Preclinical Safety and Tolerability of an AAV Vector Expressing TLR9 in Mice and Hamsters

Preclinical Safety and Tolerability of an AAV Vector Expressing TLR9 in Mice and Hamsters | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Preclinical Safety and Tolerability of an AAV Vector Expressing TLR9 in Mice and Hamsters Sarah Wootton, Cici Yang, Igor Santos, Brad Thompson This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8545024/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Toll-like receptor 9 (TLR9) is an innate DNA sensor that activates pro-inflammatory pathways and contributes to the maturation of antigen presenting cells. TLR9 deficiency has been implicated in impaired tumor immunosurveillance and attenuated responsiveness to immune checkpoint blockade. We developed an adeno-associated virus (AAV) vector encoding TLR9 to restore receptor expression in individuals with TLR9 deficiency and augment antitumor immunity. We first evaluated transgene biodistribution in mice 21 days after intraperitoneal administration of 1x10 11 vector genomes (vg) of AAV6.2FF-TLR9 using RNA in-situ hybridization. TLR9 was detected in liver, spleen, pancreas, ovary, heart, and lymph node, indicating systemic transduction and transcription following intraperitoneal delivery. To assess safety, mice and hamsters received low (1.5x10 13 vg/kg) or high (4.5x10 13 vg/kg) dose of AAV6.2FF-TLR9 intraperitoneally and were evaluated at 7, 28, and 56 days post-administration. Across both species and dosages, no adverse vector-related changes were observed in leukocyte counts, plasma biomarkers of hepatic or renal function, pro-inflammatory cytokines, or upon histopathological examination. The broad tissue expression and favorable safety profile of intraperitoneally delivered AAV6.2FF-TLR9 support progression of this vector toward clinical development as a gene replacement strategy to potentially enhance to efficacy of checkpoint blockade in patients with metastatic malignancies and impaired TLR9 signaling. Biological sciences/Biotechnology/Gene delivery Biological sciences/Biotechnology/Gene therapy Adeno-associated virus (AAV) gene therapy TLR9 intraperitoneal administration toxicology tolerability murine model Syrian hamster model pathology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 4 Figure 5 Figure 6 Figure 6 Figure 7 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Innate sensing of unmethylated CpG DNA by toll-like receptor 9 (TLR9) orchestrates a canonical MyD88-dependent cascade that activates nuclear factor-κB (NF-κB) and interferon regulatory factors, driving production of pro-inflammatory cytokines and type I interferons and licensing antigen-presenting cells (APCs) for effective T-cell priming. [ 1 ] TLR9 moves from the endoplasmic reticulum to endolysosomal compartments with the assistance of the chaperone UNC93B1, a process that does not depend on ligand binding. Its activation requires proteolytic cleavage and recognition of unmethylated CpG DNA within acidic endosomes. [ 2 ] Activation of TLR9 signaling in myeloid and lymphoid compartments has been shown in preclinical models to augment antitumor immunity by enhancing dendritic cell activation, promoting cytotoxic T-cell priming, and shifting the tumor microenvironment toward a pro-inflammatory phenotype. [ 3 – 5 ] Emerging evidence indicates that TLR9 activity within the tumor microenvironment is an important determinant of responsiveness to immune checkpoint inhibitors, as its activation enhances dendritic-cell cross-presentation and restores antitumor T-cell function. [ 6 , 7 ] Thus, it is not surprising that loss or deficiency of TLR9 function compromises tumor immunosurveillance and diminishes responsiveness to immune checkpoint inhibitors. [ 8 ] Despite extensive efforts with CpG oligodeoxynucleotide (ODN) TLR9 agonists, clinical activity as monotherapy has been limited and context-dependent [ 9 ]; moreover, these agents are dependent on the presence of functional TLR9 protein expression. Gene transfer approaches can overcome these constraints by restoring receptor availability. Among viral delivery systems, adeno-associated virus (AAV) vectors offer a favorable safety profile, broad tropism across dividing and non-dividing cells, and durable episomal transgene expression with low genotoxic risk relative to integrating vectors; these attributes reinforce the growing clinical adoption of AAV and multiple recent regulatory approvals. [ 10 ] The peritoneal cavity is a common site of dissemination for ovarian, colorectal, gastric, and appendiceal cancers and remains therapeutically challenging due to the peritoneum-plasma barrier, diffuse nodularity, and a profoundly suppressive microenvironment.[ 11 ] Clinical and translational advances in intraperitoneal (IP) therapy, including hyperthermic intraperitoneal chemotherapy (HIPEC), catheter-based IP chemotherapy, and pressurized IP aerosol chemotherapy, demonstrate that regional dosing can enhance local drug concentrations and, in selected contexts, improve outcomes, motivating exploration of gene-based locoregional strategies. [ 12 , 13 ] Here we engineered a TLR9 encoding AAV vector to provide systemic, durable expression of human TLR9 following intraperitoneal administration. We also assessed the safety and tolerability of this vector in two animal models. TLR9 mRNA expression was detected in a range of tissues including liver, spleen, pancreas, ovary, heart, and lymph node 21 days following intraperitoneal administration of a standard dose of 1x10 11 vector genomes (vg) AAV6.2FF-TLR9 to BALB/c mice. Toxicological analysis of low (1.5×10 13 vg/kg) and high (4.5×10 13 vg/kg) dose AAV6.2FF-TLR9 at three time points (7-, 28-, and 56-days post AAV administration) in mice and hamsters revealed that the vector was well tolerated in both species based on the absence of significant changes in leukocyte counts, plasma biomarkers of hepatic or renal dysfunction, and pro-inflammatory cytokines. Additionally, no histological abnormalities were detected in any examined tissues. These findings indicate a favorable safety profile and support advancement of AAV-TLR9 into clinical development. Methods AAV Vector Production. The coding sequence for human TLR9 (Genbank accession number NM_17442.4) was human codon optimized and synthesized by Genscript USA. The TLR9 gene was cloned into the KpnI-XbaI site of an AAV vector genome between the composite CASI promoter [ 14 ] and an SV40 polyadenylation signal. The entire expression cassette was flanked by AAV2 inverted terminal repeats to facilitate packaging (Fig. 1 A) and fully sequenced by Plasmidsaurus. Genomes were packaged into the AAV6.2FF capsid [ 15 ] and production was carried out as previously described using adherent Lenti-X 293T cells and heparin affinity chromatography. [ 16 ] AAV Titration and Quality Control Assays. AAV vector genome titers were determined by qPCR as described previously. [ 17 ] For this, 5 uL aliquots of vector were first treated with DNase (Promega M6101) to eliminate any non-viral DNA followed by proteinase K (Invitrogen LSAM2546). Viral DNA genomes were purified using the Qiagen Blood and Tissue Kit (Qiagen 69504). AAV DNA genomes were quantified by qPCR using a TaqMan primer and probe set against the SV40 polyA: forward primer 5’- AGCAATAGCATCACAAATTTCACAA-3’, reverse primer 5’- CCAGACATGATAAGATACATTGATGAGTT-3’ and probe 5’ AGCATTTT TTTCACTGCATTCTAGTTGTGGTTTGTC/56-FAM/AGCATTTTT/Zen/ TTCACTGCATTCTAGTTGTGGTTTGTC/ 3IABkFQ/ (Integrated DNA Technologies Coralville, IA, USA), Luna universal qPCR master mix (New England Biolabs M3003), and a LightCycler 480 (Roche) thermal cycler. Vector genome integrity and virus batch purity were evaluated by alkaline gel electrophoresis and SDS PAGE Coomassie staining as described previously. [ 17 ] Animal Experiments. All animal experiments were reviewed and approved (AUP# 4664) by the Animal Care Committee at the University of Guelph in accordance with the guidelines outlined by the Canadian Council on Animal Care. Five-week-old BALB/c mice (Strain code 028) were purchased from Charles River Laboratories and 3-week-old Syrian hamsters (HsdHan®:AURA) were purchased from Envigo. All animals were given a 7-day acclimation period before proceeding with animal experiments. For the in-situ TLR9 mRNA expression pilot study, female mice (n = 4) were injected intraperitoneally with 1x10 11 vg of AAV6.2FF-TLR9 or phosphate-buffered saline (PBS) in a final volume of 250uL. Mice were euthanized by isoflurane overdose followed by CO 2 inhalation 21 days post-injection and the collected tissues were fixed in 10% phosphate-buffered formalin for 24 hours. For the toxicology study, groups of 18 BALB/c mice (9 males and 9 females) and groups of 12 Syrian hamsters (6 males and 6 females) were injected intraperitoneally with (1) PBS, (2) a low dose of 1.5×10 13 vg/kg of AAV6.2FF-TLR9, or (3) a high dose of 4.5×10 13 vg/kg of AAV6.2FF-TLR9 in a final volume of 250uL. The animals were weighed immediately prior to injection, as well as on days 4, 7, 14, 21, 28, 35, 42, 49, and 56 post-AAV administration. On day 1 post-injection, non-terminal blood was collected from mice via the saphenous vein using a 25G needle (Med-Vet International, Mettawa, IL, USA) and an EDTA microvette (Sarstedt Inc, Newton, NC, USA). Hamsters were anesthetized using isoflurane then non-terminal blood was collected on day 1 post-injection via the subclavian vein using an Air-Tite Luer Slip 25G syringe (Air-Tite Products Co., Inc., Virginia Beach, VA, USA) and a MiniCollect® EDTA tube (Greiner Bio-One, Monroe, NC, USA). Each endpoint group consisted of equal numbers of male and female animals (9 males and 9 females for mice, 6 males and 6 females for hamsters). On days 7, 28, and 56 post-injection, the animals were deeply anesthetized using isoflurane and terminal blood collection was performed via heart puncture for mice or subclavian vein bleed for hamsters. Approximately 200uL of whole blood was allotted to an EDTA blood collection tube and the remaining whole blood was collected in a BD Vacutainer® Sodium Heparin tube (BD Diagnostics Systems, Mississauga, ON, Canada). The animals were then euthanized by isoflurane overdose followed by CO 2 inhalation. The inguinal lymph nodes (for mice only), lung, heart, liver, spleen, pancreas, kidneys, testicles or ovaries, skeletal muscle, and brain were harvested. Half of each organ was fixed in 10% phosphate-buffered formalin for 24 hours and the other half was frozen at − 80°C until further processing. Histopathology and RNA In-Situ Hybridization. Formalin-fixed tissues were routinely processed for histology and stained with hematoxylin and eosin. The slides were examined by an anatomic pathologist blinded to the treatment groups. A preliminary study to observe the in-situ expression of AAV6.2FF-TLR9 in mice was conducted using RNAScope™ 2.5 High-Definition RED Assay (Advanced Cell Diagnostics, 322350). Deparaffinized and rehydrated 4um-thick sections from the formalin-fixed tissues were submitted to manual antigen retrieval, performed at 95ºC for 15min or 30min (liver only). Tissue sections were hybridized with a custom probe against human TLR9 mRNA (probe ID: Hs-TLR9-O1-NoXMmMau) then the signal was amplified using the HybEZ™ oven (Advanced Cell Diagnostics) as per manufacturer’s instructions. The signal was detected using Fast Red dye provided in the kit, and the sections were counterstained with hematoxylin. Slides were examined to assess signal distribution and imaged using a Nikon Digital Sight 10 camera and CellSens microscope imaging software. Differential Leukocyte Count and Biochemical Profile. Sodium-heparin whole blood was submitted to the Animal Health Laboratory at the University of Guelph (Guelph, Ontario, Canada) for the following tests: differential leukocyte count, alanine aminotransferase, aspartate aminotransferase, urea, and total protein profile. Total Anti-AAV6.2FF-TLR9 Antibodies. Half-area 96-well ELISA plates (Corning 3690) were coated with 1x10 10 vg/mL of AAV6.2FF-TLR9 and incubated overnight at 4°C. The plates were blocked with SuperBlock™ blocking buffer (Fisher 37515) for 90 minutes at room temperature. Two-fold serial dilutions of EDTA plasma from mice and hamsters starting from a 1:50 dilution were plated and incubated for 1 hour at 37°C. A 2-fold serial dilution of mouse IgG-2a anti-AAV8 primary antibody (ProGen 610160S) starting from a 1:50 dilution was plated in parallel to serve as the negative control. Goat anti-mouse IgG HRP-conjugated secondary antibody (Invitrogen G-21040) or goat anti-Syrian hamster IgG HRP-conjugated secondary antibody (Invitrogen HA6007) diluted 1:5000 in SuperBlock blocking buffer was plated then incubated for 1 hour at 37°C. The plate was incubated with TMB ELISA substrate (Thermo Scientific 34021) for 15 minutes and the absorbance at 650nm was detected using a Promega GloMax® Multi microplate reader (Madison, WI, USA). Total antibody titer was defined as the lowest dilution of plasma that produced an OD650 reading below double the mean OD650 reading of the negative control wells. Cytokine Analysis. EDTA plasma from mice was diluted 1:2 in PBS then submitted to Eve Technologies (Calgary, Alberta, Canada) for the Mouse Cytokine Proinflammatory Focused 10-Plex Discovery Assay® using the Luminex® 200™ platform. This cytokine panel analyzed: IFNγ, TNFα, MCP-1, GM-CSF, IL-1β, IL-2, IL-4, IL-6, IL-10, and IL-12p70. EDTA plasma from hamsters was diluted 1:5 in PBS and submitted to Ampersand Biosciences (Lake Clear, New York, USA) for the Hamster MAP 1.0 cytokine panel using the Luminex® platform which detected: IFNγ, TNFα, MIP-1α, MCP-1, IL-1β, IL-2, IL-4, IL-6, IL-10, and IL-18. AAV Vector Biodistribution. Up to 30mg of frozen tissue was homogenized in tissue lysis buffer (Omega Bio-tek D3396-03) using 5mm stainless steel beads (Qiagen 69989) and a Qiagen TissueLyser II (Germantown, MD, USA) set to run for two rounds of 2 minutes at 30Hz. DNA was extracted from the homogenate using the E.Z.N.A.® Tissue DNA kit (Omega Bio-tek D3396-03). Vector genomes were quantified by qPCR as described above. A DeNovix DS-7 DNA quantification spectrophotometer (Wilmington, Detroit, USA) was used to quantify the total genomic DNA concentration of each sample. Vector genome numbers were normalized to total genomic DNA concentration prior to statistical analysis. Statistical Analysis. Graphpad Prism 9 software (San Diego, CA, USA) was used to perform all statistical analyses. Mean and standard deviation are displayed on all graphs except for the vector biodistribution figures, which show the geometric mean and geometric standard deviation. Two-way analysis of variance (ANOVA) was used to evaluate the differences within cohorts. Tukey’s multiple comparison test was used as a post-test. An unpaired One-way ANOVA was used to compare the mouse weights over time. A lognormal two-tailed t-test was used to compare the vector biodistribution between low dose and high dose groups. P values of < 0.05 was considered significant. Results Confirmation of AAV6.2FF-TLR9 expression in vitro and in vivo The AAV6.2FF-TLR9 investigational construct was engineered to encode a codon-optimized human TLR9 gene under the control of a constitutive CASI promoter and flanked by AAV2 inverted terminal repeats (Fig. 1 A). Following full plasmid sequencing, the AAV-TLR9 genome was packaged into an AAV6.2FF capsid and subjected to standard quality control assays including qPCR for vector titer, Coomassie staining for vector purity, and alkaline gel for confirmation of genome integrity (data not shown). To confirm TLR9 expression, Lenti-X 293T cells were transduced with AAV vectors expressing TLR9 or a C-terminally HA-tagged version of TLR9 engineered to facilitate in vitro confirmation of TLR9 expression at a multiplicity of infection of 100 000. The full-length unprocessed form of TLR9-HA was detected when probed with an anti-HA antibody (Fig. 1 B), and the processed form was detected when probed with an anti-TLR9 antibody (Fig. 1 C). These results demonstrate effective in vitro transgene expression of TLR9 following AAV transduction. To confirm AAV-mediated expression of TLR9 in vivo , a small-scale study was conducted in four vector-treated mice and one vehicle control mouse. For this, mice were administered an intraperitoneal injection of 1x10 11 vg of AAV6.2FF-TLR9 or PBS, euthanized 21 days post-AAV administration, and tissues from all major organs were collected for RNAScope analysis of TLR9 mRNA expression. No TLR9 signals were detected in the brain, lung, kidney, and skeletal muscle (Supplemental Figure S1 ). Organs positive for TLR9 signals included the lymph node, spleen, liver, pancreas, ovary, and heart (Fig. 2 ). All tissues positive for TLR9, except for lymph node, were consistent in their staining: the PBS-treated mouse showed no signal, while transgene mRNA was detected in all vector-treated mice. Lymph node was the exception: the PBS-treated mouse showed no signal, while vector-treated mice showed variable staining (no signal in 1/4 mice, positive signal in 3/4 mice). In the lymph node, the signal was observed primarily in the lymphoid follicles and was also present in the interfollicular zone. Similarly, in the spleen, the signal was concentrated in the splenic follicles with additional signal scattered across the red pulp. The signal was restricted to the hepatic cords in the liver. In the pancreas, the signal was predominantly localized to the pancreatic acini with occasional signal observed in the pancreatic islets. In the ovary, the signal was primarily detected in the stroma as well as in ovarian follicles but no signal was observed within oocytes. Finally, in the heart, the signal was observed in the myocardium. Taken together, these data confirm systemic expression of human TLR9 from the intraperitoneally delivered AAV6.2FF-TLR9 vector. Safety and tolerability of AAV-TLR9 in a mouse model A mouse study was designed to investigate the safety and tolerability of intraperitoneal administration of AAV6.2FF-TLR9. The study was designed to evaluate two doses of AAV6.2FF-TLR9—1.5×10¹³ vg/kg (low) and 4.5×10¹³ vg/kg (high)—at three timepoints: 7, 28, and 56 days post-AAV administration (n = 6; 3 males and 3 females) (Table 1). Mice were weighed on days 0, 4, and every 7 days post-AAV administration until endpoint. No significant change in weight was observed following administration of the low or high dose of AAV6.2FF-TLR9 when compared to the vehicle control group (Fig. 3 A). Due to the limited amount of blood that can be taken at one time point, only terminal blood draws were taken from the mice at endpoint. For all time points, there were no notable differences in leukocyte counts between the vehicle group and the AAV-TLR9 treated groups (Figs. 3 B-E). The only significant observation was an increase in the segmented neutrophil count of the vehicle control group at day 56 (Fig. 3 F). The blood biochemistry parameters displayed non-dose-related changes, since all remarkable clinical findings were isolated to the vehicle control and low dose groups. Vehicle mice experienced transient elevations in hepatic transaminases (Figs. 4 A and 4 B) which resolved by day 28. Mice injected with the low dose of vector demonstrated a transient increase in aspartate aminotransferase (Fig. 4 B), which subsided by day 28. A transient plasma protein imbalance was also observed in the low-dose mice (Fig. 4 G); higher albumin (Fig. 4 E) and lower globulin (Fig. 4 F) levels were recorded for days 7 and 28 and these levels then corrected by day 56. Total anti-AAV6.2FF capsid antibody titers in mice from vehicle control group remained consistent across each of the timepoints. Mice from the low dose group demonstrated elevated anti-capsid antibodies compared to the other treatment groups, but this difference was only statistically significant compared to the vehicle group (Fig. 4 H). At day 56, both vector-treated groups possessed higher antibody titers than the vehicle control group; however, neither achieved statistical significance. Cytokine analysis of plasma samples collected on days 1, 7, 28 and 56 post-treatment revealed no statistically significant difference between treatment groups at any timepoint, nor were any statistically significant differences observed between timepoints (Fig. 5 ). No notable trend was observed for any of the cytokines evaluated. Tissues from the cohort of mice that were euthanized on day 28 post-treatment were analyzed for AAV vector biodistribution using qPCR. The AAV6.2FF-TLR9 genome was detected at similar levels for both the high and low dose groups in most tissues (Fig. 6 ). A mild but not significant dose-dependent increase was observed in the lung, heart, liver, spleen, gonads, and lymph node with the highest mean number of vector genomes being detected in the liver and pancreas (Figs. 6 C and 6 E). The organs with the lowest mean number of vector genomes detected included the lung, skeletal muscle, lymph node, and brain. Histological evaluation was performed on tissues collected from all mice at the three designated time points (day 7, 28 and 56) to assess potential adverse effects in the brain, gonads, kidneys, skeletal muscle, pancreas, liver, spleen, heart, lung, and lymph nodes that could be associated with intraperitoneal administration of AAV6.2FF-TLR9. No significant histological lesions were observed, except for mild, focal myositis in the female cohort of mice that were administered the high dose and euthanized on day 7, and this finding was interpreted to be incidental. Overall, none of the organs were found to show lesions due to vector-related toxicities. Safety and tolerability of AAV-TLR9 in the hamster model To complement the mouse toxicology data and further evaluate interspecies variability in AAV6.2FF-TLR9 safety and biodistribution, a second study was conducted in Golden Syrian hamsters, a pharmacologically relevant species selected in accordance with ICH S6(R1) guidance. [ 18 ] As with the mice, two doses of AAV6.2FF-TLR9 were evaluated—1.5×10¹³ vg/kg (low) and 4.5×10¹³ vg/kg (high)—at three timepoints: 7, 28, and 56 days post-AAV administration (n = 4; 2 males and 2 females) (Table 2). No significant differences in weight gain were observed over the study period (Fig. 7 A). Hamsters that received a low dose of the vector had significantly higher lymphocyte and segmented neutrophil counts, thus contributing to the higher white blood cell count, at day 28 (Fig. 7 ). These elevations, indicative of an adaptive immune response involving secondary recruitment of neutrophils, were short-lived and resolved by day 56. Hamsters injected with the low dose of vector also demonstrated an uptick in hepatic transaminases and urea on day 56 (Fig. 8 ). All treatment groups had lower globulin levels and, in turn, lower total protein levels at day 7. These levels increased at each subsequent timepoint. Given that there was no significant difference between treatment groups and all groups followed the same trend, the protein increase observed may simply be attributed to maturation of the animals. Total antibody titers for all vehicle control hamsters remained consistently undetectable across each of the timepoints (Fig. 8 H). At day 28, a marked increase in anti-AAV6.2FF antibodies was observed in hamsters that received the vector, although this increase was only statistically significant for those that received the low dose AAV6.2FF-TLR9. By day 56, the antibody response in hamsters that were given the vector has persisted. In hamsters, a general decrease in cytokine levels from plasma samples was observed for all treatment groups over the course of the study (Fig. 9 ). In the low dose group, several pro-inflammatory cytokines and chemokines were significantly elevated compared to the vehicle control group, high-dose group, or both groups: TNFa (vs high-dose, 7dpi; vs high-dose, 28dpi), MCP-1 (vs both, 1dpi), MIP-1a (vs both, 7dpi), and IL-1b (vs. high-dose, 28dpi). Although significantly higher levels of anti-inflammatory IL-10 were observed in the low dose group at day 1 compared to the high dose group, this finding may represent an early attempt to regulate the numerous pro-inflammatory signals elicited in the low dose group. Vector genome copy numbers of AAV6.2FF-TLR9 did not differ significantly between the low- and high-dose groups across all examined tissues, although inter-animal variability was observed (Fig. 10 ). For all tissues, there was a trend toward higher genome copy numbers in the high dose group, with the highest genome copy numbers occurring in the liver and the lowest genome copy numbers detected in the brain. Histopathological evaluation revealed no significant lesions. Only mild to moderate, focal myositis with myonecrosis was seen in three hamsters; one female hamster given the low dose and euthanized at day 28, plus two male hamsters given the high dose and euthanized at day 56. These findings were interpreted as incidental, given their spontaneous and random distribution across groups. No lesions attributed to vector-related toxicities were observed in any of the examined organs. Discussion The data from this preclinical toxicology study show that AAV6.2FF-TLR9, administered intraperitoneally at doses of 1.5x10 13 vg/kg and 4.5x10 13 vg/kg, is safe and does not cause remarkable short-term or long-term toxicity in mice and hamsters. As an innate immune sensor, TLR9 confers responsiveness to viruses by inducing downstream release of pro-inflammatory cytokines upon stimulation [ 19 , 20 ]. Given this, it was important to confirm that AAV-mediated overexpression of TLR9 would not result in an exaggerated immune response since both the receptor and its ligand would be present at high levels. Instead, AAV6.2FF-TLR9 was well tolerated in both evaluated species. In mice, no significant differences were observed in cytokine expression levels between groups at all timepoints, indicating the absence of a cytokine-mediated innate response. This safety signal is of particular importance because AAV-vectored gene therapy products, when administered at high systemic doses necessary for many clinical indications, have been implicated in life-threatening complications involving hypercytokinemia (e.g., cytokine-mediated capillary leak syndrome [ 21 ] and hemophagocytic lymphohistiocytosis [ 22 ]). The lack of excessive cytokine production, in combination with no significant difference in lymphocyte counts, further suggests the absence of a T-cell mediated adaptive response. Significantly higher anti-AAV6.2FF capsid antibody titers were detected in mice injected with the low dose at day 28, pointing to a B-cell response. Evidence for B-cell involvement is further supported by the presence of the vector genome in spleen tissue and detection of transgene mRNA signals in splenic follicles and in lymph nodes. Further investigation, using multiplex in-situ hybridization or immunohistochemistry, of the exact cell types that are positive for transgene mRNA would be helpful in pinpointing the population of immune cells responsible for generating the immune response. The hamsters mounted a slightly greater but overall mild and transient immune response compared to mice. The only cytokines significantly elevated when compared to controls were the chemotactic proteins MCP-1 (1dpi) and MIP-1a (7dpi), indicative of early phagocyte and lymphocyte recruitment for the initiation of inflammation in the low dose group. [ 23 , 24 ] The immune response that was initiated was very mild, given that there was no significant elevation in any of the key pro-inflammatory cytokines released following immune detection of viral DNA (IFNg, TNFa, IL-1b, and IL-6) [ 25 ] when comparing vector-treated and vehicle control groups. As was observed in mice, a B-cell response was detectable in hamsters injected with the low dose, as they possessed significantly higher anti-capsid antibody titers at day 28. Hamsters that received the low dose also experienced an increase in hepatic transaminases at day 56, which may be owing to the lysis of transduced hepatocytes by AAV6.2FF specific T-cells. Indeed, it has been shown in a human subject of a hemophilia B clinical trial, infusion of an AAV2 vector expressing coagulation factor IX resulted in a rise in hepatic transaminases, that peaked at 32 days post vector administration with a concomitant fall in transgene expression. [ 26 ] These two concurrent findings were attributed to the CD8 + T-cell mediated destruction of transduced hepatocytes, which would 1) eliminate transgene expressing cells and 2) release hepatic enzymes into the blood. [ 27 ] It should be noted that subjects of the AAV-FIX clinical trial that experienced hepatic transaminase elevation remained asymptomatic and these levels returned to baseline without medical intervention or adverse reactions in the subjects. [ 26 ] Interestingly, the low vector dose was observed to be more immunogenic than the high dose. While neither dose elicited a particularly remarkable immune response, the low dose induced a B-cell response in both species and increases in lymphocyte counts and hepatic transaminases in hamsters. Notably, hamsters that received the high dose also had significantly lower TNFa levels than both vehicle and low dose hamsters at day 28. Additionally, the low dose provoked an increase in circulating levels of multiple cytokines, but this increase was not observed in the high dose or vehicle. This non-linear dose-response pattern has been associated with the unique tolerogenic milieu of the liver. As an organ that encounters a plethora of neo-antigens, the liver has developed a range of mechanisms to avoid constant overactivation of the immune system. [ 28 ] The mechanisms that lead to attenuation of the immune response at high vector doses are numerous, including the induction of tolerance by CD4 + regulatory T-cells [ 29 ], CD8 + T-cells [ 30 ], or B-cells [ 31 ], as well as T-cell exhaustion due to persistent antigen stimulation [ 32 ]. An analysis of CD4 + and CD8 + T-cell counts, in addition to characterization of T-cell surface markers and cytolytic ability, would be useful to dissect the main mechanisms responsible for the non-linear dose-response observed here. Following intraperitoneal injection, the highest vector genome copy numbers of AAV6.2FF-TLR9 were detected in the liver and pancreas in both mice and hamsters. In line with these results, another study investigating AAV biodistribution reported predominant targeting of the diaphragm, liver, and pancreas after intraperitoneal administration of an AAV6.2 vector. [ 33 ] Furthermore, multiple studies employing an alternate method of systemic administration, the intravenous route, found that the liver (alongside the heart and skeletal muscle) was a major organ transduced by AAV6 and AAV6.2 [ 33 – 35 ] Taken together, our data, in alignment with other studies, suggests that intraperitoneal injection of AAV6.2 is suitable for robust transgene delivery to abdominal organs. To our knowledge, this is the first report of viral vectorized expression of a toll-like receptor. Previously, overexpression of TLR9 in B-cells using a conditional overexpression allele in a murine model of systemic lupus erythematosus has been reported. [ 36 ] Although their focus was not the safety and tolerability of TLR9 overexpression, a key finding was that TLR9 overexpression improved clinical signs of renal disease despite TLR9 activation driving the production of anti-DNA autoantibodies that mediate disease in systemic lupus erythematosus. [ 36 ] A limitation of this study is that only tissues from animals euthanized 28 days post-treatment were analyzed for the presence of vector genomes. An examination of vector genome copy numbers in animals euthanized 7 and 56 days post-treatment would provide more insight into the persistence and biodistribution of AAV6.2FF-TLR9. In particular, comparing biodistribution data from days 28 and 56 could reveal whether transgene expression persists or if transduced cells are being cleared by adaptive immune responses. Another limitation is that the animals were not screened for pre-existing antibodies against the capsid. Although AAV6.2FF is an engineered capsid, it only differs by three point mutations compared to wild-type AAV6 [ 15 ]. Due to a high degree of homology between the two capsids, animals that have previously encountered wild-type AAV6 would possess anti-capsid antibodies that may impede vector transduction and contribute to the immune response. [ 37 ] In conclusion, we have demonstrated the preclinical safety of an AAV-TLR9 vector in mice and hamsters. There was absence of significant changes in leukocyte counts, plasma biomarkers of hepatic or renal dysfunction, pro-inflammatory cytokines, or histological lesions. Taken together, these findings suggest that the vector has low immunogenicity and is well tolerated. Given its safety profile, this study provides preclinical evidence that supports the use of AAV-TLR9 as an adjunct to checkpoint inhibitor therapy, with the goal of enhancing innate signaling and sensitizing metastatic cancer to T-cell mediated elimination in an otherwise immunologically cold environment. Abbreviations AAV adeno–associated virus vg vector genomes TLR9 Toll–like receptor 9 ODN oligodeoxynucleotide MOI multiplicity of infection dpi days post infection Declarations Data availability All data generated or analysed during this study are included in this published article and its supplementary information file. Acknowledgements We would like to thank Veronique Carson, Sarah Griffiths, Sarah Boutcher, and all other staff members of the Animal Isolation Facility at the University of Guelph for their outstanding care of the animals used in this study. Author contributions Conceptualization, C.Y., B.T., and S.K.W.; methodology, C.Y.; histopathology, I.R.S.; writing—original draft preparation, C.Y. and S.K.W.; writing—review and editing, B.T., and I.R.S.; supervision, S.K.W.; funding acquisition, B.T. and S.K.W. All authors have read and agreed to the published version of the manuscript. Funding Funding for this study was provided by Wyvern Pharmaceuticals Inc. This work was supported in part by a grant from the Natural Sciences and Engineering Research Council of Canada (RGPIN-2018-04737) to S.K.W. Ethical approval All animal experiments were reviewed and approved (AUP #4664) by the Animal Care Committee at the University of Guelph in accordance with the guidelines stipulated by the Canadian Council on Animal Care. Competing interests S.K.W. is a scientific cofounder of Avamab Pharma Inc., a pre-clinical, pre-revenue stage company dedicated to research and development of AAV gene therapies for the treatment and prevention of infectious diseases and Inspire Biotherapeutics, a pre-clinical, pre-revenue stage company dedicated to research and development of AAV gene therapies for the treatment of monogenic lung diseases. S.K.W. is an inventor on a U.S. patent for the AAV6.2FF capsid, which is owned by the University of Guelph. This patent (US20190216949) is licensed to Avamab Pharma Inc. and Inspire Biotherapeutics. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. The other authors have no competing interests to declare. References Kawasaki T, Kawai T. Toll-like receptor signaling pathways. Front Immunol. 2014;5:461. Marongiu L, Gornati L, Artuso I, Zanoni I, Granucci F. Below the surface: The inner lives of TLR4 and TLR9. J Leukoc Biol. 2019;106:147–60. Chuang YC, Tseng JC, Huang LR, Huang CM, Huang CF, Chuang TH. Adjuvant effect of toll-like receptor 9 activation on cancer immunotherapy using checkpoint blockade. Front Immunol. 2020;11:1075. Miles MA, Luong R, To EE, Erlich JR, Liong S, Liong F, et al. TLR9 monotherapy in immune-competent mice suppresses orthotopic prostate tumor development. Cells. 2024;13:97. Parroche P, Roblot G, Le Calvez-Kelm F, Tout I, Marotel M, Malfroy M, et al. TLR9 re-expression in cancer cells extends the S-phase and stabilizes p16(INK4a) protein expression. Oncogenesis. 2016;5:e244. Fernandez-Rodriguez L, Cianciaruso C, Bill R, Trefny MP, Klar R, Kirchhammer N, et al. Dual TLR9 and PD-L1 targeting unleashes dendritic cells to induce durable antitumor immunity. J Immunother Cancer. 2023;11:e006714. Carbone C, Piro G, Agostini A, Delfino P, De Sanctis F, Nasca V, et al. Intratumoral injection of TLR9 agonist promotes an immunopermissive microenvironment transition and causes cooperative antitumor activity in combination with anti-PD1 in pancreatic cancer. J Immunother Cancer. 2021;9:e002876. Dongye Z, Li J, Wu Y. Toll-like receptor 9 agonists and combination therapies: strategies to modulate the tumour immune microenvironment for systemic anti-tumour immunity. Br J Cancer. 2022;127:1584–94. Karapetyan L, Luke JJ, Davar D. Toll-like receptor 9 agonists in cancer. Onco Targets Ther. 2020;13:10039–61. Wang J-H, Gessler DJ, Zhan W, Gallagher TL, Gao G. Adeno-associated virus as a delivery vector for gene therapy of human diseases. Signal Transduct Target Ther. 2024;9:78. Cortés-Guiral D, Hübner M, Alyami M, Bhatt A, Ceelen W, Glehen O, et al. Primary and metastatic peritoneal surface malignancies. Nat Rev Dis Primers. 2021;7:91. Nadiradze G, Horvath P, Sautkin Y, Archid R, Weinreich F-J, Königsrainer A, et al. Overcoming drug resistance by taking advantage of physical principles: pressurized intraperitoneal aerosol chemotherapy (PIPAC). Cancers. 2020;12:34. Tewari D, Java JJ, Salani R, Armstrong DK, Markman M, Herzog T, et al. Long-term survival advantage and prognostic factors associated with intraperitoneal chemotherapy treatment in advanced ovarian cancer: a gynecologic oncology group study. J Clin Oncol. 2015;33:1460–6. Balazs AB, Chen J, Hong CM, Rao DS, Yang L, Baltimore D. Antibody-based protection against HIV infection by vectored immunoprophylaxis. Nature. 2012;481:81–4. van Lieshout LP, Domm JM, Rindler TN, Frost KL, Sorensen DL, Medina SJ, et al. A novel triple-mutant AAV6 capsid induces rapid and potent transgene expression in the muscle and respiratory tract of mice. Mol Ther Methods Clin Dev. 2018;9:323–9. van Lieshout LP, Domm JM, Wootton SK. AAV-mediated gene delivery to the lung. Methods Mol Biol. 2019; 1950:361 – 72. Rghei AD, Stevens BAY, Thomas SP, Yates JGE, McLeod BM, Karimi K et al. Production of adeno-associated virus vectors in cell stacks for preclinical studies in large animal models. J Vis Exp. 2021; 172. International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH). S6(R1) Preclinical safety evaluation of biotechnology-derived pharmaceuticals. In: FDA Guidance Documents. U.S. Food and Drug Administration. 1997. https://www.fda.gov/regulatory-information/search-fda-guidance-documents/s6r1-preclinical-safety-evaluation-biotechnology-derived-pharmaceuticals . Accessed 19 Dec 2025. Zhu J, Huang X, Yang Y. The TLR9-MyD88 pathway is critical for adaptive immune responses to adeno-associated virus gene therapy vectors in mice. J Clin Invest. 2009;119:2388–98. Alakhras NS, Moreland CA, Wong LC, Raut P, Kamalakaran S, Wen Y, et al. Essential role of pre-existing humoral immunity in TLR9-mediated type I IFN response to recombinant AAV vectors in human whole blood. Front Immunol. 2024;15:1354055. Lek A, Wong B, Keeler A, Blackwood M, Ma K, Huang S, et al. Death after high-dose rAAV9 gene therapy in a patient with Duchenne’s muscular dystrophy. N Engl J Med. 2023;389:1203–10. Galletta F, Cucinotta U, Marseglia L, Cacciola A, Gallizzi R, Cuzzocrea S, et al. Hemophagocytic lymphohistiocytosis following gene replacement therapy in a child with type 1 spinal muscular dystrophy. J Clin Pharm Ther. 2022;47:1478–81. Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29:313–26. Bhavsar I, Miller CS, Al-Sabbagh M. Macrophage inflammatory protein-1 alpha (MIP-1 alpha)/CCL3: as a biomarker. General Methods in Biomarker Research and their Applications. 2015; 223 – 49. Huang X, Yang Y. Targeting the TLR9-MyD88 pathway in the regulation of adaptive immune responses. Expert Opin Ther Targets. 2010;14:787–96. Manno CS, Pierce GF, Arruda VR, Glader B, Ragni M, Rasko JJ, et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med. 2006;12:342–7. Mingozzi F, Maus MV, Hui DJ, Sabatino DE, Murphy SL, Rasko JJ, et al. CD8 + T-cell responses to adeno-associated virus capsid in humans. Nat Med. 2007;13:419–22. Tiegs G, Lohse AW. Immune tolerance: what is unique about the liver. J Autoimmun. 2009;34:1–6. Cao O, Dobrzynski E, Wang L, Nayak S, Mingle B, Terhorst C, et al. Induction and role of regulatory CD4 + CD25 + T cells in tolerance to the transgene product following hepatic in vivo gene transfer. Blood. 2007;110:1132–40. Kumar SRP, Hoffman BE, Terhorst C, de Jong YP, Herzog RW. The balance between CD8 + T cell-mediated clearance of AAV-encoded antigen in the liver and tolerance is dependent on the vector dose. Mol Ther. 2017;25:880–90. Mingozzi F, Liu YL, Dobrzynski E, Kaufhold A, Liu JH, Wang YQ, et al. Induction of immune tolerance to coagulation factor IX antigen by in vivo hepatic gene transfer. J Clin Invest. 2003;111:1347–56. Tay SS, Wong YC, McDonald DM, Wood NAW, Roediger B, Sierro F, et al. Antigen expression level threshold tunes the fate of CD8 T cells during primary hepatic immune responses. PNAS. 2014;111:2540–9. Abele S, Alanis-Lobato G, Oti M, Rust W, Blazevic D, Danner-Liskus J, et al. Mapping administration route-dependent transduction profiles of commonly used AAV variants in mice by barcode amplicon sequencing. Mol Ther Methods Clin Dev. 2025;33:101468. Zincarelli C, Soltys S, Rengo G, Rabinowitz JE. Analysis of AAV serotypes 1–9 mediated gene expression and tropism in mice after systemic injection. Mol Ther. 2008;16:1073–80. Weinmann J, Weis S, Sippel J, Tulalamba W, Remes A, El Andari J, et al. Identification of a myotropic AAV by massively parallel in vivo evaluation of barcoded capsid variants. Nat Comm. 2020;11:5432. Tilstra JS, John S, Gordon RA, Leibler C, Kashgarian M, Bastacky S, et al. B cell-intrinsic TLR9 expression is protective in murine lupus. J Clin Invest. 2020;130:3172–87. Mendell JR, Connolly AM, Lehman KJ, Griffin DA, Khan SZ, Dharia SD, et al. Testing preexisting antibodies prior to AAV gene transfer therapy: rationale, lessons and future considerations. Mol Ther Methods Clin Dev. 2022;25:74–83. Tables Tables 1 and 2 are available in the supplementary files section Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SupplementalFigure1.pdf Supplemental Figure S1 Cite Share Download PDF Status: Under Review Version 1 posted Reviewer # 2 agreed at journal 05 May, 2026 Review # 1 received at journal 16 Mar, 2026 Reviewer # 1 agreed at journal 27 Feb, 2026 Reviewers invited by journal 25 Jan, 2026 Editor assigned by journal 13 Jan, 2026 Submission checks completed at journal 13 Jan, 2026 First submitted to journal 07 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8545024","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":571074505,"identity":"5068a36e-3963-4bd3-af19-5d88a8a7c6b0","order_by":0,"name":"Sarah Wootton","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBACCRiDH0JZMBgQpeVAAgODZAOUT7wWgwPEapGckXzw8ccfNnnGN5IPv+apkMgzZ2B++AGfFmmJtGSDAwlpxWY30tKsec5IFFs2sBlL4NMiJ51jJnEg4XDiths5Zsa8bRKJGw7wMBCnZfMMkJZ/YC3MP/A6DKZlg0SO8WPeBrAWNry2SM5/lmxwJi0tccaZZ2mMc45JFBscZjOzwKdF4szhgw8qbGwS+9uTD394U2OTZ3C8+fENfFqQAdg9CQzMxKoHAuYPYC2jYBSMglEwCtAAAF1RSvXfS4v0AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-5985-2406","institution":"University of Guelph","correspondingAuthor":true,"prefix":"","firstName":"Sarah","middleName":"","lastName":"Wootton","suffix":""},{"id":571074506,"identity":"7de67db6-be27-4374-a42d-042021fcbb1e","order_by":1,"name":"Cici Yang","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Cici","middleName":"","lastName":"Yang","suffix":""},{"id":571074507,"identity":"2a59fc9b-5c2b-4254-ba9e-52b54b29d886","order_by":2,"name":"Igor Santos","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Igor","middleName":"","lastName":"Santos","suffix":""},{"id":571074508,"identity":"1ca67018-b68b-4b75-9e30-228527d41483","order_by":3,"name":"Brad Thompson","email":"","orcid":"","institution":"Avamab Pharma Inc.","correspondingAuthor":false,"prefix":"","firstName":"Brad","middleName":"","lastName":"Thompson","suffix":""}],"badges":[],"createdAt":"2026-01-07 20:30:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8545024/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8545024/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100133456,"identity":"b967895a-6451-45fd-af3f-301c976126d6","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92982,"visible":true,"origin":"","legend":"","description":"","filename":"AAVTLR9ManuscriptJan72026.docx","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/e7b59153cc478cb6af501f31.docx"},{"id":100133470,"identity":"adb14e18-f16a-46c7-ad9e-6281de8f5417","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"json","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5750,"visible":true,"origin":"","legend":"","description":"","filename":"GT202600011.json","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/52b44bdb8b4e228eda29028c.json"},{"id":100133477,"identity":"b9034983-2489-4a67-96dc-a5d86f5c5c63","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":939386,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/9fd3a89d87017818097899b2.pdf"},{"id":100133473,"identity":"6da47673-104d-404e-9ab7-4110850e3a4a","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113871,"visible":true,"origin":"","legend":"","description":"","filename":"GT2026000110enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/fa0ae15b1f79fecbbf628fa3.xml"},{"id":100368019,"identity":"e0d73f10-d133-4d78-af47-949c2fc6d7e6","added_by":"auto","created_at":"2026-01-16 07:57:31","extension":"pdf","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1099183,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/e87628fdacf355b96a20c3c5.pdf"},{"id":100133483,"identity":"5734474d-8eeb-453a-92d0-4892b1460135","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":437221,"visible":true,"origin":"","legend":"","description":"","filename":"Figure10.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/69b14bedf2600f347037fee1.pdf"},{"id":100366128,"identity":"21b1976b-6ff5-46b6-bc06-5d4284f9acac","added_by":"auto","created_at":"2026-01-16 07:55:59","extension":"pdf","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1936338,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/d827447e5346b1c690bf3cc6.pdf"},{"id":100133484,"identity":"96adf3f4-6174-4af0-a449-5bccebe477a8","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":634658,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/81b300f6fbb5873223c18bf5.pdf"},{"id":100366663,"identity":"890cd096-ff12-4254-9ddb-32d8624f21a6","added_by":"auto","created_at":"2026-01-16 07:56:27","extension":"pdf","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":507132,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/3b271b33107e13fc78dac84a.pdf"},{"id":100366572,"identity":"3df947f1-71b0-4a76-9e29-4cece71ab7c3","added_by":"auto","created_at":"2026-01-16 07:56:22","extension":"pdf","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":555936,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/963ed782868183d9924c1d90.pdf"},{"id":100133474,"identity":"b12fefba-0788-4415-8d19-66377542489b","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46282,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/37f9e806c66237517ae67ffb.pdf"},{"id":100366487,"identity":"328d01e2-878e-4ed4-a30c-0dcf4f6c7edd","added_by":"auto","created_at":"2026-01-16 07:56:19","extension":"pdf","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46027,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/68732f59ebc2a42cd0ec574d.pdf"},{"id":100366488,"identity":"4dfcb75c-2436-4e61-bc87-6265f1be7324","added_by":"auto","created_at":"2026-01-16 07:56:19","extension":"pdf","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":511738,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/d36ea3627f2ca16a6235f9f0.pdf"},{"id":100133480,"identity":"c5da74e9-12d6-46e8-9a9e-9b7190312e27","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":512570,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/9eb0caf7640e3f0d0b920367.pdf"},{"id":100366813,"identity":"c73a5c7f-4614-4cca-9935-fb21105e7b66","added_by":"auto","created_at":"2026-01-16 07:56:34","extension":"pdf","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":730780,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/019e6692ea62b8662c31d39e.pdf"},{"id":100133485,"identity":"3b630afb-87ab-48c3-9727-68955de4d484","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":639661,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/6ac91475540041bf55d0dfd7.pdf"},{"id":100366692,"identity":"3d9be2df-9ab9-4b03-ad3b-a0ce838118d3","added_by":"auto","created_at":"2026-01-16 07:56:29","extension":"xml","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110934,"visible":true,"origin":"","legend":"","description":"","filename":"GT2026000110structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/bb0866a1379b9a93a1d0300c.xml"},{"id":100133481,"identity":"d940b943-9c15-49b7-a3cf-fb86e1b677f3","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"html","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126067,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/db38a7eb02f5c4cf12558510.html"},{"id":100133453,"identity":"6081fe5c-c4fe-4b00-b0ff-63a02e6038a1","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":336324,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAAV-TLR9 vector design and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e confirmation of TLR9 expression\u003c/strong\u003e. (A) Schematic of AAV genome encoding a CASI promoter driving expression of human TLR9 (AAV-TLR9) or human TLR9 encoding a C-terminal HA epitope tag (AAV-TLR9-HA) and flanked by AAV2 ITRs. HEK293T Lenti X cells were transduced with AAV-TLR9 and AAV-TLR9-HA at a multiplicity of infection (MOI) of 100,000 and harvested 5 days later. Cells were transfected (TF) with a plasmid expressing a protein with an HA tag (SPC-HA) as a positive control or mock transfected as a negative control. (B) Cell lysates were probed with an anti-HA-tag antibody (Cell Signaling, HA-Tag (C29F4) mAb #3724) at a dilution of 1:1000. TLR9-HA migrated at ~130 kDa indicative of the unprocessed protein. (C) Cell lysates were probed with anti-TLR9 antibody (ThermoFisher, PA5-85316) at a dilution of 1:1000. TLR9 migrated 65-75 kDa indicative of the processed form of TLR9. Note that the anti-TLR9 antibody consistently binds to the MW marker leading to the appearance of additional bands.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/b27e15814dda72a6aceeadd2.png"},{"id":100133466,"identity":"3278a95d-494a-4330-b60b-da31665c16cb","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1536499,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e confirmation of AAV6.2FF-mediated TLR9 expression using RNAscope.\u003c/strong\u003e Six-week-old female BALB/c mice (n=4) were injected intraperitoneally with PBS or 1×10\u003csup\u003e11\u003c/sup\u003evg of AAV6.2FF-TLR9 and tissues were harvested at 21 dpi. FFPE tissues were incubated with an RNA probe specific for the codon optimized human TLR9. The signal was amplified and then visualized using Fast Red. Sections were counterstained with hematoxylin. Scale bar=50um for all figures, except for lymph node where scale bar=100um. The inset is a high magnification of the heart from an AAV6.2FF-TLR9 treated mouse (scale bar=20um).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/77a36121553adeb4e9f51b57.png"},{"id":100133460,"identity":"f964d225-a9a3-423e-b188-a67de108bca9","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":125578,"visible":true,"origin":"","legend":"\u003cp\u003eWeight change and differential leukocyte count in AAV-TLR9 treated mice. Six-week-old BALB/c mice were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. (A) Animals were weighed on days 0, 4, and every 7 days post-injection until endpoint. Data was plotted as mean  standard deviation and analyzed using a one-way ANOVA. Sodium-heparinized plasma was analyzed for (B) white blood cells, (C) lymphocytes, (D) monocytes, (E) eosinophils and (D) segmented neutrophils. Bars represent mean ± standard deviation and each point represents an individual animal (closed circle = male, open circle = female). Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/f522436c9795cfa7e647c568.png"},{"id":100366665,"identity":"da0eebda-9f38-4017-a0d9-6c6747f04ef4","added_by":"auto","created_at":"2026-01-16 07:56:27","extension":"pdf","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1936338,"visible":true,"origin":"","legend":" Six-week-old female BALB/c mice (n\u0026thinsp;=\u0026thinsp;4) were injected intraperitoneally with PBS or 1\u0026times;10vg of AAV6.2FF-TLR9 and tissues were harvested at 21 dpi. FFPE tissues were incubated with an RNA probe specific for the codon optimized human TLR9. The signal was amplified and then visualized using Fast Red. Sections were counterstained with hematoxylin. Scale bar =\u0026thinsp;50um for all figures, except for lymph node where scale bar =\u0026thinsp;100um. The inset is a high magnification of the heart from an AAV6.2FF-TLR9 treated mouse (scale bar =\u0026thinsp;20um).","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/12e7bac93516539589d093da.pdf"},{"id":100366114,"identity":"1c3daefe-4b3e-4214-b1b6-e2b052812124","added_by":"auto","created_at":"2026-01-16 07:55:59","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":288474,"visible":true,"origin":"","legend":"\u003cp\u003eMouse blood biochemistry and serology results. Six-week-old BALB/c mice were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. Sodium-heparinized plasma was analyzed for (A) alanine aminotransferase, (B) aspartate aminotransferase, (C) urea, (D) total protein, (E) albumin, (F) globulin, and (G) albumin:globulin ratio. (H) EDTA plasma was collected and an anti-AAV6.2FF capsid ELISA was performed. Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026lt;0.05. Bars represent mean ± standard deviation and each point represents an individual animal (closed circle = male, open circle = female). Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/d0c5a36ef3ea8d50b4dfbcaa.png"},{"id":100367372,"identity":"1642f1cd-4bae-490e-bf06-2a33e493faa5","added_by":"auto","created_at":"2026-01-16 07:57:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":237241,"visible":true,"origin":"","legend":"\u003cp\u003eMouse cytokine profile. Six-week-old BALB/c mice were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. EDTA plasma was collected on days 1, 7, 28, and 56 post-injection and analyzed for (A) IFNγ, (B) TNFα, (C) MCP-1, (D) GM-CSF, (E) IL-1β, (F) IL-2, (G) IL-4, (H) IL-6, (I) IL-10, and (J) IL-12p70. Bars represent mean ± standard deviation and each point represents an individual animal (closed circle = male, open circle = female). Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference.\u0026nbsp;\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/74541d0f7d02efa59cd9852d.png"},{"id":100367220,"identity":"e65ec6b8-aee5-49d3-ba4f-be2792224608","added_by":"auto","created_at":"2026-01-16 07:56:51","extension":"pdf","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":634658,"visible":true,"origin":"","legend":" Six-week-old BALB/c mice were injected intraperitoneally with 1.510 vg/kg (low) or 4.510 vg/kg (high) of AAV6.2FF-TLR9 or PBS. (A) Animals were weighed on days 0, 4, and every 7 days post-injection until endpoint. Data was plotted as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation and analyzed using a one-way ANOVA. Sodium-heparinized plasma was analyzed for (B) white blood cells, (C) lymphocytes, (D) monocytes, (E) eosinophils and (D) segmented neutrophils. Bars represent mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation and each point represents an individual animal (closed circle\u0026thinsp;=\u0026thinsp;male, open circle\u0026thinsp;=\u0026thinsp;female). Data was analyzed using a two-way ANOVA and Tukey\u0026rsquo;s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/c9a1609c755c8c9af02c0a92.pdf"},{"id":100366471,"identity":"f47a40a8-1cf5-44d9-bb1e-e8b90d1bca4b","added_by":"auto","created_at":"2026-01-16 07:56:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":103689,"visible":true,"origin":"","legend":"\u003cp\u003eBiodistribution of AAV6.2FF-TLR9 following intraperitoneal injection in mice. Six-week-old BALB/c mice were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. Tissues from the (A) lung, (B) heart, (C) liver, (D) spleen, (E) pancreas, (F) kidney, (G) gonads, (H) skeletal muscle, (I) brain, and (J) lymph node were collected from the groups of mice euthanized on day 28 and AAV vector genomes were quantified using qPCR. Data is displayed as geometric mean ± geometric standard deviation after average background values from vehicle control mice were subtracted for each tissue type. The data was analyzed using a two-tailed lognormal Welch’s t-test.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/05c6caa933860b8eb9db1986.png"},{"id":100366476,"identity":"60293e6e-d6dd-4192-beb1-d844495a888b","added_by":"auto","created_at":"2026-01-16 07:56:19","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":129823,"visible":true,"origin":"","legend":"\u003cp\u003eWeight change and differential leukocyte count in AAV-TLR9 treated hamsters. Four-week-old HsnHan:AURA Golden Syrian hamsters were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. (A) Animals were weighed on days 0, 4, and every 7 days post-injection until endpoint. Data was plotted as mean  standard deviation and analyzed using a one-way ANOVA. Sodium-heparinized plasma was analyzed for (B) white blood cells, (C) lymphocytes, (D) monocytes, (E) eosinophils and (F) segmented neutrophils. Bars represent mean ± standard deviation and each point represents an individual animal (closed circle = male, open circle = female). Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/d147f2c2cf4e614dfff6348a.png"},{"id":100133465,"identity":"6059dff4-d72a-429e-a654-7e50199547e8","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"pdf","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":507132,"visible":true,"origin":"","legend":" Six-week-old BALB/c mice were injected intraperitoneally with 1.510 vg/kg (low) or 4.510 vg/kg (high) of AAV6.2FF-TLR9 or PBS. Sodium-heparinized plasma was analyzed for (A) alanine aminotransferase, (B) aspartate aminotransferase, (C) urea, (D) total protein, (E) albumin, (F) globulin, and (G) albumin:globulin ratio. (H) EDTA plasma was collected and an anti-AAV6.2FF capsid ELISA was performed. Data was analyzed using a two-way ANOVA and Tukey\u0026rsquo;s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Bars represent mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation and each point represents an individual animal (closed circle\u0026thinsp;=\u0026thinsp;male, open circle\u0026thinsp;=\u0026thinsp;female). Data was analyzed using a two-way ANOVA and Tukey\u0026rsquo;s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/fe0957afcdcc753f1c24c5df.pdf"},{"id":100367999,"identity":"26174ae5-e71a-4c3a-8db8-b51d1cd0d393","added_by":"auto","created_at":"2026-01-16 07:57:30","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":159821,"visible":true,"origin":"","legend":"\u003cp\u003eHamster blood biochemistry and serology results. Four-week-old HsnHan®:AURA Golden Syrian hamsters were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. Sodium-heparinized plasma was analyzed for (A) alanine aminotransferase, (B) aspartate aminotransferase, (C) urea, (D) total protein, (E) albumin, (F) globulin, and (G) albumin:globulin ratio. (H) EDTA plasma was collected and an anti-AAV6.2FF capsid ELISA was performed. Bars represent mean ± standard deviation and each point represents an individual animal (closed circle = male, open circle = female). Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/a2e64275939f7124010d13bb.png"},{"id":100133462,"identity":"a62b89a0-4f26-484f-a242-897c68c3af36","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":227864,"visible":true,"origin":"","legend":"\u003cp\u003eHamster cytokine profile. Four-week-old HsnHan®:AURA Golden Syrian hamsters were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. EDTA plasma collected on days 1, 7, 28, and 56 post-injection were analyzed for (A) IFNγ, (B) TNFα, (C) MIP-1α, (D) MCP-1, (E) IL-1β, (F) IL-2, (G) IL-4, (H) IL-6, (I) IL-10, and (J) IL-18. Bars represent mean ± standard deviation and each point represents an individual animal (closed circle = male, open circle = female). Data was analyzed using a two-way ANOVA and Tukey’s HSD test was performed if the initial ANOVA yielded a significant difference. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/ae31b25c195bcf4d621a91fb.png"},{"id":100133463,"identity":"effa80d0-11dc-45eb-8418-cc6a1e82c8f5","added_by":"auto","created_at":"2026-01-13 10:27:30","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":157505,"visible":true,"origin":"","legend":"\u003cp\u003eBiodistribution of AAV6.2FF-TLR9 following intraperitoneal injection in hamsters. Four-week-old HsnHan:AURA Golden Syrian hamsters were injected intraperitoneally with 1.5×1013 vg/kg (low) or 4.5×1013 vg/kg (high) of AAV6.2FF-TLR9 or PBS. Tissues from the (A) lung, (B) heart, (C) liver, (D) spleen, (E) pancreas, (F) kidney, (G) gonads, (H) skeletal muscle, and (I) brain were harvested from the groups of hamsters euthanized on day 28 and AAV vector genomes were quantified using qPCR and AAV vector genomes were quantified using qPCR. Data is displayed as geometric mean ± geometric standard deviation after average background values from vehicle control mice were subtracted for each tissue type. The data was analyzed using a two-tailed lognormal Welch’s t-test.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/df2a82b4ab1b015eb65f437a.png"},{"id":100382226,"identity":"9a50985b-900a-4cdf-badd-dc8902cee7cd","added_by":"auto","created_at":"2026-01-16 10:41:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3494492,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/51d41dab-38bd-49eb-849c-4b62c4d6092b.pdf"},{"id":100367380,"identity":"b36df3ee-fb47-49a6-909f-3ca8ed53ddb1","added_by":"auto","created_at":"2026-01-16 07:57:02","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":939386,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental Figure S1\u003c/p\u003e","description":"","filename":"SupplementalFigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8545024/v1/8cb0c9a15157d74a9b43946a.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Preclinical Safety and Tolerability of an AAV Vector Expressing TLR9 in Mice and Hamsters","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInnate sensing of unmethylated CpG DNA by toll-like receptor 9 (TLR9) orchestrates a canonical MyD88-dependent cascade that activates nuclear factor-κB (NF-κB) and interferon regulatory factors, driving production of pro-inflammatory cytokines and type I interferons and licensing antigen-presenting cells (APCs) for effective T-cell priming. [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] TLR9 moves from the endoplasmic reticulum to endolysosomal compartments with the assistance of the chaperone UNC93B1, a process that does not depend on ligand binding. Its activation requires proteolytic cleavage and recognition of unmethylated CpG DNA within acidic endosomes. [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] Activation of TLR9 signaling in myeloid and lymphoid compartments has been shown in preclinical models to augment antitumor immunity by enhancing dendritic cell activation, promoting cytotoxic T-cell priming, and shifting the tumor microenvironment toward a pro-inflammatory phenotype. [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] Emerging evidence indicates that TLR9 activity within the tumor microenvironment is an important determinant of responsiveness to immune checkpoint inhibitors, as its activation enhances dendritic-cell cross-presentation and restores antitumor T-cell function. [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] Thus, it is not surprising that loss or deficiency of TLR9 function compromises tumor immunosurveillance and diminishes responsiveness to immune checkpoint inhibitors. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eDespite extensive efforts with CpG oligodeoxynucleotide (ODN) TLR9 agonists, clinical activity as monotherapy has been limited and context-dependent [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]; moreover, these agents are dependent on the presence of functional TLR9 protein expression. Gene transfer approaches can overcome these constraints by restoring receptor availability. Among viral delivery systems, adeno-associated virus (AAV) vectors offer a favorable safety profile, broad tropism across dividing and non-dividing cells, and durable episomal transgene expression with low genotoxic risk relative to integrating vectors; these attributes reinforce the growing clinical adoption of AAV and multiple recent regulatory approvals. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eThe peritoneal cavity is a common site of dissemination for ovarian, colorectal, gastric, and appendiceal cancers and remains therapeutically challenging due to the peritoneum-plasma barrier, diffuse nodularity, and a profoundly suppressive microenvironment.[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] Clinical and translational advances in intraperitoneal (IP) therapy, including hyperthermic intraperitoneal chemotherapy (HIPEC), catheter-based IP chemotherapy, and pressurized IP aerosol chemotherapy, demonstrate that regional dosing can enhance local drug concentrations and, in selected contexts, improve outcomes, motivating exploration of gene-based locoregional strategies. [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eHere we engineered a TLR9 encoding AAV vector to provide systemic, durable expression of human TLR9 following intraperitoneal administration. We also assessed the safety and tolerability of this vector in two animal models. TLR9 mRNA expression was detected in a range of tissues including liver, spleen, pancreas, ovary, heart, and lymph node 21 days following intraperitoneal administration of a standard dose of 1x10\u003csup\u003e11\u003c/sup\u003e vector genomes (vg) AAV6.2FF-TLR9 to BALB/c mice. Toxicological analysis of low (1.5\u0026times;10\u003csup\u003e13\u003c/sup\u003e vg/kg) and high (4.5\u0026times;10\u003csup\u003e13\u003c/sup\u003e vg/kg) dose AAV6.2FF-TLR9 at three time points (7-, 28-, and 56-days post AAV administration) in mice and hamsters revealed that the vector was well tolerated in both species based on the absence of significant changes in leukocyte counts, plasma biomarkers of hepatic or renal dysfunction, and pro-inflammatory cytokines. Additionally, no histological abnormalities were detected in any examined tissues. These findings indicate a favorable safety profile and support advancement of AAV-TLR9 into clinical development.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cem\u003eAAV Vector Production.\u003c/em\u003e The coding sequence for human TLR9 (Genbank accession number NM_17442.4) was human codon optimized and synthesized by Genscript USA. The TLR9 gene was cloned into the KpnI-XbaI site of an AAV vector genome between the composite CASI promoter [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and an SV40 polyadenylation signal. The entire expression cassette was flanked by AAV2 inverted terminal repeats to facilitate packaging (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and fully sequenced by Plasmidsaurus. Genomes were packaged into the AAV6.2FF capsid [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and production was carried out as previously described using adherent Lenti-X 293T cells and heparin affinity chromatography. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eAAV Titration and Quality Control Assays.\u003c/em\u003e AAV vector genome titers were determined by qPCR as described previously. [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] For this, 5 uL aliquots of vector were first treated with DNase (Promega M6101) to eliminate any non-viral DNA followed by proteinase K (Invitrogen LSAM2546). Viral DNA genomes were purified using the Qiagen Blood and Tissue Kit (Qiagen 69504). AAV DNA genomes were quantified by qPCR using a TaqMan primer and probe set against the SV40 polyA: forward primer 5\u0026rsquo;- AGCAATAGCATCACAAATTTCACAA-3\u0026rsquo;, reverse primer 5\u0026rsquo;- CCAGACATGATAAGATACATTGATGAGTT-3\u0026rsquo; and probe 5\u0026rsquo; AGCATTTT TTTCACTGCATTCTAGTTGTGGTTTGTC/56-FAM/AGCATTTTT/Zen/\u003c/p\u003e \u003cp\u003eTTCACTGCATTCTAGTTGTGGTTTGTC/ 3IABkFQ/ (Integrated DNA Technologies Coralville, IA, USA), Luna universal qPCR master mix (New England Biolabs M3003), and a LightCycler 480 (Roche) thermal cycler. Vector genome integrity and virus batch purity were evaluated by alkaline gel electrophoresis and SDS PAGE Coomassie staining as described previously. [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e \u003cp\u003e\u003cem\u003eAnimal Experiments.\u003c/em\u003e All animal experiments were reviewed and approved (AUP# 4664) by the Animal Care Committee at the University of Guelph in accordance with the guidelines outlined by the Canadian Council on Animal Care. Five-week-old BALB/c mice (Strain code 028) were purchased from Charles River Laboratories and 3-week-old Syrian hamsters (HsdHan\u0026reg;:AURA) were purchased from Envigo. All animals were given a 7-day acclimation period before proceeding with animal experiments. For the \u003cem\u003ein-situ\u003c/em\u003e TLR9 mRNA expression pilot study, female mice (n\u0026thinsp;=\u0026thinsp;4) were injected intraperitoneally with 1x10\u003csup\u003e11\u003c/sup\u003evg of AAV6.2FF-TLR9 or phosphate-buffered saline (PBS) in a final volume of 250uL. Mice were euthanized by isoflurane overdose followed by CO\u003csub\u003e2\u003c/sub\u003e inhalation 21 days post-injection and the collected tissues were fixed in 10% phosphate-buffered formalin for 24 hours. For the toxicology study, groups of 18 BALB/c mice (9 males and 9 females) and groups of 12 Syrian hamsters (6 males and 6 females) were injected intraperitoneally with (1) PBS, (2) a low dose of 1.5\u0026times;10\u003csup\u003e13\u003c/sup\u003e vg/kg of AAV6.2FF-TLR9, or (3) a high dose of 4.5\u0026times;10\u003csup\u003e13\u003c/sup\u003e vg/kg of AAV6.2FF-TLR9 in a final volume of 250uL. The animals were weighed immediately prior to injection, as well as on days 4, 7, 14, 21, 28, 35, 42, 49, and 56 post-AAV administration. On day 1 post-injection, non-terminal blood was collected from mice via the saphenous vein using a 25G needle (Med-Vet International, Mettawa, IL, USA) and an EDTA microvette (Sarstedt Inc, Newton, NC, USA). Hamsters were anesthetized using isoflurane then non-terminal blood was collected on day 1 post-injection via the subclavian vein using an Air-Tite Luer Slip 25G syringe (Air-Tite Products Co., Inc., Virginia Beach, VA, USA) and a MiniCollect\u0026reg; EDTA tube (Greiner Bio-One, Monroe, NC, USA). Each endpoint group consisted of equal numbers of male and female animals (9 males and 9 females for mice, 6 males and 6 females for hamsters). On days 7, 28, and 56 post-injection, the animals were deeply anesthetized using isoflurane and terminal blood collection was performed via heart puncture for mice or subclavian vein bleed for hamsters. Approximately 200uL of whole blood was allotted to an EDTA blood collection tube and the remaining whole blood was collected in a BD Vacutainer\u0026reg; Sodium Heparin tube (BD Diagnostics Systems, Mississauga, ON, Canada). The animals were then euthanized by isoflurane overdose followed by CO\u003csub\u003e2\u003c/sub\u003e inhalation. The inguinal lymph nodes (for mice only), lung, heart, liver, spleen, pancreas, kidneys, testicles or ovaries, skeletal muscle, and brain were harvested. Half of each organ was fixed in 10% phosphate-buffered formalin for 24 hours and the other half was frozen at \u0026minus;\u0026thinsp;80\u0026deg;C until further processing.\u003c/p\u003e \u003cp\u003e \u003cem\u003eHistopathology and RNA In-Situ Hybridization.\u003c/em\u003e Formalin-fixed tissues were routinely processed for histology and stained with hematoxylin and eosin. The slides were examined by an anatomic pathologist blinded to the treatment groups. A preliminary study to observe the \u003cem\u003ein-situ\u003c/em\u003e expression of AAV6.2FF-TLR9 in mice was conducted using RNAScope\u0026trade; 2.5 High-Definition RED Assay (Advanced Cell Diagnostics, 322350). Deparaffinized and rehydrated 4um-thick sections from the formalin-fixed tissues were submitted to manual antigen retrieval, performed at 95\u0026ordm;C for 15min or 30min (liver only). Tissue sections were hybridized with a custom probe against human TLR9 mRNA (probe ID: Hs-TLR9-O1-NoXMmMau) then the signal was amplified using the HybEZ\u0026trade; oven (Advanced Cell Diagnostics) as per manufacturer\u0026rsquo;s instructions. The signal was detected using Fast Red dye provided in the kit, and the sections were counterstained with hematoxylin. Slides were examined to assess signal distribution and imaged using a Nikon Digital Sight 10 camera and CellSens microscope imaging software.\u003c/p\u003e \u003cp\u003e \u003cem\u003eDifferential Leukocyte Count and Biochemical Profile.\u003c/em\u003e Sodium-heparin whole blood was submitted to the Animal Health Laboratory at the University of Guelph (Guelph, Ontario, Canada) for the following tests: differential leukocyte count, alanine aminotransferase, aspartate aminotransferase, urea, and total protein profile.\u003c/p\u003e \u003cp\u003e \u003cem\u003eTotal Anti-AAV6.2FF-TLR9 Antibodies.\u003c/em\u003e Half-area 96-well ELISA plates (Corning 3690) were coated with 1x10\u003csup\u003e10\u003c/sup\u003evg/mL of AAV6.2FF-TLR9 and incubated overnight at 4\u0026deg;C. The plates were blocked with SuperBlock\u0026trade; blocking buffer (Fisher 37515) for 90 minutes at room temperature. Two-fold serial dilutions of EDTA plasma from mice and hamsters starting from a 1:50 dilution were plated and incubated for 1 hour at 37\u0026deg;C. A 2-fold serial dilution of mouse IgG-2a anti-AAV8 primary antibody (ProGen 610160S) starting from a 1:50 dilution was plated in parallel to serve as the negative control. Goat anti-mouse IgG HRP-conjugated secondary antibody (Invitrogen G-21040) or goat anti-Syrian hamster IgG HRP-conjugated secondary antibody (Invitrogen HA6007) diluted 1:5000 in SuperBlock blocking buffer was plated then incubated for 1 hour at 37\u0026deg;C. The plate was incubated with TMB ELISA substrate (Thermo Scientific 34021) for 15 minutes and the absorbance at 650nm was detected using a Promega GloMax\u0026reg; Multi microplate reader (Madison, WI, USA). Total antibody titer was defined as the lowest dilution of plasma that produced an OD650 reading below double the mean OD650 reading of the negative control wells.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCytokine Analysis.\u003c/em\u003e EDTA plasma from mice was diluted 1:2 in PBS then submitted to Eve Technologies (Calgary, Alberta, Canada) for the Mouse Cytokine Proinflammatory Focused 10-Plex Discovery Assay\u0026reg; using the Luminex\u0026reg; 200\u0026trade; platform. This cytokine panel analyzed: IFNγ, TNFα, MCP-1, GM-CSF, IL-1β, IL-2, IL-4, IL-6, IL-10, and IL-12p70. EDTA plasma from hamsters was diluted 1:5 in PBS and submitted to Ampersand Biosciences (Lake Clear, New York, USA) for the Hamster MAP 1.0 cytokine panel using the Luminex\u0026reg; platform which detected: IFNγ, TNFα, MIP-1α, MCP-1, IL-1β, IL-2, IL-4, IL-6, IL-10, and IL-18.\u003c/p\u003e \u003cp\u003e \u003cem\u003eAAV Vector Biodistribution.\u003c/em\u003e Up to 30mg of frozen tissue was homogenized in tissue lysis buffer (Omega Bio-tek D3396-03) using 5mm stainless steel beads (Qiagen 69989) and a Qiagen TissueLyser II (Germantown, MD, USA) set to run for two rounds of 2 minutes at 30Hz. DNA was extracted from the homogenate using the E.Z.N.A.\u0026reg; Tissue DNA kit (Omega Bio-tek D3396-03). Vector genomes were quantified by qPCR as described above. A DeNovix DS-7 DNA quantification spectrophotometer (Wilmington, Detroit, USA) was used to quantify the total genomic DNA concentration of each sample. Vector genome numbers were normalized to total genomic DNA concentration prior to statistical analysis.\u003c/p\u003e \u003cp\u003e \u003cem\u003eStatistical Analysis.\u003c/em\u003e Graphpad Prism 9 software (San Diego, CA, USA) was used to perform all statistical analyses. Mean and standard deviation are displayed on all graphs except for the vector biodistribution figures, which show the geometric mean and geometric standard deviation. Two-way analysis of variance (ANOVA) was used to evaluate the differences within cohorts. Tukey\u0026rsquo;s multiple comparison test was used as a post-test. An unpaired One-way ANOVA was used to compare the mouse weights over time. A lognormal two-tailed t-test was used to compare the vector biodistribution between low dose and high dose groups. \u003cem\u003eP\u003c/em\u003e values of \u0026lt;\u0026thinsp;0.05 was considered significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eConfirmation of AAV6.2FF-TLR9 expression in vitro and in vivo\u003c/h2\u003e \u003cp\u003eThe AAV6.2FF-TLR9 investigational construct was engineered to encode a codon-optimized human TLR9 gene under the control of a constitutive CASI promoter and flanked by AAV2 inverted terminal repeats (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Following full plasmid sequencing, the AAV-TLR9 genome was packaged into an AAV6.2FF capsid and subjected to standard quality control assays including qPCR for vector titer, Coomassie staining for vector purity, and alkaline gel for confirmation of genome integrity (data not shown). To confirm TLR9 expression, Lenti-X 293T cells were transduced with AAV vectors expressing TLR9 or a C-terminally HA-tagged version of TLR9 engineered to facilitate \u003cem\u003ein vitro\u003c/em\u003e confirmation of TLR9 expression at a multiplicity of infection of 100 000. The full-length unprocessed form of TLR9-HA was detected when probed with an anti-HA antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), and the processed form was detected when probed with an anti-TLR9 antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). These results demonstrate effective \u003cem\u003ein vitro\u003c/em\u003e transgene expression of TLR9 following AAV transduction.\u003c/p\u003e \u003cp\u003eTo confirm AAV-mediated expression of TLR9 \u003cem\u003ein vivo\u003c/em\u003e, a small-scale study was conducted in four vector-treated mice and one vehicle control mouse. For this, mice were administered an intraperitoneal injection of 1x10\u003csup\u003e11\u003c/sup\u003e vg of AAV6.2FF-TLR9 or PBS, euthanized 21 days post-AAV administration, and tissues from all major organs were collected for RNAScope analysis of TLR9 mRNA expression. No TLR9 signals were detected in the brain, lung, kidney, and skeletal muscle (Supplemental Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Organs positive for TLR9 signals included the lymph node, spleen, liver, pancreas, ovary, and heart (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). All tissues positive for TLR9, except for lymph node, were consistent in their staining: the PBS-treated mouse showed no signal, while transgene mRNA was detected in all vector-treated mice. Lymph node was the exception: the PBS-treated mouse showed no signal, while vector-treated mice showed variable staining (no signal in 1/4 mice, positive signal in 3/4 mice). In the lymph node, the signal was observed primarily in the lymphoid follicles and was also present in the interfollicular zone. Similarly, in the spleen, the signal was concentrated in the splenic follicles with additional signal scattered across the red pulp. The signal was restricted to the hepatic cords in the liver. In the pancreas, the signal was predominantly localized to the pancreatic acini with occasional signal observed in the pancreatic islets. In the ovary, the signal was primarily detected in the stroma as well as in ovarian follicles but no signal was observed within oocytes. Finally, in the heart, the signal was observed in the myocardium. Taken together, these data confirm systemic expression of human TLR9 from the intraperitoneally delivered AAV6.2FF-TLR9 vector.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSafety and tolerability of AAV-TLR9 in a mouse model\u003c/h3\u003e\n\u003cp\u003eA mouse study was designed to investigate the safety and tolerability of intraperitoneal administration of AAV6.2FF-TLR9. The study was designed to evaluate two doses of AAV6.2FF-TLR9\u0026mdash;1.5\u0026times;10\u0026sup1;\u0026sup3; vg/kg (low) and 4.5\u0026times;10\u0026sup1;\u0026sup3; vg/kg (high)\u0026mdash;at three timepoints: 7, 28, and 56 days post-AAV administration (n\u0026thinsp;=\u0026thinsp;6; 3 males and 3 females) (Table\u0026nbsp;1). Mice were weighed on days 0, 4, and every 7 days post-AAV administration until endpoint. No significant change in weight was observed following administration of the low or high dose of AAV6.2FF-TLR9 when compared to the vehicle control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Due to the limited amount of blood that can be taken at one time point, only terminal blood draws were taken from the mice at endpoint. For all time points, there were no notable differences in leukocyte counts between the vehicle group and the AAV-TLR9 treated groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-E). The only significant observation was an increase in the segmented neutrophil count of the vehicle control group at day 56 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe blood biochemistry parameters displayed non-dose-related changes, since all remarkable clinical findings were isolated to the vehicle control and low dose groups. Vehicle mice experienced transient elevations in hepatic transaminases (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) which resolved by day 28. Mice injected with the low dose of vector demonstrated a transient increase in aspartate aminotransferase (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), which subsided by day 28. A transient plasma protein imbalance was also observed in the low-dose mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG); higher albumin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) and lower globulin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF) levels were recorded for days 7 and 28 and these levels then corrected by day 56.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTotal anti-AAV6.2FF capsid antibody titers in mice from vehicle control group remained consistent across each of the timepoints. Mice from the low dose group demonstrated elevated anti-capsid antibodies compared to the other treatment groups, but this difference was only statistically significant compared to the vehicle group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). At day 56, both vector-treated groups possessed higher antibody titers than the vehicle control group; however, neither achieved statistical significance.\u003c/p\u003e \u003cp\u003eCytokine analysis of plasma samples collected on days 1, 7, 28 and 56 post-treatment revealed no statistically significant difference between treatment groups at any timepoint, nor were any statistically significant differences observed between timepoints (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). No notable trend was observed for any of the cytokines evaluated.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTissues from the cohort of mice that were euthanized on day 28 post-treatment were analyzed for AAV vector biodistribution using qPCR. The AAV6.2FF-TLR9 genome was detected at similar levels for both the high and low dose groups in most tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). A mild but not significant dose-dependent increase was observed in the lung, heart, liver, spleen, gonads, and lymph node with the highest mean number of vector genomes being detected in the liver and pancreas (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). The organs with the lowest mean number of vector genomes detected included the lung, skeletal muscle, lymph node, and brain.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistological evaluation was performed on tissues collected from all mice at the three designated time points (day 7, 28 and 56) to assess potential adverse effects in the brain, gonads, kidneys, skeletal muscle, pancreas, liver, spleen, heart, lung, and lymph nodes that could be associated with intraperitoneal administration of AAV6.2FF-TLR9. No significant histological lesions were observed, except for mild, focal myositis in the female cohort of mice that were administered the high dose and euthanized on day 7, and this finding was interpreted to be incidental. Overall, none of the organs were found to show lesions due to vector-related toxicities.\u003c/p\u003e\n\u003ch3\u003eSafety and tolerability of AAV-TLR9 in the hamster model\u003c/h3\u003e\n\u003cp\u003e To complement the mouse toxicology data and further evaluate interspecies variability in AAV6.2FF-TLR9 safety and biodistribution, a second study was conducted in Golden Syrian hamsters, a pharmacologically relevant species selected in accordance with ICH S6(R1) guidance. [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] As with the mice, two doses of AAV6.2FF-TLR9 were evaluated\u0026mdash;1.5\u0026times;10\u0026sup1;\u0026sup3; vg/kg (low) and 4.5\u0026times;10\u0026sup1;\u0026sup3; vg/kg (high)\u0026mdash;at three timepoints: 7, 28, and 56 days post-AAV administration (n\u0026thinsp;=\u0026thinsp;4; 2 males and 2 females) (Table\u0026nbsp;2). No significant differences in weight gain were observed over the study period (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Hamsters that received a low dose of the vector had significantly higher lymphocyte and segmented neutrophil counts, thus contributing to the higher white blood cell count, at day 28 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). These elevations, indicative of an adaptive immune response involving secondary recruitment of neutrophils, were short-lived and resolved by day 56. Hamsters injected with the low dose of vector also demonstrated an uptick in hepatic transaminases and urea on day 56 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). All treatment groups had lower globulin levels and, in turn, lower total protein levels at day 7. These levels increased at each subsequent timepoint. Given that there was no significant difference between treatment groups and all groups followed the same trend, the protein increase observed may simply be attributed to maturation of the animals.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTotal antibody titers for all vehicle control hamsters remained consistently undetectable across each of the timepoints (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eH). At day 28, a marked increase in anti-AAV6.2FF antibodies was observed in hamsters that received the vector, although this increase was only statistically significant for those that received the low dose AAV6.2FF-TLR9. By day 56, the antibody response in hamsters that were given the vector has persisted.\u003c/p\u003e \u003cp\u003eIn hamsters, a general decrease in cytokine levels from plasma samples was observed for all treatment groups over the course of the study (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). In the low dose group, several pro-inflammatory cytokines and chemokines were significantly elevated compared to the vehicle control group, high-dose group, or both groups: TNFa (vs high-dose, 7dpi; vs high-dose, 28dpi), MCP-1 (vs both, 1dpi), MIP-1a (vs both, 7dpi), and IL-1b (vs. high-dose, 28dpi). Although significantly higher levels of anti-inflammatory IL-10 were observed in the low dose group at day 1 compared to the high dose group, this finding may represent an early attempt to regulate the numerous pro-inflammatory signals elicited in the low dose group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eVector genome copy numbers of AAV6.2FF-TLR9 did not differ significantly between the low- and high-dose groups across all examined tissues, although inter-animal variability was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). For all tissues, there was a trend toward higher genome copy numbers in the high dose group, with the highest genome copy numbers occurring in the liver and the lowest genome copy numbers detected in the brain.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistopathological evaluation revealed no significant lesions. Only mild to moderate, focal myositis with myonecrosis was seen in three hamsters; one female hamster given the low dose and euthanized at day 28, plus two male hamsters given the high dose and euthanized at day 56. These findings were interpreted as incidental, given their spontaneous and random distribution across groups. No lesions attributed to vector-related toxicities were observed in any of the examined organs.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe data from this preclinical toxicology study show that AAV6.2FF-TLR9, administered intraperitoneally at doses of 1.5x10\u003csup\u003e13\u003c/sup\u003evg/kg and 4.5x10\u003csup\u003e13\u003c/sup\u003evg/kg, is safe and does not cause remarkable short-term or long-term toxicity in mice and hamsters. As an innate immune sensor, TLR9 confers responsiveness to viruses by inducing downstream release of pro-inflammatory cytokines upon stimulation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Given this, it was important to confirm that AAV-mediated overexpression of TLR9 would not result in an exaggerated immune response since both the receptor and its ligand would be present at high levels. Instead, AAV6.2FF-TLR9 was well tolerated in both evaluated species. In mice, no significant differences were observed in cytokine expression levels between groups at all timepoints, indicating the absence of a cytokine-mediated innate response. This safety signal is of particular importance because AAV-vectored gene therapy products, when administered at high systemic doses necessary for many clinical indications, have been implicated in life-threatening complications involving hypercytokinemia (e.g., cytokine-mediated capillary leak syndrome [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and hemophagocytic lymphohistiocytosis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]). The lack of excessive cytokine production, in combination with no significant difference in lymphocyte counts, further suggests the absence of a T-cell mediated adaptive response. Significantly higher anti-AAV6.2FF capsid antibody titers were detected in mice injected with the low dose at day 28, pointing to a B-cell response. Evidence for B-cell involvement is further supported by the presence of the vector genome in spleen tissue and detection of transgene mRNA signals in splenic follicles and in lymph nodes. Further investigation, using multiplex \u003cem\u003ein-situ\u003c/em\u003e hybridization or immunohistochemistry, of the exact cell types that are positive for transgene mRNA would be helpful in pinpointing the population of immune cells responsible for generating the immune response.\u003c/p\u003e \u003cp\u003eThe hamsters mounted a slightly greater but overall mild and transient immune response compared to mice. The only cytokines significantly elevated when compared to controls were the chemotactic proteins MCP-1 (1dpi) and MIP-1a (7dpi), indicative of early phagocyte and lymphocyte recruitment for the initiation of inflammation in the low dose group. [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] The immune response that was initiated was very mild, given that there was no significant elevation in any of the key pro-inflammatory cytokines released following immune detection of viral DNA (IFNg, TNFa, IL-1b, and IL-6) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] when comparing vector-treated and vehicle control groups. As was observed in mice, a B-cell response was detectable in hamsters injected with the low dose, as they possessed significantly higher anti-capsid antibody titers at day 28. Hamsters that received the low dose also experienced an increase in hepatic transaminases at day 56, which may be owing to the lysis of transduced hepatocytes by AAV6.2FF specific T-cells. Indeed, it has been shown in a human subject of a hemophilia B clinical trial, infusion of an AAV2 vector expressing coagulation factor IX resulted in a rise in hepatic transaminases, that peaked at 32 days post vector administration with a concomitant fall in transgene expression. [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] These two concurrent findings were attributed to the CD8\u003csup\u003e+\u003c/sup\u003e T-cell mediated destruction of transduced hepatocytes, which would 1) eliminate transgene expressing cells and 2) release hepatic enzymes into the blood. [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] It should be noted that subjects of the AAV-FIX clinical trial that experienced hepatic transaminase elevation remained asymptomatic and these levels returned to baseline without medical intervention or adverse reactions in the subjects. [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eInterestingly, the low vector dose was observed to be more immunogenic than the high dose. While neither dose elicited a particularly remarkable immune response, the low dose induced a B-cell response in both species and increases in lymphocyte counts and hepatic transaminases in hamsters. Notably, hamsters that received the high dose also had significantly lower TNFa levels than both vehicle and low dose hamsters at day 28. Additionally, the low dose provoked an increase in circulating levels of multiple cytokines, but this increase was not observed in the high dose or vehicle. This non-linear dose-response pattern has been associated with the unique tolerogenic milieu of the liver. As an organ that encounters a plethora of neo-antigens, the liver has developed a range of mechanisms to avoid constant overactivation of the immune system. [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] The mechanisms that lead to attenuation of the immune response at high vector doses are numerous, including the induction of tolerance by CD4\u0026thinsp;+\u0026thinsp;regulatory T-cells [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], CD8\u0026thinsp;+\u0026thinsp;T-cells [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], or B-cells [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], as well as T-cell exhaustion due to persistent antigen stimulation [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. An analysis of CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T-cell counts, in addition to characterization of T-cell surface markers and cytolytic ability, would be useful to dissect the main mechanisms responsible for the non-linear dose-response observed here.\u003c/p\u003e \u003cp\u003eFollowing intraperitoneal injection, the highest vector genome copy numbers of AAV6.2FF-TLR9 were detected in the liver and pancreas in both mice and hamsters. In line with these results, another study investigating AAV biodistribution reported predominant targeting of the diaphragm, liver, and pancreas after intraperitoneal administration of an AAV6.2 vector. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] Furthermore, multiple studies employing an alternate method of systemic administration, the intravenous route, found that the liver (alongside the heart and skeletal muscle) was a major organ transduced by AAV6 and AAV6.2 [\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] Taken together, our data, in alignment with other studies, suggests that intraperitoneal injection of AAV6.2 is suitable for robust transgene delivery to abdominal organs.\u003c/p\u003e \u003cp\u003eTo our knowledge, this is the first report of viral vectorized expression of a toll-like receptor. Previously, overexpression of TLR9 in B-cells using a conditional overexpression allele in a murine model of systemic lupus erythematosus has been reported. [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] Although their focus was not the safety and tolerability of TLR9 overexpression, a key finding was that TLR9 overexpression improved clinical signs of renal disease despite TLR9 activation driving the production of anti-DNA autoantibodies that mediate disease in systemic lupus erythematosus. [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eA limitation of this study is that only tissues from animals euthanized 28 days post-treatment were analyzed for the presence of vector genomes. An examination of vector genome copy numbers in animals euthanized 7 and 56 days post-treatment would provide more insight into the persistence and biodistribution of AAV6.2FF-TLR9. In particular, comparing biodistribution data from days 28 and 56 could reveal whether transgene expression persists or if transduced cells are being cleared by adaptive immune responses. Another limitation is that the animals were not screened for pre-existing antibodies against the capsid. Although AAV6.2FF is an engineered capsid, it only differs by three point mutations compared to wild-type AAV6 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Due to a high degree of homology between the two capsids, animals that have previously encountered wild-type AAV6 would possess anti-capsid antibodies that may impede vector transduction and contribute to the immune response. [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eIn conclusion, we have demonstrated the preclinical safety of an AAV-TLR9 vector in mice and hamsters. There was absence of significant changes in leukocyte counts, plasma biomarkers of hepatic or renal dysfunction, pro-inflammatory cytokines, or histological lesions. Taken together, these findings suggest that the vector has low immunogenicity and is well tolerated. Given its safety profile, this study provides preclinical evidence that supports the use of AAV-TLR9 as an adjunct to checkpoint inhibitor therapy, with the goal of enhancing innate signaling and sensitizing metastatic cancer to T-cell mediated elimination in an otherwise immunologically cold environment.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAAV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eadeno\u0026ndash;associated virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003evg\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evector genomes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTLR9\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eToll\u0026ndash;like receptor 9\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eODN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eoligodeoxynucleotide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMOI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emultiplicity of infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003edpi\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edays post infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch3\u003eData availability\u003c/h3\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information file.\u003c/p\u003e\n\u003ch3\u003eAcknowledgements\u003c/h3\u003e\n\u003cp\u003eWe would like to thank Veronique Carson, Sarah Griffiths, Sarah Boutcher, and all other staff members of the Animal Isolation Facility at the University of Guelph for their outstanding care of the animals used in this study.\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eAuthor contributions\u003c/h3\u003e\n\u003cp\u003eConceptualization, C.Y., B.T., and S.K.W.; methodology, C.Y.; histopathology, I.R.S.; writing\u0026mdash;original draft preparation, C.Y. and S.K.W.; writing\u0026mdash;review and editing, B.T., and I.R.S.; supervision, S.K.W.; funding acquisition, B.T. and S.K.W. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003ch3\u003eFunding\u003c/h3\u003e\n\u003cp\u003eFunding for this study was provided by Wyvern Pharmaceuticals Inc.\u0026nbsp;This work was supported in part by a grant from the Natural Sciences and Engineering Research Council of Canada (RGPIN-2018-04737)\u0026nbsp;to S.K.W.\u003c/p\u003e\n\u003ch3\u003eEthical approval\u003c/h3\u003e\n\u003cp\u003eAll animal experiments were reviewed and approved (AUP #4664) by the Animal Care Committee at the University of Guelph in accordance with the guidelines stipulated by the Canadian Council on Animal Care.\u003c/p\u003e\n\u003ch3\u003eCompeting interests\u003c/h3\u003e\n\u003cp\u003eS.K.W. is a scientific cofounder of Avamab Pharma Inc., a pre-clinical, pre-revenue stage company dedicated to research and development of AAV gene therapies for the treatment and prevention of infectious diseases and Inspire Biotherapeutics, a pre-clinical, pre-revenue stage company dedicated to research and development of AAV gene therapies for the treatment of monogenic lung diseases. S.K.W. is an inventor on a U.S. patent for the AAV6.2FF capsid, which is owned by the University of Guelph. This patent (US20190216949) is licensed to Avamab Pharma Inc. and Inspire Biotherapeutics. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. The other authors have no competing interests to declare.\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKawasaki T, Kawai T. Toll-like receptor signaling pathways. Front Immunol. 2014;5:461.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarongiu L, Gornati L, Artuso I, Zanoni I, Granucci F. Below the surface: The inner lives of TLR4 and TLR9. J Leukoc Biol. 2019;106:147\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChuang YC, Tseng JC, Huang LR, Huang CM, Huang CF, Chuang TH. Adjuvant effect of toll-like receptor 9 activation on cancer immunotherapy using checkpoint blockade. Front Immunol. 2020;11:1075.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiles MA, Luong R, To EE, Erlich JR, Liong S, Liong F, et al. TLR9 monotherapy in immune-competent mice suppresses orthotopic prostate tumor development. Cells. 2024;13:97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParroche P, Roblot G, Le Calvez-Kelm F, Tout I, Marotel M, Malfroy M, et al. TLR9 re-expression in cancer cells extends the S-phase and stabilizes p16(INK4a) protein expression. Oncogenesis. 2016;5:e244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandez-Rodriguez L, Cianciaruso C, Bill R, Trefny MP, Klar R, Kirchhammer N, et al. Dual TLR9 and PD-L1 targeting unleashes dendritic cells to induce durable antitumor immunity. J Immunother Cancer. 2023;11:e006714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarbone C, Piro G, Agostini A, Delfino P, De Sanctis F, Nasca V, et al. Intratumoral injection of TLR9 agonist promotes an immunopermissive microenvironment transition and causes cooperative antitumor activity in combination with anti-PD1 in pancreatic cancer. J Immunother Cancer. 2021;9:e002876.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDongye Z, Li J, Wu Y. Toll-like receptor 9 agonists and combination therapies: strategies to modulate the tumour immune microenvironment for systemic anti-tumour immunity. Br J Cancer. 2022;127:1584\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarapetyan L, Luke JJ, Davar D. Toll-like receptor 9 agonists in cancer. Onco Targets Ther. 2020;13:10039\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J-H, Gessler DJ, Zhan W, Gallagher TL, Gao G. Adeno-associated virus as a delivery vector for gene therapy of human diseases. Signal Transduct Target Ther. 2024;9:78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCort\u0026eacute;s-Guiral D, H\u0026uuml;bner M, Alyami M, Bhatt A, Ceelen W, Glehen O, et al. Primary and metastatic peritoneal surface malignancies. Nat Rev Dis Primers. 2021;7:91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadiradze G, Horvath P, Sautkin Y, Archid R, Weinreich F-J, K\u0026ouml;nigsrainer A, et al. Overcoming drug resistance by taking advantage of physical principles: pressurized intraperitoneal aerosol chemotherapy (PIPAC). Cancers. 2020;12:34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTewari D, Java JJ, Salani R, Armstrong DK, Markman M, Herzog T, et al. Long-term survival advantage and prognostic factors associated with intraperitoneal chemotherapy treatment in advanced ovarian cancer: a gynecologic oncology group study. J Clin Oncol. 2015;33:1460\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalazs AB, Chen J, Hong CM, Rao DS, Yang L, Baltimore D. Antibody-based protection against HIV infection by vectored immunoprophylaxis. Nature. 2012;481:81\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Lieshout LP, Domm JM, Rindler TN, Frost KL, Sorensen DL, Medina SJ, et al. A novel triple-mutant AAV6 capsid induces rapid and potent transgene expression in the muscle and respiratory tract of mice. Mol Ther Methods Clin Dev. 2018;9:323\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Lieshout LP, Domm JM, Wootton SK. AAV-mediated gene delivery to the lung. Methods Mol Biol. 2019; 1950:361\u0026thinsp;\u0026ndash;\u0026thinsp;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRghei AD, Stevens BAY, Thomas SP, Yates JGE, McLeod BM, Karimi K et al. Production of adeno-associated virus vectors in cell stacks for preclinical studies in large animal models. J Vis Exp. 2021; 172.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInternational Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH). S6(R1) Preclinical safety evaluation of biotechnology-derived pharmaceuticals. In: FDA Guidance Documents. U.S. Food and Drug Administration. 1997. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.fda.gov/regulatory-information/search-fda-guidance-documents/s6r1-preclinical-safety-evaluation-biotechnology-derived-pharmaceuticals\u003c/span\u003e\u003cspan address=\"https://www.fda.gov/regulatory-information/search-fda-guidance-documents/s6r1-preclinical-safety-evaluation-biotechnology-derived-pharmaceuticals\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 19 Dec 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, Huang X, Yang Y. The TLR9-MyD88 pathway is critical for adaptive immune responses to adeno-associated virus gene therapy vectors in mice. J Clin Invest. 2009;119:2388\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlakhras NS, Moreland CA, Wong LC, Raut P, Kamalakaran S, Wen Y, et al. Essential role of pre-existing humoral immunity in TLR9-mediated type I IFN response to recombinant AAV vectors in human whole blood. Front Immunol. 2024;15:1354055.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLek A, Wong B, Keeler A, Blackwood M, Ma K, Huang S, et al. Death after high-dose rAAV9 gene therapy in a patient with Duchenne\u0026rsquo;s muscular dystrophy. N Engl J Med. 2023;389:1203\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalletta F, Cucinotta U, Marseglia L, Cacciola A, Gallizzi R, Cuzzocrea S, et al. Hemophagocytic lymphohistiocytosis following gene replacement therapy in a child with type 1 spinal muscular dystrophy. J Clin Pharm Ther. 2022;47:1478\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29:313\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhavsar I, Miller CS, Al-Sabbagh M. Macrophage inflammatory protein-1 alpha (MIP-1 alpha)/CCL3: as a biomarker. General Methods in Biomarker Research and their Applications. 2015; 223\u0026thinsp;\u0026ndash;\u0026thinsp;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X, Yang Y. Targeting the TLR9-MyD88 pathway in the regulation of adaptive immune responses. Expert Opin Ther Targets. 2010;14:787\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManno CS, Pierce GF, Arruda VR, Glader B, Ragni M, Rasko JJ, et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med. 2006;12:342\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMingozzi F, Maus MV, Hui DJ, Sabatino DE, Murphy SL, Rasko JJ, et al. CD8\u0026thinsp;+\u0026thinsp;T-cell responses to adeno-associated virus capsid in humans. Nat Med. 2007;13:419\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTiegs G, Lohse AW. Immune tolerance: what is unique about the liver. J Autoimmun. 2009;34:1\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao O, Dobrzynski E, Wang L, Nayak S, Mingle B, Terhorst C, et al. Induction and role of regulatory CD4\u0026thinsp;+\u0026thinsp;CD25\u0026thinsp;+\u0026thinsp;T cells in tolerance to the transgene product following hepatic in vivo gene transfer. Blood. 2007;110:1132\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar SRP, Hoffman BE, Terhorst C, de Jong YP, Herzog RW. The balance between CD8\u0026thinsp;+\u0026thinsp;T cell-mediated clearance of AAV-encoded antigen in the liver and tolerance is dependent on the vector dose. Mol Ther. 2017;25:880\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMingozzi F, Liu YL, Dobrzynski E, Kaufhold A, Liu JH, Wang YQ, et al. Induction of immune tolerance to coagulation factor IX antigen by in vivo hepatic gene transfer. J Clin Invest. 2003;111:1347\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTay SS, Wong YC, McDonald DM, Wood NAW, Roediger B, Sierro F, et al. Antigen expression level threshold tunes the fate of CD8 T cells during primary hepatic immune responses. PNAS. 2014;111:2540\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbele S, Alanis-Lobato G, Oti M, Rust W, Blazevic D, Danner-Liskus J, et al. Mapping administration route-dependent transduction profiles of commonly used AAV variants in mice by barcode amplicon sequencing. Mol Ther Methods Clin Dev. 2025;33:101468.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZincarelli C, Soltys S, Rengo G, Rabinowitz JE. Analysis of AAV serotypes 1\u0026ndash;9 mediated gene expression and tropism in mice after systemic injection. Mol Ther. 2008;16:1073\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeinmann J, Weis S, Sippel J, Tulalamba W, Remes A, El Andari J, et al. Identification of a myotropic AAV by massively parallel in vivo evaluation of barcoded capsid variants. Nat Comm. 2020;11:5432.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTilstra JS, John S, Gordon RA, Leibler C, Kashgarian M, Bastacky S, et al. B cell-intrinsic TLR9 expression is protective in murine lupus. J Clin Invest. 2020;130:3172\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendell JR, Connolly AM, Lehman KJ, Griffin DA, Khan SZ, Dharia SD, et al. Testing preexisting antibodies prior to AAV gene transfer therapy: rationale, lessons and future considerations. Mol Ther Methods Clin Dev. 2022;25:74\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 and 2 are available in the supplementary files section\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"gene-therapy","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"gt","sideBox":"Learn more about [Gene Therapy](http://www.nature.com/gt/)","snPcode":"41434","submissionUrl":"https://mts-gt.nature.com/cgi-bin/main.plex","title":"Gene Therapy","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Adeno-associated virus (AAV), gene therapy, TLR9, intraperitoneal administration, toxicology, tolerability, murine model, Syrian hamster model, pathology","lastPublishedDoi":"10.21203/rs.3.rs-8545024/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8545024/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eToll-like receptor 9 (TLR9) is an innate DNA sensor that activates pro-inflammatory pathways and contributes to the maturation of antigen presenting cells. TLR9 deficiency has been implicated in impaired tumor immunosurveillance and attenuated responsiveness to immune checkpoint blockade. We developed an adeno-associated virus (AAV) vector encoding TLR9 to restore receptor expression in individuals with TLR9 deficiency and augment antitumor immunity. We first evaluated transgene biodistribution in mice 21 days after intraperitoneal administration of 1x10\u003csup\u003e11\u003c/sup\u003e vector genomes (vg) of AAV6.2FF-TLR9 using RNA \u003cem\u003ein-situ\u003c/em\u003e hybridization. TLR9 was detected in liver, spleen, pancreas, ovary, heart, and lymph node, indicating systemic transduction and transcription following intraperitoneal delivery. To assess safety, mice and hamsters received low (1.5x10\u003csup\u003e13\u003c/sup\u003e vg/kg) or high (4.5x10\u003csup\u003e13\u003c/sup\u003e vg/kg) dose of AAV6.2FF-TLR9 intraperitoneally and were evaluated at 7, 28, and 56 days post-administration. Across both species and dosages, no adverse vector-related changes were observed in leukocyte counts, plasma biomarkers of hepatic or renal function, pro-inflammatory cytokines, or upon histopathological examination. The broad tissue expression and favorable safety profile of intraperitoneally delivered AAV6.2FF-TLR9 support progression of this vector toward clinical development as a gene replacement strategy to potentially enhance to efficacy of checkpoint blockade in patients with metastatic malignancies and impaired TLR9 signaling.\u003c/p\u003e","manuscriptTitle":"Preclinical Safety and Tolerability of an AAV Vector Expressing TLR9 in Mice and Hamsters","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-13 10:27:25","doi":"10.21203/rs.3.rs-8545024/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-05-05T15:52:18+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-16T13:31:52+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-27T16:17:47+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-01-26T04:28:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-13T11:00:24+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-13T11:00:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Gene Therapy","date":"2026-01-07T20:28:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"gene-therapy","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"gt","sideBox":"Learn more about [Gene Therapy](http://www.nature.com/gt/)","snPcode":"41434","submissionUrl":"https://mts-gt.nature.com/cgi-bin/main.plex","title":"Gene Therapy","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a3b27949-e402-413f-888c-159eba3b5c61","owner":[],"postedDate":"January 13th, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-05-05T15:52:18+00:00","index":2,"fulltext":"This content is not available."}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":60771682,"name":"Biological sciences/Biotechnology/Gene delivery"},{"id":60771683,"name":"Biological sciences/Biotechnology/Gene therapy"}],"tags":[],"updatedAt":"2026-01-26T04:31:03+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-13 10:27:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8545024","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8545024","identity":"rs-8545024","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}