The dissemination potential of Microsporidia MB in Anopheles arabiensis mosquitoes is modulated by temperature

The dissemination potential of Microsporidia MB in Anopheles arabiensis mosquitoes is modulated by temperature | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The dissemination potential of Microsporidia MB in Anopheles arabiensis mosquitoes is modulated by temperature Fidel Gabriel Otieno, Priscille Barreaux, Affognon Steeven Belvinos, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5654412/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Aug, 2025 Read the published version in Scientific Reports → Version 1 posted 14 You are reading this latest preprint version Abstract Microsporidia MB , a vertically transmitted endosymbiont of Anopheles mosquitoes, shows strong potential as a malaria control agent due to its ability to inhibit Plasmodium development within the mosquito host. To optimize its deployment in malaria transmission reduction strategies, it is critical to understand how environmental factors, particularly temperature, affect its infection dynamics. In this study, we investigated the influence of four temperature regimes (22°C, 27°C, 32°C, and 37°C) on Microsporidia MB prevalence and infection intensity by rearing mosquito larvae under controlled laboratory conditions. Our results demonstrate that elevated temperatures, especially 32°C, significantly enhance both larval growth and Microsporidia MB infection rates. Population growth modeling further indicates that at 32°C, an infected mosquito population can reach 1,000 offspring within 15–35 days—representing a 4.7-, 1.3-, and 1.7-fold higher dissemination potential compared to 22°C, 27°C, and 37°C, respectively. Despite a higher mortality rate at 32°C (approximately 20% greater than at 27°C), this temperature emerged as the most favorable for mass-rearing Microsporidia MB -infected larvae. These findings offer the first insights into temperature-mediated dynamics of Microsporidia MB and support its potential for scalable implementation in malaria-endemic regions. Biological sciences/Microbiology/Applied microbiology Physical sciences/Mathematics and computing/Computational science Microsporidia MB malaria control endosymbiosis temperature dissemination potential computational biology Figures Figure 1 Figure 2 Importance Malaria, transmitted by Anopheles mosquitoes, poses a severe threat to human health and economic sustainability in sub-Saharan Africa. Traditional control methods, reliant on insecticides and drugs, are losing effectiveness due to resistance, highlighting the urgent need for innovative solutions. One such potential solution is Microsporidia MB , a naturally occurring symbiont that can block Plasmodium transmission in Anopheles gambiae s.l.. However, its success in controlling malaria depends on understanding the infection dynamics of the symbiont over time and across different environments. Our experimental studies on field derived mosquitoes and mathematical modelling show that Microsporidia MB dissemination potential increases with temperature within a viable range for Anopheles gambiae s.l. mosquitoes, driven by trade-offs between mosquito development, survival and the symbiont growth. This study suggests that fluctuating temperatures could influence the effectiveness of Microsporidia MB in blocking malaria transmission, and future research should focus on how these temperature changes impact its performance in natural settings. Introduction Malaria prevention and management are increasingly challenged by global temperature rise [ 1 ] and the growing threat of insecticide resistance, particularly low- and middle-income countries in sub-Saharan Africa [ 2 , 57 ]. Climate change accelerates insecticide resistance, undermining the efficacy of current insecticide-based control measures [ 3 , 53 , 56 , 59 ]. Consequently, the global malaria burden continues to rise, with 249 million cases in 2022, up from 231 million cases in 2015 [ 4 ]. The ambitious target from the World Health Organization to reduce malaria cases and mortality by 90% by 2030 cannot be met using insecticide-based methods alone [ 5 ]. While insecticide-treated nets and indoor residual spraying of insecticides remain central to vector control, novel and complementary malaria control innovations are urgently needed. [ 58 ]. These new tools must be evaluated with consideration of their interactions with environmental conditions, ecology and existing control measures [ 4 ]. Microsporidia MB , a naturally occurring symbiont, shows great promise as a complementary malaria control strategy through by inhibiting Plasmodium parasite proliferation in Anopheles mosquitoes [ 6 , 7 ]. Identified in various Anopheles species ( An. arabiensis, An. gambiae, An. coluzii ) and across different geographical regions [ 7 , 31 , 64 ], Microsporidia MB spreads through vertical and horizontal transmission routes [ 6 ]. Despite its potential, understanding the impact of temperature and climate on its performance is crucial for maximizing its effectiveness as a malaria control tool. Notably, Microsporidia MB shows seasonal variation in prevalence with higher infection rates following peak rainfall periods [ 7 ], a pattern observed in several microsporidians in Anopheles mosquitoes [ 8 ]. Temperature plays a key roles in influencing the growth of microsporidians, with high temperatures and low humidity promoting increased infection intensity and spore production [ 8 – 14 ]. Additionally, environmental conditions significantly affect mosquito physiology, survival, reproduction, and development [ 8 , 15 – 17 – 24 ]. Temperature also impacts symbiontic relationships in other insect species, such as the stinkbug pest Nezara viridula , where warmer conditions disrupts its gut microbiome and reduce fitness [ 25 ]. Microsporidia MB transmission is intensity-dependent [ 6 , 7 ] and the infection levels can be influenced by factors such as mosquito age and blood feeding [ 7 , 26 ]. Thus, temperature may have a profound impact on the proliferation of Microsporidia MB , presenting both opportunities and challenges for its use as malaria control strategy [ 9 ]. In this study, we investigate the impact of temperature on the dissemination potential of Microsporidia MB in An. arabiensis mosquitoes collected from the Ahero irrigation scheme, where we have identified a single isolate of Microsporidia MB based on genome sequencing [ 65 ]. By examining mosquito larval development time, survival rates, and infection levels at different temperatures (22°C, 27°C, 32°C, and 37°C), we developed a population growth model to simulate the spread of Microsporidia MB -infected Anopheles arabiensis mosquitoes. The reference temperature for rearing Anopheles arabiensis mosquitoes is 27°C [ 60 ], with 22°C and above 35°C marking the critical thresholds for mosquito development [ 61 ]. Our model quantifies how quickly Microsporidia MB can establish itself within a population, offering valuable insights into the optimal conditions for maximizing its dissemination potential. By predicting the dynamics of Microsporidia MB spread, we aim to enhance the feasibility of using symbiont in malaria control efforts. Results 1) Quantification of Microsporidia MB The vertical transmission rate of Microsporidia MB in the Anopheles arabiensis lineages used for this study was found to be 43%, meaning that approximately 43% of the offspring from Microsporidia MB -infected (MB+) females were infected with Microsporidia MB . Microsporidia MB uninfected females (MB-) are either uninfected offspring of MB + female An. arabiensis (the remaining 57%) or offspring from MB- An. arabiensis females. Pupation rate : The average pupation rate across all temperature treatment was 54.1 (95% confidence interval: 51.60-56.59) %. Notably, at 27°C, the pupation rate was 73.8 (69.44–78.14) % which was significantly higher than at 32°C (56.1%, 50.92–61.13) and 37°C (19.0%, 15.12–22.86) ( Fig. 1 A ) . However, pupation at 27°C was not significantly different from 22°C (67.8%, 63.16–72.36). (Tukey post-hoc comparisons: p 27°C−22°C > 0.05 and p 27°C−32°C and p 27°C−37°C < 0.001; χ 2 = 153.95, df = 3, p < 0.001). Offspring of MB- female An. arabiensis exhibited higher pupation rates than those of MB + female An. arabiensis [MB- female An. arabiensis : 58.5 (52.29–64.73) % ; MB + An. arabiensis : 53.3 (50.56-56.00) %]. This effect is due to the offspring of MB − female An. arabiensis exhibiting pupation success rates three times higher than those of MB + offspring when reared at 37°C. [37°C; MB- female An. arabiensis : 40.9 (0.29–0.53) %, MB + female An. arabiensis : 14.6 (10.77–18.40) %] (Tukey test at 37°C: p MB−/MB+ 0.05; χ 2 = 11.26, df = 1, p < 0.003). Larval death age : Larvae that did not pupate died after 6.1 (5.79–6.33) days on average after hatching. When reared at 37°C, larvae died about two days earlier than at other temperatures [22°C: 7.1 (6.17–8.02) days; 27°C: 6.6 (5.93–7.35) days; 32°C: 7.1 (6.53–7.60) days; 37°C: 5.0 (4.69–5.27) days; ( Fig. 1 B ) ] (Tukey for dead larvae: p 27°C−37°C , p 22°C−37°C and p 32°C−37°C < 0.001; χ 2 = 39.79, df = 3, p < 0.001). Time to pupation : The average time for the larvae to pupate was 9.6 (9.41–9.80) days, with larvae from MB- female An. arabiensis pupating almost two days faster than those from MB + female An. arabiensis [MB- female An. arabiensis : 8.1 (7.67–8.47) days; MB + female An. arabiensis : 9.9 (9.71–10.13) days] ( χ 2 = 56.87, df = 1, p < 0.001). However, being an MB + offspring from an MB + female An. arabiensis increased the chance to pupate one day faster compared to MB- larvae coming from MB + female An. arabiensis [MB + offspring: 9.1 (8.85–9.40) days; MB- coming from MB + female An. arabiensis : 10.2 (9.93–10.52) days] ( χ 2 = 50.92, df = 2, p < 0.001), (supplementary Fig. 1 ) , largely due to a significant difference at 27°C [MB- offspring from MB + female An. arabiensis : 11.1 (10.66–11.46) days; MB + offspring: 9.4 (9.06–9.83) days] (Tukey: p MB+ female An. arabiensis only− MB+offspring = 0.02; χ 2 = 21.92, df = 6, p = 0.001). At 22°C, 32°C, and 37°C, all larvae coming from MB + female An. arabiensis had similar development times (all Tukey test p > 0.05). Overall, time to pupation decreased with increasing temperature, with larvae at 32°C and 37°C pupating 36% faster than at 27°C and nearly 50% faster than at 22°C [22°C: 11.6 (11.29–11.88) days; 27°C: 10.1 (9.86–10.36) days; 32°C: 7.1 (6.89–7.42) days; 37°C: 6.96 (6.62–7.30) days] (Tukey for larvae that pupated: for all p 0.05; χ 2 = 137.95, df = 3, p < 0.001) ( Fig. 1 C ) . Infection rate in offspring : The infection rate in offspring varied by temperature, with a significant decrease at 22°C compared to 27°C [22°C: 30.8 (24.45–37.22) %; 27°C: 48.7 (42.43–5507) %] and 37°C showing the highest infection rate [32°C: 46.7 (39.06–54.28) %; 37°C: 52.1 (37.95–66.21)%] ( Fig. 1 D ) (Tukey: estimate 27°C−22°C = 0.68, p 27°C−22°C = 0.001; p 27°C−32°C and p 27°C−37°C > 0.05; χ 2 = 9.99, df = 1, p = 0.001). The infection rate in the offspring was positively correlated with the maternal Microsporidia MB intensity (r 2 = 0.5612, y = 1.47x + 26.09 , p < 0.005) (supplementary Fig. 2). Microsporidia MB intensity in offspring The relative intensity of Microsporidia MB in MB + offspring was 1.7 (1.19–2.23) as calculated relative to the single copy nuclear Anopheles S7 gene. Larvae with higher Microsporidia MB intensity tended to pupate faster ( χ 2 = 6.56, df = 1, p = 0.01). This relationship however dependent on temperature [p 22°C−27°C < 0.001; p 27°C−37°C = 0.06; p 27°C−32°C = 0.001; χ 2 = 17.45, df = 3, p < 0.001 ( Fig. 1 E ) ]. At 27°C and 37°C, the development time was negatively correlated to Microsporidia MB intensity in the offspring. At 27°C faster pupation led to a 45% increase in Microsporidia MB intensity, while at 22°C, delayed pupation increased intensity by the same amount [y (27) = 9.7–0.467x, r 2 = 0.12; y (22) = 11.4 + 0.311x, r 2 = 0.13; y (37) = 7.75–0.252x, r 2 = 0.23]. The intensity at 32°C was unaffected by pupation time [y (32) = 7.33 + 0.00623x, r 2 < 0.01]. Additionally, female An. arabiensis with higher transmission rate (above 50%), produced offspring with greater Microsporidia MB intensity (supplementary Fig. 3). 2) Modelling the Microsporidia MB dissemination potential Using the experimental data, we developed a mathematical model to predict the spread of Microsporidia MB in Anopheles arabiensis populations at different temperatures. The time required to reach a target population of a thousand MB + offspring from an initial population of ten female An. arabiensis was significantly influenced by temperature. As temperature increased, the mean age at pupation decreased, and the probability of successful pupation increased (Fig. 2 A). The probability that an offspring is infected, survives to age x , and pupates at age x given temperature T was modelled as a function of fitted parameters: A (scaling factor), mu (µ) (mean age of pupation), and sigma (σ ) (spread of the pupation age). This probability combined the likelihood of infection at temperature T , the chance of survival to age x given infection, and the probability of pupating at that specific age. The model’s accuracy was validated by high R 2 values, especially at higher temperatures, indicating a strong fit to the observed data. At 22°C, the normalization constant A was 0.02942, with a mean pupation age mu of 10.73 and a standard deviation sigma of 2.20, resulting in a mean squared error (MSE) of 0.00003 and a R 2 value of 0.794, indicating a moderate fit. At 27°C, A increased to 0.04785, mu decreased to 8.99, and sigma was 2.06, with an MSE of 0.00003 and a stronger fit at R 2 = 0.917. At 32°C, A further increased to 0.05782, mu dropped to 7.40, and sigma narrowed to 1.27, producing an MSE of 0.00005 and an R 2 of 0.874. Finally, at 37°C, A was 0.03147, mu was 6.88, sigm a was 1.02, with the best fit demonstrated by an MSE of 0.00000 and a R 2 of 0.970. The population growth for infected offspring across different temperatures and fecundity levels revealed that both factors significantly impact growth rates and time to reach population of 1000 MB + offspring. The optimum temperatures 27°C and 32°C consistently led to rapid population growth, with 1000 MB + offspring reached within 15–48 days across all fecundity levels. Specifically, at a fecundity of 33 offspring per female An. arabiensis ( Fig. 2 B ) , populations at 27°C and 32°C reach 1000 MB + offspring by approximately day 48 and day 35, respectively, while at 37°C, it was estimated to take around 62 days. In contrast, at 22°C, the population did not reach 1000 MB + offspring within the 100-day period. Increasing fecundity to 66 offspring per female An. arabiensis further accelerated growth, with populations at 27°C, 32°C, and 37°C reaching 1000 MB + offspring by approximately day 25, 20, and 35, respectively ( Fig. 2 C ). At 22°C, the average time to reach the target population was 100 days. At the highest fecundity level of 99 offspring per female An. arabiensis ( Fig. 2 D ) , the population growth was extremely rapid, with 27°C and 32°C reaching 1000 MB + offspring by day 17 and 15, respectively, and 37°C by day 25. At 22°C, the population reached 1000 MB + offspring by approximatively 65 days. To further clarify the effects of offspring numbers per female An. arabiensis , Monte Carlo simulations with 1000 iterations, accounting for 10% variability in offspring number (Supplementary information, Fig. 4) showed that temperature, rather than offspring number variability, played a key role in establishing the MB + population. Optimal temperatures were consistently 27°C and 32°C, regardless of fluctuations in the offspring count. Discussion Microsporidia MB spreads both vertically (from female to offspring) and sexually (horizontal transmission) [ 6 , 7 ]. Vertical transmission occurs as the symbiont enters developing eggs via stem cell division, remaining inside the host cell, while sexual transmission likely requires the symbiont to form spores and exit the host cell. Though vertical transmission is highly efficient, some offspring appear to lose the infection during juvenile stages [ 62 ]. This study explores how temperature affects the prevalence and spread of Microsporidia MB during the aquatic stages of An. arabiensis development. In this study, we investigated the impact of temperature on Microsporidia MB prevalence and dissemination potential during aquatic stages of Anopheles arabiensis development. Our results show that the optimal temperature for sustainning Microsporidia MB intensity and supporting the growth of MB + Anopheles arabiensis mosquito population growth is 32°C. This contrasts with the commonly accepted rearing temperature for Anopheles mosquitoes of 27°C. While both infected and uninfected mosquitoes showed better survival at 27°C, the MB + Anopheles arabiensis population grew best at 32°C due to a shorter larval development time and higher Microsporidia MB intensity in the offspring. Therefore, temperatures ranging from 27°C to 32°C, particularly closer to 32°C, seem most effective for rearing mosquitoes for symbiont-based malaria control tool. These findings suggest that mass rearing of MB + mosquitoes at these temperatures field releases could optimize their effectiveness as a vector control tool (though the malaria-blocking potential at different temperatures still needs evaluation). Our experiments used offspring of wild-caught Anopheles arabiensis mosquitoes which typically have lower fecundity (33–66 offspring per female) compared to lab-adapted colonies [ 27 ]. This underlines the importance of considering the effects of natural mosquito populations when evaluating vector control strategies. Our results also highlight the key role of temperature in determining both the prevalence of MB + in An. arabiensis populations and their potential for malaria transmission. The strong correlation between temperature and population growth, supported by high R² values (0.79396 to 0.97048), suggests that our logistic growth model effectively captured the dynamics of MB + mosquito population under varying environmental conditions. As poikilotherms, mosquitoes’ life history traits, such as longevity, fecundity, biting rate and development of immature stages of mosquitoes, are strongly influenced by temperature [ 28 ]. Our findings confirm previous studies showing that higher temperatures shorten larval development time and reduce pupation rates, regardless of Microsporidia MB infection [ 29 , 30 ]. Interestingly, larvae from MB + females develop more slowly than those from MB- females. However, when the offspring of MB + female An. arabiensis were separated between infected and non-infected larvae in the statistical model, we realized that MB + offspring were overall developing 1 day faster than MB- offspring coming from Microsporidia MB infected female An. arabiensis at 27°C. This result is similar to earlier reports performed in the laboratory and semi-field conditions where temperature was not controlled [ 7 , 31 , 32 ]. The occurrence of certain microsporidian genera, including Enterocytospora, Microsporidium and Vairimorpha , is positively correlated with rising environmental temperature [ 8 ]. Similarly, in our study, we observed that higher temperatures led to increased prevalence of Microsporidia MB , with infection intensity also rising at elevated temperatures. This suggests that the transmission rate of Microsporidia MB, dependant on infection intensity, is significantly influenced by temperature. A similar pattern as been observed in other systems, such as Drosophila , where higher temperatures promote proliferation of Wolbachia bacteria [ 30 , 34 ], leading to greater fitness costs associated with pathogenic variants like wMelOctoless and wMelPop in D. melanongaster [ 33 ]. Additionally, lower development temperatures result in reduced titres of wYak in Drosophila yakuba , which decreases the chances of vertical transmission. In our study, the lowest rearing temperature of 22°C resulted in a lower prevalence of Microsporidia MB infection compared to higher temperatures, indicating that symbiont loss after vertical transmission [ 62 ] is more likely at this cooler temperature. We also observed that lower temperatures, in addition to the slower development time, were associated with increased late-stage larval mortality. This could suggest that under these conditions, the symbiont might favour horizontal transmission over vertical transmission [ 35 – 37 ]. The importance of understanding the symbiotic relationship between Anopheles arabiensis and Microsporidia MB becomes evident as we explore the benefits or potential costs of infection. While we did not investigate the effect of temperature on the specific transmission strategy (vertical vs. horizontal) employed by Microsporidia MB , we hypothesize that cooler temperatures, which prolong larval development and slow larval death, could encourage spore formation in the symbiont [ 38 , 39 ]. Previous studies did not observed larvae-to-larvae transmission in our system, but we cannot exclude the possibility that physiological stressors or sub-optimal rearing conditions might promote horizontal transmission at the larval stage. Other microsporidian systems, such as Edhazardia aedis , have shown that resource limitations can shift transmission routes, with horizontal transmission becoming more prominent when larvae are reared under low-food conditions, a stress that extends development time [ 40 , 41 ]. We observed the highest infection intensity and prevalence of Microsporidia MB at 37°C, which suggests that higher temperatures may accelerate the growth rate of the symbiont in An. arabiensis . A faster growth rate could result in higher infection intensity, possibly preventing the host from clearing the infection, thus increasing Microsporidia MB prevalence. Although 37°C is ner the upper thermal limit for adult Anopheles gambiae development [ 42 – 44 ], it is possible that the larvae exhibit higher heat tolerance compared to adults. The observed lower pupation rate for offspring coming from MB + female An. arabiensis compared to those coming from MB- female An. arabiensis at 37°C could suggest that this temperature approaches the thermal limit for Microsporidia MB ; where the symbiont’s growth becomes detrimental to the host. The heat might kill some of the symbionts, making them toxic and leading to higher mortality rate in MB + mosquitoes [ 8 ]. The presence of the symbiont might also reduce the mosquito ability to tolerate heat stress, similar to how the obligate bacterial pathogen Pasteuria ramose affects Daphnia magna [ 45 ]. This scenario aligns with the thermal mismatch hypothesis, which predicts that cooler-adapted hosts are more susceptible to infections from warmer-adapted parasites when exposed to warmer temperature [ 46 ]. This hypothesis warrants future investigation into the thermal sensitivity of Microsporidia MB . It is also possible that high larval mortality associated with higher temperatures could favour the formation of spores and horizontal transmission. if spore-based infection results in some mortality, this could explain the increased in Microsporidia MB prevalence and higher mortality of Anopheles arabiensis larvae under hot rearing conditions. Similar heat stress effects have been observed in Wolbachia -infected Aedes aegypti , where increased rearing temperatures from 26° C to 37°C reversed the infection, preventing transmission to the next generation of mosquitoes [ 46 ]. Environmental conditions during larval development are known to affect adult mosquito life-history traits, including longevity, fecundity, and overall vector competence [ 22 , 47 ]. Since our study focuses on juvenile development it limits our ability to predict the potential population growth potential of mosquitoes reared in different temperatures. The survival rate of mosquitoes, particularly adults, is underestimated in our study, as we only collected data on juvenile stages. However, it is well established that higher temperatures can negatively affect the longevity and fecundity of adult mosquitoes [ 42 ], reducing body size and hatch rate [ 5 , 20 , 21 , 48 ]. The relationship between body size and longevity is complex and depends on factors like food availability and temperature during larval development [ 22 ]. These factors also interact with vector competence for malaria, with temperature- competence relationship varying based on larval food intake [ 5 , 49 ]. We hypothesize that a similar complex relationship exists between temperature, Microsporidia MB competence and mosquito survival, which warrants further investigation. Additionally, while we recognize that Microsporidia MB infection intensity can be influenced by nutrition [ 26 , 31 ], our study assumed that larval competition for food was similar across all temperature treatments. Since density-dependent competition and temperature interact to influence mosquito survival and offspring production [ 40 , 41 ], it is crucial to further explore how nutritional intake affects Microsporidia-MB -infected mosquitoes. This is particularly important given our findings that temperature influences Microsporidia MB spread depending on the number of offspring produced. For example, with 33 offspring per female An. arabiensis , 22°C prevents the growth of Microsporidia MB infected populations, while higher offspring counts (99 offspring per female An. arabiensis ) at 22°C and 37°C promote rapid establishment of Microsporidia MB . Future studies should account for these factors to refine predictions on the dissemination potential of Microsporidia-MB infected mosquitoes across different temperatures environments. Conclusion Although 27°C is widely considered the optimal temperature for rearing Anopheles mosquitoes, it is not the most favourable for the spread of the Microsporidia MB symbiont. Our study shows that 32°C supports higher symbiont intensity, faster larval development, and better population growth, even though 27°C results in higher mosquito survival. These findings reinforce previous predictions that warmer temperatures enhances the spread of MB + mosquito populations, despite the potential for increased mosquito mortality. By identifying regions with climates conducive to the spread of MB + mosquito populations, this research contributes to the development of an effective Microsporidia -based strategies for malaria control. Our study also emphasizes the need to consider environmental factors, such as temperature, when assessing microbial-based malaria control methods and understanding the natural prevalence and spread of symbionts like Microsporidia MB across different climatic regions. Material and methods 1) Experimental design 1.1) Mosquito collection 1583 larvae used in this study were obtained from 17 field caught gravid Anopheles arabiensis female collected via mouth aspiration from Kigoche village (00°34′S, 34°65′ E) in the Ahero irrigation scheme, Kenya and transported to the International Centre of Insect Physiology and Ecology (ICIPE)-Duduville campus in Nairobi, Kenya. During collection, a torch was used to locate Anopheles gambiae s.l. indoors on the walls of muddy houses, this was guided by identification protocol illustrated in [ 68 ], the morphological traits used were resting position, characteristics of wings and abdomen. Abdomens of the collected gravid females were morphologically examined and those observed as engorged, and dark were considered gravid. MB + females used in these experiments were selected over three different collection timepoints. September 2022, 1123, gravid field collected female An. arabiensis were screened for presence of Microsporidia MB , 180 were positive resulting in a 16.03% prevalence in the field (5 MB + females were used for this experiment, offspring n = 404). November 2022, 399 mosquitoes were screened, 142 were positive for Microsporidia MB , this recorded a prevalence of 35.58% of the symbiont in the field (5 MB + females, offspring n = 511). In July 2023, 565 mosquitoes were screened, 75 were positive for the symbiont resulting to 13.27% prevalence in the field (7 MB + females, offspring n = 624). The gravid females were placed in 1.5ml micro-centrifuge tubes containing 1cm by 1cm Whatman filter paper to allow egg laying following the methods described in [ 6 , 7 , 26 , 30 , 31 ]. After oviposition, they were screened for species ID [ 49 ] and the presence of Microsporidia MB [ 6 , 7 , 26 ] using PCR. 1.2) Larval rearing Eggs from Microsporidia MB positive and negative female An. arabiensis were separated into larval trays with around 300 ml of deionised water to hatch. In three replicates, stage one (L1) larvae from the same MB + female An. arabiensis were randomly and in equal number split into four temperature treatments: A total of 444, 515 and 624 L1 larvae were used to set up replicates one, two and three of the experiments. L1 larvae from each MB + female An. arabiensis were divided into four equal proportions and put in four different larval trays. L1 larvae from MB- female An. arabiensis was also put in a separate larval tray for each of the temperature regimes. We, therefore, had four larval trays per each MB + and MB- female An. arabiensis , each tray per temperature regime. One MB- female An. arabiensis was used per replicate. This was due to limited space in the incubators. We set temperature 22°C using insect growth chamber since it supported low temperature settings. Trays for temperature 27°C were put in an isolated room with control ambient room temperature of 27°C. We used small incubators to set experiments for temperatures 32°C and 37°C, this is because these incubators could only support temperature settings above 30°C. The number of larvae per tray in the for the MB + female An. arabiensis were dependent on the amount of offsprings produced by each female An. arabiensis (the data of larvae per tray in each temperature regime has been attached for reference). In MB- female An. arabiensis , 23, 25 and 18 L1 larvae were used per each tray in each temperature regime for replicates one, two and three respectively. The larvae were fed on a pinch of Tetramin baby fish food throughout their development until pupation. We monitored daily larval mortality, rate and date of pupation of each pupa. 1.3) Quantification of Microsporidia MB The ammonium acetate protein precipitation method was used for DNA extraction from offsprings of MB + female An. arabiensis [ 54 , 55 ]. Whole pupae were homogenised in 50 µl of phosphate buffered saline (PBS), incubated at 56°C for 1 hour in 300 µl of cell lysis buffer then we precipitated out proteins using 100 µl protein precipitate while incubating the samples in ice for 30 minutes. The supernatant was centrifuged for 20 minutes at 14000 revolutions per minute then transferred to 300 µl of isopropanol, the samples were inverted 100 times to allow the reagents mix before centrifuging at 14000 revolutions per minute for 1 hour to remove excess salt. To obtain a clean DNA, we poured out the resulting supernatant then added 300 µl of ice cold 70% ethanol, inverted the samples 50 times then centrifuged at maximum speed of 14000 revolutions per minute for 30 minutes to remove excess salts. The resultant DNA was air dried under the biosafety cabinet overnight before elution in 60 µl of nuclease free water [ 6 , 7 , 26 , 30 ]. All pupae collected from the experimental group (offspring of MB + female An. arabiensis ) were screened to identify those infected with Microsporidia MB using conventional PCR [ 6 , 7 , 26 ]. We measured the Microsporidia MB infection rate in the collected G 0 female An. arabiensis and offspring as well and quantified Microsporidia MB density through relative quantification using qPCR. Partial Microsporidia MB 18s gene region from each DNA sample was amplified using specific 18s primers (MB18SF: CGCCGG CCGTGAAAAATTTA and MB18SR: CCTTGGACGTG GGAGCTATC) [ 6 , 7 , 26 , 30 , 31 ]. The gene was then amplified in an 11µl reaction volume of a mixture containing 0.5µl of 5pmol/µl reverse and forward primers, 2µl HOTFirepol Blend Master Mix Ready-To-Load (Solis Biodyne, Estonia), 6µl of nuclease-free PCR water and 2µl of DNA template. The amplification was achieved under the following conditions: initial denaturation at 95°C for 15 min, denaturation at 95°C for 1 minute for 35 cycles, annealing at 62°C for 30 s, a further extension for 30 s at 72°C, and finally, final elongation for 5 min at 72°C. To quantify the level of infection, samples positive for Microsporidia MB were subjected to relative qPCR analysis using MB18SF/MB18SR primers normalised with the reference host-keeping gene for the Anopheles ribosomal s7 gene (S7F: TCCTGGAGCTGGAGATGAAC and S7R: GACGGGTCTGTACCTTCTGG). Since the ribosomal protein S7 is a highly conserved gene in Anopheles mosquitoes, its expression levels are stable across different conditions and tissues, making it a reliable internal control for qPCR experiments [ 63 ]. The qPCR reaction mixture consisted of 11µl reaction volume containing 0.5µl of 5pmol/µl reverse and forward primers, 2µl HOT FIREPol® EvaGreen® 416 HRM no ROX Mix Solis qPCR Master mix (Solis Biodyne, Estonia), 6µl of nuclease-free PCR water and 2µl of DNA template. The amplification was achieved under the following conditions: initial denaturation at 95°C for 15 min, denaturation at 95°C for 1 minute for 35 cycles, annealing at 62°C for 60 s, and a further extension for 45 s at 72°C. The PCR was carried out in a proflex cycler, and the qPCR was carried out in a MIC qPCR cycler (BioMolecular Systems, Australia). The MB18SF/MB18SR primers were used to confirm samples with the characteristic Microsporidia MB melt curve [ 6 , 7 , 26 , 30 , 31 ]. 1.4 ) Statistical analysis We analysed the pupation rate and age at death using Mixed-Effects Cox Models and the R “coxme” package [ 50 ]. The mean development time for the pupated larvae was analysed using the linear mixed-effects model using the “lme4” package. We analysed the infection rate and Microsporidia MB intensity using binomial and gaussian logistic mixed-effect model (GLMMs) and glmmTMB package. In all models, the temperature treatments, the G 0 female An. arabiensis ' infection status, and their interactions were included as fixed terms, and the time of capture in the field was included as a random effect. In addition, the development time model also looked at the interaction between temperature treatments and infection status in offspring ( Microsporidia MB negative offspring coming from un-infected colonized female An. arabiensis , Microsporidia MB positive offspring coming from field-collected infected G 0 female An. arabiensis and Microsporidia MB negative coming from field collected infected G 0 female An. arabiensis ). Individuals that pupated were excluded from the age-at-death analysis. Individuals who died were excluded from the development time and infection status analysis. The Microsporidia MB intensity analysis (log transformed for better data visualisation) excluded uninfected pupae, and we used temperature treatments and transmission groups (0–33%, 33–66%, or 66–99% transmission from mother to offspring) as interaction terms in the model. We used the Tukey post-hoc test and “means” function to perform multiple comparisons among the infection status and temperature treatments [ 51 ]. Statistical analysis was performed using R statistical software version 4.1.2 and R Studio [ 52 ]. 2) Modelling the Microsporidia MB dissemination potential After obtaining experimental data on infection rates, development, and survival, we used these parameters to develop a mathematical model predicting Microsporidia MB dissemination in Anopheles arabiensis populations under different temperature conditions. To express the probability that an L1 offspring coming from MB + female An. arabiensis is infected, survives to age x , and pupates at age x given temperature T \(\:,\:\) we combined the conditional probabilities: P (infected \(\:\cap\:\) survives to age x \(\:\cap\:\) pupates at x| T ) = P(infected| T) . P (survives to age x |infected, T). P (pupates at x | infected, T ). $$\:P\left(infected\right|\:T)=\frac{\text{N}\text{u}\text{m}\text{b}\text{e}\text{r}\:\text{o}\text{f}\:\text{i}\text{n}\text{f}\text{e}\text{c}\text{t}\text{e}\text{d}\:\text{l}\text{a}\text{r}\text{v}\text{a}\text{e}\:\text{a}\text{t}\:\text{t}\text{e}\text{m}\text{p}\text{e}\text{r}\text{a}\text{t}\text{u}\text{r}\text{e}\:T\:}{\text{T}\text{o}\text{t}\text{a}\text{l}\:\text{n}\text{u}\text{m}\text{b}\text{e}\text{r}\:\text{o}\text{f}\:\text{l}\text{a}\text{r}\text{v}\text{a}\text{e}\:\text{a}\text{t}\:\text{t}\text{e}\text{m}\text{p}\text{e}\text{r}\text{a}\text{t}\text{u}\text{r}\text{e}\:T}$$ $$\:P\left(survives\:to\:age\:x\:\right|infected,\:T)=\frac{\text{N}\text{u}\text{m}\text{b}\text{e}\text{r}\:\text{o}\text{f}\:\text{i}\text{n}\text{f}\text{e}\text{c}\text{t}\text{e}\text{d}\:\text{l}\text{a}\text{r}\text{v}\text{a}\text{e}\:\text{t}\text{h}\text{a}\text{t}\:\text{s}\text{u}\text{r}\text{v}\text{i}\text{v}\text{e}\:\text{t}\text{o}\:\text{a}\text{g}\text{e}\:\text{x}\:\text{a}\text{t}\:\text{t}\text{e}\text{m}\text{p}\text{e}\text{r}\text{a}\text{t}\text{u}\text{r}\text{e}\:T\:}{\text{T}\text{o}\text{t}\text{a}\text{l}\:\text{n}\text{u}\text{m}\text{b}\text{e}\text{r}\:\text{o}\text{f}\:\text{l}\text{a}\text{r}\text{v}\text{a}\text{e}\:\text{a}\text{t}\:\text{t}\text{e}\text{m}\text{p}\text{e}\text{r}\text{a}\text{t}\text{u}\text{r}\text{e}\:T}$$ $$\:P\left(pupates\:at\:x\right|\:infected,\:T)=\frac{\text{N}\text{u}\text{m}\text{b}\text{e}\text{r}\:\text{o}\text{f}\:\text{i}\text{n}\text{f}\text{e}\text{c}\text{t}\text{e}\text{d}\:\text{l}\text{a}\text{r}\text{v}\text{a}\text{e}\:\text{t}\text{h}\text{a}\text{t}\:\text{p}\text{u}\text{p}\text{a}\text{t}\text{e}\:\text{t}\text{o}\:\text{a}\text{g}\text{e}\:\text{x}\:\text{a}\text{t}\:\text{t}\text{e}\text{m}\text{p}\text{e}\text{r}\text{a}\text{t}\text{u}\text{r}\text{e}\:T\:}{\text{T}\text{o}\text{t}\text{a}\text{l}\:\text{n}\text{u}\text{m}\text{b}\text{e}\text{r}\:\text{o}\text{f}\:\text{l}\text{a}\text{r}\text{v}\text{a}\text{e}\:\text{t}\text{h}\text{a}\text{t}\:\text{s}\text{u}\text{r}\text{v}\text{i}\text{v}\text{e}\:\text{t}\text{o}\:\text{a}\text{g}\text{e}\:\text{x}\:\text{a}\text{t}\:\text{t}\text{e}\text{m}\text{p}\text{e}\text{r}\text{a}\text{t}\text{u}\text{r}\text{e}\:T}$$ Using the Gaussian function, the probability is given by: $$\:\mathbb{P}\left(\text{T},\text{x}\right)=P(infected\:\:\cap\:\:survives\:to\:age\:x\:\cap\:\:pupates\:at\:\:x|\:T)={Ae}^{-\frac{{\left(x-\mu\:\right)}^{2}}{2{\sigma\:}^{2}}},\:\:$$ $$\:0<x<\infty\:$$ . This formula considers the conditional dependencies based on infection status and temperature, providing a logical path to estimate the combined probability. A continuous logistic model was chosen to provide a smooth and accurate representation of mosquito population growth, reflecting natural, gradual changes without the constraints of fixed time intervals required by discrete models. This continuous approach allows precise population estimates at any point in time, making it ideal for understanding temporal growth rates and incorporating stochastic variability to reflect environmental influences on fecundity.. The logistic growth equation: \(\:\) \(\:\frac{d\text{N}\left(\text{t}\right)}{d\text{t}}=\text{F}.\text{r}.\mathbb{P}\left(\text{T},\text{x}\right).\text{N}\left(\text{t}\right)\left(1-\frac{\text{N}\left(\text{t}\right)}{K}\right)\) was used to model the population growth of infected individuals, where N(t) is the number of MB + individuals at time t, F represents the fecundity, r the sex ratio, \(\:\mathbb{P}\left(T,x\right)\) the probability of infection, survival, and pupation under temperature T , and K the carrying capacity (66,67). The carrying capacity was set to 1000 to simulate real-world limitations such as resource and space constraints, establishing a stable population maximum that aligns with natural conditions. Additionally, targeting a population of 1000 MB + offspring provides a measurable endpoint for assessing the spread of Microsporidia MB within mosquito populations. The solution to this equation, $$\:\text{N}\left(\text{t}\right)=\frac{K}{1+\left(\frac{K-{\text{N}}_{0}}{{\text{N}}_{0}}\right){\text{e}}^{-\text{F}.\text{r}.\mathbb{P}\left(\text{T},\text{x}\right).t}}$$ enabled us to estimate the rate at which the population of MB + offspring increases from an initial population of 10 MB + female An. arabiensis , with the goal of reaching a target population of 1000 MB + individuals. In our deterministic simulation, parameters such as: F (fecundity ), r (sex ratio), K (carrying capacity), and \(\:{N}_{0}\) (initial population) remained constant. Fecundity was set at three fixed rates (33, 66, or 99 viable eggs per female An. arabiensis ) based on observed averages, providing a baseline for population growth under stable conditions. The sex ratio male: female was considered to be 1:1. Details of the stochastic simulation are provided in the supplementary material. To implement this methodology, we used Python for all data processing, simulations, and statistical computations. Python’s libraries, including numpy for numerical operations, scipy for probability computations and fitting, and matplotlib for visualization, were integral to generating plots, calculating probabilities, and fitting model parameters. Declarations Availability of data and materials All datasets generated, used and analysed in this study are included in this published article. Competing interests The authors declare no competing interests. Acknowledgements We acknowledge the Insectary team led by Milca Gitau, Jeniffer Thiong’o and Peris Wambui for provision of larvae rearing materials and assistance in the rearing process. The field team (Robison Kisero and Gerald Ronoh) for assistance during field collection of gravid female mosquitoes. The project administrator Faith Kyengo for facilitating all the project activities. Funding This study was supported by Open Philanthropy (SYMBIOVECTOR), the Bill and Melinda Gates Foundation (INV0225840), Children’s Investment Fund Foundation (SMBV-FFT). International Centre of Insect Physiology and Ecology (ICIPE) also receives funding and support from The Swedish International Development Cooperation Agency (Sida); the Swiss Agency for Development and Cooperation (SDC); the Australian Centre for International Agricultural Research (ACIAR); the Norwegian Agency for Development Cooperation (Norad); the German Federal Ministry for Economic Cooperation and Development (BMZ); and the Government of the Republic of Kenya. The views expressed herein do not necessarily reflect the official opinion of the donors. Author Contributions FGO: Conceptualization, Data curation, Methodology and Investigation, Validation and Visualisation of results, Writing of the original draft, review and editing ∣ PB: Conceptualization, Supervision, Formal analysis, Validation and Visualization of results, Writing of the original draft, review and editing ∣ ASB: Formal analysis, Validation and Visualization of results, Writing of the original draft, review and editing ∣ EEM: Data curation, Methodology, Investigation ∣ TOO: Methodology, Investigation, Supervision, review and editing∣ AWW: Investigation, Data curation, Methodology ∣ SMO: Investigation, Data curation, Methodology ∣ CNK: Investigation, Data collection, Methodology ∣ SBM: Formal analysis, Validation and Visualization of results, Writing of the original draft, review and editing∣ ANK: Conceptualization, Supervision ∣ JKH: Conceptualization, Methodology and Investigation, Supervision, Funding acquisition, Resources, Writing of the original draft, review and editing. References Filho, W. L., May, J., May, M. & Nagy, G. J. Climate change and malaria: some recent trends of malaria incidence rates and average annual temperature in selected sub-Saharan African countries from 2000 to 2018. Malar. J. 22 (1). https://doi.org/10.1186/s12936-023-04682-4 (2023). World Health Organization. World malaria report 2022 . (2022)., December 8 . https://www.who.int/publications/i/item/9789240064898 Ma, C. S., Zhang, W., Peng, Y., Zhao, F. & al Climate warming promotes pesticide resistance through expanding overwintering range of a global pest. Nat. Commun. 12 (1). https://doi.org/10.1038/s41467-021-25505-7 (2021). World Health Organization. WHO malaria policy advisory group (MPAG) meeting report, 18–20 April 2023 (World Health Organization, 2023). Barreaux, A. M. G., Barreaux, P., Thievent, K. & Koella, J. C. Larval environment influences vector competence of the malaria mosquito. PubMed 7 , 8–8. https://doi.org/10.5281/zenodo.10798340 (2016). Nattoh, G., Maina, T., Makhulu, E. E. & Mbaisi, L. and al. Horizontal transmission of the symbiont Microsporidia MB in Anopheles arabiensis . Frontiers in microbiology, 12 . (2021). https://doi.org/10.3389/fmicb.2021.647183 Herren, J. K., Mbaisi, L., Mararo, E. & al A microsporidian impairs Plasmodium falciparum transmission in Anopheles arabiensis mosquitoes. Nat. Commun. 11 (1). https://doi.org/10.1038/s41467-020-16121-y (2020). Artur Trzebny, O. & Miroslawa Dabert. High temperatures and low humidity promote the occurrence of microsporidians ( Microsporidia ) in mosquitoes ( Culicidae ). Parasites Vectors . 17 (1). https://doi.org/10.1186/s13071-024-06254-0 (2024). Charlène, N. T., Mfangnia, Henri, B., Herren, J. & Tsanou, & Mathematical modelling of the interactive dynamics of wild and Microsporidia MB -infected mosquitoes. Math. Biosci. Eng. 20 (8), 15167–15200. https://doi.org/10.3934/mbe.2023679 (2023). Ye, Y. H., Sgrò, C. M., Dong, Y., McGraw, E. A. & Carrasco, A. M. The Effect of Temperature on Wolbachia -Mediated Dengue Virus Blocking in Aedes aegypti . Am. J. Trop. Med. Hyg. 94 (4), 812–819. https://doi.org/10.4269/ajtmh.15-0801 (2016). Gavotte, L., Mercer, D. R., Stoeckle, J. J. & Dobson, S. L. Costs and benefits of Wolbachia infection in immature Aedes albopictus depend upon sex and competition level. J. Invertebr. Pathol. 105 (3), 341–346. https://doi.org/10.1016/j.jip.2010.08.005 (2010). Willis, A. R. & Reinke, A. W. Factors that determine Microsporidia infection and host specificity. Experientia Suppl. 91–114. https://doi.org/10.1007/978-3-030-93306-7_4 (2022). Chakrabarti, S. B. Influence of temperature and relative humidity in infection of Nosema bombycis ( Microsporidia: Nosematidae ) and cross-infection of N. mylitta on growth and development of Mulberry silkworm, Bombyx mori . Int. J. Industrial Entomol. Biomaterials . 17 (2), 173–180 (2016). https://koreascience.kr/article/JAKO200811237154541.page Cali, A. & Takvorian, P. M. Developmental morphology and life cycles of the Microsporidia . 71–133. (2014). https://doi.org/10.1002/9781118395264.ch2 Chandrasegaran, K., Lahondère, C., Escobar, L. E. & Vinauger, C. Linking mosquito ecology, traits, behavior, and disease transmission. Trends Parasitol. 36 (4), 393–403. https://doi.org/10.1016/j.pt.2020.02.001 (2020). Reinhold, J., Lazzari, C. & Lahondère, C. Effects of the environmental temperature on Aedes aegypti and Aedes albopictus mosquitoes: A review. Insects 9 (4), 158. https://doi.org/10.3390/insects9040158 (2018). Paaijmans, K. P. & Thomas, M. B. The influence of mosquito resting behaviour and associated microclimate for malaria risk. Malar. J. 10 (1). https://doi.org/10.1186/1475-2875-10-183 (2011). Martin, L. E. & Hillyer, J. F. Higher temperature accelerates the aging-dependent weakening of the melanization immune response in mosquitoes. PLoS Pathog. 20 (1). https://doi.org/10.1371/journal.ppat.1011935 (2024). Mancini, M. C., Ant, T. H. & Herd, C. S. and al. High temperature cycles result in maternal transmission and dengue infection differences between Wolbachia strains in Aedes aegypti . (2020). https://doi.org/10.1101/2020.11.25.397604 Moller-Jacobs, L. L., Murdock, C. C. & Thomas, M. B. Capacity of mosquitoes to transmit malaria depends on larval environment. Parasites Vectors . 7 (1). https://doi.org/10.1186/s13071-014-0593-4 (2014a). Moller-Jacobs, L. L., Murdock, C. C. & Thomas, M. B. Capacity of mosquitoes to transmit malaria depends on larval environment. Parasites Vectors . 7 (1). https://doi.org/10.1186/s13071-014-0593-4 (2014b). Barreaux, A. M. G., Stone, C. M. & Barreaux, P. and al. The relationship between size and longevity of the malaria vector Anopheles gambiae (s.s.) depends on the larval environment. Parasites & Vectors, 11 (1). (2018). https://doi.org/10.1186/s13071-018-3058-3 Paaijmans, K. P., Blanford, S., Chan, B. H. K. & al Warmer temperatures reduce the vectorial capacity of malaria mosquitoes. Biol. Lett. 8 (3), 465–468. https://doi.org/10.1098/rsbl.2011.1075 (2011). Gimonneau, G., Bouyer, J., Morand, S., Besansky, N. J. & al A behavioral mechanism underlying ecological divergence in the malaria mosquito Anopheles gambiae . Behav. Ecol. 21 (5), 1087–1092. https://doi.org/10.1093/beheco/arq114 (2010). Kikuchi, Y., Tada, A., Musolin, D. L. & al Collapse of insect gut symbiosis under simulated climate change. mBio 7 (5). https://doi.org/10.1128/mbio.01578-16 (2016). Makhulu, E. E., Onchuru, T. O., Gichuhi, J. & Otieno and al. Localization and tissue tropism of the symbiont Microsporidia MB in the germ line and somatic tissues of Anopheles arabiensis . mBio. (2023). https://doi.org/10.1128/mbio.02192-23 Huang, J., Walker, E. D., Otienoburu, P. & al Laboratory tests of oviposition by the african malaria mosquito, Anopheles gambiae , on dark soil as influenced by presence or absence of vegetation. Malar. J. (1). https://doi.org/10.1186/1475-2875-5-88 (2006). 5. Ciota, A. T., Matacchiero, A. C., Kilpatrick, A. M. & al The Effect of temperature on life history traits of Culex mosquitoes. J. Med. Entomol. 51 (1), 55–62. https://doi.org/10.1603/me13003 (2014). Christiansen-Jucht, C. D., Parham, P. E., Saddler, A. & al Larval and adult environmental temperatures influence the adult reproductive traits of Anopheles gambiae s.s. Parasites Vectors . 8 (1). https://doi.org/10.1186/s13071-015-1053-5 (2015). Boanyah, G. Y., Koekemoer, L. L., Herren, J. K. & al Effect of Microsporidia MB infection on the development and fitness of Anopheles arabiensis under different diet regimes. Parasites Vectors . 17 (1). https://doi.org/10.1186/s13071-024-06365-8 (2024). Nattoh, G. O., Makhulu, E. E. O., Mbaisi, L. A. & al Microsporidia MB in the primary malaria vector Anopheles gambiae sensu stricto is avirulent and undergoes maternal and horizontal transmission. Parasites Vectors . 16 (1). https://doi.org/10.1186/s13071-023-05933-8 (2023). Strunov, A. A., Ilinskii, Y. Y., Zakharov, I. K. & al Effect of high temperature on survival of Drosophila melanogaster infected with pathogenic strain of Wolbachia bacteria. Russian J. genetics: Appl. Res. 3 (6), 435–443. https://doi.org/10.1134/s2079059713060099 (2013). Reynolds, K. T., Thomson, L. J. & Hoffmann, A. A. The effects of host age, host nuclear background and temperature on phenotypic effects of the virulent Wolbachia strain popcorn in Drosophila melanogaster . Genetics 164 (3), 1027–1034. https://doi.org/10.1093/genetics/164.3.1027 (2003). Dionysopoulou, N. K., Papanastasiou, S. A., Kyritsis, G. A. & al Effect of host fruit, temperature and Wolbachia infection on survival and development of ceratitis capitata immature stages. PLOS ONE . 15 (3). https://doi.org/10.1371/journal.pone.0229727 (2020). Ulrich, J. N., Beier, J. C., Devine, G. J. & al Heat Sensitivity of wMel Wolbachia during Aedes aegypti Development. PLoS Negl. Trop. Dis. 10 (7). https://doi.org/10.1371/journal.pntd.0004873 (2016). Wiwatanaratanabutr, I. & Kittayapong, P. Effects of crowding and temperature on Wolbachia infection density among life cycle stages of Aedes albopictus . J. Invertebr. Pathol. 102 (3), 220–224. https://doi.org/10.1016/j.jip.2009.08.009 (2009). Chrostek, E., Martins, N., Marialva, M. S. & Teixeira, L. Wolbachia -conferred antiviral protection is determined by developmental temperature. mBio 12 (5). https://doi.org/10.1128/mbio.02923-20 (2021). Lau, M. J., Ross, P. A., Endersby-Harshman & al Impacts of low temperatures on Wolbachia (Rickettsiales: Rickettsiaceae )-Infected Aedes aegypti (Diptera: Culicidae ). J. Med. Entomol. 57 (5), 1567–1574. https://doi.org/10.1093/jme/tjaa074 (2020). Zilio, G., Kaltz, O. & Koella, J. C. Resource availability for the mosquito Aedes aegypti affects the transmission mode evolution of a microsporidian parasite. Evol. Ecol. https://doi.org/10.1007/s10682-022-10184-7 (2022). Zilio, G., Thiévent, K. & Koella, J. C. Host genotype and environment affect the trade-off between horizontal and vertical transmission of the parasite Edhazardia aedis. BMC Evol. Biol. 18 (1). https://doi.org/10.1186/s12862-018-1184-3 (2018). Agyekum, T. P., Botwe, P. K., Arko-Mensah & al A Systematic review of the effects of temperature on Anopheles mosquito development and survival: Implications for malaria control in a future warmer climate. Int. J. Environ. Res. Public Health . 18 (14), 7255. https://doi.org/10.3390/ijerph18147255 (2021). Carrington, L. B., Armijos, M. V., Lambrechts, L. & al Effects of fluctuating daily temperatures at critical thermal extremes on Aedes aegypti life-history traits. PLoS ONE . 8 (3). https://doi.org/10.1371/journal.pone.0058824 (2013). Lyons, C. L., Coetzee, M., Terblanche, J. S. & Chown, S. L. Thermal limits of wild and laboratory strains of two African malaria vector species, Anopheles arabiensis and Anopheles funestus . Malar. J. 11 (1). https://doi.org/10.1186/1475-2875-11-226 (2012). Hector, T. E., Sgrò, C. M. & Hall, M. D. Pathogen exposure disrupts an organism’s ability to cope with thermal stress. Glob. Change Biol. 25 (11), 3893–3905. https://doi.org/10.1111/gcb.14713 (2019). Hector, T. E., Hoang, K. L., Li, J. & al Symbiosis and host responses to heating. Trends Ecol. Evol. 37 (7), 611–624. https://doi.org/10.1016/j.tree.2022.03.011 (2022). Ross, P. A., Wiwatanaratanabutr, I., Axford, J. K. & al Wolbachia infections in Aedes aegypti differ markedly in their response to cyclical heat stress. PLoS Pathog. (1). https://doi.org/10.1371/journal.ppat.1006006 (2017). 13. Tuno, N., Farjana, T., Uchida, Y. & al Effects of temperature and nutrition during the larval period on life history traits in an invasive malaria vector Anopheles stephensi . Insects 14 (6), 543. https://doi.org/10.3390/insects14060543 (2023). Araújo, M., da-Silva, Gil, L. H. S., e-Silva, A. & de-Almeida Larval food quantity affects development time, survival and adult biological traits that influence the vectorial capacity of Anopheles darlingi under laboratory conditions. Malar. J. 11 (1). https://doi.org/10.1186/1475-2875-11-261 (2012). Santolamazza, F., Mancini, E., Simard, F. & al Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar. J. 7 (1). https://doi.org/10.1186/1475-2875-7-163 (2008). Jan, Erhardt, E. B., Dodd, A. B., Nathaniel & al A cautionary tale on the effects of different covariance structures in linear mixed effects modelling of fMRI data. Hum. Brain. Mapp. 45 (7). https://doi.org/10.1002/hbm.26699 (2024). Taketomi, N., Michimae, H. & Chang, Y. T. at al. meta.shrinkage: An R package for meta-analyses for simultaneously estimating individual means. Algorithms, 15 (1), 26. (2022). https://doi.org/10.3390/a15010026 Thulin, M. Modern statistics with R (CRC, 2024). Glunt, K. D., Oliver, S. V., Hunt, R. H. & Paaijmans, K. P. The impact of temperature on insecticide toxicity against the malaria vectors Anopheles arabiensis and Anopheles funestus . Malar. J. 17 (1). https://doi.org/10.1186/s12936-018-2250-4 (2018). Makhulu, E. E. et al. Tsetse blood-meal sources, endosymbionts and trypanosome -associations in the Maasai Mara National Reserve, a wildlife-human-livestock interface. PLoS Negl. Trop. Dis. 15 (1), e0008267. https://doi.org/10.1371/journal.pntd.0008267 (2021). Adams, E. R., Hamilton, P. B., Malele, I. I. & Gibson, W. C. The identification, diversity and prevalence of trypanosomes in field caught tsetse in Tanzania using ITS-1 primers and fluorescent fragment length barcoding. Infection, Genetics and Evolution , 8 (4), 439–444. (2008). https://doi.org/10.1016/j.meegid.2007.07.013 Oliver, S. V. & Brooke, B. D. The effect of elevated temperatures on the life history and insecticide resistance phenotype of the major malaria vector Anopheles arabiensis (Diptera: Culicidae ). Malar. J. 16 (1). https://doi.org/10.1186/s12936-017-1720-4 (2017). Thomas, M. B. & Read, A. F. The threat (or not) of insecticide resistance for malaria control. Proceedings of the National Academy of Sciences , 113 (32), 8900–8902. (2016). https://doi.org/10.1073/pnas.1609889113 Koella, J. C., Saddler, A. & Karacs, T. P. S. Blocking the evolution of insecticide-resistant malaria vectors with a microsporidian . Evol. Appl. 5 (3), 283–292. https://doi.org/10.1111/j.1752-4571.2011.00219.x (2011). Mack, L. K. & Attardo, G. M. Heat shock proteins, thermotolerance, and insecticide resistance in mosquitoes. Front. Insect Sci. https://doi.org/10.3389/finsc.2024.1309941 (2024). 4 . Mamai, W. et al. Optimization of Mass-Rearing Methods for Anopheles arabiensis Larval Stages: Effects of Rearing Water Temperature and Larval Density on Mosquito Life-History Traits. J. Econ. Entomol. 111 (5), 2383–2390. https://doi.org/10.1093/jee/toy213 (2018). Lyons, C. L., Coetzee, M. & Chown, S. L. Stable and fluctuating temperature effects on the development rate and survival of two malaria vectors, Anopheles arabiensis and Anopheles funestus . Parasites Vectors . 6 (1). https://doi.org/10.1186/1756-3305-6-104 (2013). Onchuru, T. O. et al. The Plasmodium transmission-blocking symbiont, Microsporidia MB , is vertically transmitted through Anopheles arabiensis germline stem cells. PLoS Pathog. 20 (11), e1012340. https://doi.org/10.1371/journal.ppat.1012340 (2024). Liew, J. W. K., Fong, M. Y. & Lau, Y. L. Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes. PeerJ 5 , e3577. https://doi.org/10.7717/peerj.3577 (2017). Akorli, J. et al. Microsporidia MB is found predominantly associated with Anopheles gambiae s.s and Anopheles coluzzii in Ghana. Scientific Reports , 11 (1). (2021). https://doi.org/10.1038/s41598-021-98268-2 Ang’ang’o, L. M. et al. Draft genome of Microsporidia sp. MB—a malaria-blocking microsporidian symbiont of the Anopheles arabiensis . Microbiol. Resource Announcements . 13 (4). https://doi.org/10.1128/mra.00903-23 (2024). White, M. T. et al. Modelling the impact of vector control interventions on Anopheles gambiae population dynamics. Parasites Vectors . 4 (1). https://doi.org/10.1186/1756-3305-4-153 (2011). Abiodun, G. J., Maharaj, R., Witbooi, P. & Okosun, K. O. Modelling the influence of temperature and rainfall on the population dynamics of Anopheles arabiensis . Malar. J. 15 (1). https://doi.org/10.1186/s12936-016-1411-6 (2016). Gillies, M. T. & Coetzee, M. A Supplement to the Anophelinae of Africa South of the Sahara. Publ S Afr. Inst. Med. Res. 55 , 105–106 (1987). Additional Declarations No competing interests reported. Supplementary Files ScientificreportSupplementaryfigures04042025.docx Cite Share Download PDF Status: Published Journal Publication published 07 Aug, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 11 May, 2025 Reviews received at journal 09 May, 2025 Reviews received at journal 29 Apr, 2025 Reviews received at journal 29 Apr, 2025 Reviews received at journal 26 Apr, 2025 Reviews received at journal 21 Apr, 2025 Reviewers agreed at journal 21 Apr, 2025 Reviewers agreed at journal 21 Apr, 2025 Reviewers agreed at journal 19 Apr, 2025 Reviewers agreed at journal 19 Apr, 2025 Reviewers agreed at journal 19 Apr, 2025 Reviewers invited by journal 18 Apr, 2025 Submission checks completed at journal 18 Apr, 2025 First submitted to journal 07 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5654412","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":445724486,"identity":"bf365d8c-2029-40ff-be15-c44064f26840","order_by":0,"name":"Fidel Gabriel Otieno","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Fidel","middleName":"Gabriel","lastName":"Otieno","suffix":""},{"id":445724487,"identity":"56beef18-e755-4340-9753-0763579bc8f1","order_by":1,"name":"Priscille Barreaux","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYDACCRiDvbGBIYE0LTwHSdYiQZx6BgZz6eZnnysq7BI33Hzc+OHhDhsGfunjF/BqsZxzzHjmmTPJiTNnJzZLJJ5JY5DsyynAq8XgRoIxY2Mbc2K/dGIbQ2LbYQaDMzz4nWhwI/0zY+O/+sQ2yYMgLf+J0ZIDtKXhcGK/BCNIywGgFvYDBPxyppix4dhx45k9YL8k80j28ODVAQyx9s2MDTXVshuOH3/48ecOOzl+HvYH+B2GwmNsYABawWOAQzEOLUBAwJZRMApGwSgYcQAARBhJKJJzDhgAAAAASUVORK5CYII=","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":true,"prefix":"","firstName":"Priscille","middleName":"","lastName":"Barreaux","suffix":""},{"id":445724488,"identity":"1d6e386c-d54f-42ee-a47b-9f2f4c64c935","order_by":2,"name":"Affognon Steeven Belvinos","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Affognon","middleName":"Steeven","lastName":"Belvinos","suffix":""},{"id":445724490,"identity":"babb1365-84dc-42c7-b327-5086ad40c334","order_by":3,"name":"Edward Edmond Makhulu","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Edward","middleName":"Edmond","lastName":"Makhulu","suffix":""},{"id":445724493,"identity":"70b96644-f4de-4bc5-9dbf-4e814d1dbeb2","order_by":4,"name":"Thomas Ogao Onchuru","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Thomas","middleName":"Ogao","lastName":"Onchuru","suffix":""},{"id":445724495,"identity":"ec0e2811-a6dc-411e-ab5c-5fca2bb5e7ad","order_by":5,"name":"Anne Wambui Wairimu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Anne","middleName":"Wambui","lastName":"Wairimu","suffix":""},{"id":445724497,"identity":"59d8f81b-99d3-4c25-b6df-8de9b53db0f7","order_by":6,"name":"Stancy Mandere Omboye","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Stancy","middleName":"Mandere","lastName":"Omboye","suffix":""},{"id":445724498,"identity":"3b8e2e02-44d3-41f9-af54-1f32daff86e4","order_by":7,"name":"Cynthia Nyambura King’ori","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Cynthia","middleName":"Nyambura","lastName":"King’ori","suffix":""},{"id":445724499,"identity":"827a73c9-5911-4d37-8276-cf1925baddbf","order_by":8,"name":"Sokame Bonoukpoè Mawuko","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Sokame","middleName":"Bonoukpoè","lastName":"Mawuko","suffix":""},{"id":445724500,"identity":"f69ec8fd-07ee-4421-8444-833015c14fbb","order_by":9,"name":"Anthony Kebira Nyamache","email":"","orcid":"","institution":"Kenyatta University","correspondingAuthor":false,"prefix":"","firstName":"Anthony","middleName":"Kebira","lastName":"Nyamache","suffix":""},{"id":445724501,"identity":"843bc2e1-16c8-476d-854f-7be1aabf0132","order_by":10,"name":"Jeremy Keith Herren","email":"","orcid":"","institution":"International Centre of Insect Physiology and Ecology","correspondingAuthor":false,"prefix":"","firstName":"Jeremy","middleName":"Keith","lastName":"Herren","suffix":""}],"badges":[],"createdAt":"2024-12-16 13:53:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5654412/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5654412/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-07414-7","type":"published","date":"2025-08-07T15:57:18+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81236505,"identity":"29bf9679-f709-4ebf-9d58-84c46fc26238","added_by":"auto","created_at":"2025-04-23 19:59:18","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":16331,"visible":true,"origin":"","legend":"\u003cp\u003ePanel representing the average \u003cstrong\u003e(A)\u003c/strong\u003e Pupation rate: The pupation rates of the offspring from MB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e differed significantly by temperature, with all other temperatures significantly different from 27°C.\u0026nbsp; The highest pupation rate was observed at 27°C, 74.4 (70.14-79.56) %; then 22°C, 68.4 (63.37-73.37) %; then 32°C, 55.8 (49.84-60.95) % and low at 37°C, 14.6 (10.77-18.40) % (Tukey for MB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e: p\u003csub\u003e22°C-27°C \u003c/sub\u003e= 0.001; p\u003csub\u003e27°C-32°C \u003c/sub\u003e= 0.137, p\u003csub\u003e27°C-37°C\u003c/sub\u003e \u0026lt; 0.001; p\u003csub\u003e32°C-37°C\u003c/sub\u003e \u0026lt; 0.001; p\u003csub\u003e22°C-32°C\u003c/sub\u003e \u0026gt; 0.05; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e= 29.39 df = 3, p \u0026lt; 0.001). \u003cstrong\u003e(B) \u003c/strong\u003eAge at death: MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e’ offspring died two days earlier on average than the offspring from the MB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e regardless of the temperature [MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 4.2 (3.62-4.86) days; MB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 6.4 (6.07-6.66) days] (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e= 18.66, df = 1, p \u0026lt; 0.001), except at 27°C where we found no significant differences between the female \u003cem\u003eAn. arabiensis\u003c/em\u003e’ groups (Tukey 27°C: p\u003csub\u003eMB+=/MB- \u003c/sub\u003e\u0026gt; 0.05); \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e= 9.98, df = 3, p = 0.02). \u003cstrong\u003e(C) \u003c/strong\u003e\u0026nbsp;Time to pupation: In offspring coming from MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e, the time to pupation did not vary between 22°C and 27°C (Tukey: p\u003csub\u003e22°C-27°C \u003c/sub\u003e\u0026gt; 0.05), but we observed a two days difference in offspring coming from MB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e reared in these temperatures [22°C: 12.0 (11.70-12.31) days; 27°C: 10.2 (9.93-10.48) days; 32°C: 7.4 (6.89-7.42) days; 37°C: 7.6 (7.25-8.04) days,\u003cstrong\u003e \u003c/strong\u003e(Tukey: p\u003csub\u003e22°C-27°C\u003c/sub\u003e \u0026lt; 0.001; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e= 21.89, df = 3, p \u0026lt; 0.001).\u0026nbsp; \u003cstrong\u003e(D)\u003c/strong\u003e Infection rate: The highest infection rate was recorded at 37°C (52.1%) followed by 27°C (48.7%), 32°C (46.7%) and 22°C (30.8%), there was no significant difference in pupation across all temperature regimes\u0026nbsp; (Tukey: estimate\u003csub\u003e27°C-22°C\u003c/sub\u003e = 0.68, p\u003csub\u003e27°C-22°C \u003c/sub\u003e= 0.001; p\u003csub\u003e27°C-32°C \u003c/sub\u003eand p\u003csub\u003e27°C-37°C\u003c/sub\u003e \u0026gt; 0.05; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e= 9.99, df = 1, p = 0.001)\u003cstrong\u003e (E)\u003c/strong\u003e M\u003cem\u003eicrosporidia MB \u003c/em\u003eintensity: The lowest \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity in the offspring was observed at 27°C which was significantly different from the intensity in those maintained at 37°C [22°C: 2.2 (0.34-4.01) ratio\u003csub\u003eMB18S/S7\u003c/sub\u003e; 27°C: 1.0 (0.55-1.43) ratio\u003csub\u003eMB18S/S7\u003c/sub\u003e; 32°C: 2.2 (1.27-3.11) ratio\u003csub\u003eMB18S/S7\u003c/sub\u003e; 37°C: 2.55 (1.28-3.75) ratio\u003csub\u003eMB18S/S7\u003c/sub\u003e; (Tukey: p\u003csub\u003e22°C-37°C \u003c/sub\u003e\u0026lt; 0.001; p\u003csub\u003e27°C-37°C \u003c/sub\u003e= 0.001; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e= 19.40, df =3, p \u0026lt; 0.001)]. ( data log transformed for better data visualization) in offspring coming from non-infected (MB-, lighter colours) and infected female \u003cem\u003eAn. arabiensis\u003c/em\u003e (MB+, darker colours) reared in 4 temperature treatments: 22°C (blue bars), 27°C (tan bars), 32°C (green bars) or 37°C (emerald bars). Average pupation rates are calculated out of the total count of offspring, average larval death ages are calculated for larvae that died, average times to pupation were calculated for all individuals that pupated, offspring infection rates were calculated for all individuals coming from infected female \u003cem\u003eAn. arabiensis\u003c/em\u003e, and average \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensities were calculated for all MB infected offspring. The error bars show \u0026nbsp;95% confidence intervals.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5654412/v1/540b630298f68884f86da68d.jpg"},{"id":81236251,"identity":"bb9a97f9-3478-4aed-aa3a-5744fd7ebd1e","added_by":"auto","created_at":"2025-04-23 19:51:18","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":38291,"visible":true,"origin":"","legend":"\u003cp\u003ePanel representing the effects of 4 different temperature treatments: 22°C (blue colour), 27°C (tan colour), 32°C (green colour) or 37°C (emerald colour) on \u003cstrong\u003e(A)\u003c/strong\u003eThe probabilities P(Tx) modelled using a gaussian function that an offspring is infected, survives to age \u003cem\u003ex \u003c/em\u003e, and pupates at age x and \u003cstrong\u003e(B)\u003c/strong\u003e, \u003cstrong\u003e(C)\u003c/strong\u003e, \u003cstrong\u003e(D)\u003c/strong\u003e represent the population growth of MB+ offspring starting with an initial population of 10 MB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e and progressing over a 100-day period across the 4 four temperature treatments considering different fecundity levels; 33, 66 and 99 offspring per female \u003cem\u003eAn. arabiensis\u003c/em\u003e, respectively. Each growth curve incorporates a sex ratio of 0.5 (indicating an equal proportion of female offspring), a generation cycle and is capped by a carrying capacity \u003cem\u003eK \u003c/em\u003e= 1000, illustrating how temperature affects the speed and likelihood of reaching the target population over time.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5654412/v1/b4ecfa5c41cfde74129336b1.jpg"},{"id":88814120,"identity":"dee3474e-8a55-452e-9156-8f0de325624e","added_by":"auto","created_at":"2025-08-11 16:07:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1204518,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5654412/v1/8748b533-c357-4462-b1dc-96ca825054f7.pdf"},{"id":81236254,"identity":"5eb1f563-3b6a-4d6d-abac-90bf2a017138","added_by":"auto","created_at":"2025-04-23 19:51:18","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":164032,"visible":true,"origin":"","legend":"","description":"","filename":"ScientificreportSupplementaryfigures04042025.docx","url":"https://assets-eu.researchsquare.com/files/rs-5654412/v1/ec42101d5c07b5a80db9dc07.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eThe dissemination potential of Microsporidia MB in Anopheles arabiensis mosquitoes is modulated by temperature\u003c/p\u003e","fulltext":[{"header":"Importance","content":"\u003cp\u003eMalaria, transmitted by \u003cem\u003eAnopheles\u0026nbsp;\u003c/em\u003emosquitoes, poses a severe threat to human health and economic sustainability in sub-Saharan Africa. Traditional control methods, reliant on insecticides and drugs, are losing effectiveness due to resistance, highlighting the urgent need for innovative solutions. One such potential solution is \u003cem\u003eMicrosporidia MB\u003c/em\u003e, a naturally occurring symbiont that can block \u003cem\u003ePlasmodium\u003c/em\u003e transmission in \u003cem\u003eAnopheles gambiae\u003c/em\u003e s.l.. However, its success in controlling malaria depends on understanding the infection dynamics of the symbiont over time and across different environments. Our experimental studies on field derived mosquitoes and mathematical modelling show that \u003cem\u003eMicrosporidia MB\u003c/em\u003e dissemination potential increases with temperature within a viable range for \u003cem\u003eAnopheles gambiae s.l.\u003c/em\u003e mosquitoes, driven by trade-offs between mosquito development, survival and the symbiont growth. This study suggests that fluctuating temperatures could influence the effectiveness of \u003cem\u003eMicrosporidia MB\u003c/em\u003e in blocking malaria transmission, and future research should focus on how these temperature changes impact its performance in natural settings.\u0026nbsp;\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eMalaria prevention and management are increasingly challenged by global temperature rise [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] and the growing threat of insecticide resistance, particularly low- and middle-income countries in sub-Saharan Africa [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Climate change accelerates insecticide resistance, undermining the efficacy of current insecticide-based control measures [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Consequently, the global malaria burden continues to rise, with 249\u0026nbsp;million cases in 2022, up from 231\u0026nbsp;million cases in 2015 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The ambitious target from the World Health Organization to reduce malaria cases and mortality by 90% by 2030 cannot be met using insecticide-based methods alone [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. While insecticide-treated nets and indoor residual spraying of insecticides remain central to vector control, novel and complementary malaria control innovations are urgently needed. [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. These new tools must be evaluated with consideration of their interactions with environmental conditions, ecology and existing control measures [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eMicrosporidia MB\u003c/em\u003e, a naturally occurring symbiont, shows great promise as a complementary malaria control strategy through by inhibiting \u003cem\u003ePlasmodium\u003c/em\u003e parasite proliferation in \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Identified in various \u003cem\u003eAnopheles\u003c/em\u003e species (\u003cem\u003eAn. arabiensis, An. gambiae, An. coluzii\u003c/em\u003e) and across different geographical regions [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e], \u003cem\u003eMicrosporidia MB\u003c/em\u003e spreads through vertical and horizontal transmission routes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Despite its potential, understanding the impact of temperature and climate on its performance is crucial for maximizing its effectiveness as a malaria control tool. Notably, \u003cem\u003eMicrosporidia MB\u003c/em\u003e shows seasonal variation in prevalence with higher infection rates following peak rainfall periods [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], a pattern observed in several microsporidians in \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTemperature plays a key roles in influencing the growth of microsporidians, with high temperatures and low humidity promoting increased infection intensity and spore production [\u003cspan additionalcitationids=\"CR9 CR10 CR11 CR12 CR13\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Additionally, environmental conditions significantly affect mosquito physiology, survival, reproduction, and development [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan additionalcitationids=\"CR18 CR19 CR20 CR21 CR22 CR23\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Temperature also impacts symbiontic relationships in other insect species, such as the stinkbug pest \u003cem\u003eNezara viridula\u003c/em\u003e, where warmer conditions disrupts its gut microbiome and reduce fitness [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. \u003cem\u003eMicrosporidia MB\u003c/em\u003e transmission is intensity-dependent [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] and the infection levels can be influenced by factors such as mosquito age and blood feeding [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Thus, temperature may have a profound impact on the proliferation of \u003cem\u003eMicrosporidia MB\u003c/em\u003e, presenting both opportunities and challenges for its use as malaria control strategy [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we investigate the impact of temperature on the dissemination potential of \u003cem\u003eMicrosporidia MB\u003c/em\u003e in \u003cem\u003eAn. arabiensis\u003c/em\u003e mosquitoes collected from the Ahero irrigation scheme, where we have identified a single isolate of \u003cem\u003eMicrosporidia MB\u003c/em\u003e based on genome sequencing [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. By examining mosquito larval development time, survival rates, and infection levels at different temperatures (22\u0026deg;C, 27\u0026deg;C, 32\u0026deg;C, and 37\u0026deg;C), we developed a population growth model to simulate the spread of \u003cem\u003eMicrosporidia MB\u003c/em\u003e-infected \u003cem\u003eAnopheles arabiensis\u003c/em\u003e mosquitoes. The reference temperature for rearing \u003cem\u003eAnopheles arabiensis\u003c/em\u003e mosquitoes is 27\u0026deg;C [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], with 22\u0026deg;C and above 35\u0026deg;C marking the critical thresholds for mosquito development [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Our model quantifies how quickly \u003cem\u003eMicrosporidia MB\u003c/em\u003e can establish itself within a population, offering valuable insights into the optimal conditions for maximizing its dissemination potential. By predicting the dynamics of \u003cem\u003eMicrosporidia MB\u003c/em\u003e spread, we aim to enhance the feasibility of using symbiont in malaria control efforts.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e1) Quantification of\u003c/b\u003e \u003cb\u003eMicrosporidia MB\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe vertical transmission rate of \u003cem\u003eMicrosporidia MB\u003c/em\u003e in the \u003cem\u003eAnopheles arabiensis\u003c/em\u003e lineages used for this study was found to be 43%, meaning that approximately 43% of the offspring from \u003cem\u003eMicrosporidia MB\u003c/em\u003e-infected (MB+) females were infected with \u003cem\u003eMicrosporidia MB\u003c/em\u003e. \u003cem\u003eMicrosporidia MB\u003c/em\u003e uninfected females (MB-) are either uninfected offspring of MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e (the remaining 57%) or offspring from MB- \u003cem\u003eAn. arabiensis\u003c/em\u003e females.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePupation rate\u003c/b\u003e: The average pupation rate across all temperature treatment was 54.1 (95% confidence interval: 51.60-56.59) %. Notably, at 27\u0026deg;C, the pupation rate was 73.8 (69.44\u0026ndash;78.14) % which was significantly higher than at 32\u0026deg;C (56.1%, 50.92\u0026ndash;61.13) and 37\u0026deg;C (19.0%, 15.12\u0026ndash;22.86) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. However, pupation at 27\u0026deg;C was not significantly different from 22\u0026deg;C (67.8%, 63.16\u0026ndash;72.36). (Tukey post-hoc comparisons: p\u003csub\u003e27\u0026deg;C\u0026minus;22\u0026deg;C\u003c/sub\u003e \u0026gt; 0.05 and p\u003csub\u003e27\u0026deg;C\u0026minus;32\u0026deg;C\u003c/sub\u003e and p\u003csub\u003e27\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e \u0026lt; 0.001; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;153.95, df\u0026thinsp;=\u0026thinsp;3, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Offspring of MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e exhibited higher pupation rates than those of MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e [MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 58.5 (52.29\u0026ndash;64.73) % ; MB\u0026thinsp;+\u0026thinsp;\u003cem\u003eAn. arabiensis\u003c/em\u003e: 53.3 (50.56-56.00) %]. This effect is due to the offspring of MB\u0026thinsp;\u0026minus;\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e exhibiting pupation success rates three times higher than those of MB\u0026thinsp;+\u0026thinsp;offspring when reared at 37\u0026deg;C. [37\u0026deg;C; MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e : 40.9 (0.29\u0026ndash;0.53) %, MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e : 14.6 (10.77\u0026ndash;18.40) %] (Tukey test at 37\u0026deg;C: p\u003csub\u003eMB\u0026minus;/MB+\u003c/sub\u003e \u0026lt; 0.001; other Tukey tests: p\u0026thinsp;\u0026gt;\u0026thinsp;0.05; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;11.26, df\u0026thinsp;=\u0026thinsp;1, p\u0026thinsp;\u0026lt;\u0026thinsp;0.003).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eLarval death age\u003c/b\u003e: Larvae that did not pupate died after 6.1 (5.79\u0026ndash;6.33) days on average after hatching. When reared at 37\u0026deg;C, larvae died about two days earlier than at other temperatures [22\u0026deg;C: 7.1 (6.17\u0026ndash;8.02) days; 27\u0026deg;C: 6.6 (5.93\u0026ndash;7.35) days; 32\u0026deg;C: 7.1 (6.53\u0026ndash;7.60) days; 37\u0026deg;C: 5.0 (4.69\u0026ndash;5.27) days; \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e] (Tukey for dead larvae: p\u003csub\u003e27\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e, p\u003csub\u003e22\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e and p\u003csub\u003e32\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e \u0026lt; 0.001; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;39.79, df\u0026thinsp;=\u0026thinsp;3, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003cb\u003eTime to pupation\u003c/b\u003e: The average time for the larvae to pupate was 9.6 (9.41\u0026ndash;9.80) days, with larvae from MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e pupating almost two days faster than those from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e [MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 8.1 (7.67\u0026ndash;8.47) days; MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 9.9 (9.71\u0026ndash;10.13) days] (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;56.87, df\u0026thinsp;=\u0026thinsp;1, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, being an MB\u0026thinsp;+\u0026thinsp;offspring from an MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e increased the chance to pupate one day faster compared to MB- larvae coming from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e [MB\u0026thinsp;+\u0026thinsp;offspring: 9.1 (8.85\u0026ndash;9.40) days; MB- coming from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 10.2 (9.93\u0026ndash;10.52) days] (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;50.92, df\u0026thinsp;=\u0026thinsp;2, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), \u003cb\u003e(supplementary Fig.\u0026nbsp;1 )\u003c/b\u003e, largely due to a significant difference at 27\u0026deg;C [MB- offspring from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e: 11.1 (10.66\u0026ndash;11.46) days; MB\u0026thinsp;+\u0026thinsp;offspring: 9.4 (9.06\u0026ndash;9.83) days] (Tukey: p\u003csub\u003eMB+ female \u003cem\u003eAn. arabiensis\u003c/em\u003e only\u0026minus; MB+offspring\u003c/sub\u003e = 0.02; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;21.92, df\u0026thinsp;=\u0026thinsp;6, p\u0026thinsp;=\u0026thinsp;0.001). At 22\u0026deg;C, 32\u0026deg;C, and 37\u0026deg;C, all larvae coming from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e had similar development times (all Tukey test p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Overall, time to pupation decreased with increasing temperature, with larvae at 32\u0026deg;C and 37\u0026deg;C pupating 36% faster than at 27\u0026deg;C and nearly 50% faster than at 22\u0026deg;C [22\u0026deg;C: 11.6 (11.29\u0026ndash;11.88) days; 27\u0026deg;C: 10.1 (9.86\u0026ndash;10.36) days; 32\u0026deg;C: 7.1 (6.89\u0026ndash;7.42) days; 37\u0026deg;C: 6.96 (6.62\u0026ndash;7.30) days] (Tukey for larvae that pupated: for all p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, except p\u003csub\u003e32\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e \u0026gt; 0.05; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;137.95, df\u0026thinsp;=\u0026thinsp;3, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInfection rate in offspring\u003c/b\u003e: The infection rate in offspring varied by temperature, with a significant decrease at 22\u0026deg;C compared to 27\u0026deg;C [22\u0026deg;C: 30.8 (24.45\u0026ndash;37.22) %; 27\u0026deg;C: 48.7 (42.43\u0026ndash;5507) %] and 37\u0026deg;C showing the highest infection rate [32\u0026deg;C: 46.7 (39.06\u0026ndash;54.28) %; 37\u0026deg;C: 52.1 (37.95\u0026ndash;66.21)%] \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e (Tukey: estimate\u003csub\u003e27\u0026deg;C\u0026minus;22\u0026deg;C\u003c/sub\u003e = 0.68, p\u003csub\u003e27\u0026deg;C\u0026minus;22\u0026deg;C\u003c/sub\u003e = 0.001; p\u003csub\u003e27\u0026deg;C\u0026minus;32\u0026deg;C\u003c/sub\u003e and p\u003csub\u003e27\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e \u0026gt; 0.05; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;9.99, df\u0026thinsp;=\u0026thinsp;1, p\u0026thinsp;=\u0026thinsp;0.001). The infection rate in the offspring was positively correlated with the maternal \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity (r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.5612, \u003cem\u003ey\u0026thinsp;=\u0026thinsp;1.47x\u0026thinsp;+\u0026thinsp;26.09\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.005) \u003cb\u003e(supplementary Fig.\u0026nbsp;2).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e\u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity in offspring\u003c/strong\u003e \u003cp\u003eThe relative intensity of \u003cem\u003eMicrosporidia MB\u003c/em\u003e in MB\u0026thinsp;+\u0026thinsp;offspring was 1.7 (1.19\u0026ndash;2.23) as calculated relative to the single copy nuclear \u003cem\u003eAnopheles\u003c/em\u003e S7 gene. Larvae with higher \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity tended to pupate faster (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;6.56, df\u0026thinsp;=\u0026thinsp;1, p\u0026thinsp;=\u0026thinsp;0.01). This relationship however dependent on temperature [p\u003csub\u003e22\u0026deg;C\u0026minus;27\u0026deg;C\u003c/sub\u003e \u0026lt; 0.001; p\u003csub\u003e27\u0026deg;C\u0026minus;37\u0026deg;C\u003c/sub\u003e = 0.06; p\u003csub\u003e27\u0026deg;C\u0026minus;32\u0026deg;C\u003c/sub\u003e = 0.001; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;17.45, df\u0026thinsp;=\u0026thinsp;3, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e]. At 27\u0026deg;C and 37\u0026deg;C, the development time was negatively correlated to \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity in the offspring. At 27\u0026deg;C faster pupation led to a 45% increase in \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity, while at 22\u0026deg;C, delayed pupation increased intensity by the same amount [y\u003csub\u003e(27)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;9.7\u0026ndash;0.467x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.12; y\u003csub\u003e(22)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;11.4\u0026thinsp;+\u0026thinsp;0.311x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.13; y\u003csub\u003e(37)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;7.75\u0026ndash;0.252x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.23]. The intensity at 32\u0026deg;C was unaffected by pupation time [y\u003csub\u003e(32)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;7.33\u0026thinsp;+\u0026thinsp;0.00623x, r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01]. Additionally, female \u003cem\u003eAn. arabiensis\u003c/em\u003e with higher transmission rate (above 50%), produced offspring with greater \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity \u003cb\u003e(supplementary Fig.\u0026nbsp;3).\u003c/b\u003e\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e2) Modelling the\u003c/b\u003e \u003cb\u003eMicrosporidia MB\u003c/b\u003e \u003cb\u003edissemination potential\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUsing the experimental data, we developed a mathematical model to predict the spread of \u003cem\u003eMicrosporidia MB\u003c/em\u003e in \u003cem\u003eAnopheles arabiensis\u003c/em\u003e populations at different temperatures. The time required to reach a target population of a thousand MB\u0026thinsp;+\u0026thinsp;offspring from an initial population of ten female \u003cem\u003eAn. arabiensis\u003c/em\u003e was significantly influenced by temperature. As temperature increased, the mean age at pupation decreased, and the probability of successful pupation increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe probability that an offspring is infected, survives to age \u003cem\u003ex\u003c/em\u003e, and pupates at age x given temperature \u003cem\u003eT\u003c/em\u003e was modelled as a function of fitted parameters: \u003cem\u003eA\u003c/em\u003e (scaling factor), \u003cem\u003emu (\u0026micro;)\u003c/em\u003e (mean age of pupation), and \u003cem\u003esigma (σ\u003c/em\u003e) (spread of the pupation age). This probability combined the likelihood of infection at temperature \u003cem\u003eT\u003c/em\u003e, the chance of survival to age \u003cem\u003ex\u003c/em\u003e given infection, and the probability of pupating at that specific age. The model\u0026rsquo;s accuracy was validated by high \u003cem\u003eR\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e values, especially at higher temperatures, indicating a strong fit to the observed data. At 22\u0026deg;C, the normalization constant \u003cem\u003eA\u003c/em\u003e was 0.02942, with a mean pupation age \u003cem\u003emu\u003c/em\u003e of 10.73 and a standard deviation \u003cem\u003esigma\u003c/em\u003e of 2.20, resulting in a mean squared error \u003cem\u003e(MSE)\u003c/em\u003e of 0.00003 and a R\u003csup\u003e2\u003c/sup\u003e value of 0.794, indicating a moderate fit. At 27\u0026deg;C, \u003cem\u003eA\u003c/em\u003e increased to 0.04785, \u003cem\u003emu\u003c/em\u003e decreased to 8.99, and \u003cem\u003esigma\u003c/em\u003e was 2.06, with an MSE of 0.00003 and a stronger fit at R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.917. At 32\u0026deg;C, A further increased to 0.05782, \u003cem\u003emu\u003c/em\u003e dropped to 7.40, and sigma narrowed to 1.27, producing an MSE of 0.00005 and an R\u003csup\u003e2\u003c/sup\u003e of 0.874. Finally, at 37\u0026deg;C, \u003cem\u003eA\u003c/em\u003e was 0.03147, \u003cem\u003emu\u003c/em\u003e was 6.88, \u003cem\u003esigm\u003c/em\u003ea was 1.02, with the best fit demonstrated by an \u003cem\u003eMSE\u003c/em\u003e of 0.00000 and a R\u003csup\u003e2\u003c/sup\u003e of 0.970.\u003c/p\u003e \u003cp\u003eThe population growth for infected offspring across different temperatures and fecundity levels revealed that both factors significantly impact growth rates and time to reach population of 1000 \u003cem\u003eMB\u003c/em\u003e\u0026thinsp;+\u0026thinsp;offspring. The optimum temperatures 27\u0026deg;C and 32\u0026deg;C consistently led to rapid population growth, with 1000 \u003cem\u003eMB\u003c/em\u003e\u0026thinsp;+\u0026thinsp;offspring reached within 15\u0026ndash;48 days across all fecundity levels. Specifically, at a fecundity of 33 offspring per female \u003cem\u003eAn. arabiensis\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e, populations at 27\u0026deg;C and 32\u0026deg;C reach 1000 \u003cem\u003eMB\u003c/em\u003e\u0026thinsp;+\u0026thinsp;offspring by approximately day 48 and day 35, respectively, while at 37\u0026deg;C, it was estimated to take around 62 days. In contrast, at 22\u0026deg;C, the population did not reach 1000 \u003cem\u003eMB\u003c/em\u003e\u0026thinsp;+\u0026thinsp;offspring within the 100-day period. Increasing fecundity to 66 offspring per female \u003cem\u003eAn. arabiensis\u003c/em\u003e further accelerated growth, with populations at 27\u0026deg;C, 32\u0026deg;C, and 37\u0026deg;C reaching 1000 \u003cem\u003eMB\u0026thinsp;+\u003c/em\u003e\u0026thinsp;offspring by approximately day 25, 20, and 35, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u003cb\u003e).\u003c/b\u003e At 22\u0026deg;C, the average time to reach the target population was 100 days. At the highest fecundity level of 99 offspring per female \u003cem\u003eAn. arabiensis\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e, the population growth was extremely rapid, with 27\u0026deg;C and 32\u0026deg;C reaching 1000 \u003cem\u003eMB\u0026thinsp;+\u003c/em\u003e\u0026thinsp;offspring by day 17 and 15, respectively, and 37\u0026deg;C by day 25. At 22\u0026deg;C, the population reached 1000 \u003cem\u003eMB\u0026thinsp;+\u003c/em\u003e\u0026thinsp;offspring by approximatively 65 days.\u003c/p\u003e \u003cp\u003eTo further clarify the effects of offspring numbers per female \u003cem\u003eAn. arabiensis\u003c/em\u003e, Monte Carlo simulations with 1000 iterations, accounting for 10% variability in offspring number \u003cb\u003e(Supplementary information, Fig.\u0026nbsp;4)\u003c/b\u003e showed that temperature, rather than offspring number variability, played a key role in establishing the MB\u0026thinsp;+\u0026thinsp;population. Optimal temperatures were consistently 27\u0026deg;C and 32\u0026deg;C, regardless of fluctuations in the offspring count.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eMicrosporidia MB\u003c/em\u003e spreads both vertically (from female to offspring) and sexually (horizontal transmission) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Vertical transmission occurs as the symbiont enters developing eggs via stem cell division, remaining inside the host cell, while sexual transmission likely requires the symbiont to form spores and exit the host cell. Though vertical transmission is highly efficient, some offspring appear to lose the infection during juvenile stages [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. This study explores how temperature affects the prevalence and spread of \u003cem\u003eMicrosporidia MB\u003c/em\u003e during the aquatic stages of \u003cem\u003eAn. arabiensis\u003c/em\u003e development. In this study, we investigated the impact of temperature on \u003cem\u003eMicrosporidia MB\u003c/em\u003e prevalence and dissemination potential during aquatic stages of \u003cem\u003eAnopheles arabiensis\u003c/em\u003e development. Our results show that the optimal temperature for sustainning \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity and supporting the growth of MB\u0026thinsp;+\u0026thinsp;\u003cem\u003eAnopheles arabiensis\u003c/em\u003e mosquito population growth is 32\u0026deg;C. This contrasts with the commonly accepted rearing temperature for \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes of 27\u0026deg;C. While both infected and uninfected mosquitoes showed better survival at 27\u0026deg;C, the MB\u0026thinsp;+\u0026thinsp;\u003cem\u003eAnopheles arabiensis\u003c/em\u003e population grew best at 32\u0026deg;C due to a shorter larval development time and higher \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity in the offspring. Therefore, temperatures ranging from 27\u0026deg;C to 32\u0026deg;C, particularly closer to 32\u0026deg;C, seem most effective for rearing mosquitoes for symbiont-based malaria control tool. These findings suggest that mass rearing of MB\u0026thinsp;+\u0026thinsp;mosquitoes at these temperatures field releases could optimize their effectiveness as a vector control tool (though the malaria-blocking potential at different temperatures still needs evaluation).\u003c/p\u003e \u003cp\u003eOur experiments used offspring of wild-caught \u003cem\u003eAnopheles arabiensis\u003c/em\u003e mosquitoes which typically have lower fecundity (33\u0026ndash;66 offspring per female) compared to lab-adapted colonies [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. This underlines the importance of considering the effects of natural mosquito populations when evaluating vector control strategies. Our results also highlight the key role of temperature in determining both the prevalence of MB\u0026thinsp;+\u0026thinsp;in \u003cem\u003eAn. arabiensis\u003c/em\u003e populations and their potential for malaria transmission. The strong correlation between temperature and population growth, supported by high R\u0026sup2; values (0.79396 to 0.97048), suggests that our logistic growth model effectively captured the dynamics of MB\u0026thinsp;+\u0026thinsp;mosquito population under varying environmental conditions.\u003c/p\u003e \u003cp\u003eAs poikilotherms, mosquitoes\u0026rsquo; life history traits, such as longevity, fecundity, biting rate and development of immature stages of mosquitoes, are strongly influenced by temperature [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Our findings confirm previous studies showing that higher temperatures shorten larval development time and reduce pupation rates, regardless of \u003cem\u003eMicrosporidia MB\u003c/em\u003e infection [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Interestingly, larvae from MB\u0026thinsp;+\u0026thinsp;females develop more slowly than those from MB- females. However, when the offspring of MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e were separated between infected and non-infected larvae in the statistical model, we realized that MB\u0026thinsp;+\u0026thinsp;offspring were overall developing 1 day faster than MB- offspring coming from \u003cem\u003eMicrosporidia MB\u003c/em\u003e infected female \u003cem\u003eAn. arabiensis\u003c/em\u003e at 27\u0026deg;C. This result is similar to earlier reports performed in the laboratory and semi-field conditions where temperature was not controlled [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe occurrence of certain microsporidian genera, including \u003cem\u003eEnterocytospora, Microsporidium\u003c/em\u003e and \u003cem\u003eVairimorpha\u003c/em\u003e, is positively correlated with rising environmental temperature [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Similarly, in our study, we observed that higher temperatures led to increased prevalence of \u003cem\u003eMicrosporidia MB\u003c/em\u003e, with infection intensity also rising at elevated temperatures. This suggests that the transmission rate of Microsporidia MB, dependant on infection intensity, is significantly influenced by temperature. A similar pattern as been observed in other systems, such as \u003cem\u003eDrosophila\u003c/em\u003e, where higher temperatures promote proliferation of \u003cem\u003eWolbachia\u003c/em\u003e bacteria [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], leading to greater fitness costs associated with pathogenic variants like \u003cem\u003ewMelOctoless\u003c/em\u003e and \u003cem\u003ewMelPop\u003c/em\u003e in \u003cem\u003eD. melanongaster\u003c/em\u003e [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Additionally, lower development temperatures result in reduced titres of \u003cem\u003ewYak\u003c/em\u003e in \u003cem\u003eDrosophila yakuba\u003c/em\u003e, which decreases the chances of vertical transmission. In our study, the lowest rearing temperature of 22\u0026deg;C resulted in a lower prevalence of \u003cem\u003eMicrosporidia MB\u003c/em\u003e infection compared to higher temperatures, indicating that symbiont loss after vertical transmission [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] is more likely at this cooler temperature. We also observed that lower temperatures, in addition to the slower development time, were associated with increased late-stage larval mortality. This could suggest that under these conditions, the symbiont might favour horizontal transmission over vertical transmission [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe importance of understanding the symbiotic relationship between \u003cem\u003eAnopheles arabiensis\u003c/em\u003e and \u003cem\u003eMicrosporidia MB\u003c/em\u003e becomes evident as we explore the benefits or potential costs of infection. While we did not investigate the effect of temperature on the specific transmission strategy (vertical vs. horizontal) employed by \u003cem\u003eMicrosporidia MB\u003c/em\u003e, we hypothesize that cooler temperatures, which prolong larval development and slow larval death, could encourage spore formation in the symbiont [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Previous studies did not observed larvae-to-larvae transmission in our system, but we cannot exclude the possibility that physiological stressors or sub-optimal rearing conditions might promote horizontal transmission at the larval stage. Other microsporidian systems, such as \u003cem\u003eEdhazardia aedis\u003c/em\u003e, have shown that resource limitations can shift transmission routes, with horizontal transmission becoming more prominent when larvae are reared under low-food conditions, a stress that extends development time [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe observed the highest infection intensity and prevalence of \u003cem\u003eMicrosporidia MB\u003c/em\u003e at 37\u0026deg;C, which suggests that higher temperatures may accelerate the growth rate of the symbiont in \u003cem\u003eAn. arabiensis\u003c/em\u003e. A faster growth rate could result in higher infection intensity, possibly preventing the host from clearing the infection, thus increasing \u003cem\u003eMicrosporidia MB\u003c/em\u003e prevalence. Although 37\u0026deg;C is ner the upper thermal limit for adult \u003cem\u003eAnopheles gambiae\u003c/em\u003e development [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], it is possible that the larvae exhibit higher heat tolerance compared to adults. The observed lower pupation rate for offspring coming from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e compared to those coming from MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e at 37\u0026deg;C could suggest that this temperature approaches the thermal limit for \u003cem\u003eMicrosporidia MB\u003c/em\u003e; where the symbiont\u0026rsquo;s growth becomes detrimental to the host. The heat might kill some of the symbionts, making them toxic and leading to higher mortality rate in MB\u0026thinsp;+\u0026thinsp;mosquitoes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The presence of the symbiont might also reduce the mosquito ability to tolerate heat stress, similar to how the obligate bacterial pathogen \u003cem\u003ePasteuria ramose\u003c/em\u003e affects \u003cem\u003eDaphnia magna\u003c/em\u003e [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. This scenario aligns with the thermal mismatch hypothesis, which predicts that cooler-adapted hosts are more susceptible to infections from warmer-adapted parasites when exposed to warmer temperature [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. This hypothesis warrants future investigation into the thermal sensitivity of \u003cem\u003eMicrosporidia MB\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIt is also possible that high larval mortality associated with higher temperatures could favour the formation of spores and horizontal transmission. if spore-based infection results in some mortality, this could explain the increased in \u003cem\u003eMicrosporidia MB\u003c/em\u003e prevalence and higher mortality of \u003cem\u003eAnopheles arabiensis\u003c/em\u003e larvae under hot rearing conditions. Similar heat stress effects have been observed in \u003cem\u003eWolbachia\u003c/em\u003e-infected \u003cem\u003eAedes aegypti\u003c/em\u003e, where increased rearing temperatures from 26\u0026deg; C to 37\u0026deg;C reversed the infection, preventing transmission to the next generation of mosquitoes [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEnvironmental conditions during larval development are known to affect adult mosquito life-history traits, including longevity, fecundity, and overall vector competence [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Since our study focuses on juvenile development it limits our ability to predict the potential population growth potential of mosquitoes reared in different temperatures. The survival rate of mosquitoes, particularly adults, is underestimated in our study, as we only collected data on juvenile stages. However, it is well established that higher temperatures can negatively affect the longevity and fecundity of adult mosquitoes [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], reducing body size and hatch rate [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The relationship between body size and longevity is complex and depends on factors like food availability and temperature during larval development [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. These factors also interact with vector competence for malaria, with temperature- competence relationship varying based on larval food intake [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. We hypothesize that a similar complex relationship exists between temperature, \u003cem\u003eMicrosporidia MB\u003c/em\u003e competence and mosquito survival, which warrants further investigation.\u003c/p\u003e \u003cp\u003eAdditionally, while we recognize that \u003cem\u003eMicrosporidia MB\u003c/em\u003e infection intensity can be influenced by nutrition [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], our study assumed that larval competition for food was similar across all temperature treatments. Since density-dependent competition and temperature interact to influence mosquito survival and offspring production [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], it is crucial to further explore how nutritional intake affects \u003cem\u003eMicrosporidia-MB\u003c/em\u003e-infected mosquitoes. This is particularly important given our findings that temperature influences \u003cem\u003eMicrosporidia MB\u003c/em\u003e spread depending on the number of offspring produced. For example, with 33 offspring per female \u003cem\u003eAn. arabiensis\u003c/em\u003e, 22\u0026deg;C prevents the growth of \u003cem\u003eMicrosporidia MB\u003c/em\u003e infected populations, while higher offspring counts (99 offspring per female \u003cem\u003eAn. arabiensis\u003c/em\u003e) at 22\u0026deg;C and 37\u0026deg;C promote rapid establishment of \u003cem\u003eMicrosporidia MB\u003c/em\u003e. Future studies should account for these factors to refine predictions on the dissemination potential of \u003cem\u003eMicrosporidia-MB\u003c/em\u003e infected mosquitoes across different temperatures environments.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eAlthough 27\u0026deg;C is widely considered the optimal temperature for rearing \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes, it is not the most favourable for the spread of the \u003cem\u003eMicrosporidia MB\u003c/em\u003e symbiont. Our study shows that 32\u0026deg;C supports higher symbiont intensity, faster larval development, and better population growth, even though 27\u0026deg;C results in higher mosquito survival. These findings reinforce previous predictions that warmer temperatures enhances the spread of MB\u0026thinsp;+\u0026thinsp;mosquito populations, despite the potential for increased mosquito mortality. By identifying regions with climates conducive to the spread of MB\u0026thinsp;+\u0026thinsp;mosquito populations, this research contributes to the development of an effective \u003cem\u003eMicrosporidia\u003c/em\u003e-based strategies for malaria control. Our study also emphasizes the need to consider environmental factors, such as temperature, when assessing microbial-based malaria control methods and understanding the natural prevalence and spread of symbionts like \u003cem\u003eMicrosporidia MB\u003c/em\u003e across different climatic regions.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1) Experimental design\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e1.1) Mosquito collection\u003c/h2\u003e \u003cp\u003e1583 larvae used in this study were obtained from 17 field caught gravid \u003cem\u003eAnopheles arabiensis\u003c/em\u003e female collected via mouth aspiration from Kigoche village (00\u0026deg;34\u0026prime;S, 34\u0026deg;65\u0026prime; E) in the Ahero irrigation scheme, Kenya and transported to the International Centre of Insect Physiology and Ecology (ICIPE)-Duduville campus in Nairobi, Kenya. During collection, a torch was used to locate \u003cem\u003eAnopheles gambiae s.l.\u003c/em\u003e indoors on the walls of muddy houses, this was guided by identification protocol illustrated in [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], the morphological traits used were resting position, characteristics of wings and abdomen. Abdomens of the collected gravid females were morphologically examined and those observed as engorged, and dark were considered gravid. MB\u0026thinsp;+\u0026thinsp;females used in these experiments were selected over three different collection timepoints. September 2022, 1123, gravid field collected female \u003cem\u003eAn. arabiensis\u003c/em\u003e were screened for presence of \u003cem\u003eMicrosporidia MB\u003c/em\u003e, 180 were positive resulting in a 16.03% prevalence in the field (5 MB\u0026thinsp;+\u0026thinsp;females were used for this experiment, offspring n\u0026thinsp;=\u0026thinsp;404). November 2022, 399 mosquitoes were screened, 142 were positive for \u003cem\u003eMicrosporidia MB\u003c/em\u003e, this recorded a prevalence of 35.58% of the symbiont in the field (5 MB\u0026thinsp;+\u0026thinsp;females, offspring n\u0026thinsp;=\u0026thinsp;511). In July 2023, 565 mosquitoes were screened, 75 were positive for the symbiont resulting to 13.27% prevalence in the field (7 MB\u0026thinsp;+\u0026thinsp;females, offspring n\u0026thinsp;=\u0026thinsp;624). The gravid females were placed in 1.5ml micro-centrifuge tubes containing 1cm by 1cm Whatman filter paper to allow egg laying following the methods described in [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. After oviposition, they were screened for species ID [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] and the presence of \u003cem\u003eMicrosporidia MB\u003c/em\u003e [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] using PCR.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e1.2) Larval rearing\u003c/h2\u003e \u003cp\u003eEggs from \u003cem\u003eMicrosporidia MB\u003c/em\u003e positive and negative female \u003cem\u003eAn. arabiensis\u003c/em\u003e were separated into larval trays with around 300 ml of deionised water to hatch. In three replicates, stage one (L1) larvae from the same MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e were randomly and in equal number split into four temperature treatments: A total of 444, 515 and 624 L1 larvae were used to set up replicates one, two and three of the experiments. L1 larvae from each MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e were divided into four equal proportions and put in four different larval trays. L1 larvae from MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e was also put in a separate larval tray for each of the temperature regimes. We, therefore, had four larval trays per each MB\u0026thinsp;+\u0026thinsp;and MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e, each tray per temperature regime. One MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e was used per replicate. This was due to limited space in the incubators. We set temperature 22\u0026deg;C using insect growth chamber since it supported low temperature settings. Trays for temperature 27\u0026deg;C were put in an isolated room with control ambient room temperature of 27\u0026deg;C. We used small incubators to set experiments for temperatures 32\u0026deg;C and 37\u0026deg;C, this is because these incubators could only support temperature settings above 30\u0026deg;C. The number of larvae per tray in the for the MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e were dependent on the amount of offsprings produced by each female \u003cem\u003eAn. arabiensis\u003c/em\u003e (the data of larvae per tray in each temperature regime has been attached for reference). In MB- female \u003cem\u003eAn. arabiensis\u003c/em\u003e, 23, 25 and 18 L1 larvae were used per each tray in each temperature regime for replicates one, two and three respectively. The larvae were fed on a pinch of Tetramin baby fish food throughout their development until pupation. We monitored daily larval mortality, rate and date of pupation of each pupa.\u003c/p\u003e \u003cp\u003e \u003cb\u003e1.3) Quantification of\u003c/b\u003e \u003cb\u003eMicrosporidia MB\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe ammonium acetate protein precipitation method was used for DNA extraction from offsprings of MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Whole pupae were homogenised in 50 \u0026micro;l of phosphate buffered saline (PBS), incubated at 56\u0026deg;C for 1 hour in 300 \u0026micro;l of cell lysis buffer then we precipitated out proteins using 100 \u0026micro;l protein precipitate while incubating the samples in ice for 30 minutes. The supernatant was centrifuged for 20 minutes at 14000 revolutions per minute then transferred to 300 \u0026micro;l of isopropanol, the samples were inverted 100 times to allow the reagents mix before centrifuging at 14000 revolutions per minute for 1 hour to remove excess salt. To obtain a clean DNA, we poured out the resulting supernatant then added 300 \u0026micro;l of ice cold 70% ethanol, inverted the samples 50 times then centrifuged at maximum speed of 14000 revolutions per minute for 30 minutes to remove excess salts. The resultant DNA was air dried under the biosafety cabinet overnight before elution in 60 \u0026micro;l of nuclease free water [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAll pupae collected from the experimental group (offspring of MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e) were screened to identify those infected with \u003cem\u003eMicrosporidia MB\u003c/em\u003e using conventional PCR [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. We measured the \u003cem\u003eMicrosporidia MB\u003c/em\u003e infection rate in the collected G\u003csub\u003e0\u003c/sub\u003e female \u003cem\u003eAn. arabiensis\u003c/em\u003e and offspring as well and quantified \u003cem\u003eMicrosporidia MB\u003c/em\u003e density through relative quantification using qPCR. Partial \u003cem\u003eMicrosporidia MB\u003c/em\u003e 18s gene region from each DNA sample was amplified using specific 18s primers (MB18SF: CGCCGG CCGTGAAAAATTTA and MB18SR: CCTTGGACGTG GGAGCTATC) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The gene was then amplified in an 11\u0026micro;l reaction volume of a mixture containing 0.5\u0026micro;l of 5pmol/\u0026micro;l reverse and forward primers, 2\u0026micro;l HOTFirepol Blend Master Mix Ready-To-Load (Solis Biodyne, Estonia), 6\u0026micro;l of nuclease-free PCR water and 2\u0026micro;l of DNA template. The amplification was achieved under the following conditions: initial denaturation at 95\u0026deg;C for 15 min, denaturation at 95\u0026deg;C for 1 minute for 35 cycles, annealing at 62\u0026deg;C for 30 s, a further extension for 30 s at 72\u0026deg;C, and finally, final elongation for 5 min at 72\u0026deg;C. To quantify the level of infection, samples positive for \u003cem\u003eMicrosporidia MB\u003c/em\u003e were subjected to relative qPCR analysis using MB18SF/MB18SR primers normalised with the reference host-keeping gene for the \u003cem\u003eAnopheles\u003c/em\u003e ribosomal s7 gene (S7F: TCCTGGAGCTGGAGATGAAC and S7R: GACGGGTCTGTACCTTCTGG). Since the ribosomal protein S7 is a highly conserved gene in \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes, its expression levels are stable across different conditions and tissues, making it a reliable internal control for qPCR experiments [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. The qPCR reaction mixture consisted of 11\u0026micro;l reaction volume containing 0.5\u0026micro;l of 5pmol/\u0026micro;l reverse and forward primers, 2\u0026micro;l HOT FIREPol\u0026reg; EvaGreen\u0026reg; 416 HRM no ROX Mix Solis qPCR Master mix (Solis Biodyne, Estonia), 6\u0026micro;l of nuclease-free PCR water and 2\u0026micro;l of DNA template. The amplification was achieved under the following conditions: initial denaturation at 95\u0026deg;C for 15 min, denaturation at 95\u0026deg;C for 1 minute for 35 cycles, annealing at 62\u0026deg;C for 60 s, and a further extension for 45 s at 72\u0026deg;C. The PCR was carried out in a proflex cycler, and the qPCR was carried out in a MIC qPCR cycler (BioMolecular Systems, Australia). The MB18SF/MB18SR primers were used to confirm samples with the characteristic \u003cem\u003eMicrosporidia MB\u003c/em\u003e melt curve [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e1.4 ) \u003cb\u003eStatistical analysis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe analysed the pupation rate and age at death using Mixed-Effects Cox Models and the R \u0026ldquo;coxme\u0026rdquo; package [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The mean development time for the pupated larvae was analysed using the linear mixed-effects model using the \u0026ldquo;lme4\u0026rdquo; package. We analysed the infection rate and \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity using binomial and gaussian logistic mixed-effect model (GLMMs) and glmmTMB package. In all models, the temperature treatments, the G\u003csub\u003e0\u003c/sub\u003e female \u003cem\u003eAn. arabiensis\u003c/em\u003e' infection status, and their interactions were included as fixed terms, and the time of capture in the field was included as a random effect. In addition, the development time model also looked at the interaction between temperature treatments and infection status in offspring (\u003cem\u003eMicrosporidia MB\u003c/em\u003e negative offspring coming from un-infected colonized female \u003cem\u003eAn. arabiensis\u003c/em\u003e, \u003cem\u003eMicrosporidia MB\u003c/em\u003e positive offspring coming from field-collected infected G\u003csub\u003e0\u003c/sub\u003e female \u003cem\u003eAn. arabiensis\u003c/em\u003e and \u003cem\u003eMicrosporidia MB\u003c/em\u003e negative coming from field collected infected G\u003csub\u003e0\u003c/sub\u003e female \u003cem\u003eAn. arabiensis\u003c/em\u003e). Individuals that pupated were excluded from the age-at-death analysis. Individuals who died were excluded from the development time and infection status analysis. The \u003cem\u003eMicrosporidia MB\u003c/em\u003e intensity analysis (log transformed for better data visualisation) excluded uninfected pupae, and we used temperature treatments and transmission groups (0\u0026ndash;33%, 33\u0026ndash;66%, or 66\u0026ndash;99% transmission from mother to offspring) as interaction terms in the model. We used the Tukey post-hoc test and \u0026ldquo;means\u0026rdquo; function to perform multiple comparisons among the infection status and temperature treatments [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Statistical analysis was performed using R statistical software version 4.1.2 and R Studio [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003e2) Modelling the\u003c/b\u003e \u003cb\u003eMicrosporidia MB\u003c/b\u003e \u003cb\u003edissemination potential\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAfter obtaining experimental data on infection rates, development, and survival, we used these parameters to develop a mathematical model predicting \u003cem\u003eMicrosporidia MB\u003c/em\u003e dissemination in \u003cem\u003eAnopheles arabiensis\u003c/em\u003e populations under different temperature conditions. To express the probability that an L1 offspring coming from MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e is infected, survives to age \u003cem\u003ex\u003c/em\u003e, and pupates at age \u003cem\u003ex\u003c/em\u003e given temperature \u003cem\u003eT\u003c/em\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:,\\:\\)\u003c/span\u003e\u003c/span\u003ewe combined the conditional probabilities:\u003c/p\u003e \u003cp\u003e \u003cem\u003eP\u003c/em\u003e(infected \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\cap\\:\\)\u003c/span\u003e\u003c/span\u003e survives to age x \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\cap\\:\\)\u003c/span\u003e\u003c/span\u003e pupates at \u003cem\u003ex| T\u003c/em\u003e)\u0026thinsp;=\u0026thinsp;P(infected| \u003cem\u003eT)\u003c/em\u003e. \u003cem\u003eP\u003c/em\u003e (survives to age \u003cem\u003ex\u003c/em\u003e |infected, \u003cem\u003eT). P\u003c/em\u003e (pupates at \u003cem\u003ex\u003c/em\u003e| infected, \u003cem\u003eT\u003c/em\u003e).\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:P\\left(infected\\right|\\:T)=\\frac{\\text{N}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r}\\:\\text{o}\\text{f}\\:\\text{i}\\text{n}\\text{f}\\text{e}\\text{c}\\text{t}\\text{e}\\text{d}\\:\\text{l}\\text{a}\\text{r}\\text{v}\\text{a}\\text{e}\\:\\text{a}\\text{t}\\:\\text{t}\\text{e}\\text{m}\\text{p}\\text{e}\\text{r}\\text{a}\\text{t}\\text{u}\\text{r}\\text{e}\\:T\\:}{\\text{T}\\text{o}\\text{t}\\text{a}\\text{l}\\:\\text{n}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r}\\:\\text{o}\\text{f}\\:\\text{l}\\text{a}\\text{r}\\text{v}\\text{a}\\text{e}\\:\\text{a}\\text{t}\\:\\text{t}\\text{e}\\text{m}\\text{p}\\text{e}\\text{r}\\text{a}\\text{t}\\text{u}\\text{r}\\text{e}\\:T}$$\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Equb\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e\n$$\\:P\\left(survives\\:to\\:age\\:x\\:\\right|infected,\\:T)=\\frac{\\text{N}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r}\\:\\text{o}\\text{f}\\:\\text{i}\\text{n}\\text{f}\\text{e}\\text{c}\\text{t}\\text{e}\\text{d}\\:\\text{l}\\text{a}\\text{r}\\text{v}\\text{a}\\text{e}\\:\\text{t}\\text{h}\\text{a}\\text{t}\\:\\text{s}\\text{u}\\text{r}\\text{v}\\text{i}\\text{v}\\text{e}\\:\\text{t}\\text{o}\\:\\text{a}\\text{g}\\text{e}\\:\\text{x}\\:\\text{a}\\text{t}\\:\\text{t}\\text{e}\\text{m}\\text{p}\\text{e}\\text{r}\\text{a}\\text{t}\\text{u}\\text{r}\\text{e}\\:T\\:}{\\text{T}\\text{o}\\text{t}\\text{a}\\text{l}\\:\\text{n}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r}\\:\\text{o}\\text{f}\\:\\text{l}\\text{a}\\text{r}\\text{v}\\text{a}\\text{e}\\:\\text{a}\\text{t}\\:\\text{t}\\text{e}\\text{m}\\text{p}\\text{e}\\text{r}\\text{a}\\text{t}\\text{u}\\text{r}\\text{e}\\:T}$$\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Equc\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equc\" name=\"EquationSource\"\u003e\n$$\\:P\\left(pupates\\:at\\:x\\right|\\:infected,\\:T)=\\frac{\\text{N}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r}\\:\\text{o}\\text{f}\\:\\text{i}\\text{n}\\text{f}\\text{e}\\text{c}\\text{t}\\text{e}\\text{d}\\:\\text{l}\\text{a}\\text{r}\\text{v}\\text{a}\\text{e}\\:\\text{t}\\text{h}\\text{a}\\text{t}\\:\\text{p}\\text{u}\\text{p}\\text{a}\\text{t}\\text{e}\\:\\text{t}\\text{o}\\:\\text{a}\\text{g}\\text{e}\\:\\text{x}\\:\\text{a}\\text{t}\\:\\text{t}\\text{e}\\text{m}\\text{p}\\text{e}\\text{r}\\text{a}\\text{t}\\text{u}\\text{r}\\text{e}\\:T\\:}{\\text{T}\\text{o}\\text{t}\\text{a}\\text{l}\\:\\text{n}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r}\\:\\text{o}\\text{f}\\:\\text{l}\\text{a}\\text{r}\\text{v}\\text{a}\\text{e}\\:\\text{t}\\text{h}\\text{a}\\text{t}\\:\\text{s}\\text{u}\\text{r}\\text{v}\\text{i}\\text{v}\\text{e}\\:\\text{t}\\text{o}\\:\\text{a}\\text{g}\\text{e}\\:\\text{x}\\:\\text{a}\\text{t}\\:\\text{t}\\text{e}\\text{m}\\text{p}\\text{e}\\text{r}\\text{a}\\text{t}\\text{u}\\text{r}\\text{e}\\:T}$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eUsing the Gaussian function, the probability is given by:\u003cdiv id=\"Equd\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equd\" name=\"EquationSource\"\u003e\n$$\\:\\mathbb{P}\\left(\\text{T},\\text{x}\\right)=P(infected\\:\\:\\cap\\:\\:survives\\:to\\:age\\:x\\:\\cap\\:\\:pupates\\:at\\:\\:x|\\:T)={Ae}^{-\\frac{{\\left(x-\\mu\\:\\right)}^{2}}{2{\\sigma\\:}^{2}}},\\:\\:$$\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Eque\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Eque\" name=\"EquationSource\"\u003e\n$$\\:0\u0026lt;x\u0026lt;\\infty\\:$$\u003c/div\u003e\u003c/div\u003e.\u003c/p\u003e \u003cp\u003eThis formula considers the conditional dependencies based on infection status and temperature, providing a logical path to estimate the combined probability.\u003c/p\u003e \u003cp\u003eA continuous logistic model was chosen to provide a smooth and accurate representation of mosquito population growth, reflecting natural, gradual changes without the constraints of fixed time intervals required by discrete models. This continuous approach allows precise population estimates at any point in time, making it ideal for understanding temporal growth rates and incorporating stochastic variability to reflect environmental influences on fecundity.. The logistic growth equation:\u003c/p\u003e \u003cp\u003e \u003cspan class=\"InlineEquation\"\u003e \u003cspan class=\"mathinline\"\u003e\\(\\:\\)\u003c/span\u003e \u003c/span\u003e \u003cspan class=\"InlineEquation\"\u003e \u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{d\\text{N}\\left(\\text{t}\\right)}{d\\text{t}}=\\text{F}.\\text{r}.\\mathbb{P}\\left(\\text{T},\\text{x}\\right).\\text{N}\\left(\\text{t}\\right)\\left(1-\\frac{\\text{N}\\left(\\text{t}\\right)}{K}\\right)\\)\u003c/span\u003e \u003c/span\u003e \u003c/p\u003e \u003cp\u003ewas used to model the population growth of infected individuals, where \u003cem\u003eN(t)\u003c/em\u003e is the number of MB\u0026thinsp;+\u0026thinsp;individuals at time \u003cem\u003et, F\u003c/em\u003e represents the fecundity, \u003cem\u003er\u003c/em\u003e the sex ratio, \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\mathbb{P}\\left(T,x\\right)\\)\u003c/span\u003e\u003c/span\u003e the probability of infection, survival, and pupation under temperature \u003cem\u003eT\u003c/em\u003e, and \u003cem\u003eK\u003c/em\u003e the carrying capacity (66,67). The carrying capacity was set to 1000 to simulate real-world limitations such as resource and space constraints, establishing a stable population maximum that aligns with natural conditions. Additionally, targeting a population of 1000 MB\u0026thinsp;+\u0026thinsp;offspring provides a measurable endpoint for assessing the spread \u003cem\u003eof Microsporidia MB\u003c/em\u003e within mosquito populations. The solution to this equation,\u003cdiv id=\"Equf\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equf\" name=\"EquationSource\"\u003e\n$$\\:\\text{N}\\left(\\text{t}\\right)=\\frac{K}{1+\\left(\\frac{K-{\\text{N}}_{0}}{{\\text{N}}_{0}}\\right){\\text{e}}^{-\\text{F}.\\text{r}.\\mathbb{P}\\left(\\text{T},\\text{x}\\right).t}}$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eenabled us to estimate the rate at which the population of MB\u0026thinsp;+\u0026thinsp;offspring increases from an initial population of 10 MB\u0026thinsp;+\u0026thinsp;female \u003cem\u003eAn. arabiensis\u003c/em\u003e, with the goal of reaching a target population of 1000 MB\u0026thinsp;+\u0026thinsp;individuals.\u003c/p\u003e \u003cp\u003eIn our deterministic simulation, parameters such as: \u003cem\u003eF\u003c/em\u003e (fecundity\u003cem\u003e), r\u003c/em\u003e (sex ratio), \u003cem\u003eK\u003c/em\u003e (carrying capacity), and \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:{N}_{0}\\)\u003c/span\u003e\u003c/span\u003e (initial population) remained constant. Fecundity was set at three fixed rates (33, 66, or 99 viable eggs per female \u003cem\u003eAn. arabiensis\u003c/em\u003e) based on observed averages, providing a baseline for population growth under stable conditions. The sex ratio male: female was considered to be 1:1. Details of the stochastic simulation are provided in the supplementary material.\u003c/p\u003e \u003cp\u003eTo implement this methodology, we used Python for all data processing, simulations, and statistical computations. Python\u0026rsquo;s libraries, including \u003cem\u003enumpy\u003c/em\u003e for numerical operations, \u003cem\u003escipy\u003c/em\u003e for probability computations and fitting, and \u003cem\u003ematplotlib\u003c/em\u003e for visualization, were integral to generating plots, calculating probabilities, and fitting model parameters.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll datasets generated, used and analysed in this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge the Insectary team led by Milca Gitau, Jeniffer Thiong’o and Peris Wambui for provision of larvae rearing materials and assistance in the rearing process. The field team (Robison Kisero and Gerald Ronoh) for assistance during field collection of gravid female mosquitoes. The project administrator Faith Kyengo for facilitating all the project activities.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Open Philanthropy (SYMBIOVECTOR), the Bill and Melinda Gates Foundation (INV0225840), Children’s Investment Fund Foundation (SMBV-FFT). International Centre of Insect Physiology and Ecology (ICIPE) also receives funding and support from The Swedish International Development Cooperation Agency (Sida); the Swiss Agency for Development and Cooperation (SDC); the Australian Centre for International Agricultural Research\u0026nbsp;(ACIAR); the Norwegian Agency for Development Cooperation (Norad); the German Federal Ministry for Economic Cooperation and Development (BMZ); and the Government of the Republic of Kenya. The views expressed herein do not necessarily reflect the official opinion of the donors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFGO: Conceptualization, Data curation, Methodology and Investigation, Validation and Visualisation of results, Writing of the original draft, review and editing\u0026nbsp;∣\u0026nbsp;PB:\u0026nbsp;Conceptualization, Supervision, Formal analysis, Validation and Visualization of results, Writing of the original draft, review and editing \u0026nbsp;∣\u0026nbsp;ASB:\u0026nbsp;Formal analysis, Validation and Visualization of results, Writing of the original draft, review and editing\u0026nbsp;∣\u0026nbsp;EEM: Data curation, Methodology, Investigation\u0026nbsp;∣\u0026nbsp;TOO: Methodology, Investigation, Supervision, review and editing∣\u0026nbsp;AWW: Investigation, Data curation, Methodology\u0026nbsp;∣ \u0026nbsp;SMO: Investigation, Data curation, Methodology\u0026nbsp;∣\u0026nbsp;CNK: Investigation, Data collection, Methodology\u0026nbsp;∣\u0026nbsp; SBM: Formal analysis, Validation and Visualization of results, Writing of the original draft, review and editing∣\u0026nbsp;ANK: Conceptualization, Supervision\u0026nbsp;∣\u0026nbsp;JKH: Conceptualization, Methodology and Investigation, Supervision, Funding acquisition, \u0026nbsp;Resources, Writing of the original draft, review and editing.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFilho, W. L., May, J., May, M. \u0026amp; Nagy, G. J. Climate change and malaria: some recent trends of malaria incidence rates and average annual temperature in selected sub-Saharan African countries from 2000 to 2018. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-023-04682-4\u003c/span\u003e\u003cspan address=\"10.1186/s12936-023-04682-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. World malaria report \u003cem\u003e2022\u003c/em\u003e. (2022)., December 8 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003c/span\u003e\u003cspan address=\"http://www.who.int\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. https://www.who.int/publications/i/item/9789240064898\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, C. S., Zhang, W., Peng, Y., Zhao, F. \u0026amp; al Climate warming promotes pesticide resistance through expanding overwintering range of a global pest. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-25505-7\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-25505-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. \u003cem\u003eWHO malaria policy advisory group (MPAG) meeting report, 18\u0026ndash;20 April 2023\u003c/em\u003e (World Health Organization, 2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarreaux, A. M. G., Barreaux, P., Thievent, K. \u0026amp; Koella, J. C. Larval environment influences vector competence of the malaria mosquito. \u003cem\u003ePubMed\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 8\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5281/zenodo.10798340\u003c/span\u003e\u003cspan address=\"10.5281/zenodo.10798340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNattoh, G., Maina, T., Makhulu, E. E. \u0026amp; Mbaisi, L. and al. Horizontal transmission of the symbiont \u003cem\u003eMicrosporidia MB\u003c/em\u003e in \u003cem\u003eAnopheles arabiensis\u003c/em\u003e. Frontiers in microbiology, \u003cem\u003e12\u003c/em\u003e. (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2021.647183\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2021.647183\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerren, J. K., Mbaisi, L., Mararo, E. \u0026amp; al A microsporidian impairs \u003cem\u003ePlasmodium falciparum\u003c/em\u003e transmission in \u003cem\u003eAnopheles arabiensis\u003c/em\u003e mosquitoes. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-020-16121-y\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-16121-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArtur Trzebny, O. \u0026amp; Miroslawa Dabert. High temperatures and low humidity promote the occurrence of \u003cem\u003emicrosporidians\u003c/em\u003e (\u003cem\u003eMicrosporidia\u003c/em\u003e) in mosquitoes (\u003cem\u003eCulicidae\u003c/em\u003e). \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-024-06254-0\u003c/span\u003e\u003cspan address=\"10.1186/s13071-024-06254-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCharl\u0026egrave;ne, N. T., Mfangnia, Henri, B., Herren, J. \u0026amp; Tsanou, \u0026amp; Mathematical modelling of the interactive dynamics of wild and \u003cem\u003eMicrosporidia MB\u003c/em\u003e-infected mosquitoes. \u003cem\u003eMath. Biosci. Eng.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (8), 15167\u0026ndash;15200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3934/mbe.2023679\u003c/span\u003e\u003cspan address=\"10.3934/mbe.2023679\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe, Y. H., Sgr\u0026ograve;, C. M., Dong, Y., McGraw, E. A. \u0026amp; Carrasco, A. M. The Effect of Temperature on \u003cem\u003eWolbachia\u003c/em\u003e-Mediated Dengue Virus Blocking in \u003cem\u003eAedes aegypti\u003c/em\u003e. \u003cem\u003eAm. J. Trop. Med. Hyg.\u003c/em\u003e \u003cb\u003e94\u003c/b\u003e (4), 812\u0026ndash;819. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4269/ajtmh.15-0801\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.15-0801\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGavotte, L., Mercer, D. R., Stoeckle, J. J. \u0026amp; Dobson, S. L. Costs and benefits of \u003cem\u003eWolbachia\u003c/em\u003e infection in immature \u003cem\u003eAedes albopictus\u003c/em\u003e depend upon sex and competition level. \u003cem\u003eJ. Invertebr. Pathol.\u003c/em\u003e \u003cb\u003e105\u003c/b\u003e (3), 341\u0026ndash;346. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jip.2010.08.005\u003c/span\u003e\u003cspan address=\"10.1016/j.jip.2010.08.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWillis, A. R. \u0026amp; Reinke, A. W. Factors that determine \u003cem\u003eMicrosporidia\u003c/em\u003e infection and host specificity. \u003cem\u003eExperientia Suppl.\u003c/em\u003e 91\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-93306-7_4\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-93306-7_4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChakrabarti, S. B. Influence of temperature and relative humidity in infection of \u003cem\u003eNosema bombycis\u003c/em\u003e (\u003cem\u003eMicrosporidia: Nosematidae\u003c/em\u003e) and cross-infection of \u003cem\u003eN. mylitta\u003c/em\u003e on growth and development of \u003cem\u003eMulberry silkworm, Bombyx mori\u003c/em\u003e. \u003cem\u003eInt. J. Industrial Entomol. Biomaterials\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e (2), 173\u0026ndash;180 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://koreascience.kr/article/JAKO200811237154541.page\u003c/span\u003e\u003cspan address=\"https://koreascience.kr/article/JAKO200811237154541.page\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCali, A. \u0026amp; Takvorian, P. M. Developmental morphology and life cycles of the \u003cem\u003eMicrosporidia\u003c/em\u003e. 71\u0026ndash;133. (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/9781118395264.ch2\u003c/span\u003e\u003cspan address=\"10.1002/9781118395264.ch2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandrasegaran, K., Lahond\u0026egrave;re, C., Escobar, L. E. \u0026amp; Vinauger, C. Linking mosquito ecology, traits, behavior, and disease transmission. \u003cem\u003eTrends Parasitol.\u003c/em\u003e \u003cb\u003e36\u003c/b\u003e (4), 393\u0026ndash;403. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pt.2020.02.001\u003c/span\u003e\u003cspan address=\"10.1016/j.pt.2020.02.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReinhold, J., Lazzari, C. \u0026amp; Lahond\u0026egrave;re, C. Effects of the environmental temperature on \u003cem\u003eAedes aegypti\u003c/em\u003e and \u003cem\u003eAedes albopictus\u003c/em\u003e mosquitoes: A review. \u003cem\u003eInsects\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (4), 158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/insects9040158\u003c/span\u003e\u003cspan address=\"10.3390/insects9040158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaaijmans, K. P. \u0026amp; Thomas, M. B. The influence of mosquito resting behaviour and associated microclimate for malaria risk. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-10-183\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-10-183\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin, L. E. \u0026amp; Hillyer, J. F. Higher temperature accelerates the aging-dependent weakening of the melanization immune response in mosquitoes. \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.ppat.1011935\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1011935\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMancini, M. C., Ant, T. H. \u0026amp; Herd, C. S. and al. High temperature cycles result in maternal transmission and \u003cem\u003edengue\u003c/em\u003e infection differences between \u003cem\u003eWolbachia\u003c/em\u003e strains in \u003cem\u003eAedes aegypti\u003c/em\u003e. (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2020.11.25.397604\u003c/span\u003e\u003cspan address=\"10.1101/2020.11.25.397604\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoller-Jacobs, L. L., Murdock, C. C. \u0026amp; Thomas, M. B. Capacity of mosquitoes to transmit malaria depends on larval environment. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-014-0593-4\u003c/span\u003e\u003cspan address=\"10.1186/s13071-014-0593-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014a).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoller-Jacobs, L. L., Murdock, C. C. \u0026amp; Thomas, M. B. Capacity of mosquitoes to transmit malaria depends on larval environment. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-014-0593-4\u003c/span\u003e\u003cspan address=\"10.1186/s13071-014-0593-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014b).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarreaux, A. M. G., Stone, C. M. \u0026amp; Barreaux, P. and al. The relationship between size and longevity of the malaria vector \u003cem\u003eAnopheles gambiae (s.s.)\u003c/em\u003e depends on the larval environment. Parasites \u0026amp; Vectors, \u003cem\u003e11\u003c/em\u003e(1). (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-018-3058-3\u003c/span\u003e\u003cspan address=\"10.1186/s13071-018-3058-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaaijmans, K. P., Blanford, S., Chan, B. H. K. \u0026amp; al Warmer temperatures reduce the vectorial capacity of malaria mosquitoes. \u003cem\u003eBiol. Lett.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (3), 465\u0026ndash;468. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rsbl.2011.1075\u003c/span\u003e\u003cspan address=\"10.1098/rsbl.2011.1075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGimonneau, G., Bouyer, J., Morand, S., Besansky, N. J. \u0026amp; al A behavioral mechanism underlying ecological divergence in the malaria mosquito \u003cem\u003eAnopheles gambiae\u003c/em\u003e. \u003cem\u003eBehav. Ecol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e (5), 1087\u0026ndash;1092. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/beheco/arq114\u003c/span\u003e\u003cspan address=\"10.1093/beheco/arq114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKikuchi, Y., Tada, A., Musolin, D. L. \u0026amp; al Collapse of insect gut symbiosis under simulated climate change. \u003cem\u003emBio\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e (5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mbio.01578-16\u003c/span\u003e\u003cspan address=\"10.1128/mbio.01578-16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakhulu, E. E., Onchuru, T. O., Gichuhi, J. \u0026amp; Otieno and al. Localization and tissue tropism of the symbiont \u003cem\u003eMicrosporidia MB\u003c/em\u003e in the germ line and somatic tissues of \u003cem\u003eAnopheles arabiensis\u003c/em\u003e. mBio. (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mbio.02192-23\u003c/span\u003e\u003cspan address=\"10.1128/mbio.02192-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, J., Walker, E. D., Otienoburu, P. \u0026amp; al Laboratory tests of oviposition by the african malaria mosquito, \u003cem\u003eAnopheles gambiae\u003c/em\u003e, on dark soil as influenced by presence or absence of vegetation. \u003cem\u003eMalar. J.\u003c/em\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-5-88\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-5-88\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006). 5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCiota, A. T., Matacchiero, A. C., Kilpatrick, A. M. \u0026amp; al The Effect of temperature on life history traits of \u003cem\u003eCulex\u003c/em\u003e mosquitoes. \u003cem\u003eJ. Med. Entomol.\u003c/em\u003e \u003cb\u003e51\u003c/b\u003e (1), 55\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1603/me13003\u003c/span\u003e\u003cspan address=\"10.1603/me13003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChristiansen-Jucht, C. D., Parham, P. E., Saddler, A. \u0026amp; al Larval and adult environmental temperatures influence the adult reproductive traits of \u003cem\u003eAnopheles\u003c/em\u003e gambiae s.s. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-015-1053-5\u003c/span\u003e\u003cspan address=\"10.1186/s13071-015-1053-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoanyah, G. Y., Koekemoer, L. L., Herren, J. K. \u0026amp; al Effect of \u003cem\u003eMicrosporidia MB\u003c/em\u003e infection on the development and fitness of \u003cem\u003eAnopheles arabiensis\u003c/em\u003e under different diet regimes. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-024-06365-8\u003c/span\u003e\u003cspan address=\"10.1186/s13071-024-06365-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNattoh, G. O., Makhulu, E. E. O., Mbaisi, L. A. \u0026amp; al \u003cem\u003eMicrosporidia MB\u003c/em\u003e in the primary malaria vector \u003cem\u003eAnopheles gambiae sensu stricto\u003c/em\u003e is avirulent and undergoes maternal and horizontal transmission. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13071-023-05933-8\u003c/span\u003e\u003cspan address=\"10.1186/s13071-023-05933-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrunov, A. A., Ilinskii, Y. Y., Zakharov, I. K. \u0026amp; al Effect of high temperature on survival of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e infected with pathogenic strain of \u003cem\u003eWolbachia\u003c/em\u003e bacteria. \u003cem\u003eRussian J. genetics: Appl. Res.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e (6), 435\u0026ndash;443. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/s2079059713060099\u003c/span\u003e\u003cspan address=\"10.1134/s2079059713060099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReynolds, K. T., Thomson, L. J. \u0026amp; Hoffmann, A. A. The effects of host age, host nuclear background and temperature on phenotypic effects of the virulent \u003cem\u003eWolbachia\u003c/em\u003e strain \u003cem\u003epopcorn\u003c/em\u003e in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. \u003cem\u003eGenetics\u003c/em\u003e \u003cb\u003e164\u003c/b\u003e (3), 1027\u0026ndash;1034. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/genetics/164.3.1027\u003c/span\u003e\u003cspan address=\"10.1093/genetics/164.3.1027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDionysopoulou, N. K., Papanastasiou, S. A., Kyritsis, G. A. \u0026amp; al Effect of host fruit, temperature and \u003cem\u003eWolbachia\u003c/em\u003e infection on survival and development of ceratitis capitata immature stages. \u003cem\u003ePLOS ONE\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e (3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0229727\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0229727\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUlrich, J. N., Beier, J. C., Devine, G. J. \u0026amp; al Heat Sensitivity of \u003cem\u003ewMel Wolbachia\u003c/em\u003e during \u003cem\u003eAedes aegypti\u003c/em\u003e Development. \u003cem\u003ePLoS Negl. Trop. Dis.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (7). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pntd.0004873\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0004873\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiwatanaratanabutr, I. \u0026amp; Kittayapong, P. Effects of crowding and temperature on \u003cem\u003eWolbachia\u003c/em\u003e infection density among life cycle stages of \u003cem\u003eAedes albopictus\u003c/em\u003e. \u003cem\u003eJ. Invertebr. Pathol.\u003c/em\u003e \u003cb\u003e102\u003c/b\u003e (3), 220\u0026ndash;224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jip.2009.08.009\u003c/span\u003e\u003cspan address=\"10.1016/j.jip.2009.08.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChrostek, E., Martins, N., Marialva, M. S. \u0026amp; Teixeira, L. \u003cem\u003eWolbachia\u003c/em\u003e -conferred antiviral protection is determined by developmental temperature. \u003cem\u003emBio\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mbio.02923-20\u003c/span\u003e\u003cspan address=\"10.1128/mbio.02923-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLau, M. J., Ross, P. A., Endersby-Harshman \u0026amp; al Impacts of low temperatures on \u003cem\u003eWolbachia\u003c/em\u003e (Rickettsiales: \u003cem\u003eRickettsiaceae\u003c/em\u003e)-Infected \u003cem\u003eAedes aegypti\u003c/em\u003e (Diptera: \u003cem\u003eCulicidae\u003c/em\u003e). \u003cem\u003eJ. Med. Entomol.\u003c/em\u003e \u003cb\u003e57\u003c/b\u003e (5), 1567\u0026ndash;1574. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jme/tjaa074\u003c/span\u003e\u003cspan address=\"10.1093/jme/tjaa074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZilio, G., Kaltz, O. \u0026amp; Koella, J. C. Resource availability for the mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e affects the transmission mode evolution of a microsporidian parasite. \u003cem\u003eEvol. Ecol.\u003c/em\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10682-022-10184-7\u003c/span\u003e\u003cspan address=\"10.1007/s10682-022-10184-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZilio, G., Thi\u0026eacute;vent, K. \u0026amp; Koella, J. C. Host genotype and environment affect the trade-off between horizontal and vertical transmission of the parasite Edhazardia aedis. \u003cem\u003eBMC Evol. Biol.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12862-018-1184-3\u003c/span\u003e\u003cspan address=\"10.1186/s12862-018-1184-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgyekum, T. P., Botwe, P. K., Arko-Mensah \u0026amp; al A Systematic review of the effects of temperature on \u003cem\u003eAnopheles\u003c/em\u003e mosquito development and survival: Implications for malaria control in a future warmer climate. \u003cem\u003eInt. J. Environ. Res. Public Health\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e (14), 7255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijerph18147255\u003c/span\u003e\u003cspan address=\"10.3390/ijerph18147255\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarrington, L. B., Armijos, M. V., Lambrechts, L. \u0026amp; al Effects of fluctuating daily temperatures at critical thermal extremes on \u003cem\u003eAedes aegypti\u003c/em\u003e life-history traits. \u003cem\u003ePLoS ONE\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e (3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0058824\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0058824\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyons, C. L., Coetzee, M., Terblanche, J. S. \u0026amp; Chown, S. L. Thermal limits of wild and laboratory strains of two African malaria vector species, \u003cem\u003eAnopheles arabiensis\u003c/em\u003e and \u003cem\u003eAnopheles funestus\u003c/em\u003e. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-11-226\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-11-226\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHector, T. E., Sgr\u0026ograve;, C. M. \u0026amp; Hall, M. D. Pathogen exposure disrupts an organism\u0026rsquo;s ability to cope with thermal stress. \u003cem\u003eGlob. Change Biol.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (11), 3893\u0026ndash;3905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/gcb.14713\u003c/span\u003e\u003cspan address=\"10.1111/gcb.14713\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHector, T. E., Hoang, K. L., Li, J. \u0026amp; al Symbiosis and host responses to heating. \u003cem\u003eTrends Ecol. Evol.\u003c/em\u003e \u003cb\u003e37\u003c/b\u003e (7), 611\u0026ndash;624. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tree.2022.03.011\u003c/span\u003e\u003cspan address=\"10.1016/j.tree.2022.03.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoss, P. A., Wiwatanaratanabutr, I., Axford, J. K. \u0026amp; al \u003cem\u003eWolbachia\u003c/em\u003e infections in \u003cem\u003eAedes aegypti\u003c/em\u003e differ markedly in their response to cyclical heat stress. \u003cem\u003ePLoS Pathog.\u003c/em\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.ppat.1006006\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1006006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017). 13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuno, N., Farjana, T., Uchida, Y. \u0026amp; al Effects of temperature and nutrition during the larval period on life history traits in an invasive malaria vector \u003cem\u003eAnopheles stephensi\u003c/em\u003e. \u003cem\u003eInsects\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e (6), 543. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/insects14060543\u003c/span\u003e\u003cspan address=\"10.3390/insects14060543\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAra\u0026uacute;jo, M., da-Silva, Gil, L. H. S., e-Silva, A. \u0026amp; de-Almeida Larval food quantity affects development time, survival and adult biological traits that influence the vectorial capacity of \u003cem\u003eAnopheles darlingi\u003c/em\u003e under laboratory conditions. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-11-261\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-11-261\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantolamazza, F., Mancini, E., Simard, F. \u0026amp; al Insertion polymorphisms of SINE200 retrotransposons within speciation islands of \u003cem\u003eAnopheles gambiae\u003c/em\u003e molecular forms. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1475-2875-7-163\u003c/span\u003e\u003cspan address=\"10.1186/1475-2875-7-163\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJan, Erhardt, E. B., Dodd, A. B., Nathaniel \u0026amp; al A cautionary tale on the effects of different covariance structures in linear mixed effects modelling of fMRI data. \u003cem\u003eHum. Brain. Mapp.\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e (7). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/hbm.26699\u003c/span\u003e\u003cspan address=\"10.1002/hbm.26699\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaketomi, N., Michimae, H. \u0026amp; Chang, Y. T. at al. meta.shrinkage: An R package for meta-analyses for simultaneously estimating individual means. Algorithms, \u003cem\u003e15\u003c/em\u003e(1), 26. (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/a15010026\u003c/span\u003e\u003cspan address=\"10.3390/a15010026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThulin, M. \u003cem\u003eModern statistics with R\u003c/em\u003e (CRC, 2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlunt, K. D., Oliver, S. V., Hunt, R. H. \u0026amp; Paaijmans, K. P. The impact of temperature on insecticide toxicity against the malaria vectors \u003cem\u003eAnopheles arabiensis\u003c/em\u003e and \u003cem\u003eAnopheles funestus\u003c/em\u003e. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-018-2250-4\u003c/span\u003e\u003cspan address=\"10.1186/s12936-018-2250-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakhulu, E. E. et al. Tsetse blood-meal sources, endosymbionts and \u003cem\u003etrypanosome\u003c/em\u003e-associations in the Maasai Mara National Reserve, a wildlife-human-livestock interface. \u003cem\u003ePLoS Negl. Trop. Dis.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (1), e0008267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pntd.0008267\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0008267\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdams, E. R., Hamilton, P. B., Malele, I. I. \u0026amp; Gibson, W. C. The identification, diversity and prevalence of \u003cem\u003etrypanosomes\u003c/em\u003e in field caught tsetse in Tanzania using \u003cem\u003eITS-1\u003c/em\u003e primers and fluorescent fragment length barcoding. \u003cem\u003eInfection, Genetics and Evolution\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(4), 439\u0026ndash;444. (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.meegid.2007.07.013\u003c/span\u003e\u003cspan address=\"10.1016/j.meegid.2007.07.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOliver, S. V. \u0026amp; Brooke, B. D. The effect of elevated temperatures on the life history and insecticide resistance phenotype of the major malaria vector \u003cem\u003eAnopheles arabiensis\u003c/em\u003e (Diptera: \u003cem\u003eCulicidae\u003c/em\u003e). \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-017-1720-4\u003c/span\u003e\u003cspan address=\"10.1186/s12936-017-1720-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas, M. B. \u0026amp; Read, A. F. The threat (or not) of insecticide resistance for malaria control. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e, \u003cem\u003e113\u003c/em\u003e(32), 8900\u0026ndash;8902. (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1609889113\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1609889113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoella, J. C., Saddler, A. \u0026amp; Karacs, T. P. S. Blocking the evolution of insecticide-resistant malaria vectors with a \u003cem\u003emicrosporidian\u003c/em\u003e. \u003cem\u003eEvol. Appl.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e (3), 283\u0026ndash;292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1752-4571.2011.00219.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1752-4571.2011.00219.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMack, L. K. \u0026amp; Attardo, G. M. Heat shock proteins, thermotolerance, and insecticide resistance in mosquitoes. \u003cem\u003eFront. Insect Sci.\u003c/em\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/finsc.2024.1309941\u003c/span\u003e\u003cspan address=\"10.3389/finsc.2024.1309941\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024). \u003cem\u003e4\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMamai, W. et al. Optimization of Mass-Rearing Methods for \u003cem\u003eAnopheles arabiensis\u003c/em\u003e Larval Stages: Effects of Rearing Water Temperature and Larval Density on Mosquito Life-History Traits. \u003cem\u003eJ. Econ. Entomol.\u003c/em\u003e \u003cb\u003e111\u003c/b\u003e (5), 2383\u0026ndash;2390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jee/toy213\u003c/span\u003e\u003cspan address=\"10.1093/jee/toy213\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyons, C. L., Coetzee, M. \u0026amp; Chown, S. L. Stable and fluctuating temperature effects on the development rate and survival of two malaria vectors, \u003cem\u003eAnopheles arabiensis\u003c/em\u003e and \u003cem\u003eAnopheles funestus\u003c/em\u003e. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1756-3305-6-104\u003c/span\u003e\u003cspan address=\"10.1186/1756-3305-6-104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOnchuru, T. O. et al. The Plasmodium transmission-blocking symbiont, \u003cem\u003eMicrosporidia MB\u003c/em\u003e, is vertically transmitted through \u003cem\u003eAnopheles arabiensis\u003c/em\u003e germline stem cells. \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (11), e1012340. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.ppat.1012340\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1012340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiew, J. W. K., Fong, M. Y. \u0026amp; Lau, Y. L. Quantitative real-time PCR analysis of \u003cem\u003eAnopheles dirus TEP1\u003c/em\u003e and \u003cem\u003eNOS\u003c/em\u003e during \u003cem\u003ePlasmodium berghei\u003c/em\u003e infection, using three reference genes. \u003cem\u003ePeerJ\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, e3577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7717/peerj.3577\u003c/span\u003e\u003cspan address=\"10.7717/peerj.3577\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkorli, J. et al. \u003cem\u003eMicrosporidia MB\u003c/em\u003e is found predominantly associated with \u003cem\u003eAnopheles gambiae s.s\u003c/em\u003e and \u003cem\u003eAnopheles coluzzii\u003c/em\u003e in Ghana. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1). (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-98268-2\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-98268-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAng\u0026rsquo;ang\u0026rsquo;o, L. M. et al. Draft genome of \u003cem\u003eMicrosporidia\u003c/em\u003e sp. MB\u0026mdash;a malaria-blocking microsporidian symbiont of the \u003cem\u003eAnopheles arabiensis\u003c/em\u003e. \u003cem\u003eMicrobiol. Resource Announcements\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e (4). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mra.00903-23\u003c/span\u003e\u003cspan address=\"10.1128/mra.00903-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite, M. T. et al. Modelling the impact of vector control interventions on \u003cem\u003eAnopheles gambiae\u003c/em\u003e population dynamics. \u003cem\u003eParasites Vectors\u003c/em\u003e. \u003cb\u003e4\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1756-3305-4-153\u003c/span\u003e\u003cspan address=\"10.1186/1756-3305-4-153\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbiodun, G. J., Maharaj, R., Witbooi, P. \u0026amp; Okosun, K. O. Modelling the influence of temperature and rainfall on the population dynamics \u003cem\u003eof Anopheles arabiensis\u003c/em\u003e. \u003cem\u003eMalar. J.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-016-1411-6\u003c/span\u003e\u003cspan address=\"10.1186/s12936-016-1411-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGillies, M. T. \u0026amp; Coetzee, M. A Supplement to the \u003cem\u003eAnophelinae\u003c/em\u003e of Africa South of the Sahara. \u003cem\u003ePubl S Afr. Inst. Med. Res.\u003c/em\u003e \u003cb\u003e55\u003c/b\u003e, 105\u0026ndash;106 (1987).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Microsporidia MB, malaria control, endosymbiosis, temperature, dissemination potential, computational biology","lastPublishedDoi":"10.21203/rs.3.rs-5654412/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5654412/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eMicrosporidia MB\u003c/em\u003e, a vertically transmitted endosymbiont of \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes, shows strong potential as a malaria control agent due to its ability to inhibit \u003cem\u003ePlasmodium\u003c/em\u003e development within the mosquito host. To optimize its deployment in malaria transmission reduction strategies, it is critical to understand how environmental factors, particularly temperature, affect its infection dynamics. In this study, we investigated the influence of four temperature regimes (22\u0026deg;C, 27\u0026deg;C, 32\u0026deg;C, and 37\u0026deg;C) on \u003cem\u003eMicrosporidia MB\u003c/em\u003e prevalence and infection intensity by rearing mosquito larvae under controlled laboratory conditions. Our results demonstrate that elevated temperatures, especially 32\u0026deg;C, significantly enhance both larval growth and \u003cem\u003eMicrosporidia MB\u003c/em\u003e infection rates. Population growth modeling further indicates that at 32\u0026deg;C, an infected mosquito population can reach 1,000 offspring within 15\u0026ndash;35 days\u0026mdash;representing a 4.7-, 1.3-, and 1.7-fold higher dissemination potential compared to 22\u0026deg;C, 27\u0026deg;C, and 37\u0026deg;C, respectively. Despite a higher mortality rate at 32\u0026deg;C (approximately 20% greater than at 27\u0026deg;C), this temperature emerged as the most favorable for mass-rearing \u003cem\u003eMicrosporidia MB\u003c/em\u003e-infected larvae. These findings offer the first insights into temperature-mediated dynamics of \u003cem\u003eMicrosporidia MB\u003c/em\u003e and support its potential for scalable implementation in malaria-endemic regions.\u003c/p\u003e","manuscriptTitle":"The dissemination potential of Microsporidia MB in Anopheles arabiensis mosquitoes is modulated by temperature","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-23 19:51:14","doi":"10.21203/rs.3.rs-5654412/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-12T02:10:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-09T07:21:25+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-29T14:06:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-29T07:04:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-26T07:46:10+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-22T03:57:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"60416523692475493579574386886166284077","date":"2025-04-21T11:20:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"246698170302562968832758586464713789179","date":"2025-04-21T07:17:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"156506519611263394901471466319987410733","date":"2025-04-19T16:43:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"305692802964671321350785670583201014893","date":"2025-04-19T11:59:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"259409966510225852342503781547854655794","date":"2025-04-19T06:45:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-19T01:45:57+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-18T06:29:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-04-07T16:21:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"154c6f6d-4f41-485d-9f58-f502c176076b","owner":[],"postedDate":"April 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":47591464,"name":"Biological sciences/Microbiology/Applied microbiology"},{"id":47591465,"name":"Physical sciences/Mathematics and computing/Computational science"}],"tags":[],"updatedAt":"2025-08-11T16:00:31+00:00","versionOfRecord":{"articleIdentity":"rs-5654412","link":"https://doi.org/10.1038/s41598-025-07414-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-08-07 15:57:18","publishedOnDateReadable":"August 7th, 2025"},"versionCreatedAt":"2025-04-23 19:51:14","video":"","vorDoi":"10.1038/s41598-025-07414-7","vorDoiUrl":"https://doi.org/10.1038/s41598-025-07414-7","workflowStages":[]},"version":"v1","identity":"rs-5654412","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5654412","identity":"rs-5654412","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}