003eAnopheles stephensi\u003c/em\u003e in eastern Ethiopia. Parasit Vectors [Internet]. BioMed Central Ltd.; 2020. [cited 2025 Aug 4];13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13071-020-3904-Y\u003c/span\u003e\u003cspan address=\"10.1186/S13071-020-3904-Y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalkew M, Mumba P, Yohannes G, Abiy E, Getachew D, Yared S et al. An update on the distribution, bionomics, and insecticide susceptibility of \u003cem\u003eAnopheles stephensi\u003c/em\u003e in Ethiopia, 2018\u0026ndash;2020. Malar J [Internet]. BioMed Central Ltd; 2021 [cited 2025 Aug 4];20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S12936-021-03801-3\u003c/span\u003e\u003cspan address=\"10.1186/S12936-021-03801-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO initiative to stop the spread of Anopheles stephensi in Africa. 2023 update [Internet]. [cited 2025 Nov 27]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/publications/i/item/WHO-UCN-GMP-2022.06\u003c/span\u003e\u003cspan address=\"https://www.who.int/publications/i/item/WHO-UCN-GMP-2022.06\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 27 Nov 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePucca MB, de Sousa TN, Cardoso de Melo G, Viana GMR, Editorial. Challenges for diagnosis, treatment, and elimination of malaria. Front Trop Dis Front Media SA. 2024;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/FITD.2024.1394693/PDF\u003c/span\u003e\u003cspan address=\"10.3389/FITD.2024.1394693/PDF\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMnzava A, Monroe AC, Okumu F. \u003cem\u003eAnopheles stephensi\u003c/em\u003e in Africa requires a more integrated response. Malar J [Internet]. BioMed Central Ltd; 2022 [cited 2025 Aug 4];21:1\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S12936-022-04197-4/METRICS\u003c/span\u003e\u003cspan address=\"10.1186/S12936-022-04197-4/METRICS\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHodgson E, Levi PE. Pesticides: an important but underused model for the environmental health sciences. Environ Health Perspect [Internet]. Environ Health Perspect; 1996 [cited 2025 Nov 27];104 Suppl 1:97\u0026ndash;106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1289/EHP.96104S197\u003c/span\u003e\u003cspan address=\"10.1289/EHP.96104S197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePesticides | US EPA [Internet]. [cited 2025 Aug 4]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.epa.gov/pesticides\u003c/span\u003e\u003cspan address=\"https://www.epa.gov/pesticides\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 4 Aug 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAirs PM, Bartholomay LC. RNA Interference for Mosquito and Mosquito-Borne Disease Control. Insects [Internet]. Insects; 2017 [cited 2025 Nov 27];8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/INSECTS8010004\u003c/span\u003e\u003cspan address=\"10.3390/INSECTS8010004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiltshire RM, Duman-Scheel M. Advances in oral RNAi for disease vector mosquito research and control. Volume 40. Elsevier Inc.; 2020. pp. 18\u0026ndash;23. [cited 2025 Nov 27];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cois.2020.05.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cois.2020.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Curr Opin Insect Sci [Internet].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHapairai LK, Mysore K, Chen Y, Harper EI, Scheel MP, Lesnik AM et al. Lure-and-Kill Yeast Interfering RNA Larvicides Targeting Neural Genes in the Human Disease Vector Mosquito \u003cem\u003eAedes aegypti.\u003c/em\u003e Scientific Reports 2017 7:1 [Internet]. Nature Publishing Group; 2017 [cited 2025 Nov 27];7:13223-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-13566-y\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-13566-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHapairai LK, Mysore K, Sun L, Li P, Wang CW, Scheel ND, et al. Characterization of an adulticidal and larvicidal interfering RNA pesticide that targets a conserved sequence in mosquito G protein-coupled dopamine 1 receptor genes. Insect Biochem Mol Biol [Internet]. Elsevier Ltd; 2020. [cited 2025 Aug 4];120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ibmb.2020.103359\u003c/span\u003e\u003cspan address=\"10.1016/j.ibmb.2020.103359\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Hapairai LK, Sun L, Li P, Wang CW, Scheel ND, et al. Characterization of a dual-action adulticidal and larvicidal interfering RNA pesticide targeting the \u003cem\u003eShaker\u003c/em\u003e gene of multiple disease vector mosquitoes. PLoS Negl Trop Dis [Internet] Public Libr Sci. 2020;14:e0008479. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/JOURNAL.PNTD.0008479\u003c/span\u003e\u003cspan address=\"10.1371/JOURNAL.PNTD.0008479\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamb A, Iverson LE, Tanouye MA. Molecular characterization of \u003cem\u003eShaker\u003c/em\u003e, a \u003cem\u003eDrosophila\u003c/em\u003e gene that encodes a potassium channel. Cell [Internet]. Cell; 1987 [cited 2025 Aug 4];50:405\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0092-8674(87)90494-6\u003c/span\u003e\u003cspan address=\"10.1016/0092-8674(87)90494-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrizzee C, Mysore K, Njoroge TM, McConnell S, Hamid-Adiamoh M, Stewart ATM et al. Targeting Mosquitoes through Generation of an Insecticidal RNAi Yeast Strain Using Cas-CLOVER and Super PiggyBac Engineering in Saccharomyces cerevisiae. Journal of Fungi [Internet]. Multidisciplinary Digital Publishing Institute (MDPI); 2023 [cited 2025 Aug 4];9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/JOF9111056\u003c/span\u003e\u003cspan address=\"10.3390/JOF9111056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Sun L, Roethele JB, Li P, Igiede J, Misenti JK et al. A conserved female-specific larval requirement for MtnB function facilitates sex separation in multiple species of disease vector mosquitoes. Parasit Vectors [Internet]. BioMed Central Ltd; 2021 [cited 2025 Aug 4];14:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13071-021-04844-W/FIGURES/3\u003c/span\u003e\u003cspan address=\"10.1186/S13071-021-04844-W/FIGURES/3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Sun L, Li P, Roethele JB, Misenti JK, Kosmach J et al. A Conserved Female-Specific Requirement for the GGT Gene in Mosquito Larvae Facilitates RNAi-Mediated Sex Separation in Multiple Species of Disease Vector Mosquitoes. Pathogens [Internet]. MDPI; 2022 [cited 2025 Aug 4];11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/PATHOGENS11020169\u003c/span\u003e\u003cspan address=\"10.3390/PATHOGENS11020169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCriscione F, Qi Y, Tu Z. GUY1 confers complete female lethality and is a strong candidate for a male-determining factor in \u003cem\u003eAnopheles stephensi.\u003c/em\u003e Elife [Internet]. Volume 5. eLife Sciences Publications Ltd; 2016. p. e19281. [cited 2025 Nov 27];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7554/ELIFE.19281\u003c/span\u003e\u003cspan address=\"10.7554/ELIFE.19281\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCatteruccia F, Benton JP, Crisanti A. An \u003cem\u003eAnopheles\u003c/em\u003e transgenic sexing strain for vector control. Nature Biotechnology. 2005 23:11 [Internet]. Nature Publishing Group; 2005 [cited 2025 Nov 27];23:1414\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt1152\u003c/span\u003e\u003cspan address=\"10.1038/nbt1152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrizzee C, Mysore K, Njoroge TM, McConnell S, Crawford J, Duman-Scheel M. Generation of a Culex Male Mosquito Sex-Separation RNAi Yeast Strain Using Cas-CLOVER and Super PiggyBac Engineering in \u003cem\u003eSaccharomyces cerevisiae.\u003c/em\u003e Fermentation. 2023, Vol 9, Page 999 [Internet]. Multidisciplinary Digital Publishing Institute; 2023 [cited 2025 Nov 27];9:999. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/FERMENTATION9120999\u003c/span\u003e\u003cspan address=\"10.3390/FERMENTATION9120999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMethods in Anopheles Research - MR. 4 [Internet]. [cited 2025 Aug 4]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.yumpu.com/en/document/view/49409322/methods-in-anopheles-research-mr4\u003c/span\u003e\u003cspan address=\"https://www.yumpu.com/en/document/view/49409322/methods-in-anopheles-research-mr4\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 4 Aug 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Hapairai LK, Wei N, Realey JS, Scheel ND, Severson DW, et al. Preparation and Use of a Yeast shRNA Delivery System for Gene Silencing in Mosquito Larvae. Volume 1858. Humana Press Inc.; 2019. p. 213. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-4939-8775-7_15\u003c/span\u003e\u003cspan address=\"10.1007/978-1-4939-8775-7_15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Methods Mol Biol [Internet].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHandbook for integrated. vector management [Internet]. [cited 2025 Aug 4]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/publications/i/item/9789241502801\u003c/span\u003e\u003cspan address=\"https://www.who.int/publications/i/item/9789241502801\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 4 Aug 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Graham J, Njoroge TM, Stewart ATM, Nelaturi S, Duman-Scheel M. Development of an eco-friendly RNAi yeast attractive targeted sugar bait that silences the shaker gene in spotted-wing drosophila, \u003cem\u003eDrosophila suzukii\u003c/em\u003e. John Wiley and Sons Ltd; 2025. Pest Manag Sci [Internet]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/PS.70228;REQUESTEDJOURNAL:JOURNAL:15264998;WGROUP:STRING:PUBLICATION\u003c/span\u003e\u003cspan address=\"10.1002/PS.70228;REQUESTEDJOURNAL:JOURNAL:15264998;WGROUP:STRING:PUBLICATION\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEpis S, Porretta D, Mastrantonio V, Comandatore F, Sassera D, Rossi P, et al. ABC transporters are involved in defense against permethrin insecticide in the malaria vector \u003cem\u003eAnopheles stephensi.\u003c/em\u003e Parasit Vectors [Internet]. BioMed Central Ltd; 2014. [cited 2025 Aug 4];7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1756-3305-7-349\u003c/span\u003e\u003cspan address=\"10.1186/1756-3305-7-349\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods [Internet]. Academic Press Inc.; 2001 [cited 2025 Aug 4];25:402\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrzywinska E, Ferretti L, Li J, Li JC, Chen CH, Krzywinski J. femaleless Controls Sex Determination and Dosage Compensation Pathways in Females of \u003cem\u003eAnopheles\u003c/em\u003e Mosquitoes. Current Biology [Internet]. Cell Press; 2021 [cited 2025 Aug 4];31:1084\u0026ndash;1091.e4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2020.12.014\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2020.12.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCustom Dicer-Substrate siRNA. (DsiRNA) | IDT [Internet]. [cited 2025 Aug 4]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.idtdna.com/site/order/designtool/index/CRISPRCUSTOM\u003c/span\u003e\u003cspan address=\"https://www.idtdna.com/site/order/designtool/index/CRISPRCUSTOM\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 4 Aug 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMumberg D, M\u0026uuml;ller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene [Internet] Gene. 1995;156:119\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0378-1119(95)00037-7\u003c/span\u003e\u003cspan address=\"10.1016/0378-1119(95)00037-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Dijken JP, Bauer J, Brambilla L, Duboc P, Francois JM, Gancedo C, et al. An interlaboratory comparison of physiological and genetic properties of four \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e strains. Enzyme Microb Technol [Internet]. Volume 26. Elsevier Science Inc; 2000. pp. 706\u0026ndash;14. [cited 2025 Nov 27];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0141-0229(00)00162-9\u003c/span\u003e\u003cspan address=\"10.1016/S0141-0229(00)00162-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T et al. Fiji: an open-source platform for biological-image analysis. Nature Methods 2012 9:7 [Internet]. Nature Publishing Group; 2012 [cited 2025 Nov 27];9:676\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.2019\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.2019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAviles EI, Rotenberry RD, Collins CM, Dotson EM, Benedict MQ. Fluorescent markers rhodamine B and uranine for \u003cem\u003eAnopheles gambiae\u003c/em\u003e adults and matings. Malaria Journal 2020 19:1 [Internet]. BioMed Central; 2020 [cited 2025 Nov 27];19:236-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S12936-020-03306-5\u003c/span\u003e\u003cspan address=\"10.1186/S12936-020-03306-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi I, Mak KW, Wong J, Tan CH. Using the Fluorescent Dye, Rhodamine B, to Study Mating Competitiveness in Male \u003cem\u003eAedes aegypti\u003c/em\u003e Mosquitoes. J Vis Exp [Internet] J Vis Exp. 2021. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3791/62432\u003c/span\u003e\u003cspan address=\"10.3791/62432\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];2021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Sun L, Hapairai LK, Wang CW, Igiede J, Roethele JB et al. A yeast RNA-interference pesticide targeting the Irx gene functions as a broad-based mosquito larvicide and adulticide. Insects [Internet]. MDPI; 2021 [cited 2025 Nov 27];12:986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/INSECTS12110986/S1\u003c/span\u003e\u003cspan address=\"10.3390/INSECTS12110986/S1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Sun L, Hapairai LK, Wang CW, Roethele JB, Igiede J, et al. A broad-based mosquito yeast interfering rna pesticide targeting Rbfox1 represses notch signaling and kills both larvae and adult mosquitoes. Pathogens [Internet] MDPI. 2021. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/PATHOGENS10101251\u003c/span\u003e\u003cspan address=\"10.3390/PATHOGENS10101251\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Sun L, Hapairai LK, Wang CW, Igiede J, Roethele JB, et al. A yeast RNA-interference pesticide targeting the Irx gene functions as a broad-based mosquito larvicide and adulticide. Insects [Internet] MDPI. 2021. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/INSECTS12110986\u003c/span\u003e\u003cspan address=\"10.3390/INSECTS12110986\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Njoroge TM, Stewart ATM, Winter N, Hamid-Adiamoh M, Sun L et al. Characterization of a novel RNAi yeast insecticide that silences mosquito 5-HT1 receptor genes. Scientific Reports 2023 13:1 [Internet]. Nature Publishing Group; 2023 [cited 2025 Aug 4];13:1\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-023-49799-3\u003c/span\u003e\u003cspan address=\"10.1038/s41598-023-49799-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO\u0026rsquo;s interim position statement on larviciding for. malaria control in Africa [Internet]. [cited 2025 Nov 27]. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.malariaworld.org/blogs/whos-interim-position-statement-larviciding-malaria-control-africa\u003c/span\u003e\u003cspan address=\"https://www.malariaworld.org/blogs/whos-interim-position-statement-larviciding-malaria-control-africa\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 27 Nov 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, Sharma VP, Sumodan PK, Thavaselvam D, Kamat RH. Malaria control utilizing Bacillus sphaericus against \u003cem\u003eAnopheles stephensi\u003c/em\u003e in Panaji, Goa. J Am Mosq Control Assoc [Internet]. 1994 [cited 2025 Nov 28];10:534\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://europepmc.org/article/med/7707060\u003c/span\u003e\u003cspan address=\"https://europepmc.org/article/med/7707060\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 28 Nov 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker K, Lynch M. Contributions of \u003cem\u003eAnopheles\u003c/em\u003e larval control to malaria suppression in tropical Africa: Review of achievements and potential. Med Vet Entomol [Internet]. Med Vet Entomol; 2007 [cited 2025 Aug 4];21:2\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/J.1365-2915.2007.00674.X\u003c/span\u003e\u003cspan address=\"10.1111/J.1365-2915.2007.00674.X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMysore K, Oxley JD, Duckham C, Castilla-Gutierrez C, Stewart ATM, Winter N et al. Development of a controlled-release mosquito RNAi yeast larvicide suitable for the sustained control of large water storage containers. Scientific Reports 2024 14:1 [Internet]. Nature Publishing Group; 2024 [cited 2025 Nov 27];14:30186-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-024-81800-5\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-81800-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFiorenzano JM, Koehler PG, Xue R, De. Attractive Toxic Sugar Bait (ATSB) For Control of Mosquitoes and Its Impact on Non-Target Organisms: A Review. Int J Environ Res Public Health 2017. 2017;14:398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/IJERPH14040398\u003c/span\u003e\u003cspan address=\"10.3390/IJERPH14040398\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Page 398 [Internet][cited 2025 Nov 28];. Multidisciplinary Digital Publishing Institute.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhallaayoune K, Qualls WA, Revay EE, Allan SA, Arheart KL, Kravchenko VD, et al. Attractive Toxic Sugar Baits: Control of Mosquitoes With the Low-Risk Active Ingredient Dinotefuran and Potential Impacts on Nontarget Organisms in Morocco. Environ Entomol [Internet]. 2013;42:1040. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1603/EN13119\u003c/span\u003e\u003cspan address=\"10.1603/EN13119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFulcher A, Scott JM, Qualls WA, M\u0026uuml;ller GC, Xue R, De. Attractive toxic sugar baits mixed with pyriproxyfen sprayed on plants against adult and larval \u003cem\u003eAedes albopictus\u003c/em\u003e (Diptera: Culicidae). J Med Entomol [Internet] Entomol Soc Am. 2014;51:896\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1603/ME13243\u003c/span\u003e\u003cspan address=\"10.1603/ME13243\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQualls WA, M\u0026uuml;ller GC, Revay EE, Allan SA, Arheart KL, Beier JC, et al. Evaluation of attractive toxic sugar bait (ATSB)-Barrier for control of vector and nuisance mosquitoes and its effect on non-target organisms in sub-tropical environments in Florida. Acta Trop [Internet] Acta Trop. 2014;131:104\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.actatropica.2013.12.004\u003c/span\u003e\u003cspan address=\"10.1016/j.actatropica.2013.12.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJunnila A, Revay EE, M\u0026uuml;ller GC, Kravchenko V, Qualls WA, de Xue R, et al. Efficacy of attractive toxic sugar baits (ATSB) against \u003cem\u003eAedes albopictus\u003c/em\u003e with garlic oil encapsulated in beta-cyclodextrin as the active ingredient. Acta Trop [Internet] Elsevier B V. 2015;152:195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.ACTATROPICA.2015.09.006\u003c/span\u003e\u003cspan address=\"10.1016/J.ACTATROPICA.2015.09.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSissoko F, Junnila A, Traore MM, Traore SF, Doumbia S, Dembele SM, et al. Frequent sugar feeding behavior by \u003cem\u003eAedes aegypti\u003c/em\u003e in Bamako, Mali makes them ideal candidates for control with attractive toxic sugar baits (ATSB). PLoS One [Internet]. Volume 14. Public Library of Science; 2019. p. e0214170. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/JOURNAL.PONE.0214170\u003c/span\u003e\u003cspan address=\"10.1371/JOURNAL.PONE.0214170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026uuml;ller GC, Junnila A, Qualls W, Revay EE, Kline DL, Allan S, et al. Control of \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e in a storm drain system in Florida using attractive toxic sugar baits. Med Vet Entomol [Internet] Med. 2010;24:346\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/J.1365-2915.2010.00876.X\u003c/span\u003e\u003cspan address=\"10.1111/J.1365-2915.2010.00876.X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];. Vet Entomol.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026uuml;ller GC, Junnila A, Schlein Y. Effective control of adult \u003cem\u003eCulex pipiens\u003c/em\u003e by spraying an attractive toxic sugar bait solution in the vegetation near larval habitats. J Med Entomol [Internet] J Med Entomol. 2010;47:63\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1603/033.047.0108\u003c/span\u003e\u003cspan address=\"10.1603/033.047.0108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQualls WA, Scott-Fiorenzano J, M\u0026uuml;ller GC, Arheart KL, Beier JC, Xue R, De. Evaluation and Adaptation of Attractive Toxic Sugar Baits for Culex tarsalis and \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e Control in the Coachella Valley, Southern California. J Am Mosq Control Assoc Am Mosq Control Association. 2016;32:292\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2987/16-6589.1\u003c/span\u003e\u003cspan address=\"10.2987/16-6589.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeier JC, M\u0026uuml;ller GC, Gu W, Arheart KL, Schlein Y. Attractive toxic sugar bait (ATSB) methods decimate populations of \u003cem\u003eAnopheles\u003c/em\u003e malaria vectors in arid environments regardless of the local availability of favoured sugar-source blossoms. Malar J [Internet] Malar J. 2012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-11-31\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-11-31\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTraore MM, Junnila A, Traore SF, Doumbia S, Revay EE, Kravchenko VD, et al. Large-scale field trial of attractive toxic sugar baits (ATSB) for the control of malaria vector mosquitoes in Mali, West Africa. Volume 19. BioMed Central Ltd.; 2020. pp. 1\u0026ndash;16. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S12936-020-3132-0/TABLES/8\u003c/span\u003e\u003cspan address=\"10.1186/S12936-020-3132-0/TABLES/8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNjoroge TM, Hamid-Adiamoh M, Duman-Scheel M. Maximizing the Potential of Attractive Targeted Sugar Baits (ATSBs) for Integrated Vector Management. Insects 2023. Volume 14. Multidisciplinary Digital Publishing Institute; 2023. p. 585. [cited 2025 Nov 28];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/INSECTS14070585\u003c/span\u003e\u003cspan address=\"10.3390/INSECTS14070585\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Page 585 [Internet].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStewart ATM, Mysore K, Njoroge TM, Winter N, Feng RS, Singh S et al. Demonstration of RNAi Yeast Insecticide Activity in Semi-Field Larvicide and Attractive Targeted Sugar Bait Trials Conducted on Aedes and Culex Mosquitoes. Insects 2023, Vol 14, Page 950 [Internet]. Multidisciplinary Digital Publishing Institute; 2023 [cited 2025 Aug 4];14:950. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/INSECTS14120950\u003c/span\u003e\u003cspan address=\"10.3390/INSECTS14120950\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFryzlewicz L, Vanwinkle A, Lahond\u0026egrave;re C. Development of an Attractive Toxic Sugar Bait for the Control of \u003cem\u003eAedes j. japonicus\u003c/em\u003e (Diptera: Culicidae). Volume 59. Oxford University Press; 2022. pp. 308\u0026ndash;13. [cited 2025 Aug 4];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/JME/TJAB151\u003c/span\u003e\u003cspan address=\"10.1093/JME/TJAB151\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. J Med Entomol [Internet].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFoster WA. Mosquito sugar feeding and reproductive energetics. Annu Rev Entomol [Internet]. Annu Rev Entomol. 1995;40:443\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/ANNUREV.EN.40.010195.002303\u003c/span\u003e\u003cspan address=\"10.1146/ANNUREV.EN.40.010195.002303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Aug 4];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmondi S, Kosgei J, Agumba S, Polo B, Yalla N, Moshi V et al. Natural sugar feeding rates of \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes collected by different methods in western Kenya. Scientific Reports 2022 12:1 [Internet]. Nature Publishing Group; 2022 [cited 2023 Mar 9];12:1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-022-25004-9\u003c/span\u003e\u003cspan address=\"10.1038/s41598-022-25004-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTadesse FG, Ashine T, Teka H, Esayas E, Messenger LA, Chali W et al. \u003cem\u003eAnopheles stephensi\u003c/em\u003e Mosquitoes as Vectors of \u003cem\u003ePlasmodium vivax\u003c/em\u003e and \u003cem\u003efalciparum\u003c/em\u003e, Horn of Africa, 2019. Emerg Infect Dis [Internet]. Centers for Disease Control and Prevention (CDC); 2021 [cited 2025 Aug 4];27:603. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3201/EID2702.200019\u003c/span\u003e\u003cspan address=\"10.3201/EID2702.200019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapathanos PA, Bourtzis K, Tripet F, Bossin H, Virginio JF, Capurro ML et al. A perspective on the need and current status of efficient sex separation methods for mosquito genetic control. Parasit Vectors [Internet]. BioMed Central; 2018 [cited 2025 Aug 4];11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13071-018-3222-9\u003c/span\u003e\u003cspan address=\"10.1186/S13071-018-3222-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNolan T, Papathanos P, Windbichler N, Magnusson K, Benton J, Catteruccia F, et al. Developing transgenic \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes for the sterile insect technique. Genetica [Internet] Genetica. 2011;139:33\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/S10709-010-9482-8\u003c/span\u003e\u003cspan address=\"10.1007/S10709-010-9482-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 28];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenedict MQ, Robinson AS. The first releases of transgenic mosquitoes: An argument for the sterile insect technique. Trends Parasitol [Internet]. Volume 19. Elsevier Ltd; 2003. pp. 349\u0026ndash;55. [cited 2025 Nov 27];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1471-4922(03)00144-2\u003c/span\u003e\u003cspan address=\"10.1016/S1471-4922(03)00144-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapathanos PA, Bossin HC, Benedict MQ, Catteruccia F, Malcolm CA, Alphey L, et al. Sex separation strategies: past experience and new approaches. Malar J [Internet] Malar J. 2009. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-8-S2-S5\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-8-S2-S5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];8 Suppl 2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlphey L, Benedict M, Bellini R, Clark GG, Dame DA, Service MW et al. Sterile-Insect Methods for Control of Mosquito-Borne Diseases: An Analysis. Vector Borne and Zoonotic Diseases [Internet]. 2010 [cited 2025 Nov 27];10:295. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/VBZ.2009.0014\u003c/span\u003e\u003cspan address=\"10.1089/VBZ.2009.0014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoma DD, Ma\u0026iuml;ga H, Mamai W, Bimbile-Somda NS, Venter N, Ali AB, et al. Does mosquito mass-rearing produce an inferior mosquito? Malar J [Internet] Malar J. 2017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S12936-017-2012-8\u003c/span\u003e\u003cspan address=\"10.1186/S12936-017-2012-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaker BS, Wolfner MF. A molecular analysis of \u003cem\u003edoublesex\u003c/em\u003e, a bifunctional gene that controls both male and female sexual differentiation in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Genes Dev [Internet] Genes Dev. 1988;2:477\u0026ndash;89. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/GAD.2.4.477\u003c/span\u003e\u003cspan address=\"10.1101/GAD.2.4.477\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerhulst EC, Van de zande L. Double nexus\u0026ndash;Doublesex is the connecting element in sex determination. Brief Funct Genomics [Internet]. Brief Funct Genomics; 2015 [cited 2025 Nov 27];14:396\u0026ndash;406. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/BFGP/ELV005\u003c/span\u003e\u003cspan address=\"10.1093/BFGP/ELV005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerhulst EC, van de Zande L, Beukeboom LW. Insect sex determination: It all evolves around transformer. Curr Opin Genet Dev [Internet]. Curr Opin Genet Dev. 2010;20:376\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gde.2010.05.001\u003c/span\u003e\u003cspan address=\"10.1016/j.gde.2010.05.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClough E, Jimenez E, Kim YA, Whitworth C, Neville MC, Hempel LU, et al. Sex- and tissue-specific functions of \u003cem\u003eDrosophila\u003c/em\u003e doublesex transcription factor target genes. Dev Cell [Internet] Cell Press. 2014;31:761\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.devcel.2014.11.021\u003c/span\u003e\u003cspan address=\"10.1016/j.devcel.2014.11.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaracena ML, Hunt CM, Benedict MQ, Pennington PM, Dotson EM. Downregulation of female \u003cem\u003edoublesex\u003c/em\u003e expression by oral-mediated RNA interference reduces number and fitness of \u003cem\u003eAnopheles gambiae\u003c/em\u003e adult females. Parasites \u0026amp; Vectors 2019 12:1 [Internet]. BioMed Central; 2019 [cited 2025 Nov 27];12:170-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13071-019-3437-4\u003c/span\u003e\u003cspan address=\"10.1186/S13071-019-3437-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhyard S, Erdelyan CNG, Partridge AL, Singh AD, Beebe NW, Capina R. Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs. Parasites \u0026amp; Vectors 2015 8:1 [Internet]. BioMed Central; 2015 [cited 2025 Nov 27];8:96-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S13071-015-0716-6\u003c/span\u003e\u003cspan address=\"10.1186/S13071-015-0716-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgwang C, Samuels AM, McDermott DP, Kamau A, Lesosky M, Obiet K, et al. Attractive targeted sugar baits for malaria control in western Kenya (ATSB-Kenya) \u0026ndash; Effect of ATSBs on epidemiologic and entomologic indicators: A Phase III, open-label, cluster-randomised, controlled trial. PLOS Global Public Health [Internet] Public Libr Sci. 2025;5:e0004230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/JOURNAL.PGPH.0004230\u003c/span\u003e\u003cspan address=\"10.1371/JOURNAL.PGPH.0004230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. [cited 2025 Nov 27];.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarrassat S, Toure M, Diarra A, Keita M, Coulibaly H, Arou AZ, et al. Evaluation of Attractive Targeted Sugar Baits, a new outdoor vector control strategy against malaria: Results from a cluster randomised open-label parallel arm controlled trial in Southwestern Mali. Journal of Infection [Internet]. Volume 91. W.B. Saunders; 2025. p. 106524. [cited 2025 Nov 27];. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.JINF.2025.106524\u003c/span\u003e\u003cspan address=\"10.1016/J.JINF.2025.106524\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeng SC, Chen F, Li M, Lee S, Gerry C, Turksoy DC et al. Establishing a dominant early larval sex-selection strain in the Asian malaria vector \u003cem\u003eAnopheles stephensi.\u003c/em\u003e Infectious Diseases of Poverty 2024 13:1 [Internet]. BioMed Central; 2024 [cited 2025 Nov 27];13:83-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/S40249-024-01256-7\u003c/span\u003e\u003cspan address=\"10.1186/S40249-024-01256-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"malaria-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"malj","sideBox":"Learn more about [Malaria Journal](http://malariajournal.biomedcentral.com/)","snPcode":"12936","submissionUrl":"https://submission.nature.com/new-submission/12936/3","title":"Malaria Journal","twitterHandle":"@malariajournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"RNAi, yeast, insecticide, larvicide, ATSB, Anopheles stephensi, sex-separation, malaria","lastPublishedDoi":"10.21203/rs.3.rs-8982626/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8982626/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003eApart from widespread resistance of malaria mosquitoes to insecticides, \u003cem\u003ePlasmodium\u003c/em\u003e parasite resistance to frontline anti-malaria drugs, and challenges in malaria diagnosis, the World Health Organization (WHO) has described the highly invasive \u003cem\u003eAnopheles stephensi\u003c/em\u003e as a major threat to malaria control. New classes of insecticides are vitally needed for integrated control of the dangerous malaria vector that continues to spread across African countries. Yeast RNAi insecticides are promising novel pesticides that could prove effective for integrated responses to \u003cem\u003eA. stephensi.\u003c/em\u003e Here we explore the use of RNAi yeast pesticides for control of this invasive malaria vector.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSh.463, a modified \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e baker\u0026rsquo;s yeast RNAi pesticide corresponding to the \u003cem\u003eA. stephensi Shaker\u003c/em\u003e gene, was evaluated in \u003cem\u003eA. stephensi\u003c/em\u003e. A scalable attractive targeted sugar bait (ATSB)-based system for delivery of \u003cem\u003eSh\u003c/em\u003e interfering RNA pesticides (IRPs) to adult \u003cem\u003eA. stephensi\u003c/em\u003e under insectary conditions is examined, and a yeast-based system for delivery of \u003cem\u003eSh\u003c/em\u003e IRP to larvae is developed and evaluated. Additionally, female-specific yeast RNAi-larvicides targeting putative \u003cem\u003eA. stephensi\u003c/em\u003e female-specific genes for male mosquito sorting are also developed and evaluated in laboratory assays.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe demonstrate that the treatment of \u003cem\u003eA. stephensi\u003c/em\u003e larvae and adults with Sh.463-56.10R yeast silences the mosquito \u003cem\u003eShaker\u003c/em\u003e gene, resulting in high levels of mortality in laboratory studies. Additionally, our siRNA screens of putative female-specific genes in \u003cem\u003eA. stephensi\u003c/em\u003e using female-specific RNAi yeast larvicides resulted in significant female mortality in cup bioassays leading to significantly higher male: female ratios in the resulting offspring.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results of these studies suggest that an RNAi pesticide targeting mosquito \u003cem\u003eShaker\u003c/em\u003e genes may represent a novel biorational intervention that can be used in integrated \u003cem\u003eA. stephensi\u003c/em\u003e control programs while also targeting other species of disease vector mosquitoes. The potential of \u003cem\u003eA. stephensi\u003c/em\u003e female-specific RNAi yeast larvicides in male mosquito sorting is also described.\u003c/p\u003e","manuscriptTitle":"Targeting the Highly Invasive Malaria Vector Anopheles stephensi using Yeast RNAi Pesticides","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-02 06:26:56","doi":"10.21203/rs.3.rs-8982626/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"138160578688721750586341001979372550919","date":"2026-03-07T12:43:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93402068699660404358057787604665758892","date":"2026-03-05T14:49:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"138605323383333460763914604494624925830","date":"2026-03-05T13:54:06+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-05T11:01:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-27T08:15:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-27T08:12:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"Malaria Journal","date":"2026-02-27T02:22:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"malaria-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"malj","sideBox":"Learn more about [Malaria Journal](http://malariajournal.biomedcentral.com/)","snPcode":"12936","submissionUrl":"https://submission.nature.com/new-submission/12936/3","title":"Malaria Journal","twitterHandle":"@malariajournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d7ab7beb-0f1e-4ee5-b382-6e2dbb521691","owner":[],"postedDate":"March 2nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-05T11:08:36+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-02 06:26:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8982626","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8982626","identity":"rs-8982626","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00