Emergence of Human Enteric Adenovirus F41 Among Children with Gastroenteritis in North-central Bangladesh, 2022-2024

Emergence of Human Enteric Adenovirus F41 Among Children with Gastroenteritis in North-central Bangladesh, 2022-2024 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Emergence of Human Enteric Adenovirus F41 Among Children with Gastroenteritis in North-central Bangladesh, 2022-2024 Nadim Sharif, Abdullah Ibna Masud, Jannatin Naim, Rubayet Rayhan Opu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8726761/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Human enteric adenovirus F-41 is an emerging cause of pediatric gastroenteritis, but data from South Asia remain limited. We investigated the molecular epidemiology, clinical features, seasonality of adenovirus-associated gastroenteritis and feasibility of an IC kit among children under 5 in north-central Bangladesh during July 2022–June 2024. Fecal samples from 360 children with acute gastroenteritis were tested for viral and bacterial pathogens using PCR, sequencing, and phylogenetic analyses. Human adenovirus was detected in 7% of cases. Most adenovirus-positive samples (76%) were adenovirus F-41. Infected children, aged 12–35 months, exhibited more severe gastrointestinal symptoms, including dehydration and severe vomiting. Infections peaked during colder months and were correlated with temperature. Study isolates were closely related with contemporary global adenovirus F-41 strains. A rapid immunochromatographic assay demonstrated high agreement with RT-PCR. These findings identify adenovirus F-41 as an emerging contributor to pediatric gastroenteritis in Bangladesh and highlight the need for enhanced surveillance. Health sciences/Diseases Health sciences/Gastroenterology Health sciences/Medical research Biological sciences/Microbiology Human adenovirus Gastroenteritis Co-infection Rural settings LMICs South East Asia Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Virus associated gastroenteritis is one of the major causes of preventable morbidity and mortality among children under five years worldwide, especially in lower- and middle-income countries (LMICs) 1 . Health burden of gastroenteritis has reduced substantially with the expansion of vaccination programs and sustained improvements in water, sanitation, and hygiene (WASH) 2 . According to the recent data of 2023 survey by global burden of diseases (GBD), about 1.2 billion episodes and 500000 deaths of gastroenteritis were documented among children under five years, particularly South Asia contributed to the substantial portion of the disease burden 1 . After the introduction of global rotavirus vaccines, gastroenteritis associated with rotavirus has been reduced considerably in the developed countries-contributing to an overall lower trend of mortality. However, the effectiveness of rotavirus vaccines in the LMICs remains significantly lower compared with that in developed countries, due to several factors, including the circulation of other pathogens and poor achievements of WASH standards among a substantial portion of the population 2 , 3 . Human adenovirus (HAdV) F40/41 is the third leading cause of pediatric gastroenteritis worldwide, with a recent increase in cases and mortality, contributing to approximately 70,000 deaths among children under five years of age 1 , 4 . Human adenoviruses (HAdVs) are large (~ 90 nm), non-enveloped DNA viruses of the family Adenoviridae (genus Mastadenovirus ), characterized by a linear double-stranded genome of 26–45 kb 5 . The virion comprises an icosahedral capsid built from the major structural proteins hexon, penton base, and fiber, together with several minor capsid components that organize the DNA-containing core 5 . To date, 111 HAdV types have been identified and classified into seven species (A–G) 6 . HAdVs display type specific, diverse tissue tropisms and are associated with a wide range of clinical manifestations, which are typically mild and self-limiting and most commonly involve the respiratory, gastrointestinal, or ocular systems 7 , 8 . Further, HAdVs can infect the central nervous system, cardiovascular system, pancreas, urinary tract, and liver, where they may cause severe disease, particularly in immunocompromised individuals and children 9 . Isolates belonging to species F are the primary etiological agents of adenovirus-associated gastroenteritis. Among these, HAdV-F40 and HAdV-F41 are recognized as the principal enteric adenoviruses and are responsible for a substantial proportion of acute diarrheal diseases in young children worldwide 8 , 10 – 13 . These viruses exhibit a marked tropism for intestinal epithelial cells and are uniquely adapted to replication within the gastrointestinal tract, including enhanced resistance to acidic pH and bile salts, which facilitates transmission via the fecal–oral route 14 , 15 . Between the two enteric types, HAdV-F41 is reported more frequently and is increasingly implicated in both sporadic cases and outbreaks of pediatric gastroenteritis 10 – 13 . Infections typically present with prolonged diarrhea, often accompanied by vomiting and low-grade fever, and may persist longer than rotavirus- or norovirus-associated illness 12 , 13 . Severe disease and hospitalization are more common in infants, malnourished children, and immunocompromised individuals 9 . In addition to species F, non-enteric adenovirus types from species A, B, C, D, and, E have occasionally been detected in stool samples during episodes of gastroenteritis 16 , 17 . However, these detections are generally considered incidental or reflective of asymptomatic intestinal shedding following primary infection at other anatomical sites, rather than direct causation of gastrointestinal disease 7 . Several previous studies from our group in Bangladesh also reported the circulation of HAdV F40/41 among children with gastroenteritis in Dhaka 18 – 20 . However, studies focusing on the epidemiology, molecular characterization, and clinical outcomes of HAdV infection, particularly those covering regions outside Dhaka and including rural and suburban populations, are extremely limited. Therefore, we conducted this study to investigate the molecular epidemiology, seasonality, and clinical outcomes of HAdV infection, as well as the association between WASH status and HAdV prevalence and evaluate a rapid detection immunochromatography kit among the pediatric population in rural and semi-urban regions in the north-central Bangladesh. Materials and Methods Ethical Approval To conduct this study, we obtained the ethical permission from the Biosafety, Biosecurity & Ethical Committee (BBEC) at Jahangirnagar University with the approval number BBEC, JU/M 2025/02 (185). Objectives of the study were described explicitly and proper consent of the parents of the children was taken before sample collection and inclusion of the participants. Method Guidelines We confirm that we used previously approved relevant and appropriate guidelines and regulations from our studies and international bodies. All laboratory work were performed following our previous studies 20-22 . We adopted guidelines from ATCC (https://www.atcc.org/) for culture and isolation of bacterial pathogens. Study Population and Fecal Specimens We collected 360 fecal samples from July 2022 to June 2024 from children with symptoms of gastroenteritis from Tangail (north-central district), Bangladesh. The sample and respective data collection criteria included all children aged from 1 days to less than or 5 years with symptoms of gastroenteritis and reporting to the nearby medical college hospital. A single sample was collected from each child for a single point of time. Diarrhea was defined as having watery, loose or unusually frequent stools for three or more times a day. Children with blood in stools were excluded. Samples were collected and stored following previously published protocols 21,22 . Ten percent suspension of the collected stool specimens were made and centrifuged at 10 000g for 10 minutes. All the samples were stored at −20°C until further analysis. Laboratory Tests for Detecting Enteric Bacteria We characterize bacterial isolates on selective agar media following our previously published work 21,22 . We used MacConkey Agar, Thiosulphate-Citrate-Bile Salt Sucrose (TCBS) Agar, and Salmonella Shigella (SS) Agar media (HIMEDIA, India) in a sterile manner for the isolation and initial screening of Escherichia coli , Vibrio cholerae , Salmonella spp., and Shigella spp, respectively. For further screening, Eosin Methylene Blue (EMB) Agar (HIMEDIA, India) was used for E. coli , while Xylose Lysine Deoxycholate (XLD) Agar (HIMEDIA, India) was used for Salmonella spp. and Shigella spp. Eventually, we used molecular detection for confirmation of bacterial isolates (Supplementary method 1.1). Viral Genome Extraction from Fecal Samples For the identification of viruses associated with gastroenteritis, we extracted virus genome using 50 μL of the supernatant by commercially available Promega kit according to the manufacturer's protocols (Promega, Madison) and our previously published work 23,24 . Polymerase Chain Reaction (PCR) We used adenovirus specific primers AD1‐F (TTCCCCATGGCICAYAACAC) (nucleotide positions: 1834‐1853) and AD2‐R (CCCTGGTAKCCRATRTTGTA) (nucleotide positions 2315‐2296) for amplification of hexon gene, producing partial amplicons of 482 base pairs. In addition, we also used primers AK‐VP‐F1 (CGCCGTGGCTCCTGCTCT) and AK‐VP‐R1 (TGTTCGCCATCACAAAAGATGTG), targeting vp1/vp2 gene of human bocavirus (HBoV) (nucleotide positions: 3233‐3808), producing amplicons of 609 base pairs 20 . The thermal cycle of PCR reaction was conducted at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute and extension at 72°C for 1 minute for all viruses. A final extension was performed at 72°C for 7 minutes and then held at 4°C. PCR reaction mixture contained 12.5 μL of the 2× master mix (GoTaq Green Master Mix; Promega), 1 μL (200 nM) of forward primer, 1 μL (200 nM) of reverse primer, 6.5 μL of water, and 4 μL (80 ng) of the template. The total volume of the PCR reaction mixture was 25 μL. The PCR was performed in 2720 Thermal Cycler (Applied Biosystems). We used previously sequenced samples as positive controls for HAdV and HBoV, respectively 20 . Synthesis of cDNA for the Detection of Rotavirus and Norovirus We synthesized rotavirus and norovirus complementary DNA (cDNA) by using the commercially available Promega cDNA synthesis kit (Promega, Madison, USA) and our previously published work 24,25 . Further, we performed RT-PCR and sequencing to determine the presence of rotavirus and norovirus positive samples (Supplementary method 1.2-1.4). Agarose Gel Electrophoresis We performed agarose gel using 1.5% concentration. The gel run was continued for 30 minutes horizontally and 1Kb ladder was used to define the size of the amplicons. Initially isolated amplicons were visualized using an ultraviolet spectrophotometer (SPECORD‐205; Analytik‐Jena, Germany) and photographed in the Gel doc system (BioRad, USA) 24,25 . Nucleotide Sequence Analyss For conducting nucleotide sequence analysis, we purified the amplicons by centrifugation with the Wizard PCR Clean‐Up System (Promega, Madison, USA) 24 . The nucleotide sequences of PCR amplicons (DNA) positive for HAdV were determined using the same set of primers with the Big‐Dye terminator cycle sequencing kit and an ABI Prism 310 Genetic Analyzer (Applied Biosystems Inc, Foster City, CA, USA). Further, we performed sequence cleanup and analysis by using Chromas 2.6.5 (Technelysium, Helensvale, Australia). For further analysis, we used the converted FASTA files. We used the mega blast to identify sequence homology the BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) program. Multiple sequence alignment (MSA) was conducted in the BioEdit 7.2.6 software by running the ClustalW Multiple Alignment algorithm 26 . Phylogenetic Analysis To find out the evolutionary relationship and phylogenetic distance of isolated HAdV based on the partial sequence of the amplicons, we compared them with the reference sequences using MEGA‐X software 27 . We used the Maximum Likelihood Tree building methods running the Kaimura-2-Parameter model. Phylogenetic trees with 1000 bootstrap values of the topology were generated using the previously published work. Rapid Detection of HAdV by IC Kit and Evaluation of the Method For the initial screening of the samples, we used the rapid immunochromatography kit (IP Noro/Adeno Kit, Imuuno Probe Co., Japan) and evaluated the kit for the first time in Bangladesh to assess the sensitivity and specificity of the method. We performed the test according to the given protocol and previously published work 25 . After applying samples, we observed the IC kit for next 15 minutes. Positive results came within the first 5 minutes. We used a two-by-two table and previously published equation for calculating the sensitivity and specificity by comparing the findings with a set of positive and negative controls and samples tested using the gold standard RT-PCR method (Supplementary method 1.5). Statistical Analyses Categorical variables were expressed by percentage and continuous variables by mean/ median. Inferential statistics ( p -value) was applied for the analyses. We used Chi-square test for comparing the symptoms of children with gastroenteritis. The Pearson’s correlation analysis was performed for determining the seasonality. We compared the odds ratio (OR) of categorical variables by using Chi-square with 95 % confidence intervals (CIs). For creating the sampling map, we used the ArcGIS. Statistical analyses were performed using R-4.5.2 program and SPSS v24.0 software (IBM, US). Nucleotide Sequence Submission The nucleotide sequence data reported in this study was submitted to the GenBank database and they are publicly available under the accession numbers, PX781901-PX781921. Results Sociodemographic Characteristics and Association of WASH Sociodemographic and WASH data were collected from pediatric patients in rural and semi-urban areas and their association with diarrheal cases were analyzed (Figure 1 part A). The lowest age of diarrheal children was 27 days and highest was 59 months, and male to female ratio was 6:5. We found no significant differences in age or sex distribution between infected and uninfected children. In contrast, we found significant association of infection (p-value < 0.001) with rural residence, lower household income, limited access to safe water, and household hygiene practices (Table 1). However, access to sanitation facilities was not significantly associated with the infection. We found the presence of enteric pathogens including human adenovirus mainly associated with socioeconomic disadvantage and suboptimal WASH status rather than demographic factors among the children with gastroenteritis. Detection of Human Adenoviruses We found human adenovirus among 7% (25 of 360) of the children with gastroenteritis. The prevalence of HAdV was second after rotavirus (31%) among the viruses detected. Among the other viruses, we tested for norovirus (NoV), human bocavirus (HBoV) and sapovirus. However, we only found NoV among 4% of the children. Further, among the bacterial pathogens Vibrio cholerae (10%) and Escherichia coli (8%) contributed to the larger portion of pathogens (Figure 1 part B). Codetection of Other Pathogens We found co-prevalence of different pathogens among children with gastroenteritis. Among the HAdV positive children, mono-infection was found among 24% (6 of 25), dual-infection among 68% (17 of 25) and triple-infection among 8% (2 of 25). The difference on symptoms among co-infected children was not significant (Figure 1 part C). Detection of HAdV Infection Over the Study Period Prevalence of HAdV concentrated from October to January in the study region. A sharp peak was found in December with 28% cases followed by January 20%. We also conducted Pearsons’s correlation analysis of cases with environmental factors to find the effect. Lower temperature showed significantly higher association r =0.78 with HAdV cases (Figure 2). Clinical Outcomes Among Children We found higher frequency of HAdV among children aged 12 to 23 months (54%) followed by 24 to 35 months (46%) and male to female ratio 3:2-without a significant difference with negative HAdV children. We found HAdV positive children and other enteric pathogens positive children had significantly higher frequency of systemic and gastrointestinal symptoms compared to negative cases. Abdominal cramp, severe vomiting and dehydration were significantly higher among HAdV cases compared to all other pathogens. We also found significantly higher frequency of conjunctivitis among virus infected children (Figure 3). Nucleotide Sequence and Phylogenetic Analyses We used the partial sequence of hexon genes to determine the phylogenetic relationship. We found the prevalence of HAdV-F41 76% (19 of 25) and HAdV-C1 24% (6 of 25). The MSA provided over 99.4% of sequence similarity with reference sequences. Three distinct clusters of HAdV-F41 were circulating among the children. Study isolates, PX781901-PX781904, PX781906, PX781907 and PX781912 were closely related with previously reported isolates from the USA (KF303069), Beijing (MT150494) and Cote d Ivorie (KP274041); PX781914 with India (KU904307), Japan (LC790294) and Thailand (MK674752); PX781905, PX781908, PX781909, PX781911, and PX781915 with Germany (ON532817) (Figure 4 pat A). Further, the isolates of HAdV-C1 (PX781916-PX781921) showed great diversity and close relation with previous isolates from the USA, Japan, Russia, and China (Figure 4 part B). Sensitivity and Specificity of Rapid IC kit We evaluated a rapid IC kit for detection of norovirus and adenovirus simultaneously in a single sample from native children in Bangladesh. The standard 2 by 2 table was used for determine the sensitivity and specificity of the IC kit. The IC kit provided a higher specificity (99.4 %) and sensitivity (96.1%) and good agreement with the gold standard RT-PCR for the detection of HAdV among native people (Table 2). Among the tested 200 samples we found one false positive and one false negative during this evaluation process (Supplementary Figure i). Discussion Human adenovirus-F41 has become an emerging etiology and rising concern among children with gastroenteritis worldwide-with no vaccine or antiviral 1,10 . Our study provides a comprehensive epidemiological and molecular characterization of human enteric adenovirus infections among children in north-central Bangladesh, expanding recent understandings beyond Dhaka-centric surveillance. We found that HAdV-F41 was a major contributor to pediatric gastroenteritis in this region, second only to rotavirus, and accentuate its association with characteristic clinical manifestations, seasonality, and socioeconomic vulnerability. We found the circulation of HAdV-C1 and HAdV-F41 isolates among the pediatric population. However, the documented predominance of HAdV-F41 is similar with its established role as a major enteric adenovirus worldwide, particularly in low- and middle-income countries, including Brazil, China, India, Kenya and Bangladesh 4,8,20,28-31 . Strikingly, the frequency of positive cases among children aged 12–35 months aligns with the statement that the period of reducing maternal immunity and increased environmental exposure, contributing to higher susceptibility. Additionally, the absence of a significant sex-based difference supports a probable exposure-driven spread rather than host-intrinsic susceptibility. Moreover, our findings suggest for initial evidence on the significant association between infection and rural residence, low household income, and inadequate access to safe water highlights the continued importance of WASH-related factors in shaping adenovirus and other gastroenteritis associated pathogens transmission dynamics. This is one of the first studies to explore the emergence of enteric HAdV and associated factors along with pathogenic diversity in the selected population. Compared with our previous study, which reported 7% prevalence with higher diversity of HAdV from central regions in Bangladesh, we found higher prevalence of HAdV-F41 in this study 20 . We also integrated clinical symptoms of the pediatric patients. Clinically, HAdV-F41 positive children showed more severe gastrointestinal symptoms, including abdominal cramps, dehydration, and severe vomiting, compared with both pathogen-negative children and those infected with other enteric pathogens. The frequent occurrence of conjunctivitis among HAdV-C1 cases further supports a systemic or mucocutaneous involvement characteristic of adenoviral infection requiring further investigations. Our findings reinforce the statement that enteric adenovirus infections are clinically significant, contributing to severe disease progression and subsequent hospitalization, particularly in resource-limited settings. Further, the high rate of co-detection with other enteric pathogens reveals the complex enteric viriome and bacteriome encountered by children in concentrated endemic settings. Although we could not detect significant difference of symptoms among co-infected cohort, their frequent circulation might complicate diagnosis and disease burden and influence viral shedding, immune responses, and treatment outcomes. These findings are strongly supported by previous findings from several other regions in Bangladesh and other LMICs 4,20,22,24 . Further, these findings highlight the need for rapid and multiplex diagnostic approaches and vigilant interpretation of single-pathogen detections and prevention in diarrheal disease surveillance. Seasonally, HAdV-F41 infections peaked during colder months and showed a strong correlation with ambient temperature. This seasonal pattern supports previous winter-driven seasonality of enteric viruses and contrasts with the monsoon-driven seasonality of several bacterial and parasitic entero-pathogens. Our findings suggest that environmental stability, host behavioral factors, and practices may favor adenovirus transmission during colder periods. Such seasonal predictability can contribute to outbreak preparedness, diagnostic vigilance, and resource distribution to healthcare facilities. Molecular and phylogenetic analyses revealed that the majority of circulating strains belonged to HAdV-F41, creating several clusters closely related to recent global isolates from Asia, Europe, Africa, and North America. This evolutionary relatedness might indicate ongoing global circulation and reintroductions rather than long-term local evolution, emphasizing the interconnected nature of global transmission. The detection of non-enteric HAdV-C1 in a subset of cases likely reflected incidental gastrointestinal shedding following respiratory or systemic infection, consistent with prior observations. Finally, the high sensitivity and specificity of the used rapid immunochromatography test reveal its potential application as a point-of-care diagnostic tool in low-resource settings and distant regions lacking RT-PCR lab facilities. In our previous studies, we found higher effectiveness of similar IC kit for simultaneous detection of rotavirus/norovirus 25 . Rapid identification of norovirus/adenovirus-associated gastroenteritis could aid clinical decision-making, reduce unnecessary antibiotic use, and strengthen routine surveillance where molecular diagnostics are not readily available. In summary, our study detected HAdV-F41 as an emerging and underrecognized cause of pediatric gastroenteritis in rural and semi-urban Bangladesh, with clear clinical relevance and strong links to environmental and socioeconomic determinants. Collectively, the findings argue for the incorporation of adenovirus surveillance into routine diarrheal disease monitoring and for greater consideration of enteric adenoviruses in the design of future vaccines and public health interventions aimed at mitigating childhood gastroenteritis. This is one of the first reports of emergence of higher incidence of HAdV-F41 from the study regions and our findings are supported by recent studies in Brazil, China, India, Japan, Tunisia, Turkey, and Venezuela 10,13 . During the post-rotavirus vaccination era, emergence of higher incidence and disproportionate prevalence of HAdV-F41/40 in substantial regions of the world underscores the necessity of further investigations on the epidemic potential of HAdVs. Though we conducted a comprehensive epidemiologic and molecular characterization study, several limitations require attention for interpreting the findings. First, the sample size could be larger, although sufficient to identify predominant adenovirus types and clinical associations, limits the power to detect enough differences among co-infected children. Although the number of HAdV-positive cases was limited, the study spanned two full years including molecular confirmation and phylogenetic analysis, providing robust evidence in this setting. Second, our sampling was hospital-based and restricted to only symptomatic cases, which might underestimate the true burden of asymptomatic or mildly symptomatic adenovirus infections in the community and bias prevalence estimates. Third, molecular characterization relied on partial hexon gene sequences; while this approach is widely accepted for typing of HAdVs, whole-genome sequencing would provide greater understandings to identify recombination, track transmissions, and explore viral determinants of enteric tropism and virulence. In addition, we could not perform longitudinal follow-up and quantitative viral load measurements, limiting assessment of viral shedding duration, reinfection, or associations between viral burden and clinical severity. In future, studies should emphasize large-scale, multicenter surveillance including both community- and hospital-based cohorts to better characterize the population-level burden of enteric adenoviruses across diverse socioeconomic settings. Further, the application of whole-genome sequencing and metagenomic approaches will be critical to resolve adenovirus evolution, recombination, and global dissemination patterns. Moreover, mechanistic studies highlighting host immune responses, including mucosal immunity and interactions with the gut microbiota and other pathogens, are needed to clarify determinants of disease prognosis and severity. Finally, the development and evaluation of enteric adenovirus-targeted vaccines, antiviral strategies, monoclonal antibodies, along with improved point-of-care rapid diagnostics, represent important future directions to reduce the burden of adenovirus-associated pediatric gastroenteritis, particularly in low- and middle-income countries. Declarations Acknowledgements None. Conflicts of Interest The authors declare that there are no conflicts of interest to disclose. Author Contributions Nadim Sharif: writing – original draft preparation (lead); writing – review and editing (lead), methodology (lead); investigation (lead), conceptualization (supporting), data analysis (lead). Abdullah Ibna Masud: validation (equal): writing – review and editing (equal), methodology (supporting). Jannatin Naim: software (supporting), writing – review and editing (equal), methodology (supporting). Rubayet Rayhan Opu: software (supporting), writing – review and editing (equal), methodology (supporting). Afsana Khan: software (supporting), writing – review and editing (equal), data analysis (lead). Hiroshi Ushijima: software (supporting), writing – review and editing (equal). Shuvra Kanti Dey: conceptualization (lead), funding acquisition (lead), project administration (lead), resources (lead), supervision (lead). Data Availability All the data are available in the manuscript and the supplementary materials. Funding None. References Kyu, H. H. et al. Global, regional, and national age-sex-specific burden of diarrhoeal diseases, their risk factors, and aetiologies, 1990–2021, for 204 countries and territories: a systematic analysis for the Global Burden of Disease Study 2021. Lancet. Infect. Dis . 25 (5), 519–536 (2025). Prunas, O. et al. Global estimates of rotavirus vaccine efficacy and effectiveness: a rapid review and meta-regression analysis. EClinicalMedicine ; 81 . (2025). Merid, M. W. et al. Impact of access to improved water and sanitation on diarrhea reduction among rural under-five children in low and middle-income countries: a propensity score matched analysis. Trop. Med. Health . 51 (1), 36 (2023). Guga, G. et al. Burden, clinical characteristics, risk factors, and seasonality of adenovirus 40/41 diarrhea in children in eight low-resource settings. Open. forum Infect. Dis. 9 , ofac241 (2022). Kulanayake, S. & Tikoo, S. K. Adenovirus core proteins: structure and function. Viruses 13 (3), 388 (2021). Benkő, M. et al. ICTV virus taxonomy profile: Adenoviridae 2022. J. Gen. Virol. 103 (3), 001721 (2022). Arnold, A. & MacMahon, E. Adenovirus infections. Medicine 49 (12), 790–793 (2021). do Nascimento, L. G., Fialho, A. M., de Andrade, J. D., de Assis, R. M. & Fumian, T. M. Human enteric adenovirus F40/41 as a major cause of acute gastroenteritis in children in Brazil, 2018 to 2020. Sci. Rep. 12 (1), 11220 (2022). Lion, T. Adenovirus infections in immunocompetent and immunocompromised patients. Clin. Microbiol. Rev. 27 (3), 441–462 (2014). Wikswo, M. E. et al. A systematic review and meta-analysis of the global prevalence of human enteric adenovirus infections. J. Infect. Public Health :102800. (2025). Operario, D. J. et al. Etiology of severe acute watery diarrhea in children in the global rotavirus surveillance network using quantitative polymerase chain reaction. J. Infect. Dis. 216 (2), 220–227 (2017). Uhnoo, I., Wadell, G., Svensson, L. & Johansson, M. E. Importance of enteric adenoviruses 40 and 41 in acute gastroenteritis in infants and young children. J. Clin. Microbiol. 20 (3), 365–372 (1984). Khales, P. et al. Human adenoviruses in children with gastroenteritis: a systematic review and meta-analysis. BMC Infect. Dis. 24 (1), 478 (2024). Favier, A. L., Burmeister, W. P. & Chroboczek, J. Unique physicochemical properties of human enteric Ad41 responsible for its survival and replication in the gastrointestinal tract. Virology 322 (1), 93–104 (2004). Rodríguez, E. et al. Short-fiber protein of ad40 confers enteric tropism and protection against acidic gastrointestinal conditions. Hum. gene therapy methods . 24 (4), 195–204 (2013). Kajon, A. E. Adenovirus infections: new insights for the clinical laboratory. J. Clin. Microbiol. 62 (9), e00836–e00822 (2024). Yodmeeklin, A. et al. Diverse genotypes of human enteric and non-enteric adenoviruses circulating in children hospitalized with acute gastroenteritis in Thailand, from 2018 to 2021. Microbiol. Spectr. 11 (5), e01173–e01123 (2023). Dey, S. K. et al. Molecular epidemiology of adenovirus infection among infants and children with acute gastroenteritis in Dhaka City. Bangladesh Infect. Genet. Evol. 9 (4), 518–522 (2009). Afrad, M. H. et al. Detection of enteric-and non‐enteric adenoviruses in gastroenteritis patients, Bangladesh, 2012‐2015. J. Med. Virol. 90 (4), 677–684 (2018). Sharif, N. et al. Molecular and epidemiological trends of human bocavirus and adenovirus in children with acute gastroenteritis in Bangladesh during 2015 to 2019. J. Med. Virol. 92 (12), 3194–3201 (2020). Sharif, N. et al. Molecular and epidemiologic analysis of diarrheal pathogens in children with acute gastroenteritis in Bangladesh during 2014–2019. Pediatr. Infect. Dis. J. 39 (7), 580–585 (2020). Sharif, N. et al. Multidrug resistance pattern and molecular epidemiology of pathogens among children with diarrhea in Bangladesh, 2019–2021. Sci. Rep. 13 (1), 13975 (2023). Thongprachum, A. et al. Four-year study of viruses that cause diarrhea in Japanese pediatric outpatients. J. Med. Virol. 87 (7), 1141–1148 (2015). Dey, S. K. et al. Molecular epidemiology and surveillance of circulating rotavirus among children with gastroenteritis in Bangladesh during 2014–2019. PLoS One . 15 (11), e0242813 (2020). Sharif, N. et al. High prevalence of norovirus GII. 4 Sydney among children with acute gastroenteritis in Bangladesh, 2018–2021. J. Infect. Public Health . 16 (7), 1015–1022 (2023). Hall, T. A. BioEdit: a user-friendly biological sequence alignment editorand analysis program for Windows 95/98/NT. Nucleic acids symposium series ;41:95–98. (1999). Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35 , 1547–1549 (2018). Chandra, P. et al. Genetic characterization and phylogenetic variations of human adenovirus-F strains circulating in eastern India during 2017–2020. J. Med. Virol. 93 , 6180–6190 (2021). Lambisia, A. W. et al. Genomic epidemiology of human adenovirus F40 and F41 in coastal Kenya: a retrospective hospital-based surveillance study (2013–2022). Virus Evol. 9 , vead023 (2023). Binder, A. M. Human adenovirus surveillance—United States, 2003–2016. MMWR. Morbidity and mortality weekly report. ;66. (2017). Niu, P. et al. Genomic Epidemiological Characteristics of Enteric Adenovirus F40 and F41 in Yantai, China, from 2022 to 2023. Viruses 17 (12), 1595 (2025). Tables Table 1. Sociodemographic characteristics and WASH parameters among the study participants. A p -value of ≤ 0.05 was considered statistically significant. Characteristics Positive, n=246 (%) Negative n=114 (%) Total, n=360 (%) P-value Age 0.95 <1 M 42 (17.1) 18 (15.8) 60 (16.7) 1-11 M 57 (23.2) 24 (21.1) 81 (22.5) 12-23 M 70 (28.5) 34 (29.8) 104 (28.9) 24-35 M 51 (20.7) 23 (20.2) 74 (20.6) 36-59 M 26 (10.6) 15 (13.2) 41 (11.4) Sex 1.0 Male 135 (54.9) 63 (55.3) 198 (55) Female 111 (45.1) 51 (44.7) 162 (45) Ethnicity 1.3 Native 246 (100) 114 (100) 360 (100) Residents <0.001 Rural 184 (74.8) 58 (50.9) 242 (67.2) Urban 62 (25.2) 56 (49.1) 118 (32.8) Family income <0.001 10000 to 30000 132 (53.7) 21 (18.4) 153 (42.5) 31000 to 80000 75 (30.5) 64 (56.1) 139 (38.6) 81000 to 150000 39 (15.9) 29 (25.4) (18.9) Education <0.001 Educated 83 (34.6) 73 (64.0) 158 (43.9) Uneducated 161 (65.4) 41 (36.0) 202 (56.1) Access to safe water 0.01 Yes 167 (67.9) 93 (81.6) 260 (72.2) No 79 (32.1) 21 (18.4) 100 (27.8) Access to sanitation 0.58 Yes 214 (87.0) 103 (90.4) 317 (88) No 30 (13.0) 11 (9.6) 43 (12) Hygiene practice <0.001 Good 50 (20.3) 58 (50.9) 108 (30) Moderate 127 (47.6) 47 (41.2) 164 (45.6) Least 73 (29.7) 15 (13.2) 88 (24.4) M-months; Amount of income was in local currency taka. Parameter of WASH were adopted from the WASH Performance Index Report, 2015. Table 2. Evaluation of sensitivity and specificity of IC kit (IP Noro/Adeno Kit, Immuno Probe, Japan). Test Result RT- PCR Total Sensitivity Specificity IP-Noro/Adeno kit Positive (+) Negative (-) 96.15% 99.43% Positive (+) 25 1 26 Negative (-) 1 173 174 Total 26 174 200 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 09 Feb, 2026 Editor assigned by journal 30 Jan, 2026 Submission checks completed at journal 30 Jan, 2026 First submitted to journal 28 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8726761","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":587994438,"identity":"53660f7e-5136-4921-b546-794b33f799b7","order_by":0,"name":"Nadim Sharif","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArklEQVRIiWNgGAWjYHACgwMMFWwMDMwgNhvRWs6QqoWBsQ3GJkaLOfvhjYduzuNL3M7OY8DwoewwYS2WPWkFh3O3sSXubOYxYJxxjggtBgdyDMBaNhxmS2DmbSNGy/k3QC1zoFr+EqXlBsiWBpAW5gPMjMRpeVZwOOcYmzFIy8Gec+nEOCx58+ecmmOyG84fbHzwo8yasBYoOAYmDxCtHghqSFE8CkbBKBgFIw0AALhUPyPNy3knAAAAAElFTkSuQmCC","orcid":"","institution":"Jahangirnagar University","correspondingAuthor":true,"prefix":"","firstName":"Nadim","middleName":"","lastName":"Sharif","suffix":""},{"id":587994439,"identity":"225ef29b-ab48-4c44-a814-ffab51e90762","order_by":1,"name":"Abdullah Ibna Masud","email":"","orcid":"","institution":"Jahangirnagar University","correspondingAuthor":false,"prefix":"","firstName":"Abdullah","middleName":"Ibna","lastName":"Masud","suffix":""},{"id":587994440,"identity":"b5833974-7398-4c6d-9f3e-b623677c1893","order_by":2,"name":"Jannatin Naim","email":"","orcid":"","institution":"Jahangirnagar University","correspondingAuthor":false,"prefix":"","firstName":"Jannatin","middleName":"","lastName":"Naim","suffix":""},{"id":587994441,"identity":"61d8d36a-4b62-4528-904d-f4e586f16598","order_by":3,"name":"Rubayet Rayhan Opu","email":"","orcid":"","institution":"Jahangirnagar University","correspondingAuthor":false,"prefix":"","firstName":"Rubayet","middleName":"Rayhan","lastName":"Opu","suffix":""},{"id":587994442,"identity":"9e37adef-9840-4b26-ad82-147bbe9e66a0","order_by":4,"name":"Afsana Khan","email":"","orcid":"","institution":"Jahangirnagar University","correspondingAuthor":false,"prefix":"","firstName":"Afsana","middleName":"","lastName":"Khan","suffix":""},{"id":587994443,"identity":"a50dd545-dc2b-4d54-b750-4f8ad01bba81","order_by":5,"name":"Hiroshi Ushijima","email":"","orcid":"","institution":"Nihon University","correspondingAuthor":false,"prefix":"","firstName":"Hiroshi","middleName":"","lastName":"Ushijima","suffix":""},{"id":587994444,"identity":"7f603a73-195e-4377-83d8-b219383c6aa9","order_by":6,"name":"Shuvra Kanti Dey","email":"","orcid":"","institution":"Jahangirnagar University","correspondingAuthor":false,"prefix":"","firstName":"Shuvra","middleName":"Kanti","lastName":"Dey","suffix":""}],"badges":[],"createdAt":"2026-01-29 04:08:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8726761/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8726761/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102310613,"identity":"1c7a2d4e-fb23-4479-bb7a-75ed85877f61","added_by":"auto","created_at":"2026-02-10 11:55:26","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2653780,"visible":true,"origin":"","legend":"\u003cp\u003eA. Map of the distribution of pediatric patients, B. Proportionate frequency of enteric pathogens among children, C. Co-detection frequency of enteric pathogens among HAdV positive children.\u003c/p\u003e","description":"","filename":"Figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8726761/v1/5909e45cd138b5f4566e8083.jpg"},{"id":102310703,"identity":"15733aa1-aa3b-4b53-8d63-8d378aad1c34","added_by":"auto","created_at":"2026-02-10 11:55:45","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1703320,"visible":true,"origin":"","legend":"\u003cp\u003eA. Age distribution of HAdV positive cases, B. Association of infection and non-infection cases with observed enteritis symptoms.\u003cstrong\u003e \u003c/strong\u003eHere, *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001; “n.s.” denotes no significant difference.\u003c/p\u003e","description":"","filename":"Figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8726761/v1/617bdbbc5c49107c6aa4c5bd.jpg"},{"id":102311151,"identity":"fca236dc-b6ad-4900-9803-987dec5ecc33","added_by":"auto","created_at":"2026-02-10 11:56:52","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1571095,"visible":true,"origin":"","legend":"\u003cp\u003eA. Monthly distribution of HAdV cases, B. Seasonal distribution of positive cases, C. Pearsons’ correlation of cases with environmental factors.\u003c/p\u003e","description":"","filename":"Figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8726761/v1/0fcfb65bf6d983b9aac2b585.jpg"},{"id":102310758,"identity":"7c6594e0-62d9-4d1e-910c-df3609681050","added_by":"auto","created_at":"2026-02-10 11:55:59","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2173534,"visible":true,"origin":"","legend":"\u003cp\u003eA. Phylogenetic tree of HAdV-F41, B. Phylogenetic tree of HAdV-C1. The trees were constructed using the partial nucleotides of hexon regions of adenovirus. Study isolates were highlighted in italic bold in both trees.\u003c/p\u003e","description":"","filename":"Figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8726761/v1/8c2f4723f24ab74ce03ec371.jpg"},{"id":102311938,"identity":"08af70a9-f348-48f4-a140-542c56353618","added_by":"auto","created_at":"2026-02-10 11:59:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9028130,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8726761/v1/f84218cd-d072-4eec-83fd-054e488fb836.pdf"},{"id":102310751,"identity":"6e877e7e-b416-4aa6-911a-a9bd166ad890","added_by":"auto","created_at":"2026-02-10 11:55:58","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1772354,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-8726761/v1/f7830d78c73269f68c519f3b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Emergence of Human Enteric Adenovirus F41 Among Children with Gastroenteritis in North-central Bangladesh, 2022-2024","fulltext":[{"header":"Introduction","content":"\u003cp\u003eVirus associated gastroenteritis is one of the major causes of preventable morbidity and mortality among children under five years worldwide, especially in lower- and middle-income countries (LMICs)\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Health burden of gastroenteritis has reduced substantially with the expansion of vaccination programs and sustained improvements in water, sanitation, and hygiene (WASH)\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. According to the recent data of 2023 survey by global burden of diseases (GBD), about 1.2\u0026nbsp;billion episodes and 500000 deaths of gastroenteritis were documented among children under five years, particularly South Asia contributed to the substantial portion of the disease burden\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. After the introduction of global rotavirus vaccines, gastroenteritis associated with rotavirus has been reduced considerably in the developed countries-contributing to an overall lower trend of mortality. However, the effectiveness of rotavirus vaccines in the LMICs remains significantly lower compared with that in developed countries, due to several factors, including the circulation of other pathogens and poor achievements of WASH standards among a substantial portion of the population\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Human adenovirus (HAdV) F40/41 is the third leading cause of pediatric gastroenteritis worldwide, with a recent increase in cases and mortality, contributing to approximately 70,000 deaths among children under five years of age\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHuman adenoviruses (HAdVs) are large (~\u0026thinsp;90 nm), non-enveloped DNA viruses of the family \u003cem\u003eAdenoviridae\u003c/em\u003e (genus \u003cem\u003eMastadenovirus\u003c/em\u003e), characterized by a linear double-stranded genome of 26\u0026ndash;45 kb\u003csup\u003e5\u003c/sup\u003e. The virion comprises an icosahedral capsid built from the major structural proteins hexon, penton base, and fiber, together with several minor capsid components that organize the DNA-containing core\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. To date, 111 HAdV types have been identified and classified into seven species (A\u0026ndash;G)\u003csup\u003e6\u003c/sup\u003e. HAdVs display type specific, diverse tissue tropisms and are associated with a wide range of clinical manifestations, which are typically mild and self-limiting and most commonly involve the respiratory, gastrointestinal, or ocular systems\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Further, HAdVs can infect the central nervous system, cardiovascular system, pancreas, urinary tract, and liver, where they may cause severe disease, particularly in immunocompromised individuals and children\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIsolates belonging to species F are the primary etiological agents of adenovirus-associated gastroenteritis. Among these, HAdV-F40 and HAdV-F41 are recognized as the principal enteric adenoviruses and are responsible for a substantial proportion of acute diarrheal diseases in young children worldwide\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. These viruses exhibit a marked tropism for intestinal epithelial cells and are uniquely adapted to replication within the gastrointestinal tract, including enhanced resistance to acidic pH and bile salts, which facilitates transmission via the fecal\u0026ndash;oral route\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Between the two enteric types, HAdV-F41 is reported more frequently and is increasingly implicated in both sporadic cases and outbreaks of pediatric gastroenteritis\u003csup\u003e\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Infections typically present with prolonged diarrhea, often accompanied by vomiting and low-grade fever, and may persist longer than rotavirus- or norovirus-associated illness\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Severe disease and hospitalization are more common in infants, malnourished children, and immunocompromised individuals\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. In addition to species F, non-enteric adenovirus types from species A, B, C, D, and, E have occasionally been detected in stool samples during episodes of gastroenteritis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. However, these detections are generally considered incidental or reflective of asymptomatic intestinal shedding following primary infection at other anatomical sites, rather than direct causation of gastrointestinal disease\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eSeveral previous studies from our group in Bangladesh also reported the circulation of HAdV F40/41 among children with gastroenteritis in Dhaka\u003csup\u003e\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, studies focusing on the epidemiology, molecular characterization, and clinical outcomes of HAdV infection, particularly those covering regions outside Dhaka and including rural and suburban populations, are extremely limited. Therefore, we conducted this study to investigate the molecular epidemiology, seasonality, and clinical outcomes of HAdV infection, as well as the association between WASH status and HAdV prevalence and evaluate a rapid detection immunochromatography kit among the pediatric population in rural and semi-urban regions in the north-central Bangladesh.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo conduct this study, we obtained the ethical permission from the Biosafety, Biosecurity \u0026amp; Ethical Committee (BBEC) at Jahangirnagar University with the approval number BBEC, JU/M 2025/02 (185). Objectives of the study were described explicitly and proper consent of the parents of the children was taken before sample collection and inclusion of the participants.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod Guidelines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe confirm that we used previously approved relevant and appropriate guidelines and regulations from our studies and international bodies. All laboratory work were performed following our previous studies\u003csup\u003e20-22\u003c/sup\u003e. We adopted guidelines from ATCC (https://www.atcc.org/) for culture and isolation of bacterial pathogens.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy Population and Fecal Specimens\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe collected 360 fecal samples from July 2022 to June 2024 from children with symptoms of gastroenteritis from Tangail (north-central district), Bangladesh. The sample and respective data collection criteria included all children aged from 1 days to less than or 5 years with symptoms of gastroenteritis and reporting to the nearby medical college hospital. A single sample was collected from each child for a single point of time. Diarrhea was defined as having watery, loose or unusually frequent stools for three or more times a day. Children with blood in stools were excluded. Samples were collected and stored following previously published protocols\u003csup\u003e21,22\u003c/sup\u003e. Ten percent suspension of the collected stool specimens were made and centrifuged at 10 000g for 10 minutes. All the samples were stored at \u0026minus;20\u0026deg;C until further analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLaboratory Tests for Detecting Enteric Bacteria\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe characterize bacterial isolates on selective agar media following our previously published work\u003csup\u003e21,22\u003c/sup\u003e. We used MacConkey Agar, Thiosulphate-Citrate-Bile Salt Sucrose (TCBS) Agar, and \u003cem\u003eSalmonella Shigella\u003c/em\u003e (SS) Agar media (HIMEDIA, India) in a sterile manner for the isolation and initial screening of \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eVibrio cholerae\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e spp., and \u003cem\u003eShigella\u003c/em\u003e spp, respectively. For further screening, Eosin Methylene Blue (EMB) Agar (HIMEDIA, India) was used for \u003cem\u003eE. coli\u003c/em\u003e, while Xylose Lysine Deoxycholate (XLD) Agar (HIMEDIA, India) was used for \u003cem\u003eSalmonella\u003c/em\u003e spp. and \u003cem\u003eShigella\u003c/em\u003e spp. Eventually, we used molecular detection for confirmation of bacterial isolates (Supplementary method 1.1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViral Genome Extraction from Fecal Samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the identification of viruses associated with gastroenteritis, we extracted virus genome using 50 \u0026mu;L of the supernatant by commercially available Promega kit according to the manufacturer\u0026apos;s protocols (Promega, Madison) and our previously published work\u003csup\u003e23,24\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePolymerase Chain Reaction (PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used adenovirus specific primers AD1‐F (TTCCCCATGGCICAYAACAC) (nucleotide positions: 1834‐1853) and AD2‐R (CCCTGGTAKCCRATRTTGTA) (nucleotide positions 2315‐2296) for amplification of \u003cem\u003ehexon\u003c/em\u003e gene, producing partial amplicons of 482 base pairs. In addition, we also used primers AK‐VP‐F1 (CGCCGTGGCTCCTGCTCT) and AK‐VP‐R1 (TGTTCGCCATCACAAAAGATGTG), targeting \u003cem\u003evp1/vp2\u003c/em\u003e gene of human bocavirus (HBoV) (nucleotide positions: 3233‐3808), producing amplicons of 609 base pairs\u003csup\u003e20\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe thermal cycle of PCR reaction was conducted at 94\u0026deg;C for 3 minutes, followed by 35 cycles of denaturation at 94\u0026deg;C for 1 minute, annealing at 55\u0026deg;C for 1 minute and extension at 72\u0026deg;C for 1 minute for all viruses. A final extension was performed at 72\u0026deg;C for 7 minutes and then held at 4\u0026deg;C. PCR reaction mixture contained 12.5 \u0026mu;L of the 2\u0026times; master mix (GoTaq Green Master Mix; Promega), 1 \u0026mu;L (200 nM) of forward primer, 1 \u0026mu;L (200 nM) of reverse primer, 6.5 \u0026mu;L of water, and 4 \u0026mu;L (80 ng) of the template. The total volume of the PCR reaction mixture was 25 \u0026mu;L. The PCR was performed in 2720 Thermal Cycler (Applied Biosystems). We used previously sequenced samples as positive controls for HAdV and HBoV, respectively\u003csup\u003e20\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSynthesis of cDNA for the Detection of Rotavirus and Norovirus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe synthesized rotavirus and norovirus complementary DNA (cDNA) by using the commercially available Promega cDNA synthesis kit (Promega, Madison, USA) and our previously published work\u003csup\u003e24,25\u003c/sup\u003e. Further, we performed RT-PCR and sequencing to determine the presence of rotavirus and norovirus positive samples (Supplementary method 1.2-1.4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAgarose Gel Electrophoresis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe performed agarose gel using 1.5% concentration. The gel run was continued for 30 minutes horizontally and 1Kb ladder was used to define the size of the amplicons. Initially isolated amplicons were visualized using an ultraviolet spectrophotometer (SPECORD‐205; Analytik‐Jena, Germany) and photographed in the Gel doc system (BioRad, USA)\u003csup\u003e24,25\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNucleotide Sequence Analyss\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor conducting nucleotide sequence analysis, we purified the amplicons by centrifugation with the Wizard PCR Clean‐Up System (Promega, Madison, USA)\u003csup\u003e24\u003c/sup\u003e. The nucleotide sequences of PCR amplicons (DNA) positive for HAdV were determined using the same set of primers with the Big‐Dye terminator cycle sequencing kit and an ABI Prism 310 Genetic Analyzer (Applied Biosystems Inc, Foster City, CA, USA). Further, we performed sequence cleanup and analysis by using Chromas 2.6.5 (Technelysium, Helensvale, Australia). For further analysis, we used the converted FASTA files. We used the mega blast to identify sequence homology the BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) program. Multiple sequence alignment (MSA) was conducted in the BioEdit 7.2.6 software by running the ClustalW Multiple Alignment algorithm\u003csup\u003e26\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo find out the evolutionary relationship and phylogenetic distance of isolated HAdV based on the partial sequence of the amplicons, we compared them with the reference sequences using MEGA‐X software\u003csup\u003e27\u003c/sup\u003e. We used the Maximum Likelihood Tree building methods running the Kaimura-2-Parameter model. Phylogenetic trees with 1000 bootstrap values of the topology were generated using the previously published work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRapid Detection of HAdV by IC Kit and Evaluation of the Method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the initial screening of the samples, we used the rapid immunochromatography kit (IP Noro/Adeno Kit, Imuuno Probe Co., Japan) and evaluated the kit for the first time in Bangladesh to assess the sensitivity and specificity of the method. We performed the test according to the given protocol and previously published work\u003csup\u003e25\u003c/sup\u003e. After applying samples, we observed the IC kit for next 15\u0026nbsp;minutes. Positive results came within the first 5\u0026nbsp;minutes. We used a two-by-two table and previously published equation for calculating the sensitivity and specificity by comparing the findings with a set of positive and negative controls and samples tested using the gold standard RT-PCR method (Supplementary method 1.5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCategorical variables were expressed by percentage and continuous variables by mean/ median. Inferential statistics (\u003cem\u003ep\u003c/em\u003e-value) was applied for the analyses. We used Chi-square test for comparing the symptoms of children with gastroenteritis. The Pearson\u0026rsquo;s correlation analysis was performed for determining the seasonality.\u0026nbsp;We compared the odds ratio (OR) of categorical variables by using Chi-square with 95 % confidence intervals (CIs). For creating the sampling map, we used the ArcGIS. Statistical analyses were performed using R-4.5.2 program and SPSS v24.0 software (IBM, US).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNucleotide Sequence Submission\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nucleotide sequence data reported in this study was submitted to the GenBank database and they are publicly available under the accession numbers, PX781901-PX781921.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eSociodemographic Characteristics and Association of WASH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSociodemographic and WASH data were collected from pediatric patients in rural and semi-urban areas and their association with diarrheal cases were analyzed (Figure 1 part A). The lowest age of diarrheal children was 27 days and highest was 59 months, and male to female ratio was 6:5. \u0026nbsp;We found no significant differences in age or sex distribution between infected and uninfected children. In contrast, we found significant association of infection (p-value \u0026lt; 0.001) with rural residence, lower household income, limited access to safe water, and household hygiene practices (Table 1). However, access to sanitation facilities was not significantly associated with the infection. We found the presence of enteric pathogens including human adenovirus mainly associated with socioeconomic disadvantage and suboptimal WASH status rather than demographic factors among the children with gastroenteritis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of Human Adenoviruses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe found human adenovirus among 7% (25 of 360) of the children with gastroenteritis. The prevalence of HAdV was second after rotavirus (31%) among the viruses detected. Among the other viruses, we tested for norovirus (NoV), human bocavirus (HBoV) and sapovirus. However, we only found NoV among 4% of the children. Further, among the bacterial pathogens Vibrio cholerae (10%) and Escherichia coli (8%) contributed to the larger portion of pathogens (Figure 1 part B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCodetection of Other Pathogens\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe found co-prevalence of different pathogens among children with gastroenteritis. Among the HAdV positive children, mono-infection was found among 24% (6 of 25), dual-infection among 68% (17 of 25) and triple-infection among 8% (2 of 25). The difference on symptoms among co-infected children was not significant (Figure 1 part C).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of HAdV Infection Over the Study Period\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevalence of HAdV concentrated from October to January in the study region. A sharp peak was found in December with 28% cases followed by January 20%. We also conducted Pearsons\u0026rsquo;s correlation analysis of cases with environmental factors to find the effect. Lower temperature showed significantly higher association\u003cem\u003e\u0026nbsp;r\u003c/em\u003e=0.78 with HAdV cases (Figure 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical Outcomes Among Children\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe found higher frequency of HAdV among children aged 12 to 23 months (54%) followed by 24 to 35 months (46%) and male to female ratio 3:2-without a significant difference with negative HAdV children. We found HAdV positive children and other enteric pathogens positive children had significantly higher frequency of systemic and gastrointestinal symptoms compared to negative cases. Abdominal cramp, severe vomiting and dehydration were significantly higher among HAdV cases compared to all other pathogens. We also found significantly higher frequency of conjunctivitis among virus infected children (Figure 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNucleotide Sequence and Phylogenetic Analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used the partial sequence of hexon genes to determine the phylogenetic relationship. We found the prevalence of HAdV-F41 76% (19 of 25) and HAdV-C1 24% (6 of 25). The MSA provided over 99.4% of sequence similarity with reference sequences. Three distinct clusters of HAdV-F41 were circulating among the children. Study isolates, PX781901-PX781904, PX781906, PX781907 and PX781912 were closely related with previously reported isolates from the USA (KF303069), Beijing (MT150494) and Cote d Ivorie (KP274041); PX781914 with India (KU904307), Japan (LC790294) and Thailand (MK674752); PX781905, PX781908, PX781909, PX781911, and PX781915 with Germany (ON532817) (Figure 4 pat A). Further, the isolates of HAdV-C1 (PX781916-PX781921) showed great diversity and close relation with previous isolates from the USA, Japan, Russia, and China (Figure 4 part B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSensitivity and Specificity of Rapid IC kit\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe evaluated a rapid IC kit for detection of norovirus and adenovirus simultaneously in a single sample from native children in Bangladesh. The standard 2 by 2 table was used for determine the sensitivity and specificity of the IC kit. The IC kit provided a higher specificity (99.4 %) and sensitivity (96.1%) and good agreement with the gold standard RT-PCR for the detection of HAdV among native people (Table 2). Among the tested 200 samples we found one false positive and one false negative during this evaluation process (Supplementary Figure i).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHuman adenovirus-F41 has become an emerging etiology and rising concern among children with gastroenteritis worldwide-with no vaccine or antiviral\u003csup\u003e1,10\u003c/sup\u003e. \u0026nbsp;Our study provides a comprehensive epidemiological and molecular characterization of human enteric adenovirus infections among children in north-central Bangladesh, expanding recent understandings beyond Dhaka-centric surveillance. We found that HAdV-F41 was a major contributor to pediatric gastroenteritis in this region, second only to rotavirus, and accentuate its association with characteristic clinical manifestations, seasonality, and socioeconomic vulnerability.\u003c/p\u003e\n\u003cp\u003eWe found the circulation of HAdV-C1 and HAdV-F41 isolates among the pediatric population. However, the documented predominance of HAdV-F41 is similar with its established role as a major enteric adenovirus worldwide, particularly in low- and middle-income countries, including Brazil, China, India, Kenya and Bangladesh\u003csup\u003e4,8,20,28-31\u003c/sup\u003e. Strikingly, the frequency of positive cases among children aged 12\u0026ndash;35 months aligns with the statement that the period of reducing maternal immunity and increased environmental exposure, contributing to higher susceptibility. Additionally, the absence of a significant sex-based difference supports a probable exposure-driven spread rather than host-intrinsic susceptibility. Moreover, our findings suggest for initial evidence on the significant association between infection and rural residence, low household income, and inadequate access to safe water highlights the continued importance of WASH-related factors in shaping adenovirus and other gastroenteritis associated pathogens transmission dynamics. This is one of the first studies to explore the emergence of enteric HAdV and associated factors along with pathogenic diversity in the selected population. Compared with our previous study, which reported 7% prevalence with higher diversity of HAdV from central regions in Bangladesh, we found higher prevalence of HAdV-F41 in this study\u003csup\u003e20\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eWe also integrated clinical symptoms of the pediatric patients. Clinically, HAdV-F41 positive children showed more severe gastrointestinal symptoms, including abdominal cramps, dehydration, and severe vomiting, compared with both pathogen-negative children and those infected with other enteric pathogens. The frequent occurrence of conjunctivitis among HAdV-C1 cases further supports a systemic or mucocutaneous involvement characteristic of adenoviral infection requiring further investigations. Our findings reinforce the statement that enteric adenovirus infections are clinically significant, contributing to severe disease progression and subsequent hospitalization, particularly in resource-limited settings.\u003c/p\u003e\n\u003cp\u003eFurther, the high rate of co-detection with other enteric pathogens reveals the complex enteric viriome and bacteriome encountered by children in concentrated endemic settings. Although we could not detect significant difference of symptoms among co-infected cohort, their frequent circulation might complicate diagnosis and disease burden and influence viral shedding, immune responses, and treatment outcomes. These findings are strongly supported by previous findings from several other regions in Bangladesh and other LMICs\u003csup\u003e4,20,22,24\u003c/sup\u003e. Further, these findings highlight the need for rapid and multiplex diagnostic approaches and vigilant interpretation of single-pathogen detections and prevention in diarrheal disease surveillance.\u003c/p\u003e\n\u003cp\u003eSeasonally, HAdV-F41 infections peaked during colder months and showed a strong correlation with ambient temperature. This seasonal pattern supports previous winter-driven seasonality of enteric viruses and contrasts with the monsoon-driven seasonality of several bacterial and parasitic entero-pathogens. Our findings suggest that environmental stability, host behavioral factors, and practices may favor adenovirus transmission during colder periods. Such seasonal predictability can contribute to outbreak preparedness, diagnostic vigilance, and resource distribution to healthcare facilities.\u003c/p\u003e\n\u003cp\u003eMolecular and phylogenetic analyses revealed that the majority of circulating strains belonged to HAdV-F41, creating several clusters closely related to recent global isolates from Asia, Europe, Africa, and North America. This evolutionary relatedness might indicate ongoing global circulation and reintroductions rather than long-term local evolution, emphasizing the interconnected nature of global transmission. The detection of non-enteric HAdV-C1 in a subset of cases likely reflected incidental gastrointestinal shedding following respiratory or systemic infection, consistent with prior observations.\u003c/p\u003e\n\u003cp\u003eFinally, the high sensitivity and specificity of the used rapid immunochromatography test reveal its potential application as a point-of-care diagnostic tool in low-resource settings and distant regions lacking RT-PCR lab facilities. In our previous studies, we found higher effectiveness of similar IC kit for simultaneous detection of rotavirus/norovirus\u003csup\u003e25\u003c/sup\u003e. Rapid identification of norovirus/adenovirus-associated gastroenteritis could aid clinical decision-making, reduce unnecessary antibiotic use, and strengthen routine surveillance where molecular diagnostics are not readily available.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn summary, our study detected HAdV-F41 as an emerging and underrecognized cause of pediatric gastroenteritis in rural and semi-urban Bangladesh, with clear clinical relevance and strong links to environmental and socioeconomic determinants. Collectively, the findings argue for the incorporation of adenovirus surveillance into routine diarrheal disease monitoring and for greater consideration of enteric adenoviruses in the design of future vaccines and public health interventions aimed at mitigating childhood gastroenteritis. This is one of the first reports of emergence of higher incidence of HAdV-F41 from the study regions and our findings are supported by recent studies in Brazil, China, India, Japan, Tunisia, Turkey, and Venezuela\u003csup\u003e10,13\u003c/sup\u003e. During the post-rotavirus vaccination era, emergence of higher incidence and disproportionate prevalence of HAdV-F41/40 in substantial regions of the world underscores the necessity of further investigations on the epidemic potential of HAdVs.\u003c/p\u003e\n\u003cp\u003eThough we conducted a comprehensive epidemiologic and molecular characterization study, several limitations require attention for interpreting the findings. First, the sample size could be larger, although sufficient to identify predominant adenovirus types and clinical associations, limits the power to detect enough differences among co-infected children. Although the number of HAdV-positive cases was limited, the study spanned two full years including molecular confirmation and phylogenetic analysis, providing robust evidence in this setting. Second, our sampling was hospital-based and restricted to only symptomatic cases, which might underestimate the true burden of asymptomatic or mildly symptomatic adenovirus infections in the community and bias prevalence estimates. Third, molecular characterization relied on partial hexon gene sequences; while this approach is widely accepted for typing of HAdVs, whole-genome sequencing would provide greater understandings to identify recombination, track transmissions, and explore viral determinants of enteric tropism and virulence. In addition, we could not perform longitudinal follow-up and quantitative viral load measurements, limiting assessment of viral shedding duration, reinfection, or associations between viral burden and clinical severity.\u003c/p\u003e\n\u003cp\u003eIn future, studies should emphasize large-scale, multicenter surveillance including both community- and hospital-based cohorts to better characterize the population-level burden of enteric adenoviruses across diverse socioeconomic settings. Further, the application of whole-genome sequencing and metagenomic approaches will be critical to resolve adenovirus evolution, recombination, and global dissemination patterns. Moreover, mechanistic studies highlighting host immune responses, including mucosal immunity and interactions with the gut microbiota and other pathogens, are needed to clarify determinants of disease prognosis and severity. Finally, the development and evaluation of enteric adenovirus-targeted vaccines, antiviral strategies, monoclonal antibodies, along with improved point-of-care rapid diagnostics, represent important future directions to reduce the burden of adenovirus-associated pediatric gastroenteritis, particularly in low- and middle-income countries.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interest to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNadim Sharif: writing \u0026ndash; original draft preparation (lead); writing \u0026ndash; review and editing (lead), methodology (lead); investigation (lead), conceptualization (supporting), data analysis (lead). Abdullah Ibna Masud: validation (equal): writing \u0026ndash; review and editing (equal), methodology (supporting). Jannatin Naim: software (supporting), writing \u0026ndash; review and editing (equal), methodology (supporting). \u0026nbsp;Rubayet Rayhan Opu: software (supporting), writing \u0026ndash; review and editing (equal), methodology (supporting). Afsana Khan: software (supporting), writing \u0026ndash; review and editing (equal), data analysis (lead). Hiroshi Ushijima: software (supporting), writing \u0026ndash; review and editing (equal). \u003csup\u003e\u0026nbsp;\u003c/sup\u003eShuvra Kanti Dey: conceptualization (lead), funding acquisition (lead), project administration (lead), resources (lead), supervision (lead).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data are available in the manuscript and the supplementary materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKyu, H. H. et al. Global, regional, and national age-sex-specific burden of diarrhoeal diseases, their risk factors, and aetiologies, 1990\u0026ndash;2021, for 204 countries and territories: a systematic analysis for the Global Burden of Disease Study 2021. \u003cem\u003eLancet. Infect. Dis\u003c/em\u003e. \u003cb\u003e25\u003c/b\u003e (5), 519\u0026ndash;536 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrunas, O. et al. Global estimates of rotavirus vaccine efficacy and effectiveness: a rapid review and meta-regression analysis. \u003cem\u003eEClinicalMedicine\u003c/em\u003e ;\u003cb\u003e81\u003c/b\u003e. (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMerid, M. W. et al. Impact of access to improved water and sanitation on diarrhea reduction among rural under-five children in low and middle-income countries: a propensity score matched analysis. \u003cem\u003eTrop. Med. Health\u003c/em\u003e. \u003cb\u003e51\u003c/b\u003e (1), 36 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuga, G. et al. Burden, clinical characteristics, risk factors, and seasonality of adenovirus 40/41 diarrhea in children in eight low-resource settings. \u003cem\u003eOpen. forum Infect. Dis.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, ofac241 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulanayake, S. \u0026amp; Tikoo, S. K. Adenovirus core proteins: structure and function. \u003cem\u003eViruses\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (3), 388 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenkő, M. et al. ICTV virus taxonomy profile: Adenoviridae 2022. \u003cem\u003eJ. Gen. Virol.\u003c/em\u003e \u003cb\u003e103\u003c/b\u003e (3), 001721 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArnold, A. \u0026amp; MacMahon, E. Adenovirus infections. \u003cem\u003eMedicine\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e (12), 790\u0026ndash;793 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003edo Nascimento, L. G., Fialho, A. M., de Andrade, J. D., de Assis, R. M. \u0026amp; Fumian, T. M. Human enteric adenovirus F40/41 as a major cause of acute gastroenteritis in children in Brazil, 2018 to 2020. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (1), 11220 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLion, T. Adenovirus infections in immunocompetent and immunocompromised patients. \u003cem\u003eClin. Microbiol. Rev.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e (3), 441\u0026ndash;462 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWikswo, M. E. et al. A systematic review and meta-analysis of the global prevalence of human enteric adenovirus infections. \u003cem\u003eJ. Infect. Public Health\u003c/em\u003e :102800. (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOperario, D. J. et al. Etiology of severe acute watery diarrhea in children in the global rotavirus surveillance network using quantitative polymerase chain reaction. \u003cem\u003eJ. Infect. Dis.\u003c/em\u003e \u003cb\u003e216\u003c/b\u003e (2), 220\u0026ndash;227 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUhnoo, I., Wadell, G., Svensson, L. \u0026amp; Johansson, M. E. Importance of enteric adenoviruses 40 and 41 in acute gastroenteritis in infants and young children. \u003cem\u003eJ. Clin. Microbiol.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (3), 365\u0026ndash;372 (1984).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhales, P. et al. Human adenoviruses in children with gastroenteritis: a systematic review and meta-analysis. \u003cem\u003eBMC Infect. Dis.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e (1), 478 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFavier, A. L., Burmeister, W. P. \u0026amp; Chroboczek, J. Unique physicochemical properties of human enteric Ad41 responsible for its survival and replication in the gastrointestinal tract. \u003cem\u003eVirology\u003c/em\u003e \u003cb\u003e322\u003c/b\u003e (1), 93\u0026ndash;104 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez, E. et al. Short-fiber protein of ad40 confers enteric tropism and protection against acidic gastrointestinal conditions. \u003cem\u003eHum. gene therapy methods\u003c/em\u003e. \u003cb\u003e24\u003c/b\u003e (4), 195\u0026ndash;204 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKajon, A. E. Adenovirus infections: new insights for the clinical laboratory. \u003cem\u003eJ. Clin. Microbiol.\u003c/em\u003e \u003cb\u003e62\u003c/b\u003e (9), e00836\u0026ndash;e00822 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYodmeeklin, A. et al. Diverse genotypes of human enteric and non-enteric adenoviruses circulating in children hospitalized with acute gastroenteritis in Thailand, from 2018 to 2021. \u003cem\u003eMicrobiol. Spectr.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (5), e01173\u0026ndash;e01123 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDey, S. K. et al. Molecular epidemiology of adenovirus infection among infants and children with acute gastroenteritis in Dhaka City. \u003cem\u003eBangladesh Infect. Genet. Evol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (4), 518\u0026ndash;522 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAfrad, M. H. et al. Detection of enteric-and non‐enteric adenoviruses in gastroenteritis patients, Bangladesh, 2012‐2015. \u003cem\u003eJ. Med. Virol.\u003c/em\u003e \u003cb\u003e90\u003c/b\u003e (4), 677\u0026ndash;684 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharif, N. et al. Molecular and epidemiological trends of human bocavirus and adenovirus in children with acute gastroenteritis in Bangladesh during 2015 to 2019. \u003cem\u003eJ. Med. Virol.\u003c/em\u003e \u003cb\u003e92\u003c/b\u003e (12), 3194\u0026ndash;3201 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharif, N. et al. Molecular and epidemiologic analysis of diarrheal pathogens in children with acute gastroenteritis in Bangladesh during 2014\u0026ndash;2019. \u003cem\u003ePediatr. Infect. Dis. J.\u003c/em\u003e \u003cb\u003e39\u003c/b\u003e (7), 580\u0026ndash;585 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharif, N. et al. Multidrug resistance pattern and molecular epidemiology of pathogens among children with diarrhea in Bangladesh, 2019\u0026ndash;2021. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (1), 13975 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThongprachum, A. et al. Four-year study of viruses that cause diarrhea in Japanese pediatric outpatients. \u003cem\u003eJ. Med. Virol.\u003c/em\u003e \u003cb\u003e87\u003c/b\u003e (7), 1141\u0026ndash;1148 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDey, S. K. et al. Molecular epidemiology and surveillance of circulating rotavirus among children with gastroenteritis in Bangladesh during 2014\u0026ndash;2019. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e (11), e0242813 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharif, N. et al. High prevalence of norovirus GII. 4 Sydney among children with acute gastroenteritis in Bangladesh, 2018\u0026ndash;2021. \u003cem\u003eJ. Infect. Public Health\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e (7), 1015\u0026ndash;1022 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall, T. A. BioEdit: a user-friendly biological sequence alignment editorand analysis program for Windows 95/98/NT. Nucleic acids symposium series ;41:95\u0026ndash;98. (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar, S., Stecher, G., Li, M., Knyaz, C. \u0026amp; Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 1547\u0026ndash;1549 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandra, P. et al. Genetic characterization and phylogenetic variations of human adenovirus-F strains circulating in eastern India during 2017\u0026ndash;2020. \u003cem\u003eJ. Med. Virol.\u003c/em\u003e \u003cb\u003e93\u003c/b\u003e, 6180\u0026ndash;6190 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLambisia, A. W. et al. Genomic epidemiology of human adenovirus F40 and F41 in coastal Kenya: a retrospective hospital-based surveillance study (2013\u0026ndash;2022). \u003cem\u003eVirus Evol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, vead023 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBinder, A. M. Human adenovirus surveillance\u0026mdash;United States, 2003\u0026ndash;2016. MMWR. Morbidity and mortality weekly report. ;66. (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu, P. et al. Genomic Epidemiological Characteristics of Enteric Adenovirus F40 and F41 in Yantai, China, from 2022 to 2023. \u003cem\u003eViruses\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (12), 1595 (2025).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Sociodemographic characteristics and WASH parameters among the study participants. A \u003cem\u003ep\u003c/em\u003e-value of \u0026le; 0.05 was considered statistically significant.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eCharacteristics\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003ePositive, n=246 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003eNegative n=114 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003eTotal, n=360 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003eP-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e0.95\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e\u0026lt;1 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e42 (17.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e18 (15.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e60 (16.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e1-11 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e57 (23.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e24 (21.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e81 (22.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e12-23 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e70 (28.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e34 (29.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e104 (28.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e24-35 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e51 (20.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e23 (20.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e74 (20.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e36-59 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e26 (10.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e15 (13.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e41 (11.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e135 (54.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e63 (55.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e198 (55)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e111 (45.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e51 (44.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e162 (45)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eEthnicity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eNative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e246 (100)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e114 (100)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e360 (100)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eResidents\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eRural\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e184 (74.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e58 (50.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e242 (67.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eUrban\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e62 (25.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e56 (49.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e118 (32.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eFamily income\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e10000 to 30000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e132 (53.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e21 (18.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e153 (42.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e31000 to 80000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e75 (30.5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e64 (56.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e139 (38.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003e81000 to 150000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e39 (15.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e29 (25.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e(18.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eEducation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eEducated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e83 (34.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e73 (64.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e158 (43.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eUneducated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e161 (65.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e41 (36.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e202 (56.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eAccess to safe water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e167 (67.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e93 (81.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e260 (72.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e79 (32.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e21 (18.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e100 (27.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eAccess to sanitation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e0.58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e214 (87.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e103 (90.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e317 (88)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e30 (13.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e11 (9.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e43 (12)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"bottom\" style=\"width: 81.7699%;\"\u003e\n \u003cp\u003eHygiene practice\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eGood\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e50 (20.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e58 (50.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e108 (30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eModerate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e127 (47.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e47 (41.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e164 (45.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 29.2035%;\"\u003e\n \u003cp\u003eLeast\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.3451%;\"\u003e\n \u003cp\u003e73 (29.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.9912%;\"\u003e\n \u003cp\u003e15 (13.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e88 (24.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.2301%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eM-months; Amount of income was in local currency taka. Parameter of WASH were adopted from the WASH Performance Index Report, 2015.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Evaluation of sensitivity and specificity of IC kit (IP Noro/Adeno Kit, Immuno Probe, Japan).\u003c/p\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"623\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTest Result\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 225px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRT- PCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 107px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSensitivity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecificity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eIP-Noro/Adeno kit\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive (+)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 109px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNegative (-)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 107px;\"\u003e\n \u003cp\u003e96.15%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 108px;\"\u003e\n \u003cp\u003e99.43%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive (+)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 109px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNegative (-)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 109px;\"\u003e\n \u003cp\u003e173\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e174\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 119px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 109px;\"\u003e\n \u003cp\u003e174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Human adenovirus, Gastroenteritis, Co-infection, Rural settings, LMICs, South East Asia","lastPublishedDoi":"10.21203/rs.3.rs-8726761/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8726761/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHuman enteric adenovirus F-41 is an emerging cause of pediatric gastroenteritis, but data from South Asia remain limited. We investigated the molecular epidemiology, clinical features, seasonality of adenovirus-associated gastroenteritis and feasibility of an IC kit among children under 5 in north-central Bangladesh during July 2022\u0026ndash;June 2024. Fecal samples from 360 children with acute gastroenteritis were tested for viral and bacterial pathogens using PCR, sequencing, and phylogenetic analyses. Human adenovirus was detected in 7% of cases. Most adenovirus-positive samples (76%) were adenovirus F-41. Infected children, aged 12\u0026ndash;35 months, exhibited more severe gastrointestinal symptoms, including dehydration and severe vomiting. Infections peaked during colder months and were correlated with temperature. Study isolates were closely related with contemporary global adenovirus F-41 strains. A rapid immunochromatographic assay demonstrated high agreement with RT-PCR. These findings identify adenovirus F-41 as an emerging contributor to pediatric gastroenteritis in Bangladesh and highlight the need for enhanced surveillance.\u003c/p\u003e","manuscriptTitle":"Emergence of Human Enteric Adenovirus F41 Among Children with Gastroenteritis in North-central Bangladesh, 2022-2024","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-10 11:44:06","doi":"10.21203/rs.3.rs-8726761/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-09T05:59:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-30T12:31:03+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-30T12:30:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-01-29T03:54:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d799a338-f8ee-4d9a-9138-c3d3ecf65dd6","owner":[],"postedDate":"February 10th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":62550593,"name":"Health sciences/Diseases"},{"id":62550594,"name":"Health sciences/Gastroenterology"},{"id":62550595,"name":"Health sciences/Medical research"},{"id":62550596,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2026-05-11T05:27:50+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-10 11:44:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8726761","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8726761","identity":"rs-8726761","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}