Risks of Campylobacter jejuni and Campylobacter coli contamination in broiler's meat, table eggs, and the food environment in correlation to human enteritis. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Risks of Campylobacter jejuni and Campylobacter coli contamination in broiler's meat, table eggs, and the food environment in correlation to human enteritis. Tawfik Esmat Abdel-Hafeez Tawfik, Amany Abbass Yousif This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5598686/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Campylobacter in broiler meat presents a significant challenge to food safety. Human campylobacteriosis predominantly arises from multiple sources, with poultry serving as the most substantial contributor. The objective of this study was to ascertain the presence of Campylobacter contamination of retail broiler meat at various critical junctures, including slaughter, processing, food preparation, and potential cross-contamination events occurring in both slaughterhouses and restaurants, processed chicken products, table eggs, and stool samples from humans with enteritis. To fulfill this, samples were systemically collected to detect Campylobacter contamination during various stages of slaughter, processing, food preparation, and potential cross-contamination scenarios at slaughterhouses and restaurants. A total of 460 samples were procured, encompassing 120 samples of chicken meat, 100 table eggs, 120 samples of human stool, and 120 environmental food samples, all obtained from Sohag, Egypt. Each sample underwent bacteriological, biochemical analysis and multiplex PCR enabled the detection of the 23S rRNA, hip O , and gly A genes for the precise identification and differentiation of Campylobacter at the species level. The observed prevalence rates of Campylobacter in broiler meat, table eggs, environment, and human stool samples determined by multiplex PCR were 9.17, 2, 7.5, and 6%, respectively, with overall positive samples of 6.3% (28/460). 75% (21/28) of the isolates were Campylobacter jejuni , 25% (7/28) were Campylobacter coli , and 1 isolate had mixed contamination. Poultry fecal matter, broiler meat, and table eggs could be a high risk of C. jejuni and C. coli to humans, highlighting the need for targeted interventions in the poultry, and egg industry to mitigate the risk of Campylobacter infections. Improved food handling practices at restaurant and house kitchens are essential to reduce contamination. Broilers meat Campylobacter coli Campylobacter jejuni Environment Human enteritis Multiplex PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Campylobacteriosis represents a considerable global public health dilemma, ranking among the foremost causes of gastroenteritis on an international scale, and it has been recognized as the most frequently reported zoonotic disease in humans within the European Union (EU) since 2005, affecting millions of individuals (Kaakoush et al., 2015b; WHO,2020). In 2020, the confirmed cases of campylobacteriosis reached 120,946, with a 40.3 per 100,000 EU notification rate (EFSA-ECDC, 2021). Campylobacteriosis manifests sporadic cases of gastroenteritis or as minor outbreaks that typically develop after 24 to 72 hours as an incubation period. Enteritis generally presents with diarrhea, fever, abdominal discomfort, nausea, malaise, headaches, and cramps, which are self-limiting and resolve within 24–48 hours in most cases, however, a protracted course may occur (Fitzgerald, 2015). In instances of severe disease forms, dehydration, bacteremia, or sepsis symptoms resembling ulcerative colitis or acute appendicitis may occur. In the United States, approximately 1.5 million Campylobacter infections are reported annually, with 20–30% of these cases being associated with the consumption of poultry meat (CDC, 2018, 2019). Diarrheal illness may exhibit heightened severity in young children due to the vulnerabilities associated with their developing immune systems and exploratory behavior (Belina et al., 2024). Although it is infrequently fatal, 36% of persons afflicted with acute Campylobacteriosis are at risk of subsequent health complications including irritable bowel syndrome (IBS), within a timeframe of 1–2 years, with a likelihood of developing IBS estimated at 9–13% of C. jejuni infection (Pimentel et al., 2015; Geissler et al., 2017), reactive arthritis (2–5% of patients), and Guillain–Barré syndrome (0.1% of patients), often resulting in neuromuscular paralysis which may cause permanent nerve damage in some cases, (Scallan et al., 2015; CDC, 2018). Campylobacter exhibits a significant prevalence in retail chicken meat and is closely linked to cases of human campylobacteriosis. Chickens are consistently recognized as principal reservoirs of Campylobacter jejuni infections, representing an estimated 31–66% of clinical isolates in various research endeavors (Thépault et al., 2018). Chickens were identified as the predominant source of human campylobacteriosis in 45.8–65.4% of documented cases in Denmark, 68–72% in the United States, and over 80%in Australia (Pascoe, 2022; Brinch et al., 2023; McLure et al., 2023). In Japan, this trend mirrors that observed in other industrialized nations (Vetchapitak and Misawa, 2019). Raw or inadequate poultry meat and associated meat products are recognized as the primary contributors to Campylobacter jejuni/coli responsible for approximately one-fourth of total foodborne illness cases of campylobacteriosis (Clarke and Ajlouni, 2021). The gastrointestinal tract of chicken functions as a natural reservoir for Campylobacter , thereby facilitating its propagation throughout eggshells. Also, fecal leaks during evisceration, contact with contaminated equipment, and exposure to contaminated water substantially elevate the risk of contamination. For instance, the discharge of merely 5 mg of cecal matter during evisceration has been shown to augment Campylobacter loads by 0.6 log CFU in prechill rinses (EFSA-ECDC, 2021; Pascoe et al., 2023). Insufficient hygiene practices, such as inadequate handwashing and the utilization of contaminated cutting boards exacerbate the risk of Campylobacter transmission. Research has indicated that 63.1% of restaurants engage in at least one practice that may lead to potential cross-contamination, with only one out of the 23 assessed cutting boards being sufficiently sanitized with disinfectant. Scrubbing hands for less than five seconds was correlated with a notable increase in the likelihood of contamination (Lai et al., 2023; Kirchner et al., 2023). Improving hygiene practices, monitoring broiler processing facilities, and public education initiatives regarding appropriate food handling are essential measures for alleviating the public health consequences of Campylobacter infections (Kimiran, 2024). Furthermore, humans may get infected through contact with infected individuals, animals, contaminated environments, or the fecal-oral route, underscoring the critical importance of food safety and hygiene in the prevention of campylobacteriosis (McLure et al., 2023; Nowak et al., 2024). Campylobacter ranks among the four principal etiological agents of gastroenteritis globally and has increased prevalence in both developed and developing nations over the past decade. The overwhelming majority of reported Campylobacter infections are attributed to C. jejuni and, to a lesser degree, C. coli (Costa and Iraola, 2019). Consequently, the primary aims of this investigation were to scrutinize the incidence of Campylobacter in broiler meat and table eggs, the environmental context surrounding meat processing in small-scale slaughterhouses, and restaurants, as well as its correlation with Campylobacter infection in humans. Materials and methods 2.1. Sample collection A total of 440 specimens were analyzed, comprising 120 specimens derived from broiler meat and chicken meat products, 100 table eggs, and 100 human fecal samples obtained from healthcare facilities and clinical laboratories, along with 120 specimens sourced from poultry processing environments, specifically poultry slaughtershops, and restaurant kitchens. Each specimen was collected in a sterile polyethylene bag and subsequently transported to the laboratory utilizing a sampling box equipped with ice pads, ensuring minimal delay (Donnison, 2003). 2.2. Sample Preparation Twenty-five grams of each chicken meat specimen was aseptically transferred to a sterile stomacher bag containing 225 ml of Bolton broth supplemented with 5% Laked horse blood (Oxoid, SR048) and modified Bolton broth selective supplement (Oxoid, SR0183E), followed by homogenization for a duration of 1 minute (Hunt and Abeyta, 1998). The preparation of egg shells and their contents was conducted following the methodology established by Jones and Musgrove (2007). Pooled samples (2 eggs from each package). Swabs from human fecal matter and poultry droppings were collected in sterile containers containing 9 ml of Bolton broth with additional supplementation. Surface swabs were procured utilizing a 25 cm² sterile metal template. Water samples were gathered in clean, sterile 500 ml bottles and subsequently concentrated through centrifugation at 20,000 rpm for 10 minutes. The resultant pellet was resuspended in test tubes containing 9 ml of Bolton broth supplemented with water (Fricker and Park, 1989). 2.2. Isolation and Identification The specimens underwent aseptic incubation for 4 hours at 37°C to facilitate the resuscitation of stressed organisms, followed by subsequent incubation at 42°C for a period ranging from 20 to 44 hours under micro-aerophilic conditions achieved using a gas generating kit (Oxoid CampyGen, CN0035A). Additionally, each environmental swab was immersed in sterile tubes containing 10 ml of Bolton broth (Hunt and Abeyta, 1998). A loopful (10 µl) was extracted from each Bolton broth enrichment culture after 48 hours and streaked onto Modified Charcoal Cefoperazone Deoxycholate Agar (mCCDA) (Oxoid, CM0739), a selective solid medium with appropriate selective supplements (Oxoid, SR0155E). The culture plates were incubated microaerobically within a controlled microaerobic environment utilizing an anaerobic jar and Campylobacter gas-generating kits at 42°C for 48 hours (Bolton et al., 1984). Direct inoculation of human stool and poultry fecal swabs onto mCCDA was performed (Maher et al., 2003). Positive colonies exhibited characteristics of being grayish-white, convex, and moist. The confirmation of positive strains was accomplished through Gram staining, motility assessment, oxidase tests (Oxoid, MB0266A), catalase reaction, Hippurate hydrolysis (Sodium Hippurate, Sigma, H9380; Ninhydrin, Merck, 6762), H2S reaction on triple sugar iron agar slants (Oxoid, CM0277), susceptibility testing to nalidixic acid (30 µg) and cephalothin (30 µg) on Muller Hinton agar (Oxoid, CM0337) (WOAH, 2005; ISO, 2006). 2.3. Molecular Characterization Bacterial DNA was extracted via a Wizard® Genomic DNA Purification Kit (Promega, A1120). A five µl aliquot was employed as a template for PCR amplification (Shah et al., 2009). Primer sequences were procured from Metabion (Germany), and were employed as forward and reverse primers for the amplification of 23S rRNA, hip O , and gly A genes for the identification of Campylobacter species (Table A). Multiplex PCR amplification for the 23S rRNA, hip O , and gly A genes of Campylobacter species. In each reaction tube 2.5 µl of Green Taq hot-start polymerase, 1 µl of each primer, and 0.5 µl of DNA template were added, then nuclease-free water to a volume of 25 µl. A thermocycler (Takara, Code No. RR310A) was used with an initial denaturation step at 95°C for 6 minutes followed by 30 cycles (denaturation at 95°C for 30 seconds, annealing at 59°C for 30 seconds, and extension at 72°C for 30 seconds for species genes), ending with a final extension for 7 minutes at 72°C (Wang et al., 2002) (Table B). The amplified products were analyzed via 1.5% agarose gel electrophoresis (Sambrook et al., 1989), stained with ethidium bromide, and visualized on a UV transilluminator (Andrzejewska et al., 2011). Table A: Primer sequences of Campylobacter spp . according to Wang (2002) Target gene Primer Oligonucleotide sequence (5′→ 3′) Product size (bp) 23S F 23S rRNA (All Spp.) TATACCGGTAAGGAGTGCTGGAG 650 bp R ATCAATTAACCTTCGAGCACCG hip O F CJ ( C. jejuni ) ACTTCTTTATTGCTTGCTGC 323 bp R GCCACAACAAGTAAAGAAGC gly A F CC ( C. coli ) GTAAAACCAAAGCTTATCGTG 126 bp R TCCAGCAATGTGTGCAATG Table B: PCR Cycling conditions according to Wang et al. (2002) Step Temp. Time No. of cycles 1. Primary denaturation and activation of hot start green Taq DNA polymerase. 94˚C 6 min. 1 cycle 2. Cycling A. Secondary denaturation 95˚C 30 sec. 35 cycles B. Primer annealing 59˚C 30 sec. C. Extension 72˚C 30 sec. 3. Final extension 72˚C 7 min. 1 cycle Statistical analysis The data were statistically analyzed via SPSS version 22, and all significance levels were considered at P < 0.05. The associations between positive campylobacteriosis and the sources of the examined samples were calculated via Pearson’s chi-square test. The model was built in @Risk 7.5.2 (Palisade, Inc.) software. A Monte Carlo simulation (10,000 iterations) was used to estimate the probability of risks. Results Positive colonies displayed phenotypic traits consistent with a grayish-white coloration, convex morphology, and a moist texture. The organisms were identified as Gram-negative, spiral, S-shaped, and curved rod-shaped bacteria, exhibiting motility characteristic of corkscrew-like movement, with positive results for catalase and oxidase tests ( C. jejuni/C. coli ). Species were initially categorized based on their capacity to hydrolyze Hippurate, susceptibility to cephalothin and nalidixic acid, and H2S production as delineated by Rautelin et al. (1999) and Totten et al. (1987) (Fig. 1). Campylobacter was identified in chicken meat, table eggs, environment, and human fecal samples at prevalence rates of 20.83, 3, 28.33, and 23.33%, respectively. The findings indicated that the prevalence rates among chicken carcasses, breasts, and thighs were 40, 16.67, and 26.67%, respectively, whereas it was undetectable in processed chicken Luncheon and chicken nuggets. The prevalence rates in environmental samples were recorded as 46.67%, 16.67%, and 50% in slaughterhouses, restaurant swabs, and fecal samples, respectively, while tap water samples were found to be devoid of Campylobacter contamination (Table 1 ). The incidence of Campylobacter in humans suffering from diarrhea was found to be 46.67% (14/30) in children aged 6 months to 5 years, 33.33% (10/30) in those aged 6–15 years, and 13.33% (4/30) in those aged 16–35 years; however, no detection was reported in patients aged 36–60 years (Table 2 ). Campylobacter isolates were identified via multiplex PCR of the 23S rRNA gene in 9.17% (11/120), 2% (2/100), 7.5% (9/120), and 5% (6/120) of the chicken meat samples, eggs, environment, and human samples (Tables 3 , 4 and Figs. 2–4). Genetic analysis of positive isolates for the differentiation of Campylobacter species through detection of the hipO and glyA genes revealed that 4.57% (21/460) were C. jejuni [21/28, 75%], 1.74% (8/460) [7/28, 25%] were C. coli , and 1 sample was mixed contaminated with C. jejuni and C.coli. The odds ratio (OR) was 1.73 indicating that people are 1.73 times more likely to test positive for Campylobacter spp. if chicken samples were contaminated. The Pearson correlation coefficient (𝑟) was ≈ 0.852, indicating a strong positive correlation between C. jejuni and C. coli across the samples. In chicken meat, the OR was 1.071, and the Z-value for a 95% confidence interval is 1.96 ( Table 5 ). A Monte Carlo simulation for risk assessment with 10,000 iterations was used, mean, 95% confidence interval (CI). The probability of C. jejuni / C. coli being at a high-risk level in chicken meat was 74.51/ 49.28%. This indicates a high likelihood of contamination with C. jejuni and C. coli in chicken meat, making them significant risks for foodborne illness. The probability of C. jejuni and C. coli being at a high-risk level in environmental samples (e.g., food contact surfaces, etc.) was 49.22, and 15.72%, suggesting a moderate risk level concern in environmental settings. The probability of C. jejuni being at a high-risk level in human samples (e.g., from stool or clinical samples) was 15.38%, which is relatively low, C. coli (2.42%), which is quite low, indicating a very low risk of infection from C. coli in humans (Table 6 ). Table 1 Incidence of Campylobacter species in broiler meat, table eggs, and environmental samples via biochemical tests Samples Presumptive culture Biochemical identification Hippurate N Positive % Positive % Positive % Negative % Broiler meat Carcass 30 12 40.0 6 20 3 13.33 2 6.67 Breast 30 5 16.67 2 6.7 2 8.89 0 0 Thigh 30 8 26.67 4 10 4 15.56 2 0 Products 30 0 0 - - - - - - 120 25 20.83 12 10 9 7.5 4 3.33 Table egg Egg content 50 0 0 - - - - - - Eggshell 50 2 4 2 4 2 4 1 2 100 2 2 2 2 2 2 1 1 Environment Slaughter shops 30 14 46.67 7 23.3 7 23.3 0 0 Restaurant swabs 30 5 16.67 3 10 3 10 0 0 Fecal swabs 30 15 50 10 33.3 3 10 2 3.33 Water 30 0 0 - - - - - 120 34 28.33 20 16.67 13 10.83 2 1.67 -: not detected in culture and biochemical. Chi-square statistic (χ²): 7.51, the p-value (0.057) suggests no statistically significant difference in the distribution of positive Campylobacter across the different broiler meat sample types at the 0.05 significance level. Table 2: Incidence of Campylobacter species in human stool samples via biochemical tests Samples Presumptive culture Biochemical identification Hippurate Positive % Positive % Positive % Negative % Children's diarrhea 0.5 - 4 years 30 14 46.67 a 7 23.3 3 10 1 3.3 5 -15 years 30 10 33.33 a 5 16.7 1 6.67 1 3.3 16-35 years 30 4 13.33 b 2 6.7 - - - - 36-60 years 30 0 0 b - - - - - - 120 28 23.33 14 11.67 4 3.33 2 1.67 -: not detected in culture and biochemical. Different superscript letters indicate significant differences. There was a significant relationship [p-value=0.0053] between age group and presumptive positivity for Campylobacter . The incidence rates are not evenly distributed across age groups. Table 3: Prevalence of C. jejuni and C. coli in chicken meat, table eggs, and environmental samples determined via multiplex PCR Samples 23S rRNA C. jejuni C. coli No. % No % No. % Chicken meat Chicken carcass 30 5 16.67 3 10 2 6.67 Breast 30 2 6.67 2 6.67 0 0 Thigh 30 4 13.33 3 10 1 0 Products 30 - - - - - - 120 11 9.17 8 6.67 3 2.5 Table egg Egg content 50 0 0 - - - - Eggshell 50 2 4 2 4 1* 2 100 2 2 2 2 1* 1 Environmental sample Slaughter shop 30 3 10 3 10 0 0 Restaurant swabs 30 1 3.33 1 3.33 0 0 Cloacal swabs* 30 5 16.67 3 10 2 6.67 Water 30 - - - - - - 120 9 7.5 7 5.83 2 2.22 Total 340 22 6.47 17 5 6 1.76 -: not performed. There is no significant difference [p-value = 0.455] in the prevalence of Campylobacter spp. across different chicken meat samples (carcass, breast, thigh). *mixed C.jejuni & C.coli Table 4 Prevalence of C. jejuni and C. coli in human stool samples determined via multiplex PCR. Samples 23S rRNA C. jejuni C. coli No. % No % No. % Human 0.5–4 years 30 4 13.33 3 10 1 3.33 5–15 years 30 2 6.67 1 6.67 1 0 16–35 years 30 - - - - - - 36–60 years 30 - - - - - - 120 6 5 4 3.33 2 1.67 -: not detected in culture or biochemical. Table 5 Correlation of C. jejuni and C. coli from broiler meat, egg, and environment to human infection. Samples 23S rRNA C. jejuni C. coli mixed No. % No % No. % No. % OR [95% CI] Chicken meat 120 11 9.17 8 6.67 3 1.67 0 0 1.071 [0.15:7.62] Table egg 100 2 2 2 2 1 1 1 1 0.5 [0.067:3.764) Environment 120 9 7.5 7 4 2 2 0 0 0.5 [0.067:3.764) Human 120 6 5 4 3.33 2 1.67 0 0 1.333 [0.123:14.336] Total 460 28 6.09 21 4.57 8 1.74 1 0.22 𝑟≈0.852 C. jejuni/C. coli ratio (n = 28) 21 75 7 25 1 3.57 Odds Ratio (OR = 1.73): People are 1.73 times more likely to test positive for Campylobacter spp. if chicken samples are contaminated, though the CI includes 1, indicating this is not statistically significant. 95% CI (0.61–4.93): The wide CI suggests limited precision. The Pearson correlation coefficient 𝑟≈0.852, indicates a strong positive correlation between C. jejuni and C. coli across the samples. Chicken Meat, OR = 1.071, and the Z-value for a 95% confidence interval is 1.96 . Table 6: Probability of high risk of C. jejuni and C. coli in the examined samples (%). C. jejuni C. coli Chicken meat 74.51 49.28 Table egg 12.23 1.21 Environmental sample 49.22 15.72 Human 15.38 2.42 A Monte Carlo simulation with a Latin hypercube sampling method (10,000 iterations) was used to generate pseudo-random numbers from all input probability distributions defined in the model (i.e. one iteration). The final probability density function of the output (mean, 95% confidence interval) accurately accounted for all possible scenarios for the given set of parameters defined in the exposure model. Discussion Campylobacter is classified as a Gram-negative, motile, non-sporulating bacterium, exhibiting a spiral or helical curved rod that can transition to filamentous or coccoid a response to environmental stresses (Kaakoush et al., 2015a). It is an obligate microaerophile possessing a relatively compact genome measuring 1.6 megabase pairs (Mbp). It exhibits numerous adaptive responses and occupies various ecological niches that facilitate its survival throughout the poultry production continuum (Hakeem and Lu, 2021). Campylobacter species is the predominant etiological agent of gastroenteritis implicated in humans in the United Kingdom, with an annual incidence estimated at 300,000 cases (Holland and Mahmoudzadeh, 2020). Chickens are identified as the primary reservoir for thermotolerant Campylobacter spp., being accountable for an anticipated 80% of human Campylobacter infections (El-Gedawy et al., 2023). Table 1 demonstrates that 20.83% of the broiler meat and meat product samples tested positive for Campylobacter spp., as determined by culture and biochemical methodologies. This finding was similar to 20.7% in Italy (Nobile et al., 2013). This percentage is significantly lower than the 90.6% (Meeyam et al., 2004), 91.8% in Turkey (Yildirim et al., 2005), 68.7% (Ghafir et al., 2007), 62.4% in Canada (Valdivieso-Garcia et al., 2007), and 51% (Sammarco et al., 2010) from Northern Poland (Backert and Hofreuter, 2013), in addition to 66.7% from Brazil (Borges et al., 2020), 77.41% in China (Lai et al., 2023), and 28.6% in the United Arab Emirates (Habib et al., 2022). Variability in Campylobacter contamination rates in retail poultry meat was reported by Andrzejewska et al. (2015), documenting rates of 60.2, 45.9, 38.6, 29.3, and 32.0% from 2009 to 2012. Campylobacter spp. was isolated from 12 out of 30 (40%) broiler carcasses (Table 1 ). A comparable result was documented by Andrzejewska et al. (2015), wherein the mean prevalence over a five-year span was calculated at 41.6%. This finding is lower than those reported by various studies Vashin and Stoyanchev (2004), Meldrum et al. (2005), Sheveleva et al. (2006), Franchin et al. (2007), Kuana et al. (2008), Rahimi and Tajbakhsh (2008), Suzuki and Yamamoto (2009), Rahimi et al. (2010), Rantsiou et al. (2010), Bagherpour et al. (2014), Tang et al. (2020), and Bouhamed (2023), whose reported prevalence rates ranged from 92–100%, 58.6%, 67.6%, 71.3%, 99%, 56.1%, 59%, 51.2%, 79%, 56.7%, 53.4%, and 53.33%, respectively. Lower results were reported by Ledergerber et al. (2003), van Nierop et al. (2005), Stoyanchev et al. (2007), Yushina et al. (2020), and Chala et al. (2021) who reported that 7.9, 18.2, 35.3, 33, and 13% of chicken carcasses were contaminated with Campylobacter spp. Countries employing manual processing techniques exhibited elevated Campylobacter contamination levels in poultry compared to nations utilizing contemporary processing facilities. The processes of manual slaughtering and evisceration are prone to result in fecal contamination of carcasses, thereby contributing to an increase in the prevalence of Campylobacter spp. within poultry meat (Parkar et al., 2013). Breast samples yielded a contamination rate of 16.67% (5/30) (Table 1 ), which aligns with findings (16.67%) reported by Vashin and Stoyanchev (2004). This incidence was notably lower than the rates documented by Luu et al. (2006), Sallam (2007), Guyard-Nicodème et al. (2013), Awadallah et al. (2014), Sison et al. (2014), and Abd El-tawab et al. (2015), who reported incidence rates of 31.0, 64.4, 47.9, 25.9, 47.5, and 30.8%, respectively. Thigh samples demonstrated an isolation rate of 26.67% (Table 1 ), with even greater rates reported by Vashin and Stoyanchev (2004), Sallam (2007), and Abd El-tawab et al. (2015), who documented isolation rates of 36.67, 70, and 38.5%, respectively. Conversely, Gritti et al. (2011) were unable to isolate Campylobacter from thigh and breast samples utilizing both cultural and molecular techniques. Chicken meat products, specifically chicken nuggets and chicken luncheons, exhibited a complete absence of Campylobacter spp., corroborating similar findings reported by Mohamad and Som (2012) and Abdel-Malek (2015). In contrast, Paulsen et al. (2005) successfully isolated C. jejuni/C. coli from luncheons at frequencies of 15/5%, respectively, while failing to isolate these bacteria from nuggets. In Alexandria, Samaha et al. (2012) detected C. jejuni in 16% of chicken pane samples, yet could not isolate it from chicken nuggets or luncheons. Furthermore, Lake and Cressey (2015) indicated that 0.07% of ready-to-eat chicken products tested positive for Campylobacter in New Zealand. The inability to isolate C. jejuni may be attributed to the elevated salt concentration and other constituents present in the marinades. C. jejuni is incapable of proliferation in environments containing ≥ 2% NaCl at 42°C, yet it can survive in concentrations ranging from 0.5–1.5% NaCl at the same temperature (Gomes et al., 2018). Additionally, C. jejuni can be eradicated through the application of marinades. There exists a paucity of research about the prevalence of Campylobacter in frozen processed chicken products, attributed to the gradual decrease in C. jejuni counts at typical freezing temperatures, which does not result in immediate activation of the organism in global food supplies (Mohamad and Som, 2012). Campylobacter spp. could not be detected in the contents of table eggs, although 2/50 (4%) of eggshells were contaminated, and 2% as an overall rate in eggs (Table 1 ). These results are comparable to those obtained in Assiut city by Amin (2017) and in Germany (4.1%) by Messelhäusser et al. (2011). A higher incidence rate of Campylobacter in eggshells was reported in Japan, which was 36% (Sato and Sashihara, 2010, in Malaysia, (12%) (Nor Faiza et al., 2013), and in Tunisia (25.6%) by Gharbi et al., (2022). Lower rates were reported in Trinidad (1%) (Adesiyun et al., 2005), and in Egypt (Hedawey and Yousef, 2014). The contamination rates of food environmental samples from slaughter shops, restaurants, and fecal swabs were 46.6%, 16.67%, and 50%, respectively with 28.33% (34/120) as an overall environmental contamination rate. The water samples were free of Campylobacter (Table 1 ). Slaughter shop samples were collected from the surfaces of the plucking machines, cutting boards, knives for eviscerating birds, and washing basins. Franchin et al. (2005) collected samples at different points before slaughter, and Campylobacter spp. were found in litter, transport coops, coop rinse water, cloaca, feather, and breast support at rates of 37.5, 50, 25, 79.2, and 33.3%, respectively, with an average of 50%. The restaurant samples focused on points where the raw chicken meat was washed, handled, and contacted surfaces. 16.67% of the restaurant samples were positive for Campylobacter spp., in contrast to Bellio et al. (2014) in Italy, who reported that all food contact surfaces were negative for Campylobacter . Poultry fecal swabs had a 50% Campylobacter contamination rate, and similar isolation rates were previously reported by Meeyam et al. (2004), Henry et al. (2011), Brazil by Borges et al. (2020), Yushina et al. (2020), and Abdulwahab and Alhindwae (2025), who reported prevalence rates of 43.2, 54, 57, 50, and 44.5%, respectively. However, lower isolation rates of 35.9, 21.6, 39.2, 38.1, and 35.1% were reported by Awadallah et al. (2014), Jorgensen et al. (2011), Mäesaar et al. (2014), Torralbo et al. (2014), and Abd El-Tawab et al. (2015), respectively. Additionally, the results obtained in the present study are greater than those obtained in Giza, Egypt, by Hassanain (2011), and Ghoneim et al. (2020) who detected 5/50 (10%) chicken fecal droppings, and 1.9% cloacal swabs, respectively. Generally, the variation in the Campylobacter species isolation rate across different studies could be attributed to various factors, such as the type of examined samples, location, climate factors, hygienic measures, and isolation, as well as the identification techniques used by Jorgensen et al. (2011) and Chatur et al. (2014). The prevalence of Campylobacter species in poultry is expected to be high in broilers slaughtered at 35–42 days, whereas in older chickens, the prevalence decreases, reflecting acquired immunity (Kalupahana, et al., 2013). All water samples from slaughter shops and restaurants were free from Campylobacter spp. (Table 1 ). This result is lower than the results (2, 6.7, and 20.5%) obtained from the Ashburton River by Devane (2006), Mubarak (2013), and Ghoneim et al. (2020). All samples from tap water were negative for the presence of Campylobacter spp. This finding indicates that the chlorination of water inactivates Campylobacter spp. (El Sayed, 2016). Notably, Campylobacter spp. was identified in 23.33% of stool samples obtained from patients with enteritis through microbiological examination (Table 2 ), with analogous results reported in Assiut city by Abushahba et al. (2018) and Sayed et al. (2023), who identified Campylobacter spp. in 27.55% and 29% of human and worker samples, respectively. Furthermore, Collado et al. (2013) documented rates of 28% and 25.7%, respectively. In Sohag, ElSayed (2016) reported a comparatively lower rate of 5.33%. Nonetheless, lower incidence rates of 20, 11.1, 15.7, 15, 10, 2.6, and 6.7% were observed by Roshdy (2000), Gerges (2004), Quetz et al. (2010), Dabboussi et al. (2012), Salim et al. (2014), Vaishnavi et al. (2015), and Ghoneim et al. (2020), respectively. Regarding the prevalence of Campylobacter infections within the human demographic in Egypt, numerous antecedent investigations have indicated that Campylobacteriosis constitutes a significant etiological factor for diarrhea among pediatric populations in the nation (Kaakoush et al., 2015; Abdel-Ghany, 2019). In this context, it has been documented that approximately 85% of children in Egypt experience infection with Campylobacter spp. during their inaugural year of life, accompanied by an annual incidence rate of 1.2 episodes (Omara et al., 2015; Sainato et al., 2018). These observations align with the outcomes of the current research, as delineated in Table 2 , which indicated that the highest incidence occurred in the age group of 6 months to 5 years (46.67%). In contrast, the incidence rates were recorded at 6.67% and 13.3% in the age ranges of 6–15 and 16–50 years, respectively. Notably, the pathogen could not be detected within the age range of 51–70 years, yielding an overall detection rate of 28%. This finding corroborates the assertions made by Vaishnav et al. (2015), who reported that 50% of Campylobacter isolates were derived from children under 5 years old, with a subsequent prevalence noted among individuals exceeding 10 years of age. This finding exceeds the results documented by Roshdy (2000) in Assiut city, Egypt, where Campylobacter was isolated from 20% (30/150) of stool specimens obtained from infants afflicted with diarrhea, of which 16% (24/150) were identified as C. jejuni , while C. coli was isolated from 4% (6/150) of the stool samples. Furthermore, lower isolation frequencies of Campylobacter spp. from human stool samples in Egypt were reported; Girgis et al. (2014) in Assiut; and Abd El-Tawab et al. (2015), who reported isolation rates of 2.7, 5.3, and 8%, respectively. Additionally, Kang et al. (2006), Hassanain (2011), and documented isolation rates of 6, and 2.9%, respectively. On the other hand, Awadallah et al. (2014) in Zagazig recorded a higher rate (56.6%). Conversely, more significant findings were presented by Meeyam et al. (2004), who indicated the presence of Campylobacter spp. in 80% of stool samples collected from individuals employed in poultry farming. This elevated percentage may be ascribed to the collection of stool samples from humans interacting with poultry. C. jejuni is biochemically differentiated from other Campylobacter species through the Hippurate hydrolysis assay, demonstrating a positive reaction for C. jejuni and a negative response for alternative Campylobacter species (Burnett et al., 2002). Various studies conducted across different Egyptian governorates have reported isolation rates of 8.5% and 38.09% for C. jejuni derived from occupational workers (Omara et al., 2015; ElSayed, 2016; Abushahba et al., 2018). Furthermore, at the species level, C. jejuni and C. coli were identified in Sohag Governorate at a rate of 50% for each species (ElSayed, 2016), whereas the isolation rates in Assiut Governorate (Abushahba et al., 2018) were recorded at 11.7% and 6.7% for the respective species. In Egypt, poultry farms frequently exhibit deficiencies in biosecurity and control measures, which are regarded as predisposing factors contributing to the elevated incidence of the pathogen. Among others, it is evident that persons working at poultry shops and dealing with live birds are at high risk of acquiring various zoonotic pathogens, especially during the handling, slaughtering, and evisceration of birds. Conversely, several previous studies conducted in Bangladesh, and Egypt (Sarkar et al., 2014; El-Tawab et al., 2015) reported lower percentages (9.3, 11.5%) of Campylobacter 38–40. The data shown in Table 3 and Figs. 2, 3, &4 revealed that the percentage of C. jejuni was 75% (21/28) and C. coli was 25% (7/28), 1 sample had mixed strains. These results are in line with those by Rahimi et al. (2010), and Abdulwahab and Alhindwae (2025) reported that the percentage of C. jejuni/C. coli was 88.3%/11.7%, and 61.7%/20.22%, respectively. Additionally, Wong et al. (2007) reported that the distribution of C. jejuni / C. coli isolates from retail poultry in New Zealand (molecularly determined only) were 98.3/1.7%. Abd El-Tawab et al. (2014) reported that the percentages of C. jejuni, C. coli, C. lari , and C. hyointestinal infections were 54.4%, 42.1%, and 3.5%, respectively. Additionally, Uaboi-Egbenni et al. (2011) reported that 12.5% were identified as Campylobacter jejuni and 87.5% as Campylobacter coli . The prevalence of C. jejuni and C. coli among the examined samples was 61.7% and 20.22%, respectively (Abdulwahab and Alhindwae, 2025; Schreyer et al., 2022; Rodrigues et al., 2021; Lynch et al., 2022). These findings agree with the findings of other studies, in which the occurrence of C. jejuni was higher than C. coli . A possible explanation for these results may be the more sensitive nature of C. coli to stress conditions during slaughtering process of broilers. van Nierop et al. (2005), Rahimi and Tajbakhsh (2008), and Awadallah et al. (2014) reported similar isolation rates of C. coli from fresh chicken meat samples at rates of 6.7, 6.9, and 10.8%, respectively. In eggshell samples, 2 isolates from eggshells were positive for the 23S rRNA , C. jejuni was identified in all 2/50 (4%) using the Hippurate test and mPCR, while 1 sample had mixed C. jejuni and C. coli contamination (Tables 1 , 3 and Fig. 4). Also, a predominance of C. jejuni (81.9%) compared to C. coli (18.2%) was obtained in Gharbi et al. (2022). For the environmental samples, the C. jejuni / C. coli ratio (6/3) identified in the current study was 67.67/33.33%. Similarly, the ratios obtained by (Abd El-Tawab et al., 2015), C. jejuni , and C. coli/C. lari were identified in 76.9, and 23.1% of the human isolates, respectively. A higher Campylobacter spp. detection rate was reported among workers in percentages of 24% in the 18–50 years age groups by Sayed et al. (2023). ( C. jejuni 15%, and C. coli 14%) of the workers examined via mPCR. Higher isolation rates of C. jejuni was reported in different studies by Salihu et al. (2012) and Mansouri-najand et al. (2012). Low percentages of 44.4% and 31.4% were reported by Pezzotti et al. (2003) and Henry et al. (2011), respectively. However, Hassanain (2011) identified all human and poultry isolates obtained at Giza governorate as C. jejuni via biochemical testing, which may be due to the inability to differentiate between C. jejuni and C. coli via phenotypic tests, especially when mixed on the same sample, in addition to selective plating and supplements that enhance C. jejuni and may lower the other Campylobacter spp. C. jejuni was identified in 4.14% (5/120) and 0.83% (1/120) of the C. coli strains in the examined human samples (Table 4 , and Figs. 3,4). Similar percentages of C. jejuni (5.8 and 1.5%) were obtained in other studies conducted in France and India (Bessède et al., 2011; Rajagunalan et al., 2014). On the other hand, higher percentages of C. jejuni (21.4, 63.6%) were reported in other studies (Workman et al., 2006). Higher percentages of C. coli (31.8, 2.5, and 1.5%) were obtained in other studies (Workman et al., 2006, Bessède et al., 2011; Rajagunalan et al., 2014). In children aged 0.5-4 years, C. jejuni/ C. coli was detected at a rate of 3:1 in the stool samples, and 1:1 in those aged 5–15 years. Similar detection rates of C. jejuni were reported by Abd El-Tawab et al. (2015), Sorokin et al. (2007), and Ewnetu and Mihret (2010), who detected C. jejuni at rates of 70.9, 69.3, and 94.1%, respectively. Awadallah et al. (2014) identified 7.4% and 3.7% as C. coli and C. jejuni , respectively. Different isolation rates of C. coli and C. jejuni (55.5% versus 31.4%, and 57.5% versus 0%, respectively. were obtained by Henry et al. (2011) and Marinou et al. (2012). Sayed et al. (2023) reported that C. jejuni and C. coli were recovered from workers in 18–50 years age groups at percentages of 12% each. Conclusion Campylobacteriosis remains a pressing global health issue driven by contamination of broiler meat and food environments. Poultry meat and poultry meat products are important sources of Campylobacter infections. The environment and humans can be sources of Campylobacter contamination. Campylobacter food poisoning is caused mainly by Campylobacter jejuni and to a lesser extent by Campylobacter coli and other species. Efforts to mitigate Campylobacter contamination must address both preharvest and// postharvest stages. Strategies include improving biosecurity, ensuring hygienic processing, and minimizing cross-contamination. Consumer education on the proper cooking and handling of poultry products remains critical for reducing infection risk. Declarations Ethics approval and consent to participate This study adhered to ethical guidelines and was approved by the relevant ethical committee(s) at the Animal Health Research Institute, Agriculture Research Center, Egypt following the Declaration of Helsinki. Animal studies complied with the Animal Health Research Institute, Agriculture Research Center, Egypt animal welfare guidelines. The authors declared that no animal was injured, hurt, or suffering during this study, and informed consent was obtained from all participants before their involvement in the study. Consent for publication Consent for publication was obtained from all participants or their legal guardians, where applicable. No individual identifiable data, images, or videos of participants are included in this manuscript. Funding: not applicable Availability of data and materials The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no financial and non-financial competing interests. Authors' contributions TEAT: collection of broiler meat, and environmental samples, microbiological analysis, molecular biology, writing manuscript, corresponding the journal, substantial contributions to the conception and design of the study, and Responsible for ensuring the accuracy and integrity of the work, with a commitment to investigating and resolving any issues related to the manuscript. AAY: provided human and egg samples, technical support in the microbiological analysis, and the biochemical identification of the isolates, revising the results, and approved the submitted version of the manuscript and any substantially modified versions. Both authors agree to be accountable for their contributions to the study and the manuscript, and ensure that any questions related to the work’s accuracy and integrity are addressed. Acknowledgments : Not applicable References Abd El-Ghany WA (2019) One health approach of campylobacteriosis in Egypt: an emerging zoonotic disease. J Infect Develop Countries, 13: 956-960. doi: 10.3855/jidc.11860. Abd El-Malek AM (2015) Occurrence of Campylobacter jejuni in chicken meat, and chicken meat products. International Journal of Advanced Research, 3(5): 212-217. Abdel-Tawab AA, Ammar AM, Ahmed HA, Hofny FI, and Ahmed A (2015) Bacteriological and molecular identification of Campylobacter species in chickens and humans, at Zagazig City, Egypt. Benha Veterinary Medical Journal, 28 (1):17‐26. doi: 10.21608/bvmj.2015.32523. Abdulwahab HM, Alhindwae AN (2025) Campylobacter prevalence, molecular detection, and virulence gene profiles isolated from broilers slaughtered in the Faith Al-Qasim Slaughterhouse. Egyptian Journal of Veterinary Science (Egypt), 56 (6): 1337-1346. https://doi.org/10.21608/EJVS.2024.269865.1850. Abushahba M, Ahmed S, Ibrahim A, Mosa H. (2018). Prevalence of zoonotic species of Campylobacter in broiler chicken and humans in Assiut governorate. Egypt Approaches Poult Dairy Vet Sci. 3:260–8. doi: 10.31031/APDV.2018.03.000568. Adesiyun A, Offiah N, Seepersadsingh N, Rodrigo S, Lashley V, Musai L, Georges K (2005) Microbial health risk posed by table eggs in Trinidad. Epidemiol. Infect., 133, 1049–1056. Amin WF (2019). Incidence of some food-borne pathogens in table eggs in Assiut City, Egypt. International Journal of Trend in Research and Development, Volume 4(6): 75-80. ISSN: 2394-9333 www.ijtrd.com November 2017. Andrzejewska M, Klawe J, Szczepańska B, Śpica D (2011) Occurrence of virulence genes among Campylobacter jejuni and Campylobacter coli isolates from domestic animals and children. Polish journal of veterinary sciences 14: 207-211. Andrzejewska M, Szczepańska B, Śpica D, Klawe JJ (2015) Trends in the occurrence and characteristics of Campylobacter jejuni and Campylobacter coli isolates from poultry meat in Northern Poland. Food Control, 51: 190–194. Awadallah MAI, Ahmed HA, El-Gedawy AA, Saad AM (2014) Molecular identification of C. jejuni and C. coli in chicken and humans, at Zagazig, Egypt, with reference to the survival of C. jejuni in chicken meat at refrigeration and freezing temperatures. International Food Research Journal, 21(5): 1801-1812. Backert S, Hofreuter D (2013) Molecular methods to investigate adhesion, transmigration, invasion and intracellular survival of the foodborne pathogen Campylobacter jejuni . Journal of Microbiological Methods, 95(1): 8-23. Bagherpour A, Ahmadi A, Soltanialvar M (2014) Survey of Campylobacter contamination in poultry meat and by-products in Dezful province, Walia Journal 30(1): 115-118. Barakat AM, Abd El-Razik KA, Elfadaly HA, Rabie NS, Sadek SA, Almuzaini AM. (2020) Prevalence, molecular detection, and virulence gene profiles of Campylobacter species in humans and foods of animal origin. Veterinary World. 13:1430–1438. doi: 10.14202/vetworld.2020.1430-1438, Belina D, Gobena T, Kebede A, Chimdessa M, Mummed B, Thystrup CAN, Hald T (2024) Occurrence and diversity of Campylobacter species in diarrheic children and their exposure environments in Ethiopia. PLOS Global Public Health, 4 (10): 1-19. https://doi.org/10.1371/journal.pgph.0003885. Bellio A, Traversa A, Adriano D, Bianchi DM, Colzani A, Gili S, Grattarola C, Maurella CF, Decastelli L (2014) Occurrence of thermotolerant Campylobacter in raw poultry meat, environmental and pigeon stools collected in open-air markets. Italian Journal of Food Safety, 3 (3): 157-159. doi: 10.4081/ijfs.2014.1706. Bessède E, Delcamp A, Sifré E, Buissonnière A, Mégraud F (2011) New methods for detection of campylobacters in stool samples in comparison to culture. J Clin Microbiol. 49:941–4. doi: 10.1128/JCM.01489-10 Bolton FJ, Coates D, Hutchinson DN, Godfree AF (1987) A study of thermophilic campylobacters in a river system. Journal of Applied Bacteriology, 62: 167-176. Borges KA, Cisco IC, Furian TQ, Tedesco DC, Rodrigues LB, do Nascimento VP, dos Santos LR (2020) Detection and quantification of Campylobacter spp. In Brazilian poultry processing plants. Journal of Infection in Developing Countries, 14(1): 109–113. https://doi.org/10.3855/jidc.11973 Bouhamed R (2023) Campylobacter spp. at different stages of the poultry slaughtering line in Algeria: Evaluation of direct and indirect modified ISO 10272:2017 detection methods and characterization of the isolates. Archives of Razi Institute, May: 1657–1667. https://doi.org/10.32592/ari.2023.78.5.1657 Brinch ML, Hald T, Wainaina L, Merlotti A, Remondini D, Henri C, Njage PMK (2023) Comparison of Source Attribution Methodologies for Human Campylobacteriosis. Pathogens. May 31 2023;12 (6):786. doi: 10.3390/pathogens12060786. Burnett TA, Hornitzky MA, Kuhnert P, Djordjevic SP (2002) Speciating Campylobacter jejuni and Campylobacter coli isolates from poultry and humans using six PCR-based assays. FEMS Microbiol Lett. 216: 201-209. doi: 10.1111/j.1574-6968.2002.tb11436.x. CDC (2018): Centers for Disease Control and Prevention. Yellow Book 2018: Health Information for International Travel. New York: Oxford University Press. CDC “Centers for Disease Control and Prevention” (2019) Campylobacter (Campylobacteriosis) (Final Update) [(accessed on 14 April 2020)]; Available online: https://www.cdc.gov/campylobacter/index.html. Chala G, Eguale T, Abunna F, Asrat D, Stringer A. (2021) Identification and Characterization of Campylobacter Species in Livestock, Humans, and Water in Livestock Owning Households of Peri-urban Addis Ababa, Ethiopia: A One Health Approach. Front Public Heal., 9:750551 . Chatur YA, Brahmbhatt MN, Modi S, Nayak JB (2014) Fluoroquinolone resistance and detection of topoisomerase gene mutation in Campylobacter jejuni isolated from animal and human sources. International Journal of Current Microbiological Applied Sciences, 3(6): 773-783. Clarke AK, Ajlouni S (2021) Recommended practices to eliminate Campylobacter from live birds and chicken meat in Japan. Food Saf (Tokyo) 9:57–74. doi: 10.14252/foodsafetyfscj.D-20-00021. Collado L, Gutiérrez M, González M, Fernández H (2013) Assessment of the prevalence and diversity of emergent Campylobacter in human stool samples using a combination of traditional and molecular methods. Diagnostic Microbiology of Infectious Diseases, 75 (4): 434-446. Costa D, Iraola G (2019) Pathogenomics of emerging Campylobacter species. Clin. Microbiol. Rev. 32: e00072–e00018. Doi: 10.1128/CMR.00072-18. Dabboussi F, Alam S, Mallat H, Hlais S, Hamze M (2012) Preliminary study on the prevalence of Campylobacter in childhood diarrhea in north Lebanon. East Mediterranean Health Journal, 18 (12): 1225-8. Devane PM L (2006) The isolation and genotypic characterization of Campylobacter jejuni from environmental matrices. M.Sci. in Microbiology, University of Canterbury: 10-30. Donnison A (2003) Isolation of thermotolerant Campylobacter : Review and methods for New Zealand. Health San Francisco, 29: 75–80. EFSA-ECDC (2021) European Food Safety Authority”; European Centre for Disease Prevention and Control: The European Union One Health 2020 Zoonoses Report. EFSA J., 19: e06971. El-Gedawy AA, Abdelghafar AE, Mohamed HY, Elkady HA, Hassan MAFI, Ali AM (2023) Highlighting on the occurrence of Campylobacter in chickens with special reference to its antimicrobial resistance. Egyptian Journal of Animal Health 3, 4 (2023): 257-272. ElSayed SAM (2016) Prevalence of virulence genes of Campylobacter species isolated from poultry meat, human and environment. Master Degree Thesis, Faculty of Vet. Med. SVU:1–150. Ewnetu D, and Mihret A (2010) Prevalence and antimicrobial resistance of Campylobacter isolates from humans and chickens in Bahir Dar, Ethiopia. Faculty of Science, Bahir Dar University, Ethiopia. Foodborne Pathogenic Diseases, 7(6): 667-670. Facciolà A, Riso R, Avventuroso E, Visalli G, Delia SA, Laganà P (2017) Campylobacter : From Microbiology to Prevention. J. Prevent. Med. Hyg. 2017: 58-62. DOI: 10.15167/2421-4248/jpmh2017.58.2.672. Fitzgerald C (2015). Campylobacter . Clin. Lab. Med., 35: 289–298. Franchin PR, Aidoo KE, Batista CRV (2005) Sources of poultry meat contamination with thermophilic Campylobacter before slaughter. Brazilian Journal of Microbiology, 36(2): 157–162. Franchin PR, Ogliari PJ, Batista CRV (2007) Frequency of thermophilic Campylobacter in broiler chickens during industrial processing in a Southern Brazil slaughterhouse. Brazilian Poultry Science, 48:127-132. Fricker CR, Park RWA (1989) A two-year study of the distribution of thermophilic Campylobacters in human, environmental, and food samples from the Reading area with particular reference to toxin production and heat-stable serotype. Journal of Applied Bacteriology, 66: 477-90. Geissler AL, Carrillo FB, Swanson K, Patrick ME, Fullerton KE, Bennett C, Barrett K, Mahon BE (2017) Increasing Campylobacter infections, outbreaks, and antimicrobial resistance in the United States, 2004–2012. Clin. Infect. Dis., 65:1624–1631. doi: 10.1093/cid/cix624. Gerges AE (2004) The zoonotic importance of Campylobacter infection in man and animals. M.V.Sc. Thesis, Fac. Vet. Med., Assiut University, 20-60. Ghafir Y, China B, Dierick K, Dezutter L, Daube G (2007) A seven-year survey of Campylobacter contamination in meat at different production stages in Belgium. International Journal of Food Microbiology, 116:111-120. Gharbi M, Béjaoui A, Ben Hamda C, Alaya N, Hamrouni S, Bessoussa G, Ghram A, Maaroufi A (2022) Campylobacter spp. in eggs and laying hens in the North-East of Tunisia: High prevalence and multidrug-resistance phenotypes. Veterinary Sciences, 9(3): 108. https://doi.org/10.3390/vetsci9030108. Ghoneim NH, Sabry MA, Ahmed ZS, Elshafiee EA (2020) Campylobacter species isolated from chickens in Egypt: Molecular epidemiology and antimicrobial resistance. Pakistan Journal Zool., 2020: 1-10. DOI: https://dx.doi.org/10.17582/journal.pjz/20190324080346. Ghunaim H, Behnke JM, Aigha I, Sharma A, Doiphode SH, Deshmukh A, Abu-Madi MM (2015) Analysis of resistance to antimicrobials and presence of virulence/stress response genes in Campylobacter isolates from patients with severe diarrhea. PLoS ONE, 10: e0119268. Girgis SA, Rashad SS, Othman HB, Bassim HH, Kassem NN, El-Sayed F.M. (2014) Multiplex PCR for identification and differentiation of Campylobacter species and their antimicrobial susceptibility pattern in Egyptian patients. International Journal of Current Microbiology Applied Science, 3(4): 861-875. Gomes CN, Passaglia J, Vilela FP, da Silva FMP, Duque SS, Falcao JP (2018) High survival rates of Campylobacter coli under different stress conditions suggest that more rigorous food control measures might be needed in Brazil. Food Microbiol., 73: 327–333. 10.1016/j.fm.2018.02.014 Gritti D, Vaz CSL, Voss-Rech D, Alves L, Bortolini F (2011) Thermophilic Campylobacter survey in chilled and frozen poultry meat at retail in Concordia, Santa Catarina. Acta Scientiae Veterinariae, 39(3): 976-981. Guyard-Nicodème M, Tresse O, Houard, E, Jugiau F, Courtillon C, El Manaa K, Laisney M, Chemaly M (2013) Characterization of Campylobacter spp . transferred from naturally contaminated chicken legs to cooked chicken slices via a cutting board. International Journal of Food Microbiology 164 (1): 7-14. Habib I, Yousif M, Mohamed I, Lakshmi GB, Khan M, Li D (2022) Quantification of Campylobacter contamination on chicken carcasses sold in retail markets in the United Arab Emirates. 4: 1–8. https://doi.org/10.1186/s40550-022-00095-4. Hakeem MJ, Lu X (2021) Survival and Control of Campylobacter in Poultry Production Environment. Frontiers in Cellular and Infection Microbiology, 10 (January): 1–18. https://doi.org/10.3389/fcimb.2020.615049 Hassanain NA (2011) Antimicrobial-resistant Campylobacter jejuni isolated from humans and animals in Egypt. Global Veterinaria, 6 (2): 195-200. Hedawey KAA, Youssef AS (2014) Incidence of Campylobacter species in laying hens and table egg in Sohag governorate. Assiut Vet. Med. J., 141: 120–124 Henry I, Reichardt J, Denis M, Cardinale E (2011) Prevalence and risk factors for Campylobacter spp. in chicken broiler flocks in Reunion Island (Indian Ocean). Preventive Veterinary Medicine, 100 (1): 64-70. Holland D, Mahmoudzadeh N (2020) Foodborne Disease Estimates for the United Kingdom in 2018. Food Standards Agency. Available at: https://doi.org/10.46756/sci.fsa.squ824. Hunt JM, Abeyta CTT (edt.) (1998): Chapter 7: Campylobacter. FDA Bacteriological Analytical Manual, 8 th edition (revision A), 23 pages. ISO (2006) Microbiology of food and animal feeding stuffs – Horizontal method for detection and enumeration of Campylobacter spp. Part 1: Detection method 10272–2 International Organization for Standardization. Geneva, Switzerland. Jones D, Musgrove M. (2007) Pathogen prevalence and microbial levels associated with restricted shell eggs. Journal of food protection. 70: 2004-2007. 10.4315/0362-028X-70.9.2004. Jorgensen F, Ellis-Iversen J, Rushton S, Bull SA, Harris SA, Bryan SJ, Gonzalez A, Humphrey TJ (2011). Influence of Season and Geography on Campylobacter jejuni and C. coli Subtypes in Housed Broiler Flocks Reared in Great Britain. Applied Environmental Microbiology, 77(11): 37-41. Kaakoush NO, Mitchell HM, Man SM (2015b) ‘Chapter 67 - Campylobacter’ , in Y.-W. Tang et al. (eds) Molecular Medical Microbiology (2 nd Edition). Boston: Academic Press, pp. 1187–1236. Available at: https://doi.org/10.1016/B978-0-12- 397169-2.00067-6. Kaakoush NO, Castaño-Rodríguez N, Mitchell HM, Man SM (2015a) Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev., 28: 687–720. Kalupahana RS, Kottawatta KS, Kanankege KS, van Bergen MA, Abeynayake P, Wagenaar JA (2013) Colonization of Campylobacter in broiler chickens and layer hens reared in tropical climates with low biosecurity. Applied Environmental Microbiology, 79: 393-395. Kang YS, Cho YS, Yoon SK, Yu MA, Kim CM, Lee JO, Pyun YR (2006) Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from raw chicken meat and human stools in Korea. Journal of Food Protection, 69 (12): 2915-2923 Kimiran A (2024) Cross-Contamination in Terms of Food Safety. Food safety, doi: 10.69860/nobel.9786053358787.26. Kirchner MKR, Christopher G, Aaron B, Lavallee Schaffner D, Chapman B, Jaykus L-A (2023) The role of hands in cross-contamination of kitchen surfaces during meal preparation. American Journal of Infection Control. doi: 10.1016/j.ajic.2023.04.162. Kuana SL, Santos LR, Rodrigues LB, Borsoi A, Moraes HLS, Salle CTP, Nascimento VP (2008) Occurrence and characterization of Campylobacter in the Brazilian production and processing of broilers. Avian Diseases, 52: 680-684. Lai H, Tang Y, Ren F, Jiao X, Huang J (2023) Evaluation of hygiene practice for reducing Campylobacter contamination on cutting boards and risks associated with chicken handling in kitchen environment. Foods. doi: 10.3390/foods12173245. Lake R, Cressey P (2015) Risk profile Campylobacter jejuni/coli in Poultry; whole and pieces, August 2013. 2015/02. ISBN No: 978-0-477-10546-0. ISSN No: 2253-3923. Ministry for Primary Industries website at http://www.mpi.govt.nz/news-and-resources/publications/ Ledergerber U, Regula G, Stephan R, Danuser J, Bissig B, Stark KD (2003) Risk factors for antibiotic resistance in Campylobacter spp. isolated from raw poultry meat in Switzerland. BMC Public Health, 3: 39-44. Luu QH, Tran TH, Phung DC, Nguyen TB Study on the prevalence of Campylobacter spp. from chicken meat in Hanoi, Vietnam. Annals of the New York Academy of Science, 1081: 273-275. Lynch H, Franklin-Hayes P, Koolman L, Egan J, Gutierrez M, Byrne W, Whyte P (2022) Prevalence and levels of Campylobacter in broiler chicken batches and carcasses in Ireland in 2017– 2018. International Journal of Food Microbiology, 372: 109693 Mäesaar M, Kristi P, Kadrin M, Kramarenko JS, Arvo V, Kaisa M, Kovalenko K, Darja M, Hörman A, Marja-Liisa H, Mati R (2014) Prevalence and counts of Campylobacter spp. in poultry meat at retail level in Estonia. Food Control., 44:72–77. 10.1016/j.foodcont.2014.03.044. Maher M, Finnegan C, Collins E, Ward B, Carroll C, Cormican M (2003) Evaluation of culture methods and a DNA probe-based PCR assay for detection of Campylobacter species in clinical specimens of feces. J Clin Microbiol., 41(7): 2980-2986. Mansouri-najand L, Saleha AA, Wai SS (2012) Prevalence of multidrug resistance Campylobacter jejuni and Campylobacter coli in chickens slaughtered in selected markets, Malaysia. Tropical Biomedicine, 29(2): 231-238. Marinou I, Bersimis S, Ioannidis A, Nicolaou C, Mitroussia-Ziouva A, Legakis NJ, Chatzipanagiotou S (2012) Identification and antimicrobial resistance of Campylobacter species isolated from animal sources. Frontiers in Microbiology, 3 (58): 1-6. McLure A., Smith JJ, Firestone SM, Kirk MD, French NP, Fearnley E, Wallace RL, Valcanis M, Bulach DM, Moffatt CRM, Selvey LA, Jennison AV, Cribb DM, Glass K (2023) Source attribution of campylobacteriosis in Australia, 2017-2019. Risk Analysis, doi: 10.1111/risa.14138. Meeyam T, Padungtod P, Kaneene JB (2004) Molecular characterization of Campylobacter Isolated from chickens and humans in northern Thailand. Southeast Asian Journal of Tropical Medicine Public Health, 35 (3): 670-675. Meldrum RJ, Tucker D, Smith RMM, Edwards C (2005) Survey of Salmonella and Campylobacter contamination of whole, raw poultry on retail sale in Wales in 2003. Journal of Food Protection, 68: 1447-1449. Messelhäusser U, Thärigen D, Elmer-Englhard D, Bauer H, Schreiner H, Höller C (2011) Occurrence of thermotolerant Campylobacter spp. on eggshells: A missing link for food-borne infections? Appl. Environ. Microbiol., 77:3896–3897. Mohamad NL, Som FM (2012) Prevalence of Campylobacter jejuni in chicken meat and chicken-based products. J. Trop. Agric. and Fd. Sc., 1: 63-69. Mubarak AG (2013): Campylobacteriosis as a zoonotic foodborne disease in school children. MSc. Thesis, South Valley University. Nobile CGA, Costantino R, Bianco A, Pileggi C, Pavia M (2013) Prevalence and pattern of antibiotic resistance of Campylobacter spp. in poultry meat in Southern Italy. Food Control, 32:715-718. Nor Faiza S, Saleha AA, Jalila A, Fauziah N (2013) Research note occurrence of campylobacter and salmonella in ducks and duck eggs in Selangor, Malaysia. Trop. Biomed., 30: 155–158. Nowak M, Wiktoria RK, Błaszczyszyn K, Gaweł-Dąbrowska D, Paluch E (2024). Campylobacter : understanding its role as the primary bacterial cause of foodborne illness –current state of knowledge." Quality in Sport, undefined (2024). doi: 10.12775/qs.2024.17.52220. Omara ST, El Fadaly H, Barakat A (2015) Public health hazard of zoonotic Campylobacter jejuni reference to Egyptian regional and seasonal variations. Res J Microbiol., 10: 343–54. doi: 10.3923/jm.2015.343.354. Parkar SFD, Sachdev D, deSouza N, Kamble A, Suresh G, Munot H, Hanagal D, Shouche Y, Kapadnis B (2013) Prevalence, seasonality and antibiotic susceptibility of thermophilic Campylobacter spp . in ceca and carcasses of poultry birds in the “live- bird market”. African Journal of Microbiological Research, 7 (21): 2442-2453. Pascoe B, Futcher G, Pensar J, Bayliss S, Mourkas E, Calland J, Hitchings MD, Joseph LA, Lane C, Greenlee T, Arning N, Wilson DJ, Jolley KA, Maiden MCJ, Corander J, Parker CT, Cooper KK, Rose EB, Bereswill SKL, Kist M (2023) Recent developments in Campylobacter pathogenesis. Current Opinion in Infectious Diseases, 16:487-491. Pascoe B (2022). The ongoing pandemic: contaminated chicken produce is the primary source of antimicrobial-resistant campylobacteriosis in the United States. doi: 10.6084/m9.figshare.20279928.v1 Paulsen P, Kanzler P, Hilbert F, Mayrhofer S, Baumgartner S, Smulders FJM (2005) Comparison of three methods for detecting Campylobacter spp. in chilled or frozen meat. Inter. Journal of Food Microbiology, 103(2): 229-233. Pezzotti G, Serafin A, Luzzi I, Mioni R, Milan M, Perin R (2003) Occurrence and resistance to antibiotics of Campylobacter jejuni and Campylobacter coli in animals and meat in northeastern Italy. International Journal of Food Microbiology, 82: 281-287. Pimentel M, Morales W, Pokkunuri V, Brikos C, Kim SM, Kim SE, Triantafyllou K, Weitsman S, Marsh Z, Marsh E, et al. (2015) Autoimmunity Links Vinculin to the Pathophysiology of Chronic Functional Bowel Changes following Campylobacter Jejuni Infection in a Rat Model. Dig. Dis. Sci., 60(5): 1195-1205. DOI: 10.1007/s10620-014-3435-5. Quetz JS, Lima IN, Havt A, de Carvalho EB, Lima NL, Soares AM, Mota RM, Guerrant RL, Lima AA (2010) Campylobacter jejuni and Campylobacter coli in children from communities in Northeastern Brazil: molecular detection and relation to nutritional status. Diagnostic Microbiology and Infectious Disease, 67 (3): 220-227. Rahimi E, Tajbakhsh E (2008) Prevalence of Campylobacter species in poultry meat in the Esfahan city, Iran. Bulgarian Journal of Veterinary Medicine, 11(4): 257-262. Rahimi E, Momtaz H, Ameri M, Ghasemian-Safaei H, Ali-Kasemi M (2010) Prevalence and antimicrobial resistance of Campylobacter species isolated from chicken carcasses during processing in Iran. Poultry Science, 89(5): 1015-1020. Rajagunalan S, Bisht G, Pant S, Singh SP, Singh R, Dhama K (2014) Prevalence and molecular heterogeneity analysis of Campylobacter jejuni and Campylobacter coli isolated from human, poultry, and cattle. Vet Arhiv. 84:493–504. Rantsiou K, Lamberti C, Cocolin L (2010) Survey of Campylobacter jejuni in retail chicken meat products by application of a quantitative PCR protocol. International Journal of Food Microbiology, 141: S75–S79. Rautelin H, Jusufovic J, Hänninen M.-L. (1999)Identification of hippurate-negative thermophilic campylobacters. Diagn. Microbiol. Infect. Dis., 35: 9–12. Rodrigues CS, Armendaris PM, de Sá CVGC, Haddad JPA, de Melo CB (2021) Prevalence of Campylobacter spp. in chicken carcasses in slaughterhouses from South of Brazil. Current Microbiology, 78, 2242–2250. https://doi.org/10.1007/s00284-021-02478-w Roshdy MS (2000) Prevalence of Campylobacter jejuni in raw milk and infantile diarrhea in Assiut. Assiut Veterinary Medicine, 46 (97): 30-36. Sainato R, ElGendy A, Poly F, Kuroiwa J, Guerry P, Riddle MS, et al. (2018) Epidemiology of Campylobacter infections among children in Egypt. Am J Trop Med Hygiene. 98:581-585. doi: 10.4269/ajtmh.17-0469 Salihu MD, Junaidu AU, Magaji AA, Yakubu Y (2012) Prevalence and Antimicrobial Resistance of Thermophilic Campylobacter isolates from Commercial Broiler in Sokoto, Nigeria. Research Journal of Veterinary Science, 5 (2): 51-58. Salim SM, Mandal J, Parija SC (2014) Isolation of Campylobacter from Human Stool Samples. Indian Journal of Medical Microbiology, 32: 35-38. Sallam KI (2007):Prevalence of Campylobacter in chicken and chicken by-products retailed in Sapporo Ares, Hokkaido, Japan. Food Control, 18: 1113-1120. Samaha IA, Ibrahim HAA, Hamada MO (2012) Isolation of some enteropathogens from retailed poultry meat in Alexandria Province. Alex. Journal of Veterinary Science, 37 (1): 17-22. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor, NY Cold Spring Harbor Laboratory, 3(18):1-86. Sammarco ML, Ripabelli G, Fanelli I, Grasso GM, Tamburro M (2010) Prevalence and biomolecular characterization of Campylobacter spp . isolated from retail meat. Journal of Food Protection, 73: 720-728. Sarkar S, Ray N, Hossain M, Paul S, Sarkar S, Kobayashi N. (2014) Multiplex polymerase chain reaction for detection of Campylobacter from stool specimen. Mymensingh Med J. 23:449–455. Sato M, Sashihara N (2010) Occurrence of Campylobacter in commercially broken liquid egg in Japan. J. Food Prot., 73: 412–417. Sayed ASM, Ibrahim AI, Sobhy MM, Elmahallawy EK, Alsowayeh N, Alarjani KM, El-Khadragy MF, Youseef AG (2023) Circulation of thermophilic Campylobacter in pigeons, turkeys, and humans at live bird markets in Egypt. Front Vet Sci., May 12, 10: 1150077. doi: 10.3389/fvets.2023.1150077. Scallan E, Hoekstra RM, Mahon BE, Jones TF, Griffin PM (2015). An assessment of the human health impact of seven leading foodborne pathogens in the United States using disability-adjusted life years. Epidemiol. Infect . 143: 2795–2804. doi: 10.1017/S0950268814003185. Schreyer ME, Olivero CR, Rossler E, Soto LP, Frizzo LS, Zimmermann JA, Virginia ZM (2022) Prevalence and antimicrobial resistance of Campylobacter jejuni and C. coli identified in a slaughterhouse in Argentina. Current Research in Food Science, 5: 590-597. Shah D, Shringi S, Besser T, Call D (2009) Molecular detection of foodborne pathogens, Boca Raton: CRC Press, In Liu, D. (Ed). Taylor & Francis Group, Florida, USA: 369-389. Sheveleva SA, Shurysheva ZhN, Piskareva II (2006) Contamination of Campylobacter spp. from foodstuff. Voprosy Pitania Jouranl, 75: 38-43. Sison, FB, Chaisowwong W, Alter T, Tiwananthagorn S, Pichpol D, Lampang KN, Baumann MPO, Gölz G (2014) Loads and antimicrobial resistance of Campylobacter spp. on fresh chicken meat in Nueva Ecija, Philippines. Poultry Science, 93(5); 1270-1273. Sorokin M, Usein CR, Irimia M, Damian M (2007) A laboratory-based survey of Campylobacter infections in Prahova County. Roumanian archives of microbiology and immunology, 66 (3-4): 85-89. Stoyanchev T, Vashin I, Ring C, Atanassova V (2007) Prevalence of Campylobacter spp. in poultry and poultry products for sale on the Bulgarian retail market. Anton Leeuw, 92: 285–288. Suzuki H, Yamamoto S, (2009) Campylobacter contamination in retail poultry meats and by-products in Japan: A literature survey. Food Control, 20(6): 531–537. Tang JYH, Nishibuchi M, Nakaguchi Y, Ghazali F, Saleha A, Son R (2011) Transfer of Campylobacter jejuni from raw to cooked chicken via wood and plastic cutting boards. Letters in applied microbiology 52: 581-588. Thépault A, Rose V, Quesne S, Poezevara T, Béven V, Hirchaud E, Touzain F, Lucas P, Méric G, Mageiros L, Sheppard SK, Chemaly M, Rivoal K (2018) Ruminant and chicken: important sources of campylobacteriosis in France despite a variation of source attribution in 2009 and 2015. Scientific Reports, doi: 10.1038/S41598-018-27558-Z. Torralbo A, Borge C, Allepuz A, García-Bocanegra I, Sheppard S.K., Perea A, Carbonero A (2014) Prevalence and risk factors of Campylobacter infection in broiler flocks from southern Spain, Preventive Veterinary Medicine, 114 (2): 106-113. ISSN 0167-5877, https://doi.org/10.1016/j.prevetmed.2014.01.019. Totten PA, Patton CM, Tenover FC, Barrett TJ, Stamm WE, Steigerwalt AG, Lin JY, Holmes KK, Brenner DJ (1987) Prevalence and characterization of hippurate-negative Campylobacter jejuni in King County, Washington. J. Clin. Microbiol., 25, 1747–1752. Uaboi-Egbenni PO; Bessong PO, Samie A, Obi CL (2011) Prevalence, haemolysis and antibiograms of Campylobacters isolated from pigs from three farm settlements in Venda region, Limpopo province, South Africa. African Journal of Biotechnology, 10(4): 703-711. Vaishnavi C, Singh M, Thakur J, Thapa B, (2015) Low Prevalence of Campylobacteriosis in the Northern Region of India. Advances in Microbiology, 5: 155-165. doi: 10.4236/aim.2015.53015. Valdivieso-Garcia A, Harris K, Riche E, Campbell S, Jarvie A, Popa M, Deckert A, Reid-Smith R, Rahn K, (2007) Novel Campylobacter isolation method using hydrophobic grid membrane filter and semisolid medium. Journal of Food Protection, 70: 355-362. van Nierop W, Duse AG, Marais E, Aithma N, Thothobolo N, Kassel M, Stewart R, Potgieter A, Fernandes B, Galpin JS, Bloomfield SF (2005) Contamination of chicken carcasses in Gauteng, South Africa, by Salmonella , Listeria monocytogenes and Campylobacter . International Journal of Food Microbiology, 99: 1-6. Vashin IT, Stoyanchev TT (2004) Incidence and microbial diversity of Campylobacter spp. isolates during the slaughterhouse processing of poultry and critical control points of the process. Bulgian Journal of Veterinary Medicine, 7: 173-180. Vetchapitak T, Misawa N (2019) Current status of Campylobacter food poisoning in Japan. Food Saf (Tokyo) 7: 61–73. doi: 10.14252/foodsafetyfscj.D-19-00001. Wang G, Clark CG, Taylor TM, Pucknell C, Barton C, Price L, Woodward DL, Rodgers FG (2002) Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus . Journal of Clinical Microbiology 40: 4744- 4747. WHO “World Health Organization” (2020) Fact sheets: Campylobacter . World Health Organization. Available at: https://www.who.int/news-room/fact-sheets/detail/campylobacter (2020). WOAH (2005) Campylobacter jejuni and Campylobacter coli . In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals Geneva: World Organization for Animal Health. Wong T-L, Hollis L, Cornelius A, Nicol C, Cook RC, Hudson JA (2007) Prevalence, numbers, and subtypes of Campylobacter jejuni and Campylobacter coli in uncooked retail meat samples. Journal of Food Protection; 70: 566-573. Workman SN, Sobers SJ, Mathison GE, Lavoie MC (2006) Human Campylobacter-associated enteritis on the Caribbean-island of Barbados. Am J Trop Med Hygiene. 74:623-627. doi: 10.4269/ajtmh.2006.74.623. Yildirim M, Istanbulluoglu E, Ayvali B (2005) Prevalence and antibiotic susceptibility of thermophilic Campylobacter species in broiler chickens. Turkey Journal of Veterinary Animal Science, 29: 655-660. Yushina Y, Bataeva D, Makhova A, Zayko E (2020) Prevalence of Campylobacter spp. in a poultry and pork processing plants. Potravinarstvo Slovak Journal of Food Sciences vol. 14, 2020, p. 815-820 https://doi.org/10.5219/ ISSN 1337-0960. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5598686","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":390730979,"identity":"8d09f944-b782-41d6-9496-49b30e64b0ad","order_by":0,"name":"Tawfik Esmat Abdel-Hafeez Tawfik","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQklEQVRIie2RMUvDQBSA31FolrNZL0Sbv9AjUByq/pUrhXRJB7dONuUgU9VNWjr4F9LJNRKoy/2AQJYUhy6KKTgErejV1MkrdBTMt7zj3ft4j/cASkr+KBkLf15FqBYhVNRKMAAabxU0HAOQ/ZTtJ+J4H+VME9RLBdStm2j5eOK3LkCP5mn+BvVazNDiVdEFu9RjMdiNxKG85zsEiNOll1dgGzGr2IeqwXp3KcugHZiMcldEUsFNcjCSmZhVTaJQ9OeZJ5XB7bS74sfik4AumsbHCAZS0d5VCunNNoMxSFzKoR/KGrdp4hxYQ3ZBmUKJX1YeE4QGiXs+GfU7hk8cxzzyCJ2IBTcVG9OunfYwn7csa9oNsrxxqutyY8bTumXVHjr3q1y9aCiuseX7KMjfZJBXwTuVX6yLgHZ3KSkpKfk/fAGPWWwy3izhaQAAAABJRU5ErkJggg==","orcid":"","institution":"Agricultural Research Center","correspondingAuthor":true,"prefix":"","firstName":"Tawfik","middleName":"Esmat Abdel-Hafeez","lastName":"Tawfik","suffix":""},{"id":390730980,"identity":"d7316ed3-0143-4e47-ba47-a02543e783eb","order_by":1,"name":"Amany Abbass Yousif","email":"","orcid":"","institution":"Agricultural Research Center","correspondingAuthor":false,"prefix":"","firstName":"Amany","middleName":"Abbass","lastName":"Yousif","suffix":""}],"badges":[],"createdAt":"2024-12-07 11:23:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5598686/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5598686/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75984956,"identity":"c3980a18-b85a-464d-a352-85b21a7541e1","added_by":"auto","created_at":"2025-02-11 08:16:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":436843,"visible":true,"origin":"","legend":"\u003cp\u003e(a) \u003cem\u003eCampylobacter\u003c/em\u003e colonies on mCCDA plate. (b) microscopic appearance and staining reaction of \u003cem\u003eCampylobacter\u003c/em\u003espp. Showing Gram-negative bacilli, curved rods, spiral-shaped, resembling a seagull wing, and short rods.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5598686/v1/bb253fcd91e8fb8818074254.png"},{"id":75986307,"identity":"8f53f4e2-6418-47ef-ba3e-8db15a11b1a2","added_by":"auto","created_at":"2025-02-11 08:24:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":295227,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 1: Agarose gel electrophoresis of multiplex PCR for characterization of \u003cem\u003eCampylobacter \u003c/em\u003espp. Lane M: 100 bp ladder as molecular size DNA marker. Lane P: Control positive for \u003cem\u003e23S rRNA \u003c/em\u003e(650 bp)\u003cem\u003e, hipO\u003c/em\u003e (323 bp), and \u003cem\u003eglyA \u003c/em\u003e(126 bp)\u003cem\u003e \u003c/em\u003egenes. Lane N: Control negative. Lanes from 1-5:\u003cem\u003e \u003c/em\u003ePositive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom breasts and thighs\u003cem\u003e. \u003c/em\u003eLane 6: Positive \u003cem\u003eCampylobacter\u003c/em\u003espp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. coli\u003c/em\u003e for \u003cem\u003eglyA\u003c/em\u003e gene from thigh.\u003cem\u003e \u003c/em\u003eLanes 7, 9, \u0026amp;10:\u003cem\u003e \u003c/em\u003ePositive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom broiler carcasses. Lanes 8, \u0026amp; 11: Positive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. coli gly A \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom broiler carcasses. \u0026nbsp;Lane 12: Positive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom restaurant.\u003c/p\u003e","description":"","filename":"01.png","url":"https://assets-eu.researchsquare.com/files/rs-5598686/v1/d0b02db75bf457063a331c5b.png"},{"id":75984995,"identity":"317cff6b-8b6a-47ad-8e55-fc4ff77be97f","added_by":"auto","created_at":"2025-02-11 08:16:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":421704,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 2: Agarose gel electrophoresis of multiplex PCR for characterization of \u003cem\u003eCampylobacter \u003c/em\u003espp. Lane M: 100 bp ladder as molecular size DNA marker. Lane P: Control positive for \u003cem\u003e23S rRNA \u003c/em\u003e(650 bp)\u003cem\u003e, hipO\u003c/em\u003e (323 bp), and \u003cem\u003eglyA \u003c/em\u003e(126 bp)\u003cem\u003e \u003c/em\u003egenes. Lane N: Control negative. Lanes 1, \u0026amp; 2:\u003cem\u003e \u003c/em\u003ePositive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom humans (\u0026gt;4 years)\u003cem\u003e. \u003c/em\u003eLanes 3:\u003cem\u003e \u003c/em\u003ePositive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. coli gly A \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom gene\u003cem\u003e \u003c/em\u003efrom humans (\u0026gt;4 years)\u003cem\u003e.\u003c/em\u003e Lane 5: Positive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. coli\u003c/em\u003e \u003cem\u003eglyA\u003c/em\u003e gene from humans (\u0026gt;15 years). Lanes from 6, 10:\u003cem\u003e \u003c/em\u003ePositive \u003cem\u003eCampylobacter\u003c/em\u003espp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003eC. coli gly A gene \u003c/em\u003efrom cloacal swabs. Lanes 7, 8, 9: Positive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003e23S rRNA \u0026amp; C. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom cloacal swabs.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5598686/v1/b84cc3c6b73a8d1fdefbf896.png"},{"id":75985006,"identity":"39ebe4b5-417f-4fe6-a865-764700dcc966","added_by":"auto","created_at":"2025-02-11 08:16:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":112656,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 3: Agarose gel electrophoresis of biplex PCR for the characterization of \u003cem\u003eCampylobacter \u003c/em\u003espp. Lane M: 100 bp ladder as molecular size DNA marker. Lane P: Control positive for \u003cem\u003ehipO\u003c/em\u003e (323 bp), and \u003cem\u003eglyA \u003c/em\u003e(126 bp)\u003cem\u003e \u003c/em\u003egenes. Lane N: Control negative. Lanes from 1:\u003cem\u003e \u003c/em\u003ePositive for \u003cem\u003eC. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom human samples (\u0026gt;15 years). Lanes from 2-3:\u003cem\u003e \u003c/em\u003ePositive for \u003cem\u003eC. coli gly A \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom eggshells.\u003cem\u003e \u003c/em\u003eLanes 4-6:\u003cem\u003e \u003c/em\u003ePositive \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003cem\u003e \u003c/em\u003efor \u003cem\u003eC. jejuni hip O \u003c/em\u003egene\u003cem\u003e \u003c/em\u003efrom slaughter shops.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5598686/v1/6316c228f72afa11ff744ee9.png"},{"id":75986757,"identity":"504f586f-2a5d-4fa5-bdb4-7f7501474285","added_by":"auto","created_at":"2025-02-11 08:32:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3064624,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5598686/v1/59ef4fd0-8248-4913-b4dd-6292c01a5634.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Risks of Campylobacter jejuni and Campylobacter coli contamination in broiler's meat, table eggs, and the food environment in correlation to human enteritis.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCampylobacteriosis represents a considerable global public health dilemma, ranking among the foremost causes of gastroenteritis on an international scale, and it has been recognized as the most frequently reported zoonotic disease in humans within the European Union (EU) since 2005, affecting millions of individuals (Kaakoush et al., 2015b; WHO,2020). In 2020, the confirmed cases of campylobacteriosis reached 120,946, with a 40.3 per 100,000 EU notification rate (EFSA-ECDC, 2021).\u003c/p\u003e \u003cp\u003eCampylobacteriosis manifests sporadic cases of gastroenteritis or as minor outbreaks that typically develop after 24 to 72 hours as an incubation period. Enteritis generally presents with diarrhea, fever, abdominal discomfort, nausea, malaise, headaches, and cramps, which are self-limiting and resolve within 24\u0026ndash;48 hours in most cases, however, a protracted course may occur (Fitzgerald, 2015). In instances of severe disease forms, dehydration, bacteremia, or sepsis symptoms resembling ulcerative colitis or acute appendicitis may occur. In the United States, approximately 1.5\u0026nbsp;million \u003cem\u003eCampylobacter\u003c/em\u003e infections are reported annually, with 20\u0026ndash;30% of these cases being associated with the consumption of poultry meat (CDC, 2018, 2019). Diarrheal illness may exhibit heightened severity in young children due to the vulnerabilities associated with their developing immune systems and exploratory behavior (Belina et al., 2024). Although it is infrequently fatal, 36% of persons afflicted with acute Campylobacteriosis are at risk of subsequent health complications including irritable bowel syndrome (IBS), within a timeframe of 1\u0026ndash;2 years, with a likelihood of developing IBS estimated at 9\u0026ndash;13% of \u003cem\u003eC. jejuni\u003c/em\u003e infection (Pimentel et al., 2015; Geissler et al., 2017), reactive arthritis (2\u0026ndash;5% of patients), and Guillain\u0026ndash;Barr\u0026eacute; syndrome (0.1% of patients), often resulting in neuromuscular paralysis which may cause permanent nerve damage in some cases, (Scallan et al., 2015; CDC, 2018).\u003c/p\u003e \u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e exhibits a significant prevalence in retail chicken meat and is closely linked to cases of human campylobacteriosis. Chickens are consistently recognized as principal reservoirs of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e infections, representing an estimated 31\u0026ndash;66% of clinical isolates in various research endeavors (Th\u0026eacute;pault et al., 2018). Chickens were identified as the predominant source of human campylobacteriosis in 45.8\u0026ndash;65.4% of documented cases in Denmark, 68\u0026ndash;72% in the United States, and over 80%in Australia (Pascoe, 2022; Brinch et al., 2023; McLure et al., 2023). In Japan, this trend mirrors that observed in other industrialized nations (Vetchapitak and Misawa, 2019). Raw or inadequate poultry meat and associated meat products are recognized as the primary contributors to \u003cem\u003eCampylobacter jejuni/coli\u003c/em\u003e responsible for approximately one-fourth of total foodborne illness cases of campylobacteriosis (Clarke and Ajlouni, 2021). The gastrointestinal tract of chicken functions as a natural reservoir for \u003cem\u003eCampylobacter\u003c/em\u003e, thereby facilitating its propagation throughout eggshells. Also, fecal leaks during evisceration, contact with contaminated equipment, and exposure to contaminated water substantially elevate the risk of contamination. For instance, the discharge of merely 5 mg of cecal matter during evisceration has been shown to augment \u003cem\u003eCampylobacter\u003c/em\u003e loads by 0.6 log CFU in prechill rinses (EFSA-ECDC, 2021; Pascoe et al., 2023).\u003c/p\u003e \u003cp\u003eInsufficient hygiene practices, such as inadequate handwashing and the utilization of contaminated cutting boards exacerbate the risk of \u003cem\u003eCampylobacter\u003c/em\u003e transmission. Research has indicated that 63.1% of restaurants engage in at least one practice that may lead to potential cross-contamination, with only one out of the 23 assessed cutting boards being sufficiently sanitized with disinfectant. Scrubbing hands for less than five seconds was correlated with a notable increase in the likelihood of contamination (Lai et al., 2023; Kirchner et al., 2023). Improving hygiene practices, monitoring broiler processing facilities, and public education initiatives regarding appropriate food handling are essential measures for alleviating the public health consequences of \u003cem\u003eCampylobacter\u003c/em\u003e infections (Kimiran, 2024). Furthermore, humans may get infected through contact with infected individuals, animals, contaminated environments, or the fecal-oral route, underscoring the critical importance of food safety and hygiene in the prevention of campylobacteriosis (McLure et al., 2023; Nowak et al., 2024).\u003c/p\u003e \u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e ranks among the four principal etiological agents of gastroenteritis globally and has increased prevalence in both developed and developing nations over the past decade. The overwhelming majority of reported \u003cem\u003eCampylobacter\u003c/em\u003e infections are attributed to \u003cem\u003eC. jejuni\u003c/em\u003e and, to a lesser degree, \u003cem\u003eC. coli\u003c/em\u003e (Costa and Iraola, 2019).\u003c/p\u003e \u003cp\u003eConsequently, the primary aims of this investigation were to scrutinize the incidence of \u003cem\u003eCampylobacter\u003c/em\u003e in broiler meat and table eggs, the environmental context surrounding meat processing in small-scale slaughterhouses, and restaurants, as well as its correlation with \u003cem\u003eCampylobacter\u003c/em\u003e infection in humans.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Sample collection\u003c/h2\u003e \u003cp\u003eA total of 440 specimens were analyzed, comprising 120 specimens derived from broiler meat and chicken meat products, 100 table eggs, and 100 human fecal samples obtained from healthcare facilities and clinical laboratories, along with 120 specimens sourced from poultry processing environments, specifically poultry slaughtershops, and restaurant kitchens. Each specimen was collected in a sterile polyethylene bag and subsequently transported to the laboratory utilizing a sampling box equipped with ice pads, ensuring minimal delay (Donnison, 2003).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.2. Sample Preparation\u003c/h3\u003e\n\u003cp\u003e Twenty-five grams of each chicken meat specimen was aseptically transferred to a sterile stomacher bag containing 225 ml of Bolton broth supplemented with 5% Laked horse blood (Oxoid, SR048) and modified Bolton broth selective supplement (Oxoid, SR0183E), followed by homogenization for a duration of 1 minute (Hunt and Abeyta, 1998). The preparation of egg shells and their contents was conducted following the methodology established by Jones and Musgrove (2007). Pooled samples (2 eggs from each package). Swabs from human fecal matter and poultry droppings were collected in sterile containers containing 9 ml of Bolton broth with additional supplementation. Surface swabs were procured utilizing a 25 cm\u0026sup2; sterile metal template. Water samples were gathered in clean, sterile 500 ml bottles and subsequently concentrated through centrifugation at 20,000 rpm for 10 minutes. The resultant pellet was resuspended in test tubes containing 9 ml of Bolton broth supplemented with water (Fricker and Park, 1989).\u003c/p\u003e\n\u003ch3\u003e2.2. Isolation and Identification\u003c/h3\u003e\n\u003cp\u003eThe specimens underwent aseptic incubation for 4 hours at 37\u0026deg;C to facilitate the resuscitation of stressed organisms, followed by subsequent incubation at 42\u0026deg;C for a period ranging from 20 to 44 hours under micro-aerophilic conditions achieved using a gas generating kit (Oxoid CampyGen, CN0035A). Additionally, each environmental swab was immersed in sterile tubes containing 10 ml of Bolton broth (Hunt and Abeyta, 1998). A loopful (10 \u0026micro;l) was extracted from each Bolton broth enrichment culture after 48 hours and streaked onto Modified Charcoal Cefoperazone Deoxycholate Agar (mCCDA) (Oxoid, CM0739), a selective solid medium with appropriate selective supplements (Oxoid, SR0155E). The culture plates were incubated microaerobically within a controlled microaerobic environment utilizing an anaerobic jar and \u003cem\u003eCampylobacter\u003c/em\u003e gas-generating kits at 42\u0026deg;C for 48 hours (Bolton et al., 1984). Direct inoculation of human stool and poultry fecal swabs onto mCCDA was performed (Maher et al., 2003). Positive colonies exhibited characteristics of being grayish-white, convex, and moist. The confirmation of positive strains was accomplished through Gram staining, motility assessment, oxidase tests (Oxoid, MB0266A), catalase reaction, Hippurate hydrolysis (Sodium Hippurate, Sigma, H9380; Ninhydrin, Merck, 6762), H2S reaction on triple sugar iron agar slants (Oxoid, CM0277), susceptibility testing to nalidixic acid (30 \u0026micro;g) and cephalothin (30 \u0026micro;g) on Muller Hinton agar (Oxoid, CM0337) (WOAH, 2005; ISO, 2006).\u003c/p\u003e\n\u003ch3\u003e2.3. Molecular Characterization\u003c/h3\u003e\n\u003cp\u003eBacterial DNA was extracted via a Wizard\u0026reg; Genomic DNA Purification Kit (Promega, A1120). A five \u0026micro;l aliquot was employed as a template for PCR amplification (Shah et al., 2009). Primer sequences were procured from Metabion (Germany), and were employed as forward and reverse primers for the amplification of \u003cem\u003e23S rRNA, hip O\u003c/em\u003e, and \u003cem\u003egly A\u003c/em\u003e genes for the identification of \u003cem\u003eCampylobacter\u003c/em\u003e species (Table A).\u003c/p\u003e \u003cp\u003eMultiplex PCR amplification for the \u003cem\u003e23S rRNA, hip O\u003c/em\u003e, and \u003cem\u003egly A\u003c/em\u003e genes of \u003cem\u003eCampylobacter\u003c/em\u003e species. In each reaction tube 2.5 \u0026micro;l of Green Taq hot-start polymerase, 1 \u0026micro;l of each primer, and 0.5 \u0026micro;l of DNA template were added, then nuclease-free water to a volume of 25 \u0026micro;l. A thermocycler (Takara, Code No. RR310A) was used with an initial denaturation step at 95\u0026deg;C for 6 minutes followed by 30 cycles (denaturation at 95\u0026deg;C for 30 seconds, annealing at 59\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 30 seconds for species genes), ending with a final extension for 7 minutes at 72\u0026deg;C (Wang et al., 2002) (Table B). The amplified products were analyzed via 1.5% agarose gel electrophoresis (Sambrook et al., 1989), stained with ethidium bromide, and visualized on a UV transilluminator (Andrzejewska et al., 2011).\u003c/p\u003e \u003cp\u003e \u003cb\u003eTable A: Primer sequences of\u003c/b\u003e \u003cb\u003eCampylobacter\u003c/b\u003e \u003cb\u003espp\u003c/b\u003e. \u003cb\u003eaccording to Wang (2002)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003cp\u003egene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOligonucleotide sequence (5\u0026prime;\u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eProduct\u003c/p\u003e \u003cp\u003esize (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003e23S\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003e23S rRNA\u003c/em\u003e\u003c/p\u003e \u003cp\u003e(All Spp.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTATACCGGTAAGGAGTGCTGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e650 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATCAATTAACCTTCGAGCACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ehip O\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCJ\u003c/p\u003e \u003cp\u003e(\u003cem\u003eC. jejuni\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACTTCTTTATTGCTTGCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e323 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCACAACAAGTAAAGAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egly A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003cp\u003e(\u003cem\u003eC. coli\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTAAAACCAAAGCTTATCGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e126 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCCAGCAATGTGTGCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTable B: PCR Cycling conditions according to Wang et al. (2002)\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStep\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTemp.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo. of cycles\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1. Primary denaturation and activation of hot start green Taq DNA polymerase.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e94˚C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 min.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003e2. Cycling\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA. Secondary denaturation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e95˚C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 sec.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e35 cycles\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB. Primer annealing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e59˚C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 sec.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC. Extension\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e72˚C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 sec.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3. Final extension\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e72˚C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7 min.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 cycle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data were statistically analyzed via SPSS version 22, and all significance levels were considered at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The associations between positive campylobacteriosis and the sources of the examined samples were calculated via Pearson\u0026rsquo;s chi-square test. The model was built in @Risk 7.5.2 (Palisade, Inc.) software. A Monte Carlo simulation (10,000 iterations) was used to estimate the probability of risks.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003ePositive colonies displayed phenotypic traits consistent with a grayish-white coloration, convex morphology, and a moist texture. The organisms were identified as Gram-negative, spiral, S-shaped, and curved rod-shaped bacteria, exhibiting motility characteristic of corkscrew-like movement, with positive results for catalase and oxidase tests (\u003cem\u003eC. jejuni/C. coli\u003c/em\u003e). Species were initially categorized based on their capacity to hydrolyze Hippurate, susceptibility to cephalothin and nalidixic acid, and H2S production as delineated by Rautelin et al. (1999) and Totten et al. (1987) (Fig. 1). \u003cem\u003eCampylobacter\u003c/em\u003e was identified in chicken meat, table eggs, environment, and human fecal samples at prevalence rates of 20.83, 3, 28.33, and 23.33%, respectively. The findings indicated that the prevalence rates among chicken carcasses, breasts, and thighs were 40, 16.67, and 26.67%, respectively, whereas it was undetectable in processed chicken Luncheon and chicken nuggets. The prevalence rates in environmental samples were recorded as 46.67%, 16.67%, and 50% in slaughterhouses, restaurant swabs, and fecal samples, respectively, while tap water samples were found to be devoid of \u003cem\u003eCampylobacter\u003c/em\u003e contamination (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe incidence of \u003cem\u003eCampylobacter\u003c/em\u003e in humans suffering from diarrhea was found to be 46.67% (14/30) in children aged 6 months to 5 years, 33.33% (10/30) in those aged 6\u0026ndash;15 years, and 13.33% (4/30) in those aged 16\u0026ndash;35 years; however, no detection was reported in patients aged 36\u0026ndash;60 years (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCampylobacter\u003c/em\u003e isolates were identified via multiplex PCR of the \u003cem\u003e23S rRNA\u003c/em\u003e gene in 9.17% (11/120), 2% (2/100), 7.5% (9/120), and 5% (6/120) of the chicken meat samples, eggs, environment, and human samples (Tables \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e,\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e and Figs. 2\u0026ndash;4). Genetic analysis of positive isolates for the differentiation of \u003cem\u003eCampylobacter\u003c/em\u003e species through detection of the \u003cem\u003ehipO\u003c/em\u003e and \u003cem\u003eglyA\u003c/em\u003e genes revealed that 4.57% (21/460) were \u003cem\u003eC. jejuni\u003c/em\u003e [21/28, 75%], 1.74% (8/460) [7/28, 25%] were \u003cem\u003eC. coli\u003c/em\u003e, and 1 sample was mixed contaminated with \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC.coli.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe odds ratio (OR) was 1.73 indicating that people are 1.73 times more likely to test positive for \u003cem\u003eCampylobacter\u003c/em\u003e spp. if chicken samples were contaminated. The Pearson correlation coefficient (𝑟) was \u0026asymp;\u0026thinsp;0.852, indicating a strong positive correlation between \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e across the samples. In chicken meat, the OR was 1.071, and the \u003cstrong\u003eZ-value\u003c/strong\u003e for a 95% confidence interval is \u003cstrong\u003e1.96 (\u003c/strong\u003eTable \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eA Monte Carlo simulation for risk assessment with 10,000 iterations was used, mean, 95% confidence interval (CI). The probability of \u003cem\u003eC. jejuni\u003c/em\u003e /\u003cem\u003eC. coli\u003c/em\u003e being at a high-risk level in chicken meat was 74.51/ 49.28%. This indicates a high likelihood of contamination with \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e in chicken meat, making them significant risks for foodborne illness. The probability of \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e being at a high-risk level in environmental samples (e.g., food contact surfaces, etc.) was 49.22, and 15.72%, suggesting a moderate risk level concern in environmental settings. The probability of \u003cem\u003eC. jejuni\u003c/em\u003e being at a high-risk level in human samples (e.g., from stool or clinical samples) was 15.38%, which is relatively low, \u003cem\u003eC. coli\u003c/em\u003e (2.42%), which is quite low, indicating a very low risk of infection from \u003cem\u003eC. coli\u003c/em\u003e in humans (Table \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eIncidence of \u003cem\u003eCampylobacter\u003c/em\u003e species in broiler meat, table eggs, and environmental samples via biochemical tests\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSamples\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003ePresumptive culture\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eBiochemical identification\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"4\"\u003e\n \u003cp\u003eHippurate\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNegative\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eBroiler meat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCarcass\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e40.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBreast\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eThigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e26.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProducts\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e120\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e25\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e20.83\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e12\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e7.5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e3.33\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTable egg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEgg content\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEggshell\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eEnvironment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSlaughter shops\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e46.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRestaurant swabs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFecal swabs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e33.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWater\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e120\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e34\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e28.33\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e16.67\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e13\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e10.83\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.67\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e-: not detected in culture and biochemical. Chi-square statistic (\u0026chi;\u0026sup2;): 7.51, the p-value (0.057) suggests no statistically significant difference in the distribution of positive \u003cem\u003eCampylobacter\u003c/em\u003e across the different broiler meat sample types at the 0.05 significance level.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2: Incidence of \u003cem\u003eCampylobacter\u003c/em\u003e species in human stool samples\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003evia\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;biochemical tests\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\" style=\"margin-right: calc(56%); width: 44%;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eSamples\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePresumptive culture\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBiochemical identification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 37px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHippurate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 0px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 6px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNegative\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 34px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eChildren\u0026apos;s diarrhea\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e0.5 - 4 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 6px;\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e46.67\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e23.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e5 -15 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 6px;\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e33.33\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e16.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e16-35 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 6px;\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e13.33\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e6.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e36-60 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 6px;\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e0\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 6px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e120\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e28\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e23.33\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e14\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e11.67\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e3.33\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.67\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e-: not detected in culture and biochemical. Different superscript letters indicate significant differences. There was a significant relationship [p-value=0.0053] between age group and presumptive positivity for \u003cem\u003eCampylobacter\u003c/em\u003e. The incidence rates are not evenly distributed across age groups.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u003cstrong\u003eTable 3: Prevalence of \u003cem\u003eC. jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;C. coli\u0026nbsp;\u003c/em\u003ein chicken meat, table eggs, and environmental samples determined via multiplex PCR\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabc\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSamples\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003e\u003cem\u003e23S rRNA\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eC. jejuni\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eC. coli\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChicken meat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChicken carcass\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBreast\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eThigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProducts\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e120\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e11\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e9.17\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e6.67\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTable egg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEgg content\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEggshell\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eEnvironmental sample\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSlaughter shop\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRestaurant swabs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCloacal swabs*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWater\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e120\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e7.5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e5.83\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e340\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e6.47\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e17\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.76\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"8\"\u003e-: not performed. There is no significant difference [p-value\u0026thinsp;=\u0026thinsp;0.455] in the prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e spp. across different chicken meat samples (carcass, breast, thigh). *mixed \u003cem\u003eC.jejuni \u0026amp; C.coli\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003ctable id=\"Tab4\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrevalence of \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e in human stool samples determined via multiplex PCR.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSamples\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003e\u003cem\u003e23S rRNA\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eC. jejuni\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eC. coli\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.5\u0026ndash;4 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026ndash;15 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16\u0026ndash;35 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e36\u0026ndash;60 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e120\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.67\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e-: not detected in culture or biochemical.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab5\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eCorrelation of \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e from broiler meat, egg, and environment to human infection.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSamples\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003e\u003cem\u003e23S rRNA\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eC. jejuni\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eC. coli\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003emixed\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eOR\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e[95% CI]\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChicken meat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.071\u003c/p\u003e\n \u003cp\u003e[0.15:7.62]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTable egg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003cp\u003e[0.067:3.764)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEnvironment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003cp\u003e[0.067:3.764)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.333\u003c/p\u003e\n \u003cp\u003e[0.123:14.336]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e460\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e28\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e6.09\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e21\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e4.57\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.74\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e𝑟\u0026asymp;0.852\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eC. jejuni/C. coli\u003c/em\u003e ratio (n\u0026thinsp;=\u0026thinsp;28)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e21\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e75\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e25\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e3.57\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eOdds Ratio (OR\u0026thinsp;=\u0026thinsp;1.73): People are 1.73 times more likely to test positive for \u003cem\u003eCampylobacter\u003c/em\u003e spp. if chicken samples are contaminated, though the CI includes 1, indicating this is not statistically significant. 95% CI (0.61\u0026ndash;4.93): The wide CI suggests limited precision. The Pearson correlation coefficient 𝑟\u0026asymp;0.852, indicates a strong positive correlation between \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e across the samples. Chicken Meat, OR\u0026thinsp;=\u0026thinsp;1.071, and the \u003cstrong\u003eZ-value\u003c/strong\u003e for a 95% confidence interval is \u003cstrong\u003e1.96\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 6: Probability of high risk of \u003cem\u003eC. jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;C. coli\u0026nbsp;\u003c/em\u003ein the examined samples (%). \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"95%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eC. jejuni\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;C. coli\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33px;\"\u003e\n \u003cp\u003eChicken meat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28px;\"\u003e\n \u003cp\u003e74.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37px;\"\u003e\n \u003cp\u003e49.28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33px;\"\u003e\n \u003cp\u003eTable egg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28px;\"\u003e\n \u003cp\u003e12.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37px;\"\u003e\n \u003cp\u003e1.21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33px;\"\u003e\n \u003cp\u003eEnvironmental sample\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28px;\"\u003e\n \u003cp\u003e49.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37px;\"\u003e\n \u003cp\u003e15.72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33px;\"\u003e\n \u003cp\u003eHuman\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 28px;\"\u003e\n \u003cp\u003e15.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37px;\"\u003e\n \u003cp\u003e2.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eA Monte Carlo simulation with a Latin hypercube sampling method (10,000 iterations) was used to generate pseudo-random numbers from all input probability distributions defined in the model (i.e. one iteration). The final probability density function of the output (mean, 95% confidence interval) accurately accounted for all possible scenarios for the given set of parameters defined in the exposure model.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e is classified as a Gram-negative, motile, non-sporulating bacterium, exhibiting a spiral or helical curved rod that can transition to filamentous or coccoid a response to environmental stresses (Kaakoush et al., 2015a). It is an obligate microaerophile possessing a relatively compact genome measuring 1.6 megabase pairs (Mbp). It exhibits numerous adaptive responses and occupies various ecological niches that facilitate its survival throughout the poultry production continuum (Hakeem and Lu, 2021). \u003cem\u003eCampylobacter\u003c/em\u003e species is the predominant etiological agent of gastroenteritis implicated in humans in the United Kingdom, with an annual incidence estimated at 300,000 cases (Holland and Mahmoudzadeh, 2020). Chickens are identified as the primary reservoir for thermotolerant \u003cem\u003eCampylobacter\u003c/em\u003e spp., being accountable for an anticipated 80% of human \u003cem\u003eCampylobacter\u003c/em\u003e infections (El-Gedawy et al., 2023).\u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e demonstrates that 20.83% of the broiler meat and meat product samples tested positive for \u003cem\u003eCampylobacter\u003c/em\u003e spp., as determined by culture and biochemical methodologies. This finding was similar to 20.7% in Italy (Nobile et al., 2013). This percentage is significantly lower than the 90.6% (Meeyam et al., 2004), 91.8% in Turkey (Yildirim et al., 2005), 68.7% (Ghafir et al., 2007), 62.4% in Canada (Valdivieso-Garcia et al., 2007), and 51% (Sammarco et al., 2010) from Northern Poland (Backert and Hofreuter, 2013), in addition to 66.7% from Brazil (Borges et al., 2020), 77.41% in China (Lai et al., 2023), and 28.6% in the United Arab Emirates (Habib et al., 2022). Variability in \u003cem\u003eCampylobacter\u003c/em\u003e contamination rates in retail poultry meat was reported by Andrzejewska et al. (2015), documenting rates of 60.2, 45.9, 38.6, 29.3, and 32.0% from 2009 to 2012.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e spp. was isolated from 12 out of 30 (40%) broiler carcasses (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A comparable result was documented by Andrzejewska et al. (2015), wherein the mean prevalence over a five-year span was calculated at 41.6%. This finding is lower than those reported by various studies Vashin and Stoyanchev (2004), Meldrum et al. (2005), Sheveleva et al. (2006), Franchin et al. (2007), Kuana et al. (2008), Rahimi and Tajbakhsh (2008), Suzuki and Yamamoto (2009), Rahimi et al. (2010), Rantsiou et al. (2010), Bagherpour et al. (2014), Tang et al. (2020), and Bouhamed (2023), whose reported prevalence rates ranged from 92\u0026ndash;100%, 58.6%, 67.6%, 71.3%, 99%, 56.1%, 59%, 51.2%, 79%, 56.7%, 53.4%, and 53.33%, respectively. Lower results were reported by Ledergerber et al. (2003), van Nierop et al. (2005), Stoyanchev et al. (2007), Yushina et al. (2020), and Chala et al. (2021) who reported that 7.9, 18.2, 35.3, 33, and 13% of chicken carcasses were contaminated with \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003c/p\u003e \u003cp\u003eCountries employing manual processing techniques exhibited elevated \u003cem\u003eCampylobacter\u003c/em\u003e contamination levels in poultry compared to nations utilizing contemporary processing facilities. The processes of manual slaughtering and evisceration are prone to result in fecal contamination of carcasses, thereby contributing to an increase in the prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e spp. within poultry meat (Parkar et al., 2013).\u003c/p\u003e \u003cp\u003eBreast samples yielded a contamination rate of 16.67% (5/30) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), which aligns with findings (16.67%) reported by Vashin and Stoyanchev (2004). This incidence was notably lower than the rates documented by Luu et al. (2006), Sallam (2007), Guyard-Nicod\u0026egrave;me et al. (2013), Awadallah et al. (2014), Sison et al. (2014), and Abd El-tawab et al. (2015), who reported incidence rates of 31.0, 64.4, 47.9, 25.9, 47.5, and 30.8%, respectively.\u003c/p\u003e \u003cp\u003eThigh samples demonstrated an isolation rate of 26.67% (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), with even greater rates reported by Vashin and Stoyanchev (2004), Sallam (2007), and Abd El-tawab et al. (2015), who documented isolation rates of 36.67, 70, and 38.5%, respectively. Conversely, Gritti et al. (2011) were unable to isolate \u003cem\u003eCampylobacter\u003c/em\u003e from thigh and breast samples utilizing both cultural and molecular techniques.\u003c/p\u003e \u003cp\u003eChicken meat products, specifically chicken nuggets and chicken luncheons, exhibited a complete absence of \u003cem\u003eCampylobacter\u003c/em\u003e spp., corroborating similar findings reported by Mohamad and Som (2012) and Abdel-Malek (2015). In contrast, Paulsen et al. (2005) successfully isolated \u003cem\u003eC. jejuni/C. coli\u003c/em\u003e from luncheons at frequencies of 15/5%, respectively, while failing to isolate these bacteria from nuggets. In Alexandria, Samaha et al. (2012) detected \u003cem\u003eC. jejuni\u003c/em\u003e in 16% of chicken pane samples, yet could not isolate it from chicken nuggets or luncheons. Furthermore, Lake and Cressey (2015) indicated that 0.07% of ready-to-eat chicken products tested positive for \u003cem\u003eCampylobacter\u003c/em\u003e in New Zealand. The inability to isolate \u003cem\u003eC. jejuni\u003c/em\u003e may be attributed to the elevated salt concentration and other constituents present in the marinades. \u003cem\u003eC. jejuni\u003c/em\u003e is incapable of proliferation in environments containing\u0026thinsp;\u0026ge;\u0026thinsp;2% NaCl at 42\u0026deg;C, yet it can survive in concentrations ranging from 0.5\u0026ndash;1.5% NaCl at the same temperature (Gomes et al., 2018). Additionally, \u003cem\u003eC. jejuni\u003c/em\u003e can be eradicated through the application of marinades. There exists a paucity of research about the prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e in frozen processed chicken products, attributed to the gradual decrease in \u003cem\u003eC. jejuni\u003c/em\u003e counts at typical freezing temperatures, which does not result in immediate activation of the organism in global food supplies (Mohamad and Som, 2012).\u003c/p\u003e \u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e spp. could not be detected in the contents of table eggs, although 2/50 (4%) of eggshells were contaminated, and 2% as an overall rate in eggs (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These results are comparable to those obtained in Assiut city by Amin (2017) and in Germany (4.1%) by Messelh\u0026auml;usser et al. (2011). A higher incidence rate of \u003cem\u003eCampylobacter\u003c/em\u003e in eggshells was reported in Japan, which was 36% (Sato and Sashihara, 2010, in Malaysia, (12%) (Nor Faiza et al., 2013), and in Tunisia (25.6%) by Gharbi et al., (2022). Lower rates were reported in Trinidad (1%) (Adesiyun et al., 2005), and in Egypt (Hedawey and Yousef, 2014).\u003c/p\u003e \u003cp\u003eThe contamination rates of food environmental samples from slaughter shops, restaurants, and fecal swabs were 46.6%, 16.67%, and 50%, respectively with 28.33% (34/120) as an overall environmental contamination rate. The water samples were free of \u003cem\u003eCampylobacter\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Slaughter shop samples were collected from the surfaces of the plucking machines, cutting boards, knives for eviscerating birds, and washing basins. Franchin et al. (2005) collected samples at different points before slaughter, and \u003cem\u003eCampylobacter\u003c/em\u003e spp. were found in litter, transport coops, coop rinse water, cloaca, feather, and breast support at rates of 37.5, 50, 25, 79.2, and 33.3%, respectively, with an average of 50%.\u003c/p\u003e \u003cp\u003eThe restaurant samples focused on points where the raw chicken meat was washed, handled, and contacted surfaces. 16.67% of the restaurant samples were positive for \u003cem\u003eCampylobacter\u003c/em\u003e spp., in contrast to Bellio et al. (2014) in Italy, who reported that all food contact surfaces were negative for \u003cem\u003eCampylobacter\u003c/em\u003e.\u003c/p\u003e \u003cp\u003ePoultry fecal swabs had a 50% \u003cem\u003eCampylobacter\u003c/em\u003e contamination rate, and similar isolation rates were previously reported by Meeyam et al. (2004), Henry et al. (2011), Brazil by Borges et al. (2020), Yushina et al. (2020), and Abdulwahab and Alhindwae (2025), who reported prevalence rates of 43.2, 54, 57, 50, and 44.5%, respectively. However, lower isolation rates of 35.9, 21.6, 39.2, 38.1, and 35.1% were reported by Awadallah et al. (2014), Jorgensen et al. (2011), M\u0026auml;esaar et al. (2014), Torralbo et al. (2014), and Abd El-Tawab et al. (2015), respectively. Additionally, the results obtained in the present study are greater than those obtained in Giza, Egypt, by Hassanain (2011), and Ghoneim et al. (2020) who detected 5/50 (10%) chicken fecal droppings, and 1.9% cloacal swabs, respectively.\u003c/p\u003e \u003cp\u003eGenerally, the variation in the \u003cem\u003eCampylobacter\u003c/em\u003e species isolation rate across different studies could be attributed to various factors, such as the type of examined samples, location, climate factors, hygienic measures, and isolation, as well as the identification techniques used by Jorgensen et al. (2011) and Chatur et al. (2014). The prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species in poultry is expected to be high in broilers slaughtered at 35\u0026ndash;42 days, whereas in older chickens, the prevalence decreases, reflecting acquired immunity (Kalupahana, et al., 2013).\u003c/p\u003e \u003cp\u003eAll water samples from slaughter shops and restaurants were free from \u003cem\u003eCampylobacter\u003c/em\u003e spp. (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This result is lower than the results (2, 6.7, and 20.5%) obtained from the Ashburton River by Devane (2006), Mubarak (2013), and Ghoneim et al. (2020). All samples from tap water were negative for the presence of \u003cem\u003eCampylobacter\u003c/em\u003e spp. This finding indicates that the chlorination of water inactivates \u003cem\u003eCampylobacter\u003c/em\u003e spp. (El Sayed, 2016).\u003c/p\u003e \u003cp\u003eNotably, \u003cem\u003eCampylobacter\u003c/em\u003e spp. was identified in 23.33% of stool samples obtained from patients with enteritis through microbiological examination (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), with analogous results reported in Assiut city by Abushahba et al. (2018) and Sayed et al. (2023), who identified \u003cem\u003eCampylobacter\u003c/em\u003e spp. in 27.55% and 29% of human and worker samples, respectively. Furthermore, Collado et al. (2013) documented rates of 28% and 25.7%, respectively. In Sohag, ElSayed (2016) reported a comparatively lower rate of 5.33%. Nonetheless, lower incidence rates of 20, 11.1, 15.7, 15, 10, 2.6, and 6.7% were observed by Roshdy (2000), Gerges (2004), Quetz et al. (2010), Dabboussi et al. (2012), Salim et al. (2014), Vaishnavi et al. (2015), and Ghoneim et al. (2020), respectively.\u003c/p\u003e \u003cp\u003eRegarding the prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e infections within the human demographic in Egypt, numerous antecedent investigations have indicated that Campylobacteriosis constitutes a significant etiological factor for diarrhea among pediatric populations in the nation (Kaakoush et al., 2015; Abdel-Ghany, 2019). In this context, it has been documented that approximately 85% of children in Egypt experience infection with \u003cem\u003eCampylobacter\u003c/em\u003e spp. during their inaugural year of life, accompanied by an annual incidence rate of 1.2 episodes (Omara et al., 2015; Sainato et al., 2018). These observations align with the outcomes of the current research, as delineated in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, which indicated that the highest incidence occurred in the age group of 6 months to 5 years (46.67%). In contrast, the incidence rates were recorded at 6.67% and 13.3% in the age ranges of 6\u0026ndash;15 and 16\u0026ndash;50 years, respectively. Notably, the pathogen could not be detected within the age range of 51\u0026ndash;70 years, yielding an overall detection rate of 28%. This finding corroborates the assertions made by Vaishnav et al. (2015), who reported that 50% of \u003cem\u003eCampylobacter\u003c/em\u003e isolates were derived from children under 5 years old, with a subsequent prevalence noted among individuals exceeding 10 years of age.\u003c/p\u003e \u003cp\u003eThis finding exceeds the results documented by Roshdy (2000) in Assiut city, Egypt, where \u003cem\u003eCampylobacter\u003c/em\u003e was isolated from 20% (30/150) of stool specimens obtained from infants afflicted with diarrhea, of which 16% (24/150) were identified as \u003cem\u003eC. jejuni\u003c/em\u003e, while \u003cem\u003eC. coli\u003c/em\u003e was isolated from 4% (6/150) of the stool samples. Furthermore, lower isolation frequencies of \u003cem\u003eCampylobacter\u003c/em\u003e spp. from human stool samples in Egypt were reported; Girgis et al. (2014) in Assiut; and Abd El-Tawab et al. (2015), who reported isolation rates of 2.7, 5.3, and 8%, respectively. Additionally, Kang et al. (2006), Hassanain (2011), and documented isolation rates of 6, and 2.9%, respectively. On the other hand, Awadallah et al. (2014) in Zagazig recorded a higher rate (56.6%).\u003c/p\u003e \u003cp\u003eConversely, more significant findings were presented by Meeyam et al. (2004), who indicated the presence of \u003cem\u003eCampylobacter\u003c/em\u003e spp. in 80% of stool samples collected from individuals employed in poultry farming. This elevated percentage may be ascribed to the collection of stool samples from humans interacting with poultry.\u003c/p\u003e \u003cp\u003e \u003cem\u003eC. jejuni\u003c/em\u003e is biochemically differentiated from other \u003cem\u003eCampylobacter\u003c/em\u003e species through the Hippurate hydrolysis assay, demonstrating a positive reaction for \u003cem\u003eC. jejuni\u003c/em\u003e and a negative response for alternative \u003cem\u003eCampylobacter\u003c/em\u003e species (Burnett et al., 2002).\u003c/p\u003e \u003cp\u003eVarious studies conducted across different Egyptian governorates have reported isolation rates of 8.5% and 38.09% for \u003cem\u003eC. jejuni\u003c/em\u003e derived from occupational workers (Omara et al., 2015; ElSayed, 2016; Abushahba et al., 2018). Furthermore, at the species level, \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e were identified in Sohag Governorate at a rate of 50% for each species (ElSayed, 2016), whereas the isolation rates in Assiut Governorate (Abushahba et al., 2018) were recorded at 11.7% and 6.7% for the respective species. In Egypt, poultry farms frequently exhibit deficiencies in biosecurity and control measures, which are regarded as predisposing factors contributing to the elevated incidence of the pathogen.\u003c/p\u003e \u003cp\u003eAmong others, it is evident that persons working at poultry shops and dealing with live birds are at high risk of acquiring various zoonotic pathogens, especially during the handling, slaughtering, and evisceration of birds. Conversely, several previous studies conducted in Bangladesh, and Egypt (Sarkar et al., 2014; El-Tawab et al., 2015) reported lower percentages (9.3, 11.5%) of \u003cem\u003eCampylobacter\u003c/em\u003e 38\u0026ndash;40.\u003c/p\u003e \u003cp\u003eThe data shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Figs.\u0026nbsp;2, 3, \u0026amp;4 revealed that the percentage of \u003cem\u003eC. jejuni\u003c/em\u003e was 75% (21/28) and \u003cem\u003eC. coli\u003c/em\u003e was 25% (7/28), 1 sample had mixed strains. These results are in line with those by Rahimi et al. (2010), and Abdulwahab and Alhindwae (2025) reported that the percentage of \u003cem\u003eC. jejuni/C. coli\u003c/em\u003e was 88.3%/11.7%, and 61.7%/20.22%, respectively. Additionally, Wong et al. (2007) reported that the distribution of \u003cem\u003eC. jejuni\u003c/em\u003e/\u003cem\u003eC. coli\u003c/em\u003e isolates from retail poultry in New Zealand (molecularly determined only) were 98.3/1.7%. Abd El-Tawab et al. (2014) reported that the percentages of \u003cem\u003eC. jejuni, C. coli, C. lari\u003c/em\u003e, and \u003cem\u003eC. hyointestinal\u003c/em\u003e infections were 54.4%, 42.1%, and 3.5%, respectively. Additionally, Uaboi-Egbenni et al. (2011) reported that 12.5% were identified as \u003cem\u003eCampylobacter jejuni\u003c/em\u003e and 87.5% as \u003cem\u003eCampylobacter coli\u003c/em\u003e. The prevalence of \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e among the examined samples was 61.7% and 20.22%, respectively (Abdulwahab and Alhindwae, 2025; Schreyer et al., 2022; Rodrigues et al., 2021; Lynch et al., 2022). These findings agree with the findings of other studies, in which the occurrence of \u003cem\u003eC. jejuni\u003c/em\u003e was higher than \u003cem\u003eC. coli\u003c/em\u003e. A possible explanation for these results may be the more sensitive nature of \u003cem\u003eC. coli\u003c/em\u003e to stress conditions during slaughtering process of broilers.\u003c/p\u003e \u003cp\u003evan Nierop et al. (2005), Rahimi and Tajbakhsh (2008), and Awadallah et al. (2014) reported similar isolation rates of \u003cem\u003eC. coli\u003c/em\u003e from fresh chicken meat samples at rates of 6.7, 6.9, and 10.8%, respectively.\u003c/p\u003e \u003cp\u003eIn eggshell samples, 2 isolates from eggshells were positive for the \u003cem\u003e23S rRNA\u003c/em\u003e, \u003cem\u003eC. jejuni\u003c/em\u003e was identified in all 2/50 (4%) using the Hippurate test and mPCR, while 1 sample had mixed \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e contamination (Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e,\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Fig.\u0026nbsp;4). Also, a predominance of \u003cem\u003eC. jejuni\u003c/em\u003e (81.9%) compared to \u003cem\u003eC. coli\u003c/em\u003e (18.2%) was obtained in Gharbi et al. (2022).\u003c/p\u003e \u003cp\u003eFor the environmental samples, the \u003cem\u003eC. jejuni\u003c/em\u003e/\u003cem\u003eC. coli\u003c/em\u003e ratio (6/3) identified in the current study was 67.67/33.33%. Similarly, the ratios obtained by (Abd El-Tawab et al., 2015), \u003cem\u003eC. jejuni\u003c/em\u003e, and \u003cem\u003eC. coli/C. lari\u003c/em\u003e were identified in 76.9, and 23.1% of the human isolates, respectively. A higher \u003cem\u003eCampylobacter\u003c/em\u003e spp. detection rate was reported among workers in percentages of 24% in the 18\u0026ndash;50 years age groups by Sayed et al. (2023). (\u003cem\u003eC. jejuni\u003c/em\u003e 15%, and \u003cem\u003eC. coli\u003c/em\u003e 14%) of the workers examined via mPCR. Higher isolation rates of \u003cem\u003eC. jejuni\u003c/em\u003e was reported in different studies by Salihu et al. (2012) and Mansouri-najand et al. (2012). Low percentages of 44.4% and 31.4% were reported by Pezzotti et al. (2003) and Henry et al. (2011), respectively. However, Hassanain (2011) identified all human and poultry isolates obtained at Giza governorate as \u003cem\u003eC. jejuni\u003c/em\u003e via biochemical testing, which may be due to the inability to differentiate between \u003cem\u003eC. jejuni and C. coli\u003c/em\u003e via phenotypic tests, especially when mixed on the same sample, in addition to selective plating and supplements that enhance \u003cem\u003eC. jejuni\u003c/em\u003e and may lower the other \u003cem\u003eCampylobacter\u003c/em\u003e spp.\u003c/p\u003e \u003cp\u003e \u003cem\u003eC. jejuni\u003c/em\u003e was identified in 4.14% (5/120) and 0.83% (1/120) of the \u003cem\u003eC. coli\u003c/em\u003e strains in the examined human samples (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, and Figs.\u0026nbsp;3,4). Similar percentages of \u003cem\u003eC. jejuni\u003c/em\u003e (5.8 and 1.5%) were obtained in other studies conducted in France and India (Bess\u0026egrave;de et al., 2011; Rajagunalan et al., 2014). On the other hand, higher percentages of \u003cem\u003eC. jejuni\u003c/em\u003e (21.4, 63.6%) were reported in other studies (Workman et al., 2006). Higher percentages of \u003cem\u003eC. coli\u003c/em\u003e (31.8, 2.5, and 1.5%) were obtained in other studies (Workman et al., 2006, Bess\u0026egrave;de et al., 2011; Rajagunalan et al., 2014).\u003c/p\u003e \u003cp\u003eIn children aged 0.5-4 years, \u003cem\u003eC. jejuni/ C. coli\u003c/em\u003e was detected at a rate of 3:1 in the stool samples, and 1:1 in those aged 5\u0026ndash;15 years. Similar detection rates of \u003cem\u003eC. jejuni\u003c/em\u003e were reported by Abd El-Tawab et al. (2015), Sorokin et al. (2007), and Ewnetu and Mihret (2010), who detected \u003cem\u003eC. jejuni\u003c/em\u003e at rates of 70.9, 69.3, and 94.1%, respectively. Awadallah et al. (2014) identified 7.4% and 3.7% as \u003cem\u003eC. coli\u003c/em\u003e and \u003cem\u003eC. jejuni\u003c/em\u003e, respectively. Different isolation rates of \u003cem\u003eC. coli\u003c/em\u003e and \u003cem\u003eC. jejuni\u003c/em\u003e (55.5% versus 31.4%, and 57.5% versus 0%, respectively. were obtained by Henry et al. (2011) and Marinou et al. (2012). Sayed et al. (2023) reported that \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e were recovered from workers in 18\u0026ndash;50 years age groups at percentages of 12% each.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eCampylobacteriosis remains a pressing global health issue driven by contamination of broiler meat and food environments. Poultry meat and poultry meat products are important sources of \u003cem\u003eCampylobacter\u003c/em\u003e infections. The environment and humans can be sources of \u003cem\u003eCampylobacter\u003c/em\u003e contamination. \u003cem\u003eCampylobacter\u003c/em\u003e food poisoning is caused mainly by \u003cem\u003eCampylobacter jejuni\u003c/em\u003e and to a lesser extent by \u003cem\u003eCampylobacter coli\u003c/em\u003e and other species. Efforts to mitigate \u003cem\u003eCampylobacter\u003c/em\u003e contamination must address both preharvest and// postharvest stages. Strategies include improving biosecurity, ensuring hygienic processing, and minimizing cross-contamination. Consumer education on the proper cooking and handling of poultry products remains critical for reducing infection risk.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study adhered to ethical guidelines and was approved by the relevant ethical committee(s) at the Animal Health Research Institute, Agriculture Research Center, Egypt following the Declaration of Helsinki. Animal studies complied with the Animal Health Research Institute, Agriculture Research Center, Egypt animal welfare guidelines. The authors declared that no animal was injured, hurt, or suffering during this study, and informed consent was obtained from all participants before their involvement in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Consent for publication was obtained from all participants or their legal guardians, where applicable. No individual identifiable data, images, or videos of participants are included in this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003enot applicable\u003cbr\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The authors declare that they have no financial and non-financial competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;TEAT: collection of broiler meat, and environmental samples, microbiological analysis, molecular biology, writing manuscript, corresponding the journal, \u0026nbsp;substantial contributions to the conception and design of the study, and Responsible for ensuring the accuracy and integrity of the work, with a commitment to investigating and resolving any issues related to the manuscript. AAY: provided human and egg samples, technical support in the microbiological analysis, and the biochemical identification of the isolates, revising the results, and approved the submitted version of the manuscript and any substantially modified versions. Both authors agree to be accountable for their contributions to the study and the manuscript, and ensure that any questions related to the work\u0026rsquo;s accuracy and integrity are addressed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e: Not applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbd El-Ghany WA (2019) One health approach of campylobacteriosis in Egypt: an emerging zoonotic disease. J Infect Develop Countries, 13: 956-960. doi: 10.3855/jidc.11860.\u003c/li\u003e\n \u003cli\u003eAbd El-Malek AM (2015) Occurrence of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e in chicken meat, and chicken meat products. International Journal of Advanced Research, 3(5): 212-217.\u003c/li\u003e\n \u003cli\u003eAbdel-Tawab AA, Ammar AM, Ahmed HA, Hofny FI, and Ahmed A (2015) Bacteriological and molecular identification of \u003cem\u003eCampylobacter\u003c/em\u003e species in chickens and humans, at Zagazig City, Egypt. Benha Veterinary Medical Journal, 28 (1):17‐26. doi: 10.21608/bvmj.2015.32523.\u003c/li\u003e\n \u003cli\u003eAbdulwahab HM, Alhindwae AN (2025) \u003cem\u003eCampylobacter\u003c/em\u003e prevalence, molecular detection, and virulence gene profiles isolated from broilers slaughtered in the Faith Al-Qasim Slaughterhouse. Egyptian Journal of Veterinary Science (Egypt), 56 (6): 1337-1346. https://doi.org/10.21608/EJVS.2024.269865.1850.\u003c/li\u003e\n \u003cli\u003eAbushahba M, Ahmed S, Ibrahim A, Mosa H. (2018). Prevalence of zoonotic species of \u003cem\u003eCampylobacter\u003c/em\u003e in broiler chicken and humans in Assiut governorate. Egypt Approaches Poult Dairy Vet Sci. 3:260\u0026ndash;8. doi: 10.31031/APDV.2018.03.000568.\u003c/li\u003e\n \u003cli\u003eAdesiyun A, Offiah N, Seepersadsingh N, Rodrigo S, Lashley V, Musai L, Georges K (2005) Microbial health risk posed by table eggs in Trinidad. Epidemiol. Infect., 133, 1049\u0026ndash;1056.\u003c/li\u003e\n \u003cli\u003eAmin WF (2019). Incidence of some food-borne pathogens in table eggs in Assiut City, Egypt. International Journal of Trend in Research and Development, Volume 4(6): 75-80. ISSN: 2394-9333 www.ijtrd.com November 2017.\u003c/li\u003e\n \u003cli\u003eAndrzejewska M, Klawe J, Szczepańska B, Śpica D (2011) Occurrence of virulence genes among \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e isolates from domestic animals and children. Polish journal of veterinary sciences 14: 207-211.\u003c/li\u003e\n \u003cli\u003eAndrzejewska M, Szczepańska B, Śpica D, Klawe JJ (2015) Trends in the occurrence and characteristics of \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e isolates from poultry meat in Northern Poland. Food Control, 51: 190\u0026ndash;194.\u003c/li\u003e\n \u003cli\u003eAwadallah MAI, Ahmed HA, El-Gedawy AA, Saad AM (2014) Molecular identification of \u003cem\u003eC. jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;C. coli\u003c/em\u003e in chicken and humans, at Zagazig, Egypt, with reference to the survival of \u003cem\u003eC. jejuni\u003c/em\u003e in chicken meat at refrigeration and freezing temperatures. International Food Research Journal, 21(5): 1801-1812.\u003c/li\u003e\n \u003cli\u003eBackert S, Hofreuter D (2013) Molecular methods to investigate adhesion, transmigration, invasion and intracellular survival of the foodborne pathogen \u003cem\u003eCampylobacter jejuni\u003c/em\u003e. Journal of Microbiological Methods, 95(1): 8-23.\u003c/li\u003e\n \u003cli\u003eBagherpour A, Ahmadi A, Soltanialvar M (2014) Survey of \u003cem\u003eCampylobacter\u003c/em\u003e contamination in poultry meat and by-products in Dezful province, Walia Journal 30(1): 115-118.\u003c/li\u003e\n \u003cli\u003eBarakat AM, Abd El-Razik KA, Elfadaly HA, Rabie NS, Sadek SA, Almuzaini AM. (2020) Prevalence, molecular detection, and virulence gene profiles of Campylobacter species in humans and foods of animal origin. Veterinary World. 13:1430\u0026ndash;1438. doi: 10.14202/vetworld.2020.1430-1438,\u003c/li\u003e\n \u003cli\u003eBelina D, Gobena T, Kebede A, Chimdessa M, Mummed B, Thystrup CAN, Hald T (2024) Occurrence and diversity of \u003cem\u003eCampylobacter\u003c/em\u003e species in diarrheic children and their exposure environments in Ethiopia. PLOS Global Public Health, 4 (10): 1-19. https://doi.org/10.1371/journal.pgph.0003885.\u003c/li\u003e\n \u003cli\u003eBellio A, Traversa A, Adriano D, Bianchi DM, Colzani A, Gili S, Grattarola C, Maurella CF, Decastelli L (2014) Occurrence of thermotolerant \u003cem\u003eCampylobacter\u003c/em\u003e in raw poultry meat, environmental and pigeon stools collected in open-air markets. Italian Journal of Food Safety, 3 (3): 157-159. doi: 10.4081/ijfs.2014.1706.\u003c/li\u003e\n \u003cli\u003eBess\u0026egrave;de E, Delcamp A, Sifr\u0026eacute; E, Buissonni\u0026egrave;re A, M\u0026eacute;graud F (2011) New methods for detection of campylobacters in stool samples in comparison to culture. J Clin Microbiol. 49:941\u0026ndash;4. doi: 10.1128/JCM.01489-10\u003c/li\u003e\n \u003cli\u003eBolton FJ, Coates D, Hutchinson DN, Godfree AF (1987) A study of thermophilic campylobacters in a river system. Journal of Applied Bacteriology, 62: 167-176.\u003c/li\u003e\n \u003cli\u003eBorges KA, Cisco IC, Furian TQ, Tedesco DC, Rodrigues LB, do Nascimento VP, dos Santos LR (2020) Detection and quantification of \u003cem\u003eCampylobacter\u003c/em\u003e spp. In Brazilian poultry processing plants. Journal of Infection in Developing Countries, 14(1): 109\u0026ndash;113. https://doi.org/10.3855/jidc.11973\u003c/li\u003e\n \u003cli\u003eBouhamed R (2023) \u003cem\u003eCampylobacter\u003c/em\u003e spp. at different stages of the poultry slaughtering line in Algeria: Evaluation of direct and indirect modified ISO 10272:2017 detection methods and characterization of the isolates. Archives of Razi Institute, May: 1657\u0026ndash;1667. https://doi.org/10.32592/ari.2023.78.5.1657\u003c/li\u003e\n \u003cli\u003eBrinch ML, Hald T, Wainaina L, Merlotti A, Remondini D, Henri C, Njage PMK (2023) Comparison of Source Attribution Methodologies for Human Campylobacteriosis. Pathogens. May 31 2023;12 (6):786. doi: 10.3390/pathogens12060786.\u003c/li\u003e\n \u003cli\u003eBurnett TA, Hornitzky MA, Kuhnert P, Djordjevic SP (2002) Speciating \u003cem\u003eCampylobacter jejuni\u003c/em\u003e and \u003cem\u003eCampylobacter coli\u003c/em\u003e isolates from poultry and humans using six PCR-based assays. FEMS Microbiol Lett. 216: 201-209. doi: 10.1111/j.1574-6968.2002.tb11436.x.\u003c/li\u003e\n \u003cli\u003eCDC (2018): Centers for Disease Control and Prevention. Yellow Book 2018: Health Information for International Travel. New York: Oxford University Press.\u003c/li\u003e\n \u003cli\u003eCDC \u0026ldquo;Centers for Disease Control and Prevention\u0026rdquo; (2019) \u003cem\u003eCampylobacter\u003c/em\u003e (Campylobacteriosis) (Final Update) [(accessed on 14 April 2020)]; Available online: https://www.cdc.gov/campylobacter/index.html.\u003c/li\u003e\n \u003cli\u003eChala G, Eguale T, Abunna F, Asrat D, Stringer A. (2021) Identification and Characterization of \u003cem\u003eCampylobacter\u003c/em\u003e Species in Livestock, Humans, and Water in Livestock Owning Households of Peri-urban Addis Ababa, Ethiopia: A One Health Approach. Front Public Heal., 9:750551\u003cstrong\u003e.\u003c/strong\u003e\u003c/li\u003e\n \u003cli\u003eChatur YA, Brahmbhatt MN, Modi S, Nayak JB (2014) Fluoroquinolone resistance and detection of topoisomerase gene mutation in \u003cem\u003eCampylobacter jejuni\u003c/em\u003e isolated from animal and human sources. International Journal of Current Microbiological Applied Sciences, 3(6): 773-783.\u003c/li\u003e\n \u003cli\u003eClarke AK, Ajlouni S (2021) Recommended practices to eliminate \u003cem\u003eCampylobacter\u003c/em\u003e from live birds and chicken meat in Japan. Food Saf (Tokyo) 9:57\u0026ndash;74. doi: 10.14252/foodsafetyfscj.D-20-00021.\u003c/li\u003e\n \u003cli\u003eCollado L, Guti\u0026eacute;rrez M, Gonz\u0026aacute;lez M, Fern\u0026aacute;ndez H (2013) Assessment of the prevalence and diversity of emergent \u003cem\u003eCampylobacter\u003c/em\u003e in human stool samples using a combination of traditional and molecular methods. Diagnostic Microbiology of Infectious Diseases, 75 (4): 434-446.\u003c/li\u003e\n \u003cli\u003eCosta D, Iraola G (2019) Pathogenomics of emerging \u003cem\u003eCampylobacter\u003c/em\u003e species. Clin. Microbiol. Rev. 32: e00072\u0026ndash;e00018. Doi: 10.1128/CMR.00072-18.\u003c/li\u003e\n \u003cli\u003eDabboussi F, Alam S, Mallat H, Hlais S, Hamze M (2012) Preliminary study on the prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e in childhood diarrhea in north Lebanon. East Mediterranean Health Journal, 18 (12): 1225-8.\u003c/li\u003e\n \u003cli\u003eDevane PM L (2006) The isolation and genotypic characterization of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e from environmental matrices. M.Sci. in Microbiology, University of Canterbury: 10-30.\u003c/li\u003e\n \u003cli\u003eDonnison A (2003) Isolation of thermotolerant \u003cem\u003eCampylobacter\u003c/em\u003e: Review and methods for New Zealand. Health San Francisco, 29: 75\u0026ndash;80.\u003c/li\u003e\n \u003cli\u003eEFSA-ECDC (2021) European Food Safety Authority\u0026rdquo;; European Centre for Disease Prevention and Control: The European Union One Health 2020 Zoonoses Report. EFSA J., 19: e06971.\u003c/li\u003e\n \u003cli\u003eEl-Gedawy AA, Abdelghafar AE, Mohamed HY, Elkady HA, Hassan MAFI, Ali AM (2023) Highlighting on the occurrence of \u003cem\u003eCampylobacter\u003c/em\u003e in chickens with special reference to its antimicrobial resistance. Egyptian Journal of Animal Health 3, 4 (2023): 257-272.\u003c/li\u003e\n \u003cli\u003eElSayed SAM (2016) Prevalence of virulence genes of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from poultry meat, human and environment. Master Degree Thesis, Faculty of Vet. Med. SVU:1\u0026ndash;150.\u003c/li\u003e\n \u003cli\u003eEwnetu D, and Mihret A (2010) Prevalence and antimicrobial resistance of \u003cem\u003eCampylobacter\u003c/em\u003e isolates from humans and chickens in Bahir Dar, Ethiopia. Faculty of Science, Bahir Dar University, Ethiopia. Foodborne Pathogenic Diseases, 7(6): 667-670.\u003c/li\u003e\n \u003cli\u003eFacciol\u0026agrave; A, Riso R, Avventuroso E, Visalli G, Delia SA, Lagan\u0026agrave; P (2017) \u003cem\u003eCampylobacter\u003c/em\u003e: From Microbiology to Prevention. J. Prevent. Med. Hyg. 2017: 58-62. DOI: 10.15167/2421-4248/jpmh2017.58.2.672.\u003c/li\u003e\n \u003cli\u003eFitzgerald C (2015). \u003cem\u003eCampylobacter\u003c/em\u003e. Clin. Lab. Med., 35: 289\u0026ndash;298.\u003c/li\u003e\n \u003cli\u003eFranchin PR, Aidoo KE, Batista CRV (2005) Sources of poultry meat contamination with thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e before slaughter. Brazilian Journal of Microbiology, 36(2): 157\u0026ndash;162.\u003c/li\u003e\n \u003cli\u003eFranchin PR, Ogliari PJ, Batista CRV (2007) Frequency of thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e in broiler chickens during industrial processing in a Southern Brazil slaughterhouse. Brazilian Poultry Science, 48:127-132.\u003c/li\u003e\n \u003cli\u003eFricker CR, Park RWA (1989) A two-year study of the distribution of thermophilic \u003cem\u003eCampylobacters\u003c/em\u003e in human, environmental, and food samples from the Reading area with particular reference to toxin production and heat-stable serotype. Journal of Applied Bacteriology, 66: 477-90.\u003c/li\u003e\n \u003cli\u003eGeissler AL, Carrillo FB, Swanson K, Patrick ME, Fullerton KE, Bennett C, Barrett K, Mahon BE (2017) Increasing Campylobacter infections, outbreaks, and antimicrobial resistance in the United States, 2004\u0026ndash;2012. Clin. Infect. Dis., 65:1624\u0026ndash;1631. doi: 10.1093/cid/cix624.\u003c/li\u003e\n \u003cli\u003eGerges AE (2004) The zoonotic importance of \u003cem\u003eCampylobacter\u003c/em\u003e infection in man and animals. M.V.Sc. Thesis, Fac. Vet. Med., Assiut University, 20-60.\u003c/li\u003e\n \u003cli\u003eGhafir Y, China B, Dierick K, Dezutter L, Daube G (2007) A seven-year survey of \u003cem\u003eCampylobacter\u003c/em\u003e contamination in meat at different production stages in Belgium. International Journal of Food Microbiology, 116:111-120.\u003c/li\u003e\n \u003cli\u003eGharbi M, B\u0026eacute;jaoui A, Ben Hamda C, Alaya N, Hamrouni S, Bessoussa G, Ghram A, Maaroufi A (2022) \u003cem\u003eCampylobacter\u003c/em\u003e spp. in eggs and laying hens in the North-East of Tunisia: High prevalence and multidrug-resistance phenotypes. Veterinary Sciences, 9(3): 108. https://doi.org/10.3390/vetsci9030108.\u003c/li\u003e\n \u003cli\u003eGhoneim NH, Sabry MA, Ahmed ZS, Elshafiee EA (2020) \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from chickens in Egypt: Molecular epidemiology and antimicrobial resistance. Pakistan Journal Zool., 2020: 1-10. DOI: https://dx.doi.org/10.17582/journal.pjz/20190324080346.\u003c/li\u003e\n \u003cli\u003eGhunaim H, Behnke JM, Aigha I, Sharma A, Doiphode SH, Deshmukh A, Abu-Madi MM (2015) Analysis of resistance to antimicrobials and presence of virulence/stress response genes in \u003cem\u003eCampylobacter\u003c/em\u003e isolates from patients with severe diarrhea. PLoS ONE, 10: e0119268.\u003c/li\u003e\n \u003cli\u003eGirgis SA, Rashad SS, Othman HB, Bassim HH, Kassem NN, El-Sayed F.M. (2014) Multiplex PCR for identification and differentiation of \u003cem\u003eCampylobacter\u003c/em\u003e species and their antimicrobial susceptibility pattern in Egyptian patients. International Journal of Current Microbiology Applied Science, 3(4): 861-875.\u003c/li\u003e\n \u003cli\u003eGomes CN, Passaglia J, Vilela FP, da Silva FMP, Duque SS, Falcao JP (2018) High survival rates of \u003cem\u003eCampylobacter coli\u003c/em\u003e under different stress conditions suggest that more rigorous food control measures might be needed in Brazil. Food Microbiol., 73: 327\u0026ndash;333. 10.1016/j.fm.2018.02.014\u003c/li\u003e\n \u003cli\u003eGritti D, Vaz CSL, Voss-Rech D, Alves L, Bortolini F (2011) Thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e survey in chilled and frozen poultry meat at retail in Concordia, Santa Catarina. Acta Scientiae Veterinariae, 39(3): 976-981.\u003c/li\u003e\n \u003cli\u003eGuyard-Nicod\u0026egrave;me M, Tresse O, Houard, E, Jugiau F, Courtillon C, El Manaa K, Laisney M, Chemaly M (2013) Characterization of \u003cem\u003eCampylobacter\u0026nbsp;\u003c/em\u003espp\u003cem\u003e.\u003c/em\u003e transferred from naturally contaminated chicken legs to cooked chicken slices via a cutting board. International Journal of Food Microbiology 164 (1): 7-14.\u003c/li\u003e\n \u003cli\u003eHabib I, Yousif M, Mohamed I, Lakshmi GB, Khan M, Li D (2022) Quantification of\u003cem\u003e\u0026nbsp;Campylobacter\u0026nbsp;\u003c/em\u003econtamination on chicken carcasses sold in retail markets in the United Arab Emirates. 4: 1\u0026ndash;8. https://doi.org/10.1186/s40550-022-00095-4.\u003c/li\u003e\n \u003cli\u003eHakeem MJ, Lu X (2021) Survival and Control of Campylobacter in Poultry Production Environment. Frontiers in Cellular and Infection Microbiology, 10 (January): 1\u0026ndash;18. https://doi.org/10.3389/fcimb.2020.615049\u003c/li\u003e\n \u003cli\u003eHassanain NA (2011) Antimicrobial-resistant \u003cem\u003eCampylobacter\u003c/em\u003e\u003cem\u003ejejuni\u003c/em\u003e isolated from humans and animals in Egypt. Global Veterinaria, 6 (2): 195-200.\u003c/li\u003e\n \u003cli\u003eHedawey KAA, Youssef AS (2014) Incidence of \u003cem\u003eCampylobacter\u003c/em\u003e species in laying hens and table egg in Sohag governorate. Assiut Vet. Med. J., 141: 120\u0026ndash;124\u003c/li\u003e\n \u003cli\u003eHenry I, Reichardt J, Denis M, Cardinale E (2011) Prevalence and risk factors for \u003cem\u003eCampylobacter spp.\u003c/em\u003e in chicken broiler flocks in Reunion Island (Indian Ocean). Preventive Veterinary Medicine, 100 (1): 64-70.\u003c/li\u003e\n \u003cli\u003eHolland D, Mahmoudzadeh N (2020) Foodborne Disease Estimates for the United Kingdom in 2018. Food Standards Agency. Available at: https://doi.org/10.46756/sci.fsa.squ824.\u003c/li\u003e\n \u003cli\u003eHunt JM, Abeyta CTT (edt.) (1998): Chapter 7: \u003cem\u003eCampylobacter.\u0026nbsp;\u003c/em\u003eFDA Bacteriological Analytical Manual, 8\u003csup\u003eth\u003c/sup\u003e edition (revision A), 23 pages.\u003c/li\u003e\n \u003cli\u003eISO (2006) Microbiology of food and animal feeding stuffs \u0026ndash; Horizontal method for detection and enumeration of \u003cem\u003eCampylobacter\u003c/em\u003e spp. Part 1: Detection method 10272\u0026ndash;2 International Organization for Standardization. Geneva, Switzerland.\u003c/li\u003e\n \u003cli\u003eJones D, Musgrove M. (2007) Pathogen prevalence and microbial levels associated with restricted shell eggs. Journal of food protection. 70: 2004-2007. 10.4315/0362-028X-70.9.2004.\u003c/li\u003e\n \u003cli\u003eJorgensen F, Ellis-Iversen J, Rushton S, Bull SA, Harris SA, Bryan SJ, Gonzalez A, Humphrey TJ (2011). Influence of Season and Geography on \u003cem\u003eCampylobacter jejuni and C. coli\u0026nbsp;\u003c/em\u003eSubtypes in Housed Broiler Flocks Reared in Great Britain. Applied Environmental Microbiology, 77(11): 37-41.\u003c/li\u003e\n \u003cli\u003eKaakoush NO, Mitchell HM, Man SM (2015b) \u0026lsquo;Chapter 67 - \u003cem\u003eCampylobacter\u0026rsquo;\u003c/em\u003e, in Y.-W. Tang et al. (eds) Molecular Medical Microbiology (2\u003csup\u003end\u003c/sup\u003e Edition). Boston: Academic Press, pp. 1187\u0026ndash;1236. Available at: https://doi.org/10.1016/B978-0-12- 397169-2.00067-6.\u003c/li\u003e\n \u003cli\u003eKaakoush NO, Casta\u0026ntilde;o-Rodr\u0026iacute;guez N, Mitchell HM, Man SM (2015a) Global epidemiology of \u003cem\u003eCampylobacter\u003c/em\u003e infection. Clin. Microbiol. Rev., 28: 687\u0026ndash;720.\u003c/li\u003e\n \u003cli\u003eKalupahana RS, Kottawatta KS, Kanankege KS, van Bergen MA, Abeynayake P, Wagenaar JA (2013) Colonization of \u003cem\u003eCampylobacter\u003c/em\u003e in broiler chickens and layer hens reared in tropical climates with low biosecurity. Applied Environmental Microbiology, 79: 393-395.\u003c/li\u003e\n \u003cli\u003eKang YS, Cho YS, Yoon SK, Yu MA, Kim CM, Lee JO, Pyun YR (2006) Prevalence and antimicrobial resistance of \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e isolated from raw chicken meat and human stools in Korea. Journal of Food Protection, 69 (12): 2915-2923\u003c/li\u003e\n \u003cli\u003eKimiran A (2024) Cross-Contamination in Terms of Food Safety. Food safety, doi: 10.69860/nobel.9786053358787.26.\u003c/li\u003e\n \u003cli\u003eKirchner MKR, Christopher G, Aaron B, Lavallee Schaffner D, Chapman B, Jaykus L-A (2023) The role of hands in cross-contamination of kitchen surfaces during meal preparation. American Journal of Infection Control. doi: 10.1016/j.ajic.2023.04.162.\u003c/li\u003e\n \u003cli\u003eKuana SL, Santos LR, Rodrigues LB, Borsoi A, Moraes HLS, Salle CTP, Nascimento VP (2008) Occurrence and characterization of \u003cem\u003eCampylobacter\u003c/em\u003e in the Brazilian production and processing of broilers. Avian Diseases, 52: 680-684.\u003c/li\u003e\n \u003cli\u003eLai H, Tang Y, Ren F, Jiao X, Huang J (2023) Evaluation of hygiene practice for reducing \u003cem\u003eCampylobacter\u003c/em\u003e contamination on cutting boards and risks associated with chicken handling in kitchen environment. Foods. doi: 10.3390/foods12173245.\u003c/li\u003e\n \u003cli\u003eLake R, Cressey P (2015) Risk profile \u003cem\u003eCampylobacter jejuni/coli\u003c/em\u003e in Poultry; whole and pieces, August 2013. 2015/02. ISBN No: 978-0-477-10546-0. ISSN No: 2253-3923. Ministry for Primary Industries website at http://www.mpi.govt.nz/news-and-resources/publications/\u003c/li\u003e\n \u003cli\u003eLedergerber U, Regula G, Stephan R, Danuser J, Bissig B, Stark KD (2003) Risk factors for antibiotic resistance in \u003cem\u003eCampylobacter spp.\u003c/em\u003e isolated from raw poultry meat in Switzerland. BMC Public Health, 3: 39-44.\u003c/li\u003e\n \u003cli\u003eLuu QH, Tran TH, Phung DC, Nguyen TB Study on the prevalence of \u003cem\u003eCampylobacter spp.\u003c/em\u003e from chicken meat in Hanoi, Vietnam. Annals of the New York Academy of Science, 1081: 273-275.\u003c/li\u003e\n \u003cli\u003eLynch H, Franklin-Hayes P, Koolman L, Egan J, Gutierrez M, Byrne W, Whyte P (2022) Prevalence and levels of Campylobacter in broiler chicken batches and carcasses in Ireland in 2017\u0026ndash; 2018. International Journal of Food Microbiology, 372: 109693\u003c/li\u003e\n \u003cli\u003eM\u0026auml;esaar M, Kristi P, Kadrin M, Kramarenko JS, Arvo V, Kaisa M, Kovalenko K, Darja M, H\u0026ouml;rman A, Marja-Liisa H, Mati R (2014) Prevalence and counts of \u003cem\u003eCampylobacter\u003c/em\u003e spp. in poultry meat at retail level in Estonia. Food Control., 44:72\u0026ndash;77. 10.1016/j.foodcont.2014.03.044.\u003c/li\u003e\n \u003cli\u003eMaher M, Finnegan C, Collins E, Ward B, Carroll C, Cormican M (2003) Evaluation of culture methods and a DNA probe-based PCR assay for detection of Campylobacter species in clinical specimens of feces. J Clin Microbiol., 41(7): 2980-2986.\u003c/li\u003e\n \u003cli\u003eMansouri-najand L, Saleha AA, Wai SS (2012) Prevalence of multidrug resistance \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u0026nbsp;\u003c/em\u003ein chickens slaughtered in selected markets, Malaysia. Tropical Biomedicine, 29(2): 231-238.\u003c/li\u003e\n \u003cli\u003eMarinou I, Bersimis S, Ioannidis A, Nicolaou C, Mitroussia-Ziouva A, Legakis NJ, Chatzipanagiotou S (2012) Identification and antimicrobial resistance of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from animal sources. Frontiers in Microbiology, 3 (58): 1-6.\u003c/li\u003e\n \u003cli\u003eMcLure A., Smith JJ, Firestone SM, Kirk MD, French NP, Fearnley E, Wallace RL, Valcanis M, Bulach DM, Moffatt CRM, Selvey LA, Jennison AV, Cribb DM, Glass K (2023) Source attribution of campylobacteriosis in Australia, 2017-2019. Risk Analysis, doi: 10.1111/risa.14138.\u003c/li\u003e\n \u003cli\u003eMeeyam T, Padungtod P, Kaneene JB (2004) Molecular characterization of \u003cem\u003eCampylobacter\u003c/em\u003e Isolated from chickens and humans in northern Thailand. Southeast Asian Journal of Tropical Medicine Public Health, 35 (3): 670-675.\u003c/li\u003e\n \u003cli\u003eMeldrum RJ, Tucker D, Smith RMM, Edwards C (2005) Survey of \u003cem\u003eSalmonella\u003c/em\u003e and \u003cem\u003eCampylobacter\u003c/em\u003e contamination of whole, raw poultry on retail sale in Wales in 2003. Journal of Food Protection, 68: 1447-1449.\u003c/li\u003e\n \u003cli\u003eMesselh\u0026auml;usser U, Th\u0026auml;rigen D, Elmer-Englhard D, Bauer H, Schreiner H, H\u0026ouml;ller C (2011) Occurrence of thermotolerant \u003cem\u003eCampylobacter\u003c/em\u003e spp. on eggshells: A missing link for food-borne infections? Appl. Environ. Microbiol., 77:3896\u0026ndash;3897.\u003c/li\u003e\n \u003cli\u003eMohamad NL, Som FM (2012) Prevalence of \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003ein chicken meat and chicken-based products. J. Trop. Agric. and Fd. Sc., 1: 63-69.\u003c/li\u003e\n \u003cli\u003eMubarak AG (2013): Campylobacteriosis as a zoonotic foodborne disease in school children. MSc. Thesis, South Valley University.\u003c/li\u003e\n \u003cli\u003eNobile CGA, Costantino R, Bianco A, Pileggi C, Pavia M (2013) Prevalence and pattern of antibiotic resistance of \u003cem\u003eCampylobacter spp.\u003c/em\u003e in poultry meat in Southern Italy. Food Control, 32:715-718.\u003c/li\u003e\n \u003cli\u003eNor Faiza S, Saleha AA, Jalila A, Fauziah N (2013) Research note occurrence of campylobacter and salmonella in ducks and duck eggs in Selangor, Malaysia. Trop. Biomed., 30: 155\u0026ndash;158.\u003c/li\u003e\n \u003cli\u003eNowak M, Wiktoria RK, Błaszczyszyn K, Gaweł-Dąbrowska D, Paluch E (2024). \u003cem\u003eCampylobacter\u003c/em\u003e: understanding its role as the primary bacterial cause of foodborne illness \u0026ndash;current state of knowledge.\u0026quot; Quality in Sport, undefined (2024). doi: 10.12775/qs.2024.17.52220.\u003c/li\u003e\n \u003cli\u003eOmara ST, El Fadaly H, Barakat A (2015) Public health hazard of zoonotic \u003cem\u003eCampylobacter\u003c/em\u003e\u003cem\u003ejejuni\u003c/em\u003e reference to Egyptian regional and seasonal variations. Res J Microbiol., 10: 343\u0026ndash;54. doi: 10.3923/jm.2015.343.354.\u003c/li\u003e\n \u003cli\u003eParkar SFD, Sachdev D, deSouza N, Kamble A, Suresh G, Munot H, Hanagal D, Shouche Y, Kapadnis B (2013) Prevalence, seasonality and antibiotic susceptibility of thermophilic \u003cem\u003eCampylobacter\u0026nbsp;\u003c/em\u003espp\u003cem\u003e.\u003c/em\u003e in ceca and carcasses of poultry birds in the \u0026ldquo;live- bird market\u0026rdquo;. African Journal of Microbiological Research, 7 (21): 2442-2453.\u003c/li\u003e\n \u003cli\u003ePascoe B, Futcher G, Pensar J, Bayliss S, Mourkas E, Calland J, Hitchings MD, Joseph LA, Lane C, Greenlee T, Arning N, Wilson DJ, Jolley KA, Maiden MCJ, Corander J, Parker CT, Cooper KK, Rose EB, Bereswill SKL, Kist M (2023) Recent developments in \u003cem\u003eCampylobacter\u003c/em\u003e pathogenesis. Current Opinion in Infectious Diseases, 16:487-491.\u003c/li\u003e\n \u003cli\u003ePascoe B (2022). The ongoing pandemic: contaminated chicken produce is the primary source of antimicrobial-resistant campylobacteriosis in the United States. doi: 10.6084/m9.figshare.20279928.v1\u003c/li\u003e\n \u003cli\u003ePaulsen P, Kanzler P, Hilbert F, Mayrhofer S, Baumgartner S, Smulders FJM (2005) Comparison of three methods for detecting \u003cem\u003eCampylobacter spp.\u003c/em\u003e in chilled or frozen meat. Inter. Journal of Food Microbiology, 103(2): 229-233.\u003c/li\u003e\n \u003cli\u003ePezzotti G, Serafin A, Luzzi I, Mioni R, Milan M, Perin R (2003) Occurrence and resistance to antibiotics of \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e in animals and meat in northeastern Italy. International Journal of Food Microbiology, 82: 281-287.\u003c/li\u003e\n \u003cli\u003ePimentel M, Morales W, Pokkunuri V, Brikos C, Kim SM, Kim SE, Triantafyllou K, Weitsman S, Marsh Z, Marsh E, et al. (2015) Autoimmunity Links Vinculin to the Pathophysiology of Chronic Functional Bowel Changes following \u003cem\u003eCampylobacter\u003c/em\u003e\u003cem\u003eJejuni\u003c/em\u003e Infection in a Rat Model. Dig. Dis. Sci., 60(5): 1195-1205. DOI: 10.1007/s10620-014-3435-5.\u003c/li\u003e\n \u003cli\u003eQuetz JS, Lima IN, Havt A, de Carvalho EB, Lima NL, Soares AM, Mota RM, Guerrant RL, Lima AA (2010) \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e in children from communities in Northeastern Brazil: molecular detection and relation to nutritional status. Diagnostic Microbiology and Infectious Disease, 67 (3): 220-227.\u003c/li\u003e\n \u003cli\u003eRahimi E, Tajbakhsh E (2008) Prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e species in poultry meat in the Esfahan city, Iran. Bulgarian Journal of Veterinary Medicine, 11(4): 257-262.\u003c/li\u003e\n \u003cli\u003eRahimi E, Momtaz H, Ameri M, Ghasemian-Safaei H, Ali-Kasemi M (2010) Prevalence and antimicrobial resistance of \u003cem\u003eCampylobacter\u003c/em\u003e species isolated from chicken carcasses during processing in Iran. Poultry Science, 89(5): 1015-1020.\u003c/li\u003e\n \u003cli\u003eRajagunalan S, Bisht G, Pant S, Singh SP, Singh R, Dhama K (2014) Prevalence and molecular heterogeneity analysis of \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e isolated from human, poultry, and cattle. Vet Arhiv. 84:493\u0026ndash;504.\u003c/li\u003e\n \u003cli\u003eRantsiou K, Lamberti C, Cocolin L (2010) Survey of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e in retail chicken meat products by application of a quantitative PCR protocol. International Journal of Food Microbiology, 141: S75\u0026ndash;S79.\u003c/li\u003e\n \u003cli\u003eRautelin H, Jusufovic J, H\u0026auml;nninen M.-L. (1999)Identification of hippurate-negative thermophilic campylobacters. Diagn. Microbiol. Infect. Dis., 35: 9\u0026ndash;12.\u003c/li\u003e\n \u003cli\u003eRodrigues CS, Armendaris PM, de S\u0026aacute; CVGC, Haddad JPA, de Melo CB (2021) Prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e spp. in chicken carcasses in slaughterhouses from South of Brazil. Current Microbiology, 78, 2242\u0026ndash;2250. https://doi.org/10.1007/s00284-021-02478-w\u003c/li\u003e\n \u003cli\u003eRoshdy MS (2000) Prevalence of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e in raw milk and infantile diarrhea in Assiut. Assiut Veterinary Medicine, 46 (97): 30-36.\u003c/li\u003e\n \u003cli\u003eSainato R, ElGendy A, Poly F, Kuroiwa J, Guerry P, Riddle MS, et al. (2018) Epidemiology of Campylobacter infections among children in Egypt. Am J Trop Med Hygiene. 98:581-585. doi: 10.4269/ajtmh.17-0469\u003c/li\u003e\n \u003cli\u003eSalihu MD, Junaidu AU, Magaji AA, Yakubu Y (2012) Prevalence and Antimicrobial Resistance of Thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e isolates from Commercial Broiler in Sokoto, Nigeria. Research Journal of Veterinary Science, 5 (2): 51-58.\u003c/li\u003e\n \u003cli\u003eSalim SM, Mandal J, Parija SC (2014) Isolation of \u003cem\u003eCampylobacter\u003c/em\u003e from Human Stool Samples. Indian Journal of Medical Microbiology, 32: 35-38.\u003c/li\u003e\n \u003cli\u003eSallam KI (2007):Prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e in chicken and chicken by-products retailed in Sapporo Ares, Hokkaido, Japan. Food Control, 18: 1113-1120.\u003c/li\u003e\n \u003cli\u003eSamaha IA, Ibrahim HAA, Hamada MO (2012) Isolation of some enteropathogens from retailed poultry meat in Alexandria Province. Alex. Journal of Veterinary Science, 37 (1): 17-22.\u003c/li\u003e\n \u003cli\u003eSambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor, NY Cold Spring Harbor Laboratory, 3(18):1-86.\u003c/li\u003e\n \u003cli\u003eSammarco ML, Ripabelli G, Fanelli I, Grasso GM, Tamburro M (2010) Prevalence and biomolecular characterization of \u003cem\u003eCampylobacter\u003c/em\u003e\u003cem\u003espp\u003c/em\u003e. isolated from retail meat. Journal of Food Protection, 73: 720-728.\u003c/li\u003e\n \u003cli\u003eSarkar S, Ray N, Hossain M, Paul S, Sarkar S, Kobayashi N. (2014) Multiplex polymerase chain reaction for detection of \u003cem\u003eCampylobacter\u003c/em\u003e from stool specimen. Mymensingh Med J. 23:449\u0026ndash;455.\u003c/li\u003e\n \u003cli\u003eSato M, Sashihara N (2010) Occurrence of Campylobacter in commercially broken liquid egg in Japan. J. Food Prot., 73: 412\u0026ndash;417.\u003c/li\u003e\n \u003cli\u003eSayed ASM, Ibrahim AI, Sobhy MM, Elmahallawy EK, Alsowayeh N, Alarjani KM, El-Khadragy MF, Youseef AG (2023) Circulation of thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e in pigeons, turkeys, and humans at live bird markets in Egypt. Front Vet Sci., May 12, 10: 1150077. doi: 10.3389/fvets.2023.1150077.\u003c/li\u003e\n \u003cli\u003eScallan E, Hoekstra RM, Mahon BE, Jones TF, Griffin PM (2015). An assessment of the human health impact of seven leading foodborne pathogens in the United States using disability-adjusted life years. Epidemiol. Infect\u003cem\u003e.\u003c/em\u003e 143: 2795\u0026ndash;2804. doi: 10.1017/S0950268814003185.\u003c/li\u003e\n \u003cli\u003eSchreyer ME, Olivero CR, Rossler E, Soto LP, Frizzo LS, Zimmermann JA, Virginia ZM (2022) Prevalence and antimicrobial resistance of Campylobacter jejuni and C. coli identified in a slaughterhouse in Argentina. Current Research in Food Science, 5: 590-597.\u003c/li\u003e\n \u003cli\u003eShah D, Shringi S, Besser T, Call D (2009) Molecular detection of foodborne pathogens, Boca Raton: CRC Press, In Liu, D. (Ed). Taylor \u0026amp; Francis Group, Florida, USA: 369-389.\u003c/li\u003e\n \u003cli\u003eSheveleva SA, Shurysheva ZhN, Piskareva II (2006) Contamination of \u003cem\u003eCampylobacter spp.\u003c/em\u003e from foodstuff. Voprosy Pitania Jouranl, 75: 38-43.\u003c/li\u003e\n \u003cli\u003eSison, FB, Chaisowwong W, Alter T, Tiwananthagorn S, Pichpol D, Lampang KN, Baumann MPO, G\u0026ouml;lz G (2014) Loads and antimicrobial resistance of \u003cem\u003eCampylobacter spp.\u003c/em\u003e on fresh chicken meat in Nueva Ecija, Philippines. Poultry Science, 93(5); 1270-1273.\u003c/li\u003e\n \u003cli\u003eSorokin M, Usein CR, Irimia M, Damian M (2007) A laboratory-based survey of \u003cem\u003eCampylobacter\u003c/em\u003e infections in Prahova County. Roumanian archives of microbiology and immunology, 66 (3-4): 85-89.\u003c/li\u003e\n \u003cli\u003eStoyanchev T, Vashin I, Ring C, Atanassova V (2007) Prevalence of \u003cem\u003eCampylobacter spp.\u003c/em\u003e in poultry and poultry products for sale on the Bulgarian retail market. Anton Leeuw, 92: 285\u0026ndash;288.\u003c/li\u003e\n \u003cli\u003eSuzuki H, Yamamoto S, (2009) \u003cem\u003eCampylobacter\u003c/em\u003e contamination in retail poultry meats and by-products in Japan: A literature survey. Food Control, 20(6): 531\u0026ndash;537.\u003c/li\u003e\n \u003cli\u003eTang JYH, Nishibuchi M, Nakaguchi Y, Ghazali F, Saleha A, Son R (2011) Transfer of \u003cem\u003eCampylobacter jejuni\u003c/em\u003e from raw to cooked chicken via wood and plastic cutting boards. Letters in applied microbiology 52: 581-588.\u003c/li\u003e\n \u003cli\u003eTh\u0026eacute;pault A, Rose V, Quesne S, Poezevara T, B\u0026eacute;ven V, Hirchaud E, Touzain F, Lucas P, M\u0026eacute;ric G, Mageiros L, Sheppard SK, Chemaly M, Rivoal K (2018) Ruminant and chicken: important sources of campylobacteriosis in France despite a variation of source attribution in 2009 and 2015. Scientific Reports, doi: 10.1038/S41598-018-27558-Z.\u003c/li\u003e\n \u003cli\u003eTorralbo A, Borge C, Allepuz A, Garc\u0026iacute;a-Bocanegra I, Sheppard S.K., Perea A, Carbonero A (2014) Prevalence and risk factors of Campylobacter infection in broiler flocks from southern Spain, Preventive Veterinary Medicine, 114 (2): 106-113. ISSN 0167-5877, https://doi.org/10.1016/j.prevetmed.2014.01.019.\u003c/li\u003e\n \u003cli\u003eTotten PA, Patton CM, Tenover FC, Barrett TJ, Stamm WE, Steigerwalt AG, Lin JY, Holmes KK, Brenner DJ (1987) Prevalence and characterization of hippurate-negative \u003cem\u003eCampylobacter jejuni\u003c/em\u003e in King County, Washington. J. Clin. Microbiol., 25, 1747\u0026ndash;1752.\u003c/li\u003e\n \u003cli\u003eUaboi-Egbenni PO; Bessong PO, Samie A, Obi CL (2011) Prevalence, haemolysis and antibiograms of \u003cem\u003eCampylobacters\u003c/em\u003e isolated from pigs from three farm settlements in Venda region, Limpopo province, South Africa. African Journal of Biotechnology, 10(4): 703-711.\u003c/li\u003e\n \u003cli\u003eVaishnavi C, Singh M, Thakur J, Thapa B, (2015) Low Prevalence of Campylobacteriosis in the Northern Region of India. Advances in Microbiology, 5: 155-165. doi: 10.4236/aim.2015.53015.\u003c/li\u003e\n \u003cli\u003eValdivieso-Garcia A, Harris K, Riche E, Campbell S, Jarvie A, Popa M, Deckert A, Reid-Smith R, Rahn K, (2007) Novel \u003cem\u003eCampylobacter\u003c/em\u003e isolation method using hydrophobic grid membrane filter and semisolid medium. Journal of Food Protection, 70: 355-362.\u003c/li\u003e\n \u003cli\u003evan Nierop W, Duse AG, Marais E, Aithma N, Thothobolo N, Kassel M, Stewart R, Potgieter A, Fernandes B, Galpin JS, Bloomfield SF (2005) Contamination of chicken carcasses in Gauteng, South Africa, by \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003eListeria\u003c/em\u003e\u003cem\u003emonocytogenes\u003c/em\u003e and \u003cem\u003eCampylobacter\u003c/em\u003e. International Journal of Food Microbiology, 99: 1-6.\u003c/li\u003e\n \u003cli\u003eVashin IT, Stoyanchev TT (2004) Incidence and microbial diversity of \u003cem\u003eCampylobacter spp.\u003c/em\u003e isolates during the slaughterhouse processing of poultry and critical control points of the process. Bulgian Journal of Veterinary Medicine, 7: 173-180.\u003c/li\u003e\n \u003cli\u003eVetchapitak T, Misawa N (2019) Current status of \u003cem\u003eCampylobacter\u003c/em\u003e food poisoning in Japan. Food Saf (Tokyo) 7: 61\u0026ndash;73. doi: 10.14252/foodsafetyfscj.D-19-00001.\u003c/li\u003e\n \u003cli\u003eWang G, Clark CG, Taylor TM, Pucknell C, Barton C, Price L, Woodward DL, Rodgers FG (2002) Colony multiplex PCR assay for identification and differentiation of \u003cem\u003eCampylobacter jejuni, C. coli, C. lari, C. upsaliensis,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;C. fetus subsp. fetus\u003c/em\u003e. Journal of Clinical Microbiology 40: 4744- 4747.\u003c/li\u003e\n \u003cli\u003eWHO \u0026ldquo;World Health Organization\u0026rdquo; (2020) Fact sheets: \u003cem\u003eCampylobacter\u003c/em\u003e. World Health Organization. Available at: https://www.who.int/news-room/fact-sheets/detail/campylobacter (2020).\u003c/li\u003e\n \u003cli\u003eWOAH (2005) \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e. In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals Geneva: World Organization for Animal Health.\u003c/li\u003e\n \u003cli\u003eWong T-L, Hollis L, Cornelius A, Nicol C, Cook RC, Hudson JA (2007) Prevalence, numbers, and subtypes of \u003cem\u003eCampylobacter jejuni\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Campylobacter coli\u003c/em\u003e in uncooked retail meat samples. Journal of Food Protection; 70: 566-573.\u003c/li\u003e\n \u003cli\u003eWorkman SN, Sobers SJ, Mathison GE, Lavoie MC (2006) Human Campylobacter-associated enteritis on the Caribbean-island of Barbados. Am J Trop Med Hygiene. 74:623-627. doi: 10.4269/ajtmh.2006.74.623.\u003c/li\u003e\n \u003cli\u003eYildirim M, Istanbulluoglu E, Ayvali B (2005) Prevalence and antibiotic susceptibility of thermophilic \u003cem\u003eCampylobacter\u003c/em\u003e species in broiler chickens. Turkey Journal of Veterinary Animal Science, 29: 655-660.\u003c/li\u003e\n \u003cli\u003eYushina Y, Bataeva D, Makhova A, Zayko E (2020) Prevalence of \u003cem\u003eCampylobacter\u003c/em\u003e spp. in a poultry and pork processing plants. Potravinarstvo Slovak Journal of Food Sciences vol. 14, 2020, p. 815-820 https://doi.org/10.5219/ ISSN 1337-0960.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Broilers meat, Campylobacter coli, Campylobacter jejuni, Environment, Human enteritis, Multiplex PCR","lastPublishedDoi":"10.21203/rs.3.rs-5598686/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5598686/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eCampylobacter\u003c/em\u003e in broiler meat presents a significant challenge to food safety. Human campylobacteriosis predominantly arises from multiple sources, with poultry serving as the most substantial contributor. The objective of this study was to ascertain the presence of \u003cem\u003eCampylobacter\u003c/em\u003e contamination of retail broiler meat at various critical junctures, including slaughter, processing, food preparation, and potential cross-contamination events occurring in both slaughterhouses and restaurants, processed chicken products, table eggs, and stool samples from humans with enteritis. To fulfill this, samples were systemically collected to detect \u003cem\u003eCampylobacter\u003c/em\u003e contamination during various stages of slaughter, processing, food preparation, and potential cross-contamination scenarios at slaughterhouses and restaurants. A total of 460 samples were procured, encompassing 120 samples of chicken meat, 100 table eggs, 120 samples of human stool, and 120 environmental food samples, all obtained from Sohag, Egypt. Each sample underwent bacteriological, biochemical analysis and multiplex PCR enabled the detection of the \u003cem\u003e23S rRNA, hip O\u003c/em\u003e, and \u003cem\u003egly A\u003c/em\u003e genes for the precise identification and differentiation of \u003cem\u003eCampylobacter\u003c/em\u003e at the species level. The observed prevalence rates of \u003cem\u003eCampylobacter\u003c/em\u003e in broiler meat, table eggs, environment, and human stool samples determined by multiplex PCR were 9.17, 2, 7.5, and 6%, respectively, with overall positive samples of 6.3% (28/460). 75% (21/28) of the isolates were \u003cem\u003eCampylobacter jejuni\u003c/em\u003e, 25% (7/28) were \u003cem\u003eCampylobacter coli\u003c/em\u003e, and 1 isolate had mixed contamination. Poultry fecal matter, broiler meat, and table eggs could be a high risk of \u003cem\u003eC. jejuni\u003c/em\u003e and \u003cem\u003eC. coli\u003c/em\u003e to humans, highlighting the need for targeted interventions in the poultry, and egg industry to mitigate the risk of \u003cem\u003eCampylobacter\u003c/em\u003e infections. Improved food handling practices at restaurant and house kitchens are essential to reduce contamination.\u003c/p\u003e","manuscriptTitle":"Risks of Campylobacter jejuni and Campylobacter coli contamination in broiler's meat, table eggs, and the food environment in correlation to human enteritis.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-11 08:16:25","doi":"10.21203/rs.3.rs-5598686/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"41975556-2869-485a-a2ac-cea6238bb51e","owner":[],"postedDate":"February 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-02-11T08:16:25+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-11 08:16:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5598686","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5598686","identity":"rs-5598686","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.