Alveolar Epithelial Cells Involved in Pulmonary Vascular Remodeling and Constriction of Hypoxic Pulmonary Hypertension

Alveolar Epithelial Cells Involved in Pulmonary Vascular Remodeling and Constriction of Hypoxic Pulmonary Hypertension | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Alveolar Epithelial Cells Involved in Pulmonary Vascular Remodeling and Constriction of Hypoxic Pulmonary Hypertension Yanxia Wang, Xiaoming Li, Wen Niu, Jian Chen, Bo Zhang, Xiumin Zhang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-129956/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Background: Hypoxic pulmonary hypertension (HPH) is a common type of pulmonary hypertension. Alveolar epithelial cells (AECs) are the first to perceive hypoxia of alveolar, however, the role of AECs in HPH remain unclear. HPH is characterized by pulmonary vascular remodeling and constriction. The present study was to whether AECs was involved in pulmonary vascular remodeling and constriction. Methods: Rat HPH models were built and pulmonary artery smooth cells (PASMCs) and AECs were treatment with hypoxia. Hemodynamic and morphological indicators were measured in samples from rat HPH models. Superoxide dismutase 2 (SOD2), catalase (CAT) and reactive oxygen species (ROS) were detected in AECs or AECs culture medium. To find out the effect of AECs on pulmonary vascular remodeling and constriction, AECs and PASMCs were co-cultured under hypoxia, PASMCs and isolated pulmonary artery (PA) were treatment with AECs hypoxic culture medium. To explore the mechanism of AECs on pulmonary vascular remodeling and constriction, ROS inhibitor N-acetylcysteine (NAC) was used. Results: In vivo, hypoxia resulted in elevation in pulmonary vascular remodeling and pressure, but had no effect on non-pulmonary vascular. In vitro, hypoxia caused an imbalance of superoxide dismutase 2 (SOD2) and catalase (CAT) and an increase of reactive oxygen species (ROS) in AECs, as well as an increase of hydrogen peroxide (H 2 O 2 ) in AECs culture medium. Also, AECs led to pulmonary artery smooth cells (PASMCs) proliferation under hypoxia by co-culture or substituting culture medium. AECs hypoxic culture medium enhanced the constriction of isolated pulmonary artery (PA). Further, these responses were abrogated by ROS inhibitor N-acetylcysteine (NAC). Conclusion: The findings of present study demonstrated that AECs involved in pulmonary vascular remodeling and constriction under hypoxia by secreting H 2 O 2 to the pulmonary microenvironment. Pulmonology alveolar epithelial cells hypoxic pulmonary hypertension pulmonary vascular remodeling and constriction reactive oxygen species Figures Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 Background Pulmonary hypertension is a progressive disorder and characterized by pulmonary vascular remodeling and vasoconstriction [ 1 – 3 ], which ultimately leads to right ventricular hypertrophy and right heart failure with morbidity and mortality [ 4 – 6 ]. Hypoxic pulmonary hypertension (HPH) is highly prevalent in advanced chronic obstructive pulmonary disease and high altitude hypoxia [ 7 ]. It is well known that when alveolar hypoxia occurs, only pulmonary artery pressure increases, but no systemic circulation pressure increases. Vascular internality plays an important role, but its peripheral microenvironment should also be an important factor. AECs are primarily components of alveolar wall and involve in the formation of the pulmonary microenvironment. When hypoxia occurs in alveolar cavity, AECs are the first to perceive and suffer from largest change of oxygen content in the body. Previous studies have constantly reported that pulmonary arteriolar endothelial cells and adventitial fibroblast were involved in HPH [ 8 – 11 ]. However, little is known whether AECs are involved in the development of HPH. The purpose of this experiment is to observe the role and mechanism of AECs in the development of HPH. Reactive oxygen species (ROS) including hydroxyl radical (HO • ), singlet oxygen ( 1 O 2 ), superoxide anion (O 2 •_ ), and hydrogen peroxide (H 2 O 2 ) are by-products of electron transfer processes [ 12 – 14 ]. Accumulation of O 2 •_ and H 2 O 2 is prevented by the antioxidant enzymes superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in the cell normal metabolism[ 15 , 16 ]. The balance between production and degradation rates determines the steady-state concentrations of ROS in each intracellular compartment. H 2 O 2 is a stable and easily diffused out of the cell[ 14 ]. It has been documented in increase cell proliferation[ 17 ], cell-cycle arrest[ 18 ]and apoptosis[ 19 ]and vascular smooth muscle constriction[ 20 ]. The multiple responses of the lung to oxygen are a physiological paradigm of the variety of cellular responses to ROS in vitro. In the lung, AECs are the first to perceive changes of oxygen concentration in the alveolar cavity, and many other investigators recently provided extensive evidence that hypoxia results in a significant increase in ROS concentration in AECs [ 21 ], which inevitably lead to changes of the microenvironment around the pulmonary artery. A recent study demonstrated cell proliferation could only be achieved by exposing the cells to a constant flux of H 2 O 2 generated by the G/GO system [ 22 ]. Therefore, AECs, as the cells around the pulmonary capillaries, can affect the pulmonary vascular remodeling and constriction by constant release of H 2 O 2 . This study provides novel insights into the pathogenesis of HPH. It is considered that the earliest source of pulmonary microenvironment changes under hypoxia is AECs. In this experiment, AECs were used to change microenvironment of PASMCs, which proved that AECs were involved in pulmonary vascular remodeling and constriction under hypoxia and also to be related to the H 2 O 2 derived from AECs. Methods Animals Male Sprague-Dawley rats (200–250 g) were purchased from the animal center of the Fourth Military Medical University (Xi'an, China). All experiments were approved by Animal Care and Use Committee of the Fourth Military Medical University and complied with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals (Publication No. 85 − 23, revised 1985). To obtain pulmonary hypertension rats, rats were housed intermittently in a hypobaric hypoxia chamber depressurized to 380 mmHg (10% oxygen) and taken hypobaric hypoxia challenge of 8 h/d for 4 weeks. Age-matched rats were housed in room air (21% oxygen) accordingly. Hemodynamic and Morphological Investigation Right ventricular pressure and hematoxylin and eosin staining of lung and renal tissues were performed according to my published article [ 23 ]. After 4 weeks of hypoxia, the animals were anesthetized with 20% ethylurethanm (5 ml/ kg). Then, a soft silica gel catheter linked to a Power lab system (AD Instruments, Colorado Springs, CO, Australia) was inserted into the right jugular vein. The right ventricle peak systolic pressure (RVSP) waveforms were showed on the monitor when the catheter arrived in the right ventricle chamber. Meanwhile, the mean carotid artery pressure (mCAP) was recorded via a special catheter inserted into the carotid artery. After the weight of right ventricle (RV) and left ventricle plus septum (LV + S) were obtained, the ratio of RV/ (LV + S) was calculated as an index of RV hypertrophy. The right lung and kidney were placed in neutral buffer (pH 7.4) containing 10% formalin for 72 hours. The lung and kidney tissue were embedded in paraffin and sectioned into 5 µm thick sections, then processed hematoxylin and eosin staining. Microscopic evaluation showed structure remodeling of the pulmonary artery. Total 60 of pulmonary artery, bronchial artery and renal artery in approximate round shape were obtained from each group. Their external diameters are50-180 µm and the average size of artery was 78 µm. The outside diameter and inside diameter of pulmonary artery were measured by an image-processing program (Image-Pro Plus, Version 5.1, Media Cybernetics, Rockville, MD, USA). The medial wall thickness, the cross-sectional area of medial wall, and the total cross-sectional vessel area were obtained. Pulmonary vascular structure remodeling was assessed by percent medial wall thickness (MT %) and percent medial wall area (MA %) two indices: MT% = 100 × (medial wall thickness) / (vessel semi-diameter); MA% = 100 × (cross sectional medial wall area) / (total cross-sectional vessel area). All the morphological analysis was conducted via a double-blind method. The following should be explained in our experiment: pulmonary artery is a pulmonary circulatory vessel located in the pulmonary microenvironment, bronchial artery is a systemic circulatory vessel located in the pulmonary microenvironment, and renal artery is a systemic circulatory vessel not located in the pulmonary microenvironment. Cell culture AASMCs were used for systemic circulating vascular smooth muscle cells. Rat primary PASMCs and AASMCs were obtained by tissue explants culturing method according to my published articles [ 18 ]. Pulmonary artery (PA) and aortic artery(AA) were isolated from male Sprague-Dawley rats (200–250 g) and dissected into small pieces after the adventitial layers were removed, then placed in a overturned culture flask containing Dulbecco Eagle’s minimum essential Medium (DMEM, HyClone, Logan, UT) with 15% fetal bovine serum(FBS, CellMax, Beijing, China)at 37 °C in 21% oxygen condition. The flask was carefully turned over after 4 hours. PASMCs and AASMCs crawled out from the tissue in about a week. Cells were used between passages 3 to 6. Smooth muscle cell identity was verified by positive staining for smooth muscle a-actin (mouse monoclonal antibody, Sigma-Aldrich, St. Louis, MO, USA) at each passage. Alveolar epithelial cells (AECs) in this study included rat primary ATII cells and RLE-6TN cells. Rat primary ATII cells were isolated from male SpragueDawley rats (180–200 g) as previously described [ 24 ]. Pooled cells from 2 rats were prepared as follows. Rats were injected intraperitoneally with 20% ethylurethanm (4 ml/kg) and intravenously 4000U/kg heparin sodium. Intubation of pulmonary artery and tracheal were performed. Rats were exsanguinated by cutting the abdominal aorta under the aseptic condition. 50 ml Solution II (in mM: 140 NaCl, 5 KCl, 10 Hepes, 2CaCl 2 , 2.5 PBS (pH 7.4), 1.3 MgSO 4 ) was perfuse via the pulmonary artery to clear the vascular space of blood. The lungs were removed from the thorax and lavaged with 8 times solution I (10 ml/time) (in mM: 140NaCl, 5 KCl, 10 Hepes, 6 D-glucose, 2.5 PBS (pH 7.4),0.2 EDTA) and 2 times solution II (10 ml/time).Lungs were then filled 2 times with trypsin solution (10 ml/time) prepared in solution II and incubated in incubator for 10 min at 37℃ every time. The lungs were cut into pieces in the bottle with 4 ml DNAse I and 5 ml FBS. The lung tissues were then sequentially filtered through 125 µm and 75 µm stainless mesh. The filtrate was centrifuged at 1000r/min for 8 min. The cell pellet was resuspended in DMEM at 37℃.The cell suspension was plated at a density of 2 × 10 6 cells/ml in 25 cm 2 bacteriologic plastic dishes coated rat IgG to remove macrophages and incubated at 37℃in 5% CO 2 incubator for 1 h. The unattached cells in suspension were removed and centrifuged at 1000 r/min for 8 min. The cell pellet was plated at a density of 5 × 10 5 cells/cm 2 in 6-well culture dishes with DMEM, 15% FBS, 100 U/ml penicillin and 100 U/ml streptomycin and incubated at 37℃under 5% CO 2 incubator. The cell purity after 24 h was assessed by a characteristic fluorescence with phosphine3 Ras previously described [ 24 ]. RLE-6TN were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM supplemented with 15% FBS, 100 IU/ml penicillin and 100 mg/ml streptomycin. The preparation of AECs culture medium AECs were seeded in 24-well culture dishes at 5 × 10 3 cells per well under normoxic (21% O 2 ) or hypoxic conditions (5% O 2 ). Its culture medium was collected for 24 h to subsequent experiments. Cell treatment The effect of hypoxia on the proliferation of PASMCs and AASMCs was investigated under different oxygen concentrations. PASMCs or AASMCs were seeded in 96-well culture dishes at 3 × 10 4 cells per well under normoxic (21% O 2 ) or hypoxic conditions (10% O 2 and 5% O 2 ). The effect of AECs on the proliferation of PASMCs and AASMCs was investigated using 24- well transwell insert co-culture model (0.4 µm pore). PASMCs or AASMCs were seeded in 24-well culture dishes at a density of 3 × 10 4 cells per well, ATII or RLE-6TN were seeded in transwell inserts at a density of 1 × 10 4 cells per insert. The cells were maintained under normoxia (21% O 2) or hypoxia conditions (5% O 2 ). The cells were grouped as follows, PASMCs: (1) normoxia (2) hypoxia (3) normoxia, co-culture with ATII or RLE-6TN (4) hypoxia, co-culture with ATII or RLE-6TN (5) hypoxia, co-culture with ATII or RLE-6TN + NAC (10 mmol/L, a nonspecific ROS inhibitor, Sigma-Aldrich, St. Louis, MO); AASMCs: (1) normoxia (2) hypoxia (3) normoxia, co-culture with ATII or RLE-6TN (4) hypoxia, co-culture with ATII or RLE-6TN (5) hypoxia, co-culture with ATII or RLE-6TN + NAC (10 mmol/L). To further confirm that AECs participated in the proliferation of PASMCs or AASMCs,the culture medium of PASMCs and AASMCs were replaced by AECs culture medium under normoxic or hypoxic conditions every 12 hours. The cells were grouped as follows, PASMCs: (1) normoxia (2) normoxia + ATII or RLE-6TN normoxic culture medium (3) normoxia + ATII or RLE-6TN hypoxic culture medium(4) hypoxia (5) hypoxia + ATII or RLE-6TN normoxic culture medium (6) hypoxia + ATII or RLE-6TN hypoxic culture medium; AASMCs: (1) normoxia (2) normoxia + ATII or RLE-6TN normoxic culture medium (3) normoxia + ATII or RLE-6TN hypoxic culture medium(4) hypoxia (5) hypoxia + ATII or RLE-6TN normoxic culture medium (6) hypoxia + ATII or RLE-6TN hypoxic culture medium. To determine the effects of H 2 O 2 on the proliferation of PASMCs or AASMCs, concentration- response was constructed by cumulative addition of exogenous H 2 O 2 (5-1000 µM). The H 2 O 2 concentration of the largest proliferation of PASMCs or AASMCs was selected and then treated with NAC to observe the change of proliferation. MTT Assay All cells were quiesced in serum-free medium for 24 hours after growing to subconfluence and then cultured with 5% fetal bovine serum for 48 hours under normoxic or hypoxic conditions. Subsequently, MTT (5 mg/mL) was added into the plates (80µL/well in 24-well plates or 20µL/well in 96-well plates) and incubated for another 4 hours. Dimethyl sulfoxide was added into each well, and all plates were shaken for 10 minutes in a shaker. The optical density (OD) values were collected using a spectrophotometer (PowerWave XS, BioTekInc, Winooski, VT). Cell counting To better investigate the effects of hypoxia on cell proliferation, direct cell counting was performed. Cells were seeded 6 × 10 4 cells in 6-well plates and cultured overnight. The cells were then incubated in serum-free for 24 h. Cells were cultured with normoxic (21% O 2 ) or hypoxic conditions (10% O 2 and 5% O 2 ), and after 48 h they were washed with phosphate buffered solution, harvested by mild trypsinization, and counted with a hematocytometer. qRT-PCR qRT-PCR was performed with SYBR PrimeScript™ RT-PCR kit (TakaRa, Dalian, China). The total RNA of cells was extracted using Trizol (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from RNA.GAPDH was used as an internal control. Primer sequences were designed using the Primer Premier 5.0 software (PREMIER Biosoft International, CA, USA) and synthesized by the DNA Bio Tec (Shanghai, China).Primers sequences used were asfollows:forward:5’-TGGGAAACAACACCCCTATTTT-3’and reverse: 5’-CGAAGATACCACCAGTCGTAGTTG-3’for CAT; forward: CTGTGGCTGAGCTGTTGTAA and reverse: ACAGCGTCCAAGCAATTCAA for SOD 2 ; forward: 5’-CTATCGGCAATGAG CGGTTC-3’and reverse: 5’–GATCTTGATCTTCATGGTGCTAGG-3’for GAPDH. Measurement of ROS PASMCs or AASMCs in N48, H48, H48 + NAC (10 mmol/L) groups were stained with an oxidant-sensitive fluorescence dye DCFH-DA (10 µmol/L, Nanjing Jian Cheng Bioengineering Institute, Nanjing, China). Subsequently, the intracellular total ROS were detected through fluorescence microscopy (Leica, Heidelberg, Germany) and flow cytometry. Measurement of H 2 O 2 The content of H 2 O 2 in AECs and its culture medium were detected using a commercially available Hydrogen Peroxide Assay Kit (Beyotime Inc, Jiangsu, China) according to the recommended protocols. The concentrations of H 2 O 2 in different groups were finally normalized to the corresponding protein concentrations. Measurement of SOD The content and activity of SOD in AECs was detected using a commercially Tatal Superoxide Dismutase Assay Kit with WST-8 (Beyotime Inc, Jiangsu, China) according to the recommended protocols. The content of SOD in different groups was finally normalized to the corresponding protein concentrations. The activity of SOD is calculated by the formula. Isolated pulmonary artery ring preparation Pulmonary artery and aortic artery were obtained according to published articles[ 25 ].Rats was anesthetized with 20% ethylurethanm (4 ml/kg). Lung and heart were removed and immersed into cold oxygenated Krebs-Henseleit solution (in mM: NaCl 127, KCl 4.7, NaHCO 3 17, MgSO 4 1.17, KH 2 PO 4 1.18, CaCl 2 2.5, D-glucose 5.5) after median sternotomy was performed. Under a dissecting microscope, the third-division (external diameter < 300 µm) pulmonary artery and aorta were isolated carefully and cleared of connective tissue and cut into 3-mm-length rings. Endothelium was removed by gently rubbing the lumen with swab in rings. Pulmonary ring and aorta ring were suspended respectively on stainless steel hook connected to force transducers (AD Instruments, Colorado Springs, CO) for isometric force recording in individual water jacketed organ chamber containing modified Krebs-Henseleit solutions parged continuously with 95% O 2 /5% CO 2 at 37 °C. Force displacement was recorded with Power Lab (AD Instruments) eight-channel data acquisition system (sampling rate 100/s). Experimental protocols The pulmonary artery ring and aortic artery ring were stretched to a predetermined optimal passive tension of 500 mg and 1000 mg respectively and equilibrated for 60 min with three washouts at 20-min intervals. Then reproducibility of contractile responses to 1 µM phenylephrine (> 300 mg) was established. The rings were rinsed with Krebs-Henseleit solution and the tension returned to baseline. To determine the effects of H 2 O 2 on the constriction of pulmonary artery and aortic artery, concentration-response curve was constructed by cumulative addition of exogenous H 2 O 2 (5-1000 µM) at 10-min interval on ring. The H 2 O 2 concentration of the largest contractile force of artery was selected and then treated with NAC after 10 min to observe the change of contractile force. To further confirm that AECs participated in the constriction of pulmonary artery and aortic artery, pulmonary artery ring and aortic ring from HPH and normoxic rats had treatment with AECs culture medium and NAC at 10-min intervals to observe the change of contractile force. The medium with 5% fetal bovine serum was used as a negative control. In the experiments involving NAC and H 2 O 2 , darkened conditions were employed where kymograph chambers were wrapped in foil with overhead lights switched off.For the vasoconstriction experiment, 1 µmol/L PE was used. Vascular ring contraction to maximum was labeled as 100%, the contraction data for each group was expressed as a percentage of the maximum contraction caused by 1 µmol/L PE. Statistical analysis Using SPSS 20.0 software to perform statistical analysis of the data, each group of data is represented by an average ± standard deviation (mean ± SD).And statistical analysis was assessed by analysis of variance (one-way ANOVA) for multiple group comparisons and pairing T test for two group comparisons. A significant difference was accepted as significant if P < 0.05. Results Hypoxia induced pulmonary artery pressure elevation, pulmonary and bronchial artery remodeling, but did not mCAP and renal artery remodeling The RVSP was measured by catheterization via jugular vein to right ventricle, which substitutes for the pulmonary pressure. Four weeks after exposure to hypoxia, RVSP (Fig. 1 A) and RV/ (LV + S) % (Fig. 1 C) were significantly elevated in hypoxic group compared with normoxic group, while hypoxia did not influence mCAP considerably (Fig. 1 B). MT% and MA% of PA and bronchial artery (BA) were significantly elevated in hypoxic group compared with normoxic group (Fig. 2 A and 2 B), while hypoxia did not influence MT% and MA% of renal artery (RA) considerably (Fig. 2 A and 2 B). In vitro, Hypoxia promoted the proliferation of PASMCs (Fig. 3 A and 3 B) and did not affect the proliferation of AASMCs (Fig. 3 C and 3 D) compared with normoxic group. These results suggested that the different reactions of pulmonary artery and systemic artery to hypoxia may be related to the microenvironment in which they are located. Co-culture with AECs promoted the proliferation of PASMCs or AASMCs under hypoxia To explore the effect of AEC on PASMCs or AASMCs in vitro, the level of proliferation of PASMCs or AASMCs were detected by MTT. Under normoxia, co-culture with ATII had no significant effect on the proliferation of PASMCs or AASMCs compared with without ATII group (Fig. 4 A and 4 B), and co-culture with RLE-6TN inhibited the proliferation of PASMCs or AASMCs compared with without RLE-6TN group (Fig. 4 C and 4 D). Under hypoxia, co-culture with ATII or RLE-6TN promoted significantly the proliferation of PASMCs or AASMCs compared with without ATII (Fig. 4 A and 4 B) or RLE-6TN group (Fig. 4 C and 4 D).These data indicated that AECs play an important role in the proliferation of vascular smooth muscle cells in hypoxia. AECs hypoxic culture medium promoted the proliferation of PASMCs or AASMCs To investigate the involvement of AECs conditioned medium in the proliferation of PASMCs or AASMCs, the culture medium of PASMCs or AASMCs were replaced by ACE conditioned culture medium to observe their proliferation. Under normoxia, the normoxic culture medium of ATII had no significant effect on the proliferation of PASMCs or AASMCs compared with without ATII culture medium group (Fig. 5 A and 5 B), and the normoxic culture medium of RLE-6TN inhibited the proliferation of PASMCs or AASMCs compared with without RLE-6TN culture medium group(Fig. 5 C and 5 D), while ATII or RLE-6TN hypoxic culture medium promoted significantly the proliferation of PASMCs or AASMCs compared with without ATII or RLE-6TN culture medium group(Fig. 5 A, B, C, D). Under hypoxia, the normoxic culture medium of ATII or RLE-6TN had no significant effect on the proliferation of PASMCs or AASMCs compared with without ATII or RLE-6TN culture medium group (Fig. 5 A, B, C, D), while ATII or RLE-6TN hypoxic culture medium promoted significantly the proliferation of PASMCs or AASMCs compared with without ATII or RLE-6TN culture medium group (Fig. 5 A, B, C, D). These data indicated that AECs hypoxic culture medium promoted the proliferation of PASMCs and AASMCs and also proved that the microenvironment induced by AECs in hypoxia play an important role in the proliferation of vascular smooth muscle cells. AECs hypoxic culture medium promoted the constriction of PA and AA To explore whether AECs culture medium can regulate pulmonary or aortic artery ring, we further examined the effects of AECs culture medium on PA or AA from normoxic and HPH rats. For normoxic rats, the normoxic culture medium from ATII or RLE-6TN had no significant effect on the constriction of PA (Fig. 6 A and 6 B) and AA (Fig. 7 A and 7 B) compared with the culture medium group, while the hypoxic culture medium from ATII or RLE-6TN promoted the constriction of PA (Fig. 6 A and 6 B) and AA (Fig. 7 A and 7 B) compared with the culture medium or the normoxic culture medium group. For HPH rats, the normoxic culture medium from ATII or RLE-6TN had no significant effect on the constriction of AA (Fig. 9 A and 9 B) compared with the culture medium group, and the normoxic culture medium from ATII had also no significant effect on the constriction PA (Fig. 8 A) compared with culture medium group, but the normoxic culture medium from RLE-6TN promoted the constriction of PA (Fig. 8 B), and the hypoxic culture medium from ATII or RLE-6TN promoted the constriction of PA (Fig. 8 A and 8 B) and AA (Fig. 9 A and 9 B) compared with the culture medium or the normoxic culture medium group. These results showed that AECs hypoxic culture medium could induce the constriction of PA and AA and also proved that the microenvironment induced by AECs in hypoxia play an important role in the vasoconstriction. Effect of hypoxia on ROS in AECs To explore the possible mechanism involved the effect of AECs on the proliferation of PASMCs or AASMCs, total intracellular ROS was detected through DCFH-DA and the content of H 2 O 2 in AECs and its culture medium were determined by commercial kit. Hypoxia increased the production of ROS and H 2 O 2 in AECs and AECs culture medium (Fig. 10 C, D, and E). Meanwhile, we examined mRNA level of SOD2 and CAT by QT-PCR, and detected the total content and activity of SOD in AECs by commercial kits. Hypoxia increased the mRNA of SOD 2 (Fig. 11 A) and the total content and activity of SOD (Fig. 10 A and 10 B), while hypoxia have no significant effect on the mRNA of CAT (Fig. 11 B). These results showed that the increase of ROS and H 2 O 2 in AECs was caused by imbalance of SOD2 and CAT in hypoxia. Effect of exogenous H 2 O 2 on the proliferation of PASMCs or AASMCs Some studies have reported that the effects of different concentrations of H 2 O 2 on cell proliferation were different. We used exogenous 0-1000 µM H 2 O 2 to observe how H 2 O 2 affects the proliferation of PASMCs or AASMCs under normoxia. Results showed that 0–50 µM H 2 O 2 led to a dose-dependent increase in the proliferation of PASMCs, and then the proliferation of PASMCs is gradually inhibited by 100–1000 µM H 2 O 2 (Fig. 12 A).Similar to the effects of H 2 O 2 on PASMCs, 0-100 µM H 2 O 2 led to a dose-dependent increase in the proliferation of AASMCs, and then the proliferation of AASMCs is gradually inhibited by 200–1000 µM H 2 O 2 (Fig. 12 B). To observe the effect of NAC on PASMCs or AASMCs proliferation, we choose 50 µM and 100 µM H 2 O 2 , which were the most obvious concentration that affected the proliferation of PASMCs and AASMCs respectively. Results showed that NAC (5 mM and 10 mM) effectively inhibited the proliferation of PASMCs or AASMCs, of which the effect of 10 mM NAC was most obvious (Fig. 12 C and 12 D). Effect of exogenous H 2 O 2 on the constriction of PA or AA To explore whether H 2 O 2 regulate PA or AA ring, we used exogenous H 2 O 2 (5-1000 µM) to observe how H 2 O 2 affected the constriction of PA or AA from normal rats. Results showed that 5-400 µM H 2 O 2 led to a dose-dependent increase in the constriction of PA, and then the constriction of PA is gradually inhibited by 600–1000 µM H 2 O 2 (Fig. 13 A). Similar to the effects of H 2 O 2 on PA, 5-600 µM H 2 O 2 led to a dose-dependent increase in the constriction of AA, and then the constriction of AA is gradually inhibited by 800–1000 µM H 2 O 2 (Fig. 13 B). To observe the effect of NAC on PA or AA constriction, we choose 400µΜ and 600 µM H 2 O 2 , which were the most obvious concentration that affected constriction of PA and AA respectively. Results showed that 10 mM NAC effectively inhibited the constriction of PA or AA (Fig. 14 A and 14 B). NAC effectively inhibited the proliferation of PASMCs or AASMCs co-cultured with AECs The concentration of H 2 O 2 in AECs cell culture medium for 24 h in hypoxia was detected in the range of promoting cell proliferation (Fig. 10 E). NAC intervention was performed in the co-culture medium. The proliferation of PASMCs (Fig. 15 A and 15 B) and AASMCs (Fig. 15 C and 15 D) was effectively inhibited by10mM NAC. This experiment suggested that H 2 O 2 from ATII or RLE-6TN was involved in the proliferation of PASMCs or AASMCs. NAC effectively inhibited the constriction of PA or AA The concentration of H 2 O 2 in AECs culture medium for 24 h in hypoxia was detected in the range of promoting constriction. NAC intervention was performed in the hypoxic culture medium from ATII or RLE-6TN, the constriction of PA (Fig. 16 A and 17 A) or AA (Fig. 16 B and 17 B) was effectively inhibited by 10 mM NAC. This experiment suggested that H 2 O 2 from ATII or RLE-6TN was involved in the constriction of PA or AA. Discussion In this study, we first showed that AECs not only caused the proliferation of PASMCs, but also induced proliferation of AASMCs under hypoxia, and the hypoxic culture medium of AECs promoted both constriction of PA or AA in vitro. At the same time, we also confirmed that it was related to H 2 O 2 derived from AECs which was induced by the imbalance between SOD2 and CAT in AECs. NAC, the inhibitor of ROS, markedly ameliorated the proliferation of PASMCs or AASMCs and the constriction of PA or AA. The present study first demonstrated that the difference in pressure variation between pulmonary artery and aortic artery in HPH rats was related to pulmonary microenvironment in which AECs involved, and the effect of AECs on the remodeling and constriction of pulmonary vessel was through H 2 O 2 . In 1969, researches have confirmed that only alveolar hypoxia caused hypoxic pulmonary vasoconstriction, and hypoxemia did not [ 26 , 27 ]. Though bronchial artery belongs to systemic circulatory vessel, it is also exposed to pulmonary microenvironment and has undergone remodeling. In the case of ventilatory dysfunction and low oxygen in the plateau, AECs is the first to perceive hypoxia. Therefore, we thought that AECs should play an important role in HPH. In our study, we constructed the model of HPH to observe hemodynamic and morphological of PA, BA and RA. The results showed that hypoxia led to RVSP, RV/ (LV + S) %, MT% and MA% of PA and BA significantly elevate, while did not mCAP and MT% and MA% of RA. In vitro, co-culture with AECs and treatment with AECs hypoxia culture medium significantly promoted not only PASMCs proliferation and PA constriction, but also AASMCs proliferation and AA constriction. Therefore, in vivo and in vitrodata suggested that AECs played a critical role on HPH, and in vitrodata shown thatsystemic circulatory vessel placed in the microenvironment where AECs exists also undergone remodeling and constriction. It is interesting to consider the regulation of key antioxidant enzymes such as SODand CATin evaluating the role of redox-regulating signaling in pulmonary vascular diseases [ 28 ]. SOD catalyze the rapid dismutation of superoxide (O2•-) to hydrogen peroxide (H 2 O 2 ) and molecular oxygen, however, CAT catalyzes the two-stage conversion of H 2 O 2 to water and oxygen[ 28 ].H 2 O 2 is a stable and easily diffused out of the cell[ 14 ]. SOD has three isoforms, which are located in the cytosol (SOD1), mitochondria (SOD2) or extracellular compartment (SOD3)[ 29 ]. Accumulating evidence suggested that impaired activity of SOD2 and SOD3contributed to pulmonary hypertension, and the level and activity of SOD1 has not been found significantly perturbed in human pulmonary hypertension[ 30 , 31 ]. Our data suggested that the mRNA level of SOD2 and the content and activity of total SOD were increase in AECs under hypoxia, while the mRNA level of CAT have no significant change. And the content of ROS and H 2 O 2 in AECs and H 2 O 2 in AECs culture medium also were increase under hypoxia. Hence, in vitro data suggested that H 2 O 2 derived from AECs affected pulmonary microenvironment. Recently, an increasing number of studies showed that H 2 O 2 can regulate a variety of cellular functions, including proliferation, differentiation, and more generally gene expression[ 32 , 33 ]. However, quantitative data on the basal concentrations of H 2 O 2 and the thresholds for cell proliferation are limited, and it is also reported that treatment with a continuous extracellular source of H 2 O 2 increases cell proliferation [ 22 , 34 ]. The present study provided the range of concentrations of exogenous H 2 O 2 for PASMCs and AASMCs proliferation and that hypoxia increased intracellular and extracellular H 2 O 2 of AECs. Moreover, the extracellular H 2 O 2 concentration of AECs was within the range of H 2 O 2 concentrations for PASMCs and AASMCs proliferation. Co-culture with AECs under hypoxic or the intermittent replacement of AEC hypoxic culture medium which were consistent with the conditions of continuous extracellular source of H 2 O 2 induced PASMCs or AASMCs proliferation. In other words, the method described above effected the proliferation of PASMCs or AASMCs by changing the microenvironment of PASMCs and AASMCs. In addition, NAC intervention reduced the proliferation PASMCs and AASMCs co-cultured with AECs under hypoxia, which further indicated extracellular H 2 O 2 derived from AECs play important role in PASMCs and AASMCs proliferation under hypoxia. Jin N [ 35 ]reported that exposure to H 2 O 2 cause smooth muscle constrictions and dysfunction in isolated pulmonary artery. The present study also provided the range of exogenous H 2 O 2 concentrations for PA or AA constriction. Moreover, the extracellular H 2 O 2 concentration of AECs in hypoxia was within the range of H 2 O 2 concentrations for PA and AA constriction. AECs hypoxic culture medium induced PA and AA constrictions, and NAC intervention could reduce this effect. It’s indicated hypoxic culture mediumH 2 O 2 derived from AECs played important role in PA and AA constriction. Taken together, these in vitro data indicated AECs involved in remodeling and constriction of pulmonary vessel through releasingH 2 O 2 under hypoxia. Meanwhile, it also showed that systemic circulatory vessel also undergo the same change as pulmonary vessel in the AECs-induced microenvironment by H 2 O 2 under hypoxia. Conclusion The proliferation of PASMCs and constrictions of PA are essential for the development of HPH. Our study had shown that the pulmonary microenvironment was beneficial to HPH and AECs played a crucial part in construct an pulmonary microenvironment. The continuous extracellular source of ROS is necessary to induce PASMCs proliferation and PA constriction. H2O2 derived from AECs influenced the pulmonary microenvironment and also was involved in pulmonary vascular remodeling and constriction in HPH. Abbreviations HPH: Hypoxic pulmonary hypertension; AECs: alveolar epithelial cells; PA: pulmonary artery; AA: aortic artery; PASMCs :pulmonary artery smooth cells; AASMCs :aortic artery smooth cells; SOD2:superoxide dismutase 2; CAT: catalase; ROS {reactive oxygen species, (); hydrogen peroxide, (H2O2); N-acetylcysteine, (NAC); Declarations Disclosure statement The authors declare that they have no conflicts of interest Authors’ contributions Yanxia Wang and Xiaoming Li contributed to the experimental design and overall experimentation, Wen Niu, Jian Chen, Bo Zhang, Xiumin Zhang and Yingmei Wang conceptualized the project and data analysis, Zhichao Li and Shaokang Dang contributed to the experimental design, funding, and writing of the manuscript. Funding This present study was funded by the National Nature Science Foundation of China (grant nos. 31670328, 81800046, 81471816 and 81571839). Availability of data and materials We would like to share part of our data, because some of our date will be used in future research. Ethics approval and consent to participate The study was approved and supervised by the Medical Research Ethics Committee of the Fourth Military Medical University. All participants fully understood the information files. Informed consent was obtained from all participants. All experiments were performed in accordance with the relevant guidelines and regulations. The animal protocol has been reviewed and approved by the Institutional Animal Care and Use Committee (IACUC), the Fourth Military Medical University, China Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests References Barbera JA, Blanco I: Pulmonary hypertension in patients with chronic obstructive pulmonary disease: advances in pathophysiology and management. Drugs 2009, 69:1153-1171. Penaloza D, Arias-Stella J: The heart and pulmonary circulation at high altitudes: healthy highlanders and chronic mountain sickness. Circulation 2007, 115:1132-1146. Wilkins MR, Ghofrani HA, Weissmann N, Aldashev A, Zhao L: Pathophysiology and treatment of high-altitude pulmonary vascular disease. Circulation 2015, 131:582-590. Yan D, Li G, Zhang Y, Liu Y: Angiotensin-converting enzyme 2 activation suppresses pulmonary vascular remodeling by inducing apoptosis through the Hippo signaling pathway in rats with pulmonary arterial hypertension. Clin Exp Hypertens 2019, 41:589-598. Liu M, Wang Y, Zheng L, Zheng W, Dong K, Chen S, Zhang B, Li Z: Fasudil reversed MCT-induced and chronic hypoxia-induced pulmonary hypertension by attenuating oxidative stress and inhibiting the expression of Trx1 and HIF-1alpha. Respir Physiol Neurobiol 2014, 201:38-46. Zakynthinos E, Daniil Z, Papanikolaou J, Makris D: Pulmonary hypertension in COPD: pathophysiology and therapeutic targets. Curr Drug Targets 2011, 12:501-513. Wang LN, Yu WC, Du CH, Tong L, Cheng ZZ: Hypoxia is involved in hypoxic pulmonary hypertension through inhibiting the activation of FGF2 by miR-203. Eur Rev Med Pharmacol Sci 2018, 22:8866-8876. Makino A, Firth AL, Yuan JX: Endothelial and smooth muscle cell ion channels in pulmonary vasoconstriction and vascular remodeling. Compr Physiol 2011, 1:1555-1602. Zhu P, Huang L, Ge X, Yan F, Wu R, Ao Q: Transdifferentiation of pulmonary arteriolar endothelial cells into smooth muscle-like cells regulated by myocardin involved in hypoxia-induced pulmonary vascular remodelling. Int J Exp Pathol 2006, 87:463-474. Luo Y, Dong HY, Zhang B, Feng Z, Liu Y, Gao YQ, Dong MQ, Li ZC: miR-29a-3p attenuates hypoxic pulmonary hypertension by inhibiting pulmonary adventitial fibroblast activation. Hypertension 2015, 65:414-420. Gore B, Izikki M, Mercier O, Dewachter L, Fadel E, Humbert M, Dartevelle P, Simonneau G, Naeije R, Lebrin F, Eddahibi S: Key role of the endothelial TGF-beta/ALK1/endoglin signaling pathway in humans and rodents pulmonary hypertension. PLoS One 2014, 9:e100310. Smith KA, Schumacker PT: Sensors and signals: the role of reactive oxygen species in hypoxic pulmonary vasoconstriction. J Physiol 2019, 597:1033-1043. Bonnet S, Boucherat O: The ROS controversy in hypoxic pulmonary hypertension revisited. Eur Respir J 2018, 51. Xu Z, Rothstein SJ: ROS-Induced anthocyanin production provides feedback protection by scavenging ROS and maintaining photosynthetic capacity in Arabidopsis. Plant Signal Behav 2018, 13:e1451708. Zuo L, Chuang CC, Clark AD, Garrison DE, Kuhlman JL, Sypert DC: Reactive Oxygen Species in COPD-Related Vascular Remodeling. Adv Exp Med Biol 2017, 967:399-411. Jaitovich A, Jourd'heuil D: A Brief Overview of Nitric Oxide and Reactive Oxygen Species Signaling in Hypoxia-Induced Pulmonary Hypertension. Adv Exp Med Biol 2017, 967:71-81. Roberto D, Micucci P, Sebastian T, Graciela F, Anesini C: Antioxidant activity of limonene on normal murine lymphocytes: relation to H2O2 modulation and cell proliferation. Basic Clin Pharmacol Toxicol 2010, 106:38-44. Hwang JW, Kim EK, Lee SJ, Kim YS, Moon SH, Jeon BT, Sung SH, Kim ET, Park PJ: Antioxidant activity and protective effect of anthocyanin oligomers on H(2)O(2)-triggered G2/M arrest in retinal cells. J Agric Food Chem 2012, 60:4282-4288. Lo YC, Lin YC, Huang YF, Hsieh CP, Wu CC, Chang IL, Chen CL, Cheng CH, Chen HY: Carnosol-Induced ROS Inhibits Cell Viability of Human Osteosarcoma by Apoptosis and Autophagy. Am J Chin Med 2017, 45:1761-1772. Costa RM, Filgueira FP, Tostes RC, Carvalho MH, Akamine EH, Lobato NS: H2O2 generated from mitochondrial electron transport chain in thoracic perivascular adipose tissue is crucial for modulation of vascular smooth muscle contraction. Vascul Pharmacol 2016, 84:28-37. Li Z, Fang F, Xu F: Effects of different states of oxidative stress on fetal rat alveolar type II epithelial cells in vitro and ROSinduced changes in Wnt signaling pathway expression. Mol Med Rep 2013, 7:1528-1532. Sigaud S, Evelson P, Gonzalez-Flecha B: H2O2-induced proliferation of primary alveolar epithelial cells is mediated by MAP kinases. Antioxid Redox Signal 2005, 7:6-13. Wang YX, Liu ML, Zhang B, Fu EQ, Li ZC: Fasudil alleviated hypoxia-induced pulmonary hypertension by stabilizing the expression of angiotensin-(1-7) in rats. Eur Rev Med Pharmacol Sci 2016, 20:3304-3312. Takano M, Nagahiro M, Yumoto R: Transport Mechanism of Nicotine in Primary Cultured Alveolar Epithelial Cells. J Pharm Sci 2016, 105:982-988. Wang J, Dong MQ, Liu ML, Xu DQ, Luo Y, Zhang B, Liu LL, Xu M, Zhao PT, Gao YQ, Li ZC: Tanshinone IIA modulates pulmonary vascular response to agonist and hypoxia primarily via inhibiting Ca2+ influx and release in normal and hypoxic pulmonary hypertension rats. Eur J Pharmacol 2010, 640:129-138. Hauge A: Hypoxia and pulmonary vascular resistance. The relative effects of pulmonary arterial and alveolar PO2. Acta Physiol Scand 1969, 76:121-130. Lourenco AP, Fontoura D, Henriques-Coelho T, Leite-Moreira AF: Current pathophysiological concepts and management of pulmonary hypertension. Int J Cardiol 2012, 155:350-361. Song T, Zheng YM, Wang YX: Cross Talk Between Mitochondrial Reactive Oxygen Species and Sarcoplasmic Reticulum Calcium in Pulmonary Arterial Smooth Muscle Cells. Adv Exp Med Biol 2017, 967:289-298. McCord JM, Fridovich I: Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J Biol Chem 1969, 244:6049-6055. Masri FA, Comhair SA, Dostanic-Larson I, Kaneko FT, Dweik RA, Arroliga AC, Erzurum SC: Deficiency of lung antioxidants in idiopathic pulmonary arterial hypertension. Clin Transl Sci 2008, 1:99-106. Nozik-Grayck E, Woods C, Stearman RS, Venkataraman S, Ferguson BS, Swain K, Bowler RP, Geraci MW, Ihida-Stansbury K, Stenmark KR, et al: Histone deacetylation contributes to low extracellular superoxide dismutase expression in human idiopathic pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol 2016, 311:L124-134. Hirobe T, Shibata T, Sato K: Human fibroblasts treated with hydrogen peroxide stimulate human melanoblast proliferation and melanocyte differentiation, but inhibit melanocyte proliferation in serum-free co-culture system. J Dermatol Sci 2016, 84:282-295. Park WH: Exogenous H2O2 induces growth inhibition and cell death of human pulmonary artery smooth muscle cells via glutathione depletion. Mol Med Rep 2016, 14:936-942. Porter KM, Kang BY, Adesina SE, Murphy TC, Hart CM, Sutliff RL: Chronic hypoxia promotes pulmonary artery endothelial cell proliferation through H2O2-induced 5-lipoxygenase. PLoS One 2014, 9:e98532. Jin N, Rhoades RA: Activation of tyrosine kinases in H2O2-induced contraction in pulmonary artery. Am J Physiol 1997, 272:H2686-2692. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 09 Jan, 2021 Review # 3 received at journal 06 Jan, 2021 Review # 1 received at journal 27 Dec, 2020 Review # 2 received at journal 26 Dec, 2020 Reviewer # 3 agreed at journal 22 Dec, 2020 Reviewer # 2 agreed at journal 20 Dec, 2020 Reviewers invited by journal 20 Dec, 2020 Reviewer # 1 agreed at journal 20 Dec, 2020 Editor assigned by journal 14 Dec, 2020 Submission checks completed at journal 14 Dec, 2020 Editor invited by journal 14 Dec, 2020 First submitted to journal 10 Dec, 2020 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-129956","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":6585358,"identity":"598d7332-8dad-4ef0-8875-f38896d50662","order_by":0,"name":"Yanxia Wang","email":"","orcid":"","institution":"Fourth Military Medical University: Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanxia","middleName":"","lastName":"Wang","suffix":""},{"id":6585359,"identity":"36ca35e0-76f2-4898-9295-adaaaa642ed2","order_by":1,"name":"Xiaoming Li","email":"","orcid":"","institution":"Xi'an Peihua University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoming","middleName":"","lastName":"Li","suffix":""},{"id":6585360,"identity":"5f931656-7e27-43f1-94c0-217f92576d4a","order_by":2,"name":"Wen Niu","email":"","orcid":"","institution":"Fourth Military Medical University: Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wen","middleName":"","lastName":"Niu","suffix":""},{"id":6585361,"identity":"007d911f-613f-44f0-8cb1-185ec7252c17","order_by":3,"name":"Jian Chen","email":"","orcid":"","institution":"Fourth Military Medical University: Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Chen","suffix":""},{"id":6585362,"identity":"fc79cde7-f82c-4e31-9580-846b4776d06c","order_by":4,"name":"Bo Zhang","email":"","orcid":"","institution":"Fourth Military Medical University: Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Zhang","suffix":""},{"id":6585363,"identity":"ef842f6b-0f35-43e7-939b-b6e74f39eb33","order_by":5,"name":"Xiumin Zhang","email":"","orcid":"","institution":"Fourth Military Medical University: Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiumin","middleName":"","lastName":"Zhang","suffix":""},{"id":6585364,"identity":"628e0139-63a6-4f50-a0b2-cf085baa8d0a","order_by":6,"name":"Yingmei Wang","email":"","orcid":"","institution":"Fourth Military Medical University: Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yingmei","middleName":"","lastName":"Wang","suffix":""},{"id":6585365,"identity":"68046090-c472-47db-a304-856050a6786e","order_by":7,"name":"Shaokang Dang","email":"","orcid":"","institution":"Tangdu Hospital Fourth Military Medical University: Air Force Medical University Tangdu Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shaokang","middleName":"","lastName":"Dang","suffix":""},{"id":6585366,"identity":"97a96959-cbfd-400e-981b-cd10eecd8799","order_by":8,"name":"Zhichao Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYBACPmYGNoYEBht+CJeNCC1sEC1pkg3Ea4EoO0yKFnb2Zw8e1JyX0J12xoDhQ9lhBv7ZDQQdlm6QcOy2hNntHAPGGecOM0jcOUBQyzGJxIbbdSAtzLxthxkMJBIIaWFsA2o5B7aF+S9xWpjZgFoOQLQwEqeFjU0i4VgyUEtawcGec+k8EjcIaOHnP/5M8keNHVBL8sYHP8qs5fhnENCCAg4AMQ8J6kfBKBgFo2AU4AIA6+I6XzylGEIAAAAASUVORK5CYII=","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":true,"prefix":"","firstName":"Zhichao","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2020-12-16 14:28:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-129956/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-129956/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":4367280,"identity":"c9ae8c8e-8014-45c9-b7b5-e68344b1ee46","added_by":"auto","created_at":"2020-12-18 16:57:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":164243,"visible":true,"origin":"","legend":"Hypoxia increased total intracellular ROS (A) Hypoxia increased the total content of SOD in ATII (B) Hypoxia increased the activity of SOD in ATII (C) Hypoxia increased the intensity of ROS in ATII (D) Hypoxia increased the content of H2O2 in ATII(E) Hypoxia increased the content of H2O2 in ATII culture medium.","description":"","filename":"Fig10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/67704c82aceb4a816d9a4380.jpg"},{"id":4367096,"identity":"00c925cf-56de-4a3a-bb08-aa09ebf27f9c","added_by":"auto","created_at":"2020-12-18 16:54:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":158611,"visible":true,"origin":"","legend":"NAC effectively inhibited the constriction of PA or AA induced by ATII hypoxic culture medium.(A) The constriction of PA induced by ATII hypoxic culture medium was effectively inhibited by 10 mM NAC (B) The constriction of AA induced by ATII hypoxic culture medium was effectively inhibited by 10 mM NAC.AHCM=ATII hypoxic culture medium. n=5, Data are means ± S.D. **P\u003c 0.01 vs. AHCM.","description":"","filename":"Fig16.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/8652a1fe33c33ab02ebe8eb3.jpg"},{"id":4367094,"identity":"823873f3-eec1-41b9-8dab-0a17828eb84d","added_by":"auto","created_at":"2020-12-18 16:54:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":598819,"visible":true,"origin":"","legend":"Effects of hypoxia on structure of pulmonary, bronchial and renal artery in rats.\n(A)Reconstruction of pulmonary artery and bronchial artery were observed by HE staining a,b,c) pulmonary artery, bronchial artery and renal artery in normoxic group d,e,f) pulmonary artery, bronchial artery and renal artery in hypoxic group. (B) MT% and MA% of pulmonary and bronchial artery were significantly elevated in hypoxic group compared with the normoxic group a, b) MT% and MA% of pulmonary artery c, d)MT% and MA% of bronchial artery e, f) MT% and MA% of renal artery. N= normoxic group H=hypoxic group. n=12, Data are means ± S.D. **P \u003c 0.01 vs normoxic group.","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/8f638304701dac74eea54d80.jpg"},{"id":4367093,"identity":"fc3e745b-99ec-4604-848a-2cb477a210b6","added_by":"auto","created_at":"2020-12-18 16:54:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":99311,"visible":true,"origin":"","legend":"Effects of hypoxia on proliferation of PASMCs and AASMCs.\n(A and B) Hypoxia promoted the proliferation of PASMCs (C and D) Hypoxia had no obvious effect on the proliferation of AASMCs. n=8, Data are means ± S.D. #P \u003c 0.05, ## P \u003c0.01,*P \u003c 0.05 or **P \u003c 0.01 vs 21% O2.","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/d78a521e972d1b3ef930a481.jpg"},{"id":4366928,"identity":"03ab50db-c29e-4305-a9d3-63f78d9d0721","added_by":"auto","created_at":"2020-12-18 16:51:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":108063,"visible":true,"origin":"","legend":"NAC effectively inhibited the constriction of PA or AA induced by RLE-6TN hypoxic culture medium.(A) The constriction of PA induced by RLE-6TN hypoxic culture medium was effectively inhibited by 10 mM NAC (B) The constriction of AA induced by RLE-6TN hypoxic culture medium was effectively inhibited by 10 mM NAC. RHCM=RLE-6TN hypoxic culture medium. n=5, Data are means ± S.D. **P\u003c 0.01 vs. RHCM.","description":"","filename":"Fig17.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/0f2e5723ab4016b401610514.jpg"},{"id":4366927,"identity":"b1826e3a-f241-4c89-a4df-8478de1caf89","added_by":"auto","created_at":"2020-12-18 16:51:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":114490,"visible":true,"origin":"","legend":"AECs hypoxic culture medium promoted the proliferation of PASMCs or AASMCs (A) PASMCs+ ATII normoxic or hypoxic culture medium (B) AASMCs + ATII normoxic or hypoxic culture medium (C)PASMCs+RLE-6TN normoxic or hypoxic culture medium (D) AASMCs+RLE-6TN normoxic or hypoxic culture medium. ANCM=ATII normoxic culture medium, AHCM=ATII hypoxic culture medium, RNCM=RLE-6TN normoxic culture medium, RHCM=RLE-6TN hypoxic culture medium, P=PASMCs, A=AASMCs. n=8, Data are means ± S.D. #P\u003c 0.05 or ##P\u003c 0.01 vs. 5% O2 PASMCs or AASMCs,*P\u003c 0.05 or ** P\u003c 0.01vs. 21% O2 PASMCs or AASMCs.","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/f5e132b74a60cc3979c8ab26.jpg"},{"id":4366924,"identity":"f906a5c8-23f0-4387-95b1-52ce9e303e03","added_by":"auto","created_at":"2020-12-18 16:51:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":98110,"visible":true,"origin":"","legend":"Hypoxia increased SOD2 mRNA level of ATII (A) Hypoxia increased SOD2 mRNA level of ATII. (B) Hypoxia didn’t increased CAT mRNA level of ATII n=3, Data are means ± S.D.**P\u003c 0.01 vs.21% O2.","description":"","filename":"Fig11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/7717e08610f643707458243c.jpg"},{"id":4366922,"identity":"b0dc94e8-2e8a-46fe-b659-1dbe5fa55b8c","added_by":"auto","created_at":"2020-12-18 16:51:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":65898,"visible":true,"origin":"","legend":"Co-culture with AECs promoted the proliferation of PASMCs or AASMCs under hypoxia. (A) PASMCs co-culture with ATII (B) AASMCs co-culture with ATII (C) PASMCs co-culture with RLE-6TN (D)AASMCs co-culture with RLE-6TN. P=PASMCs, A=AASMCs, R=RLE-6TN. n=5, Data are means ± S.D.#P\u003c 0.05 or ##P\u003c 0.01 vs.5% O2 PASMCs or AASMCs.* P\u003c 0.05 vs.21% O2 PASMCs or AASMCs. ","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/b45b2457b34e71345d5afaa6.jpg"},{"id":4366743,"identity":"5f00565e-72ce-425c-b555-b6cc701b7a66","added_by":"auto","created_at":"2020-12-18 16:48:20","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":110909,"visible":true,"origin":"","legend":"NAC effectively inhibited the proliferation of PASMCs or AASMCs co-cultured with AECs. (A) The proliferation of PASMCs co-cultured with ATII was effectively inhibited by 10 mM NAC (B) The proliferation of PASMCs co-cultured with RLE-6TN was effectively inhibited by 10 mM NAC (C) The proliferation of AASMCs co-cultured with ATII was effectively inhibited by 10 mM NAC (D) The proliferation of AASMCs co-cultured with RLE-6TN was effectively inhibited by 10 mM NAC. P=PASMCs A=AASMCs. n=8, Data are means ± S.D. **P\u003c 0.01,*P\u003c 0.05 vs. P or A, ##P\u003c 0.01, #P\u003c 0.05 vs. P+ATII or P+R, A+ATII or A+R.","description":"","filename":"Fig15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/1598738b4c8a547902c71ab2.jpg"},{"id":4366742,"identity":"ebb09df4-4256-4ba0-91fc-114acece6493","added_by":"auto","created_at":"2020-12-18 16:48:20","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":154050,"visible":true,"origin":"","legend":"Effect of exogenous H2O2 on the constriction of PA or AA. (A) 5-400 μM H2O2 led to a dose-dependent increase in the constriction of PA, and the constriction of PA was gradually inhibited by H2O2 from 600 μM to1000 μM. (B) 5-600 μM H2O2 led to a dose-dependent increase in the constriction of AA, and the constriction of AA was gradually inhibited by H2O2 from 800 μM to 1000 μM. n=5, Data are means ± S.D.*P\u003c 0.05 or **P\u003c 0.01vs.5μM H2O2.","description":"","filename":"Fig13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/20b461dd668d5ce865865656.jpg"},{"id":4366741,"identity":"bc180e73-be2e-4931-a10e-40f706fc1ef3","added_by":"auto","created_at":"2020-12-18 16:48:20","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":169732,"visible":true,"origin":"","legend":"ATII and RLE-6TN hypoxic culture medium promoted the constriction of PA from HPH rats (A) The effect of ATII normoxic or hypoxic culture medium on the constriction of PA from HPH rats (B) The effect of RLE-6TN normoxic or hypoxic culture medium on the constriction of PA from HPH rats.CM=culture medium, ANCM=ATII normoxic culture medium, AHCM=ATII hypoxic culture medium, RNCM=RLE-6TN normoxic culture medium, RHCM=RLE-6TN hypoxic culture medium. n=5, Data are means ± S.D.*P\u003c 0.05 or **P\u003c 0.01vs.CM, #P\u003c 0.05 vs. ANCM.","description":"","filename":"Fig8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/2a104f983f776b12290b9a74.jpg"},{"id":4366740,"identity":"90e4256d-d841-4de7-88d0-9a37dabbc005","added_by":"auto","created_at":"2020-12-18 16:48:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":45769,"visible":true,"origin":"","legend":"Effects of hypoxia on RVSP, mCAP and right ventricular hypertrophy index in rats. (A) RVSP was significantly elevated in hypoxic group compared with the normoxic group (B) Hypoxia did not influence mCAP considerably. (C) RV/ (LV+S) % was significantly elevated in hypoxic group compared with normoxic group, N= normoxic group H=hypoxic group. n=12, Data are means ± S.D. **P\u003c 0.01 vs normoxic group.","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/969390fa4b3125828f7f5dc6.jpg"},{"id":4366739,"identity":"020597f7-a555-4b98-85d1-5d14db748ba3","added_by":"auto","created_at":"2020-12-18 16:48:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":191290,"visible":true,"origin":"","legend":"Effect of exogenous H2O2 andNAC intervention on the proliferation of PASMCs or AASMCs. (A) 0-50 μM H2O2 led to a dose-dependent increase in the proliferation of PASMCs, and the proliferation of PASMCs was gradually inhibited by H2O2from 100 μM to 1000 μM (B) 0-100 μM H2O2 led to a dose-dependent increase in the proliferation of AASMCs, the proliferation of AASMCs was gradually inhibited by H2O2 from 200μM to 1000 μM. (C) 5mM and 10mM NAC effectively inhibited the proliferation of PASMCs (D) 5mM and 10mM NAC effectively inhibited the proliferation of AASMCs. n=8, Data are means ± S.D.（A, B）**P\u003c 0.01 or *P\u003c 0.05vs.0 μM H2O2（C, D）**P\u003c 0.01 or *P\u003c 0.05vs.50 μM H2O2, ##P\u003c 0.01 or #P\u003c 0.05vs.100 μM H2O2.","description":"","filename":"Fig12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/824a1a61e38d8a88d1ee7c1f.jpg"},{"id":4366738,"identity":"83c1a0fd-d843-4668-918e-84fcefdeebb8","added_by":"auto","created_at":"2020-12-18 16:48:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":148723,"visible":true,"origin":"","legend":"ATII and RLE-6TN hypoxic culture medium promoted the constriction of AA from normoxic rats (A) The effect of ATII normoxic or hypoxic culture medium on the constriction of AA from normoxic rats (B) The effect of RLE-6TN normoxic or hypoxic culture medium on the constriction of AA from normoxic rats.CM= culture medium, ANCM=ATII normoxic culture medium, AHCM= ATII hypoxic culture medium, RNCM=RLE-6TN normoxic culture medium, RHCM=RLE-6TN hypoxic culture medium. n=5, Data are means ± S.D.*P\u003c 0.05vs.CM.","description":"","filename":"Fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/3d4c3ed493765d667d27dc8a.jpg"},{"id":4366735,"identity":"1fe145da-b467-4e5d-ad92-1cb1c1f45160","added_by":"auto","created_at":"2020-12-18 16:48:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":174088,"visible":true,"origin":"","legend":"ATII and RLE-6TN hypoxic culture medium promoted the constriction of AA from HPH rats (A) The effect of ATII normoxic or hypoxic culture medium on the constriction of AA from HPH rats (B) The effect of RLE-6TN normoxic or hypoxic culture medium on the constriction of AA from HPH rats.CM=culture medium, ANCM=ATII normoxic culture medium, AHCM=ATII hypoxic culture medium, RNCM=RLE-6TN normoxic culture medium, RHCM=RLE-6TN hypoxic culture medium. n=5, Data are means ± S.D.*P\u003c 0.05 orvs.CM.","description":"","filename":"Fig9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/361d9edfcf8515ec27f95b35.jpg"},{"id":4366729,"identity":"1bcdaea8-66f0-41dc-b278-8dfee791aea8","added_by":"auto","created_at":"2020-12-18 16:48:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":204387,"visible":true,"origin":"","legend":"Effect of NAC intervention on the constriction of PA or AA. (A) 10mM NAC effectively inhibited the constriction of PA (B)10mM NAC effectively inhibited the constriction of AA. n=5, Data are means ± S.D. **P\u003c 0.01, ##P\u003c 0.01vs.400 μM H2O2 or 600 μM H2O2.","description":"","filename":"Fig14.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/0b16ed3bb9c4241814e868bb.jpg"},{"id":4366728,"identity":"fa00c9b2-aeed-4cf7-a6fd-2ec525a075ec","added_by":"auto","created_at":"2020-12-18 16:48:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":154187,"visible":true,"origin":"","legend":"ATII and RLE-6TN hypoxic culture medium promoted the constriction of PA from normoxic rats (A) The effect of ATII normoxic or hypoxic culture medium on the constriction of PA from normoxic rats (B) The effect of RLE-6TN normoxic or hypoxic culture medium on the constriction of PA from normoxic rats.CM=culture medium, ANCM=ATII normoxic culture medium, AHCM= ATII hypoxic culture medium, RNCM= RLE-6TN normoxic culture medium, RHCM= RLE-6TN hypoxic culture medium. n=5, Data are means ± S.D. *P \u003c 0.05 vs.CM, #P \u003c 0.05 or ##P \u003c 0.01 vs. ANCM or RNCM.","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/465e33c0e820948af856075d.jpg"},{"id":13634783,"identity":"33ddf021-8291-4ab1-9a00-1caa14d7768e","added_by":"auto","created_at":"2021-09-17 08:33:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1859435,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-129956/v1/a409599e-8180-4cd5-9852-11e4b5e03d7e.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eAlveolar Epithelial Cells Involved in Pulmonary Vascular Remodeling and Constriction of Hypoxic Pulmonary Hypertension\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003ePulmonary hypertension is a progressive disorder and characterized by pulmonary vascular remodeling and vasoconstriction [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], which ultimately leads to right ventricular hypertrophy and right heart failure with morbidity and mortality [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Hypoxic pulmonary hypertension (HPH) is highly prevalent in advanced chronic obstructive pulmonary disease and high altitude hypoxia [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It is well known that when alveolar hypoxia occurs, only pulmonary artery pressure increases, but no systemic circulation pressure increases. Vascular internality plays an important role, but its peripheral microenvironment should also be an important factor. AECs are primarily components of alveolar wall and involve in the formation of the pulmonary microenvironment. When hypoxia occurs in alveolar cavity, AECs are the first to perceive and suffer from largest change of oxygen content in the body. Previous studies have constantly reported that pulmonary arteriolar endothelial cells and adventitial fibroblast were involved in HPH [\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, little is known whether AECs are involved in the development of HPH. The purpose of this experiment is to observe the role and mechanism of AECs in the development of HPH.\u003c/p\u003e \u003cp\u003eReactive oxygen species (ROS) including hydroxyl radical (HO\u003csup\u003e\u0026bull;\u003c/sup\u003e), singlet oxygen (\u003csup\u003e1\u003c/sup\u003eO\u003csub\u003e2\u003c/sub\u003e), superoxide anion (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026bull;_\u003c/sup\u003e), and hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) are by-products of electron transfer processes [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Accumulation of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026bull;_\u003c/sup\u003e and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e is prevented by the antioxidant enzymes superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in the cell normal metabolism[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The balance between production and degradation rates determines the steady-state concentrations of ROS in each intracellular compartment. H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e is a stable and easily diffused out of the cell[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. It has been documented in increase cell proliferation[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], cell-cycle arrest[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]and apoptosis[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]and vascular smooth muscle constriction[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe multiple responses of the lung to oxygen are a physiological paradigm of the variety of cellular responses to ROS in vitro. In the lung, AECs are the first to perceive changes of oxygen concentration in the alveolar cavity, and many other investigators recently provided extensive evidence that hypoxia results in a significant increase in ROS concentration in AECs [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], which inevitably lead to changes of the microenvironment around the pulmonary artery. A recent study demonstrated cell proliferation could only be achieved by exposing the cells to a constant flux of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e generated by the G/GO system [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Therefore, AECs, as the cells around the pulmonary capillaries, can affect the pulmonary vascular remodeling and constriction by constant release of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003eThis study provides novel insights into the pathogenesis of HPH. It is considered that the earliest source of pulmonary microenvironment changes under hypoxia is AECs. In this experiment, AECs were used to change microenvironment of PASMCs, which proved that AECs were involved in pulmonary vascular remodeling and constriction under hypoxia and also to be related to the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e derived from AECs.\u003c/p\u003e "},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eAnimals\u003c/h2\u003e\n\u003cp\u003eMale Sprague-Dawley rats (200\u0026ndash;250\u0026nbsp;g) were purchased from the animal center of the Fourth Military Medical University (Xi'an, China). All experiments were approved by Animal Care and Use Committee of the Fourth Military Medical University and complied with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals (Publication No. 85\u0026thinsp;\u0026minus;\u0026thinsp;23, revised 1985). To obtain pulmonary hypertension rats, rats were housed intermittently in a hypobaric hypoxia chamber depressurized to 380\u0026nbsp;mmHg (10% oxygen) and taken hypobaric hypoxia challenge of 8\u0026nbsp;h/d for 4 weeks. Age-matched rats were housed in room air (21% oxygen) accordingly.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eHemodynamic and Morphological Investigation\u003c/h2\u003e\n\u003cp\u003eRight ventricular pressure and hematoxylin and eosin staining of lung and renal tissues were performed according to my published article [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]. After 4 weeks of hypoxia, the animals were anesthetized with 20% ethylurethanm (5\u0026nbsp;ml/ kg). Then, a soft silica gel catheter linked to a Power lab system (AD Instruments, Colorado Springs, CO, Australia) was inserted into the right jugular vein. The right ventricle peak systolic pressure (RVSP) waveforms were showed on the monitor when the catheter arrived in the right ventricle chamber. Meanwhile, the mean carotid artery pressure (mCAP) was recorded via a special catheter inserted into the carotid artery. After the weight of right ventricle (RV) and left ventricle plus septum (LV\u0026thinsp;+\u0026thinsp;S) were obtained, the ratio of RV/ (LV\u0026thinsp;+\u0026thinsp;S) was calculated as an index of RV hypertrophy. The right lung and kidney were placed in neutral buffer (pH 7.4) containing 10% formalin for 72 hours. The lung and kidney tissue were embedded in paraffin and sectioned into 5\u0026nbsp;\u0026micro;m thick sections, then processed hematoxylin and eosin staining. Microscopic evaluation showed structure remodeling of the pulmonary artery. Total 60 of pulmonary artery, bronchial artery and renal artery in approximate round shape were obtained from each group. Their external diameters are50-180\u0026nbsp;\u0026micro;m and the average size of artery was 78\u0026nbsp;\u0026micro;m. The outside diameter and inside diameter of pulmonary artery were measured by an image-processing program (Image-Pro Plus, Version 5.1, Media Cybernetics, Rockville, MD, USA). The medial wall thickness, the cross-sectional area of medial wall, and the total cross-sectional vessel area were obtained. Pulmonary vascular structure remodeling was assessed by percent medial wall thickness (MT %) and percent medial wall area (MA %) two indices: MT% = 100 \u0026times; (medial wall thickness) / (vessel semi-diameter); MA% = 100 \u0026times; (cross sectional medial wall area) / (total cross-sectional vessel area). All the morphological analysis was conducted via a double-blind method. The following should be explained in our experiment: pulmonary artery is a pulmonary circulatory vessel located in the pulmonary microenvironment, bronchial artery is a systemic circulatory vessel located in the pulmonary microenvironment, and renal artery is a systemic circulatory vessel not located in the pulmonary microenvironment.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eCell culture\u003c/h2\u003e\n\u003cp\u003eAASMCs were used for systemic circulating vascular smooth muscle cells. Rat primary PASMCs and AASMCs were obtained by tissue explants culturing method according to my published articles [\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]. Pulmonary artery (PA) and aortic artery(AA) were isolated from male Sprague-Dawley rats (200\u0026ndash;250\u0026nbsp;g) and dissected into small pieces after the adventitial layers were removed, then placed in a overturned culture flask containing Dulbecco Eagle\u0026rsquo;s minimum essential Medium (DMEM, HyClone, Logan, UT) with 15% fetal bovine serum(FBS, CellMax, Beijing, China)at 37\u0026nbsp;\u0026deg;C in 21% oxygen condition. The flask was carefully turned over after 4 hours. PASMCs and AASMCs crawled out from the tissue in about a week. Cells were used between passages 3 to 6. Smooth muscle cell identity was verified by positive staining for smooth muscle a-actin (mouse monoclonal antibody, Sigma-Aldrich, St. Louis, MO, USA) at each passage.\u003c/p\u003e\n\u003cp\u003eAlveolar epithelial cells (AECs) in this study included rat primary ATII cells and RLE-6TN cells. Rat primary ATII cells were isolated from male SpragueDawley rats (180\u0026ndash;200\u0026nbsp;g) as previously described [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. Pooled cells from 2 rats were prepared as follows. Rats were injected intraperitoneally with 20% ethylurethanm (4\u0026nbsp;ml/kg) and intravenously 4000U/kg heparin sodium. Intubation of pulmonary artery and tracheal were performed. Rats were exsanguinated by cutting the abdominal aorta under the aseptic condition. 50\u0026nbsp;ml Solution II (in mM: 140 NaCl, 5 KCl, 10 Hepes, 2CaCl\u003csub\u003e2\u003c/sub\u003e, 2.5 PBS (pH 7.4), 1.3 MgSO\u003csub\u003e4\u003c/sub\u003e) was perfuse via the pulmonary artery to clear the vascular space of blood. The lungs were removed from the thorax and lavaged with 8 times solution I (10\u0026nbsp;ml/time) (in mM: 140NaCl, 5 KCl, 10 Hepes, 6 D-glucose, 2.5 PBS (pH 7.4),0.2 EDTA) and 2 times solution II (10\u0026nbsp;ml/time).Lungs were then filled 2 times with trypsin solution (10\u0026nbsp;ml/time) prepared in solution II and incubated in incubator for 10\u0026nbsp;min at 37℃ every time. The lungs were cut into pieces in the bottle with 4\u0026nbsp;ml DNAse I and 5\u0026nbsp;ml FBS. The lung tissues were then sequentially filtered through 125\u0026nbsp;\u0026micro;m and 75\u0026nbsp;\u0026micro;m stainless mesh. The filtrate was centrifuged at 1000r/min for 8\u0026nbsp;min. The cell pellet was resuspended in DMEM at 37℃.The cell suspension was plated at a density of 2\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e6\u003c/sup\u003e cells/ml in 25\u0026nbsp;cm\u003csup\u003e2\u003c/sup\u003e bacteriologic plastic dishes coated rat IgG to remove macrophages and incubated at 37℃in 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 1\u0026nbsp;h. The unattached cells in suspension were removed and centrifuged at 1000 r/min for 8\u0026nbsp;min. The cell pellet was plated at a density of 5\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e5\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e in 6-well culture dishes with DMEM, 15% FBS, 100\u0026nbsp;U/ml penicillin and 100\u0026nbsp;U/ml streptomycin and incubated at 37℃under 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. The cell purity after 24\u0026nbsp;h was assessed by a characteristic fluorescence with phosphine3 Ras previously described [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. RLE-6TN were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM supplemented with 15% FBS, 100\u0026nbsp;IU/ml penicillin and 100\u0026nbsp;mg/ml streptomycin.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003eThe preparation of AECs culture medium\u003c/h2\u003e\n\u003cp\u003eAECs were seeded in 24-well culture dishes at 5\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e3\u003c/sup\u003e cells per well under normoxic (21% O\u003csub\u003e2\u003c/sub\u003e) or hypoxic conditions (5% O\u003csub\u003e2\u003c/sub\u003e). Its culture medium was collected for 24\u0026nbsp;h to subsequent experiments.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003eCell treatment\u003c/h2\u003e\n\u003cp\u003eThe effect of hypoxia on the proliferation of PASMCs and AASMCs was investigated under different oxygen concentrations. PASMCs or AASMCs were seeded in 96-well culture dishes at 3\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e4\u003c/sup\u003ecells per well under normoxic (21% O\u003csub\u003e2\u003c/sub\u003e) or hypoxic conditions (10% O\u003csub\u003e2\u003c/sub\u003e and 5% O\u003csub\u003e2\u003c/sub\u003e).\u003c/p\u003e\n\u003cp\u003eThe effect of AECs on the proliferation of PASMCs and AASMCs was investigated using 24- well transwell insert co-culture model (0.4\u0026nbsp;\u0026micro;m pore). PASMCs or AASMCs were seeded in 24-well culture dishes at a density of 3\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e4\u003c/sup\u003ecells per well, ATII or RLE-6TN were seeded in transwell inserts at a density of 1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e4\u003c/sup\u003e cells per insert. The cells were maintained under normoxia (21% O\u003csub\u003e2)\u003c/sub\u003e or hypoxia conditions (5% O\u003csub\u003e2\u003c/sub\u003e). The cells were grouped as follows, PASMCs: (1) normoxia (2) hypoxia (3) normoxia, co-culture with ATII or RLE-6TN (4) hypoxia, co-culture with ATII or RLE-6TN (5) hypoxia, co-culture with ATII or RLE-6TN\u0026thinsp;+\u0026thinsp;NAC (10\u0026nbsp;mmol/L, a nonspecific ROS inhibitor, Sigma-Aldrich, St. Louis, MO); AASMCs: (1) normoxia (2) hypoxia (3) normoxia, co-culture with ATII or RLE-6TN (4) hypoxia, co-culture with ATII or RLE-6TN (5) hypoxia, co-culture with ATII or RLE-6TN\u0026thinsp;+\u0026thinsp;NAC (10\u0026nbsp;mmol/L).\u003c/p\u003e\n\u003cp\u003eTo further confirm that AECs participated in the proliferation of PASMCs or AASMCs,the culture medium of PASMCs and AASMCs were replaced by AECs culture medium under normoxic or hypoxic conditions every 12 hours. The cells were grouped as follows, PASMCs: (1) normoxia (2) normoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN normoxic culture medium (3) normoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN hypoxic culture medium(4) hypoxia (5) hypoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN normoxic culture medium (6) hypoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN hypoxic culture medium; AASMCs: (1) normoxia (2) normoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN normoxic culture medium (3) normoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN hypoxic culture medium(4) hypoxia (5) hypoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN normoxic culture medium (6) hypoxia\u0026thinsp;+\u0026thinsp;ATII or RLE-6TN hypoxic culture medium.\u003c/p\u003e\n\u003cp\u003eTo determine the effects of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on the proliferation of PASMCs or AASMCs, concentration-\u0026nbsp;response was constructed by cumulative addition of exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (5-1000\u0026nbsp;\u0026micro;M). The H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentration of the largest proliferation of PASMCs or AASMCs was selected and then treated with NAC to observe the change of proliferation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eMTT Assay\u003c/h2\u003e\n\u003cp\u003eAll cells were quiesced in serum-free medium for 24 hours after growing to subconfluence and then cultured with 5% fetal bovine serum for 48 hours under normoxic or hypoxic conditions. Subsequently, MTT (5\u0026nbsp;mg/mL) was added into the plates (80\u0026micro;L/well in 24-well plates or 20\u0026micro;L/well in 96-well plates) and incubated for another 4 hours. Dimethyl sulfoxide was added into each well, and all plates were shaken for 10 minutes in a shaker. The optical density (OD) values were collected using a spectrophotometer (PowerWave XS, BioTekInc, Winooski, VT).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003eCell counting\u003c/h2\u003e\n\u003cp\u003eTo better investigate the effects of hypoxia on cell proliferation, direct cell counting was performed. Cells were seeded 6\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e4\u003c/sup\u003e cells in 6-well plates and cultured overnight. The cells were then incubated in serum-free for 24\u0026nbsp;h. Cells were cultured with normoxic (21% O\u003csub\u003e2\u003c/sub\u003e) or hypoxic conditions (10% O\u003csub\u003e2\u003c/sub\u003e and 5% O\u003csub\u003e2\u003c/sub\u003e), and after 48\u0026nbsp;h they were washed with phosphate buffered solution, harvested by mild trypsinization, and counted with a hematocytometer.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003eqRT-PCR\u003c/h2\u003e\n\u003cp\u003eqRT-PCR was performed with SYBR PrimeScript\u0026trade; RT-PCR kit (TakaRa, Dalian, China). The total RNA of cells was extracted using Trizol (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from RNA.GAPDH was used as an internal control. Primer sequences were designed using the Primer Premier 5.0 software (PREMIER Biosoft International, CA, USA) and synthesized by the DNA Bio Tec (Shanghai, China).Primers sequences used were asfollows:forward:5\u0026rsquo;-TGGGAAACAACACCCCTATTTT-3\u0026rsquo;and reverse: 5\u0026rsquo;-CGAAGATACCACCAGTCGTAGTTG-3\u0026rsquo;for CAT; forward: CTGTGGCTGAGCTGTTGTAA and reverse: ACAGCGTCCAAGCAATTCAA for SOD\u003csub\u003e2\u003c/sub\u003e; forward: 5\u0026rsquo;-CTATCGGCAATGAG CGGTTC-3\u0026rsquo;and reverse: 5\u0026rsquo;\u0026ndash;GATCTTGATCTTCATGGTGCTAGG-3\u0026rsquo;for GAPDH.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eMeasurement of ROS\u003c/h2\u003e\n\u003cp\u003ePASMCs or AASMCs in N48, H48, H48\u0026thinsp;+\u0026thinsp;NAC (10\u0026nbsp;mmol/L) groups were stained with an oxidant-sensitive fluorescence dye DCFH-DA (10\u0026nbsp;\u0026micro;mol/L, Nanjing Jian Cheng Bioengineering Institute, Nanjing, China). Subsequently, the intracellular total ROS were detected through fluorescence microscopy (Leica, Heidelberg, Germany) and flow cytometry.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eMeasurement of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/h2\u003e\n\u003cp\u003eThe content of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs and its culture medium were detected using a commercially available Hydrogen Peroxide Assay Kit (Beyotime Inc, Jiangsu, China) according to the recommended protocols. The concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in different groups were finally normalized to the corresponding protein concentrations.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003eMeasurement of SOD\u003c/h2\u003e\n\u003cp\u003eThe content and activity of SOD in AECs was detected using a commercially Tatal Superoxide Dismutase Assay Kit with WST-8 (Beyotime Inc, Jiangsu, China) according to the recommended protocols. The content of SOD in different groups was finally normalized to the corresponding protein concentrations. The activity of SOD is calculated by the formula.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eIsolated pulmonary artery ring preparation\u003c/h2\u003e\n\u003cp\u003ePulmonary artery and aortic artery were obtained according to published articles[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e].Rats was anesthetized with 20% ethylurethanm (4\u0026nbsp;ml/kg). Lung and heart were removed and immersed into cold oxygenated Krebs-Henseleit solution (in mM: NaCl 127, KCl 4.7, NaHCO\u003csub\u003e3\u003c/sub\u003e 17, MgSO\u003csub\u003e4\u003c/sub\u003e 1.17, KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e 1.18, CaCl\u003csub\u003e2\u003c/sub\u003e 2.5, D-glucose 5.5) after median sternotomy was performed. Under a dissecting microscope, the third-division (external diameter\u0026thinsp;\u0026lt;\u0026thinsp;300\u0026nbsp;\u0026micro;m) pulmonary artery and aorta were isolated carefully and cleared of connective tissue and cut into 3-mm-length rings. Endothelium was removed by gently rubbing the lumen with swab in rings. Pulmonary ring and aorta ring were suspended respectively on stainless steel hook connected to force transducers (AD Instruments, Colorado Springs, CO) for isometric force recording in individual water jacketed organ chamber containing modified Krebs-Henseleit solutions parged continuously with 95% O\u003csub\u003e2\u003c/sub\u003e/5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026nbsp;\u0026deg;C. Force displacement was recorded with Power Lab (AD Instruments) eight-channel data acquisition system (sampling rate 100/s).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003eExperimental protocols\u003c/h2\u003e\n\u003cp\u003eThe pulmonary artery ring and aortic artery ring were stretched to a predetermined optimal passive tension of 500\u0026nbsp;mg and 1000\u0026nbsp;mg respectively and equilibrated for 60\u0026nbsp;min with three washouts at 20-min intervals. Then reproducibility of contractile responses to 1\u0026nbsp;\u0026micro;M phenylephrine (\u0026gt;\u0026thinsp;300\u0026nbsp;mg) was established. The rings were rinsed with Krebs-Henseleit solution and the tension returned to baseline. To determine the effects of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on the constriction of pulmonary artery and aortic artery, concentration-response curve was constructed by cumulative addition of exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (5-1000\u0026nbsp;\u0026micro;M) at 10-min interval on ring. The H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentration of the largest contractile force of artery was selected and then treated with NAC after 10\u0026nbsp;min to observe the change of contractile force. To further confirm that AECs participated in the constriction of pulmonary artery and aortic artery, pulmonary artery ring and aortic ring from HPH and normoxic rats had treatment with AECs culture medium and NAC at 10-min intervals to observe the change of contractile force. The medium with 5% fetal bovine serum was used as a negative control. In the experiments involving NAC and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, darkened conditions were employed where kymograph chambers were wrapped in foil with overhead lights switched off.For the vasoconstriction experiment, 1\u0026nbsp;\u0026micro;mol/L PE was used. Vascular ring contraction to maximum was labeled as 100%, the contraction data for each group was expressed as a percentage of the maximum contraction caused by 1\u0026nbsp;\u0026micro;mol/L PE.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eUsing SPSS 20.0 software to perform statistical analysis of the data, each group of data is represented by an average\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD).And statistical analysis was assessed by analysis of variance (one-way ANOVA) for multiple group comparisons and pairing T test for two group comparisons. A significant difference was accepted as significant if P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003ch2\u003eHypoxia induced pulmonary artery pressure elevation, pulmonary and bronchial artery remodeling, but did not mCAP and renal artery remodeling\u003c/h2\u003e\n\u003cp\u003eThe RVSP was measured by catheterization via jugular vein to right ventricle, which substitutes for the pulmonary pressure. Four weeks after exposure to hypoxia, RVSP (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA) and RV/ (LV\u0026thinsp;+\u0026thinsp;S) % (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC) were significantly elevated in hypoxic group compared with normoxic group, while hypoxia did not influence mCAP considerably (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). MT% and MA% of PA and bronchial artery (BA) were significantly elevated in hypoxic group compared with normoxic group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB), while hypoxia did not influence MT% and MA% of renal artery (RA) considerably (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). In vitro, Hypoxia promoted the proliferation of PASMCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB) and did not affect the proliferation of AASMCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD) compared with normoxic group. These results suggested that the different reactions of pulmonary artery and systemic artery to hypoxia may be related to the microenvironment in which they are located.\u003c/p\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003eCo-culture with AECs promoted the proliferation of PASMCs or AASMCs under hypoxia\u003c/h2\u003e\n\u003cp\u003eTo explore the effect of AEC on PASMCs or AASMCs in vitro, the level of proliferation of PASMCs or AASMCs were detected by MTT. Under normoxia, co-culture with ATII had no significant effect on the proliferation of PASMCs or AASMCs compared with without ATII group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB), and co-culture with RLE-6TN inhibited the proliferation of PASMCs or AASMCs compared with without RLE-6TN group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD). Under hypoxia, co-culture with ATII or RLE-6TN promoted significantly the proliferation of PASMCs or AASMCs compared with without ATII (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB) or RLE-6TN group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD).These data indicated that AECs play an important role in the proliferation of vascular smooth muscle cells in hypoxia.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003eAECs hypoxic culture medium promoted the proliferation of PASMCs or AASMCs\u003c/h2\u003e\n\u003cp\u003eTo investigate the involvement of AECs conditioned medium in the proliferation of PASMCs or AASMCs, the culture medium of PASMCs or AASMCs were replaced by ACE conditioned culture medium to observe their proliferation. Under normoxia, the normoxic culture medium of ATII had no significant effect on the proliferation of PASMCs or AASMCs compared with without ATII culture medium group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB), and the normoxic culture medium of RLE-6TN inhibited the proliferation of PASMCs or AASMCs compared with without RLE-6TN culture medium group(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC and \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD), while ATII or RLE-6TN hypoxic culture medium promoted significantly the proliferation of PASMCs or AASMCs compared with without ATII or RLE-6TN culture medium group(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, B, C, D). Under hypoxia, the normoxic culture medium of ATII or RLE-6TN had no significant effect on the proliferation of PASMCs or AASMCs compared with without ATII or RLE-6TN culture medium group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, B, C, D), while ATII or RLE-6TN hypoxic culture medium promoted significantly the proliferation of PASMCs or AASMCs compared with without ATII or RLE-6TN culture medium group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, B, C, D). These data indicated that AECs hypoxic culture medium promoted the proliferation of PASMCs and AASMCs and also proved that the microenvironment induced by AECs in hypoxia play an important role in the proliferation of vascular smooth muscle cells.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003eAECs hypoxic culture medium promoted the constriction of PA and AA\u003c/h2\u003e\n\u003cp\u003eTo explore whether AECs culture medium can regulate pulmonary or aortic artery ring, we further examined the effects of AECs culture medium on PA or AA from normoxic and HPH rats. For normoxic rats, the normoxic culture medium from ATII or RLE-6TN had no significant effect on the constriction of PA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB) and AA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB) compared with the culture medium group, while the hypoxic culture medium from ATII or RLE-6TN promoted the constriction of PA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB) and AA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB) compared with the culture medium or the normoxic culture medium group. For HPH rats, the normoxic culture medium from ATII or RLE-6TN had no significant effect on the constriction of AA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eB) compared with the culture medium group, and the normoxic culture medium from ATII had also no significant effect on the constriction PA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA) compared with culture medium group, but the normoxic culture medium from RLE-6TN promoted the constriction of PA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eB), and the hypoxic culture medium from ATII or RLE-6TN promoted the constriction of PA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eB) and AA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eB) compared with the culture medium or the normoxic culture medium group. These results showed that AECs hypoxic culture medium could induce the constriction of PA and AA and also proved that the microenvironment induced by AECs in hypoxia play an important role in the vasoconstriction.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n\u003ch2\u003eEffect of hypoxia on ROS in AECs\u003c/h2\u003e\n\u003cp\u003eTo explore the possible mechanism involved the effect of AECs on the proliferation of PASMCs or AASMCs, total intracellular ROS was detected through DCFH-DA and the content of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs and its culture medium were determined by commercial kit. Hypoxia increased the production of ROS and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs and AECs culture medium (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eC, D, and E). Meanwhile, we examined mRNA level of SOD2 and CAT by QT-PCR, and detected the total content and activity of SOD in AECs by commercial kits. Hypoxia increased the mRNA of SOD\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003eA) and the total content and activity of SOD (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eB), while hypoxia have no significant effect on the mRNA of CAT (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003eB). These results showed that the increase of ROS and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs was caused by imbalance of SOD2 and CAT in hypoxia.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n\u003ch2\u003eEffect of exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on the proliferation of PASMCs or AASMCs\u003c/h2\u003e\n\u003cp\u003eSome studies have reported that the effects of different concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on cell proliferation were different. We used exogenous 0-1000\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e to observe how H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e affects the proliferation of PASMCs or AASMCs under normoxia. Results showed that 0\u0026ndash;50\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e led to a dose-dependent increase in the proliferation of PASMCs, and then the proliferation of PASMCs is gradually inhibited by 100\u0026ndash;1000\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eA).Similar to the effects of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on PASMCs, 0-100\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e led to a dose-dependent increase in the proliferation of AASMCs, and then the proliferation of AASMCs is gradually inhibited by 200\u0026ndash;1000\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eB). To observe the effect of NAC on PASMCs or AASMCs proliferation, we choose 50\u0026nbsp;\u0026micro;M and 100\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, which were the most obvious concentration that affected the proliferation of PASMCs and AASMCs respectively. Results showed that NAC (5\u0026nbsp;mM and 10\u0026nbsp;mM) effectively inhibited the proliferation of PASMCs or AASMCs, of which the effect of 10\u0026nbsp;mM NAC was most obvious (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eC and \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eD).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\n\u003ch2\u003eEffect of exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on the constriction of PA or AA\u003c/h2\u003e\n\u003cp\u003eTo explore whether H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e regulate PA or AA ring, we used exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (5-1000\u0026nbsp;\u0026micro;M) to observe how H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e affected the constriction of PA or AA from normal rats. Results showed that 5-400\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e led to a dose-dependent increase in the constriction of PA, and then the constriction of PA is gradually inhibited by 600\u0026ndash;1000\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003eA). Similar to the effects of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e on PA, 5-600\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e led to a dose-dependent increase in the constriction of AA, and then the constriction of AA is gradually inhibited by 800\u0026ndash;1000\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003eB). To observe the effect of NAC on PA or AA constriction, we choose 400\u0026micro;\u0026Mu; and 600\u0026nbsp;\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, which were the most obvious concentration that affected constriction of PA and AA respectively. Results showed that 10\u0026nbsp;mM NAC effectively inhibited the constriction of PA or AA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e14\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e14\u003c/span\u003eB).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\n\u003ch2\u003eNAC effectively inhibited the proliferation of PASMCs or AASMCs co-cultured with AECs\u003c/h2\u003e\n\u003cp\u003eThe concentration of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs cell culture medium for 24\u0026nbsp;h in hypoxia was detected in the range of promoting cell proliferation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eE). NAC intervention was performed in the co-culture medium. The proliferation of PASMCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e15\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e15\u003c/span\u003eB) and AASMCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e15\u003c/span\u003eC and\u003cspan class=\"InternalRef\"\u003e15\u003c/span\u003eD) was effectively inhibited by10mM NAC. This experiment suggested that H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e from ATII or RLE-6TN was involved in the proliferation of PASMCs or AASMCs.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\n\u003ch2\u003eNAC effectively inhibited the constriction of PA or AA\u003c/h2\u003e\n\u003cp\u003eThe concentration of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs culture medium for 24\u0026nbsp;h in hypoxia was detected in the range of promoting constriction. NAC intervention was performed in the hypoxic culture medium from ATII or RLE-6TN, the constriction of PA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e16\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e17\u003c/span\u003eA) or AA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e16\u003c/span\u003eB and \u003cspan class=\"InternalRef\"\u003e17\u003c/span\u003eB) was effectively inhibited by 10\u0026nbsp;mM NAC. This experiment suggested that H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e from ATII or RLE-6TN was involved in the constriction of PA or AA.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":" \u003cp\u003eIn this study, we first showed that AECs not only caused the proliferation of PASMCs, but also induced proliferation of AASMCs under hypoxia, and the hypoxic culture medium of AECs promoted both constriction of PA or AA in vitro. At the same time, we also confirmed that it was related to H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e derived from AECs which was induced by the imbalance between SOD2 and CAT in AECs. NAC, the inhibitor of ROS, markedly ameliorated the proliferation of PASMCs or AASMCs and the constriction of PA or AA. The present study first demonstrated that the difference in pressure variation between pulmonary artery and aortic artery in HPH rats was related to pulmonary microenvironment in which AECs involved, and the effect of AECs on the remodeling and constriction of pulmonary vessel was through H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003eIn 1969, researches have confirmed that only alveolar hypoxia caused hypoxic pulmonary vasoconstriction, and hypoxemia did not [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Though bronchial artery belongs to systemic circulatory vessel, it is also exposed to pulmonary microenvironment and has undergone remodeling. In the case of ventilatory dysfunction and low oxygen in the plateau, AECs is the first to perceive hypoxia. Therefore, we thought that AECs should play an important role in HPH. In our study, we constructed the model of HPH to observe hemodynamic and morphological of PA, BA and RA. The results showed that hypoxia led to RVSP, RV/ (LV\u0026thinsp;+\u0026thinsp;S) %, MT% and MA% of PA and BA significantly elevate, while did not mCAP and MT% and MA% of RA. In vitro, co-culture with AECs and treatment with AECs hypoxia culture medium significantly promoted not only PASMCs proliferation and PA constriction, but also AASMCs proliferation and AA constriction. Therefore, in vivo and in vitrodata suggested that AECs played a critical role on HPH, and in vitrodata shown thatsystemic circulatory vessel placed in the microenvironment where AECs exists also undergone remodeling and constriction.\u003c/p\u003e \u003cp\u003eIt is interesting to consider the regulation of key antioxidant enzymes such as SODand CATin evaluating the role of redox-regulating signaling in pulmonary vascular diseases [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. SOD catalyze the rapid dismutation of superoxide (O2\u0026bull;-) to hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) and molecular oxygen, however, CAT catalyzes the two-stage conversion of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e to water and oxygen[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e is a stable and easily diffused out of the cell[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. SOD has three isoforms, which are located in the cytosol (SOD1), mitochondria (SOD2) or extracellular compartment (SOD3)[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Accumulating evidence suggested that impaired activity of SOD2 and SOD3contributed to pulmonary hypertension, and the level and activity of SOD1 has not been found significantly perturbed in human pulmonary hypertension[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Our data suggested that the mRNA level of SOD2 and the content and activity of total SOD were increase in AECs under hypoxia, while the mRNA level of CAT have no significant change. And the content of ROS and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in AECs culture medium also were increase under hypoxia. Hence, in vitro data suggested that H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e derived from AECs affected pulmonary microenvironment.\u003c/p\u003e \u003cp\u003eRecently, an increasing number of studies showed that H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e can regulate a variety of cellular functions, including proliferation, differentiation, and more generally gene expression[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. However, quantitative data on the basal concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and the thresholds for cell proliferation are limited, and it is also reported that treatment with a continuous extracellular source of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e increases cell proliferation [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The present study provided the range of concentrations of exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for PASMCs and AASMCs proliferation and that hypoxia increased intracellular and extracellular H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e of AECs. Moreover, the extracellular H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentration of AECs was within the range of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentrations for PASMCs and AASMCs proliferation. Co-culture with AECs under hypoxic or the intermittent replacement of AEC hypoxic culture medium which were consistent with the conditions of continuous extracellular source of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e induced PASMCs or AASMCs proliferation. In other words, the method described above effected the proliferation of PASMCs or AASMCs by changing the microenvironment of PASMCs and AASMCs. In addition, NAC intervention reduced the proliferation PASMCs and AASMCs co-cultured with AECs under hypoxia, which further indicated extracellular H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e derived from AECs play important role in PASMCs and AASMCs proliferation under hypoxia. Jin N [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]reported that exposure to H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e cause smooth muscle constrictions and dysfunction in isolated pulmonary artery. The present study also provided the range of exogenous H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentrations for PA or AA constriction. Moreover, the extracellular H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentration of AECs in hypoxia was within the range of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentrations for PA and AA constriction. AECs hypoxic culture medium induced PA and AA constrictions, and NAC intervention could reduce this effect. It\u0026rsquo;s indicated hypoxic culture mediumH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003ederived from AECs played important role in PA and AA constriction. Taken together, these in vitro data indicated AECs involved in remodeling and constriction of pulmonary vessel through releasingH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003eunder hypoxia. Meanwhile, it also showed that systemic circulatory vessel also undergo the same change as pulmonary vessel in the AECs-induced microenvironment by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003eunder hypoxia.\u003c/p\u003e "},{"header":"Conclusion","content":"\u003cp\u003eThe proliferation of PASMCs and constrictions of PA are essential for the development of HPH. Our study had shown that the pulmonary microenvironment was beneficial to HPH and AECs played a crucial part in construct an pulmonary microenvironment. The continuous extracellular source of ROS is necessary to induce PASMCs proliferation and PA constriction. H2O2 derived from AECs influenced the pulmonary microenvironment and also was involved in pulmonary vascular remodeling and constriction in HPH.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHPH: Hypoxic pulmonary hypertension; AECs: alveolar epithelial cells; PA: pulmonary artery; AA: aortic artery; PASMCs :pulmonary artery smooth cells; AASMCs :aortic artery smooth cells; SOD2:superoxide dismutase 2; CAT: catalase; ROS {reactive oxygen species, (); hydrogen peroxide, (H2O2); N-acetylcysteine, (NAC);\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYanxia Wang and Xiaoming Li contributed to the experimental design and overall experimentation, Wen Niu, Jian Chen, Bo Zhang, Xiumin Zhang and Yingmei Wang conceptualized the project and data analysis, Zhichao Li and Shaokang Dang contributed to the experimental design, funding, and writing of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis present study was funded by the National Nature Science Foundation of China (grant nos. 31670328, 81800046, 81471816 and 81571839).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to share part of our data, because some of our date will be used in future research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved and supervised by the Medical Research Ethics Committee of the Fourth Military Medical University. All participants fully understood the information files. Informed consent was obtained from all participants. All experiments were performed in accordance with the relevant guidelines and regulations. The animal protocol has been reviewed and approved by the Institutional Animal Care and Use Committee (IACUC), the Fourth Military Medical University, China\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBarbera JA, Blanco I: Pulmonary hypertension in patients with chronic obstructive pulmonary disease: advances in pathophysiology and management. Drugs 2009, 69:1153-1171.\u003c/li\u003e\n\u003cli\u003ePenaloza D, Arias-Stella J: The heart and pulmonary circulation at high altitudes: healthy highlanders and chronic mountain sickness. Circulation 2007, 115:1132-1146.\u003c/li\u003e\n\u003cli\u003eWilkins MR, Ghofrani HA, Weissmann N, Aldashev A, Zhao L: Pathophysiology and treatment of high-altitude pulmonary vascular disease. Circulation 2015, 131:582-590.\u003c/li\u003e\n\u003cli\u003eYan D, Li G, Zhang Y, Liu Y: Angiotensin-converting enzyme 2 activation suppresses pulmonary vascular remodeling by inducing apoptosis through the Hippo signaling pathway in rats with pulmonary arterial hypertension. Clin Exp Hypertens 2019, 41:589-598.\u003c/li\u003e\n\u003cli\u003eLiu M, Wang Y, Zheng L, Zheng W, Dong K, Chen S, Zhang B, Li Z: Fasudil reversed MCT-induced and chronic hypoxia-induced pulmonary hypertension by attenuating oxidative stress and inhibiting the expression of Trx1 and HIF-1alpha. Respir Physiol Neurobiol 2014, 201:38-46.\u003c/li\u003e\n\u003cli\u003eZakynthinos E, Daniil Z, Papanikolaou J, Makris D: Pulmonary hypertension in COPD: pathophysiology and therapeutic targets. Curr Drug Targets 2011, 12:501-513.\u003c/li\u003e\n\u003cli\u003eWang LN, Yu WC, Du CH, Tong L, Cheng ZZ: Hypoxia is involved in hypoxic pulmonary hypertension through inhibiting the activation of FGF2 by miR-203. Eur Rev Med Pharmacol Sci 2018, 22:8866-8876.\u003c/li\u003e\n\u003cli\u003eMakino A, Firth AL, Yuan JX: Endothelial and smooth muscle cell ion channels in pulmonary vasoconstriction and vascular remodeling. Compr Physiol 2011, 1:1555-1602.\u003c/li\u003e\n\u003cli\u003eZhu P, Huang L, Ge X, Yan F, Wu R, Ao Q: Transdifferentiation of pulmonary arteriolar endothelial cells into smooth muscle-like cells regulated by myocardin involved in hypoxia-induced pulmonary vascular remodelling. Int J Exp Pathol 2006, 87:463-474.\u003c/li\u003e\n\u003cli\u003eLuo Y, Dong HY, Zhang B, Feng Z, Liu Y, Gao YQ, Dong MQ, Li ZC: miR-29a-3p attenuates hypoxic pulmonary hypertension by inhibiting pulmonary adventitial fibroblast activation. Hypertension 2015, 65:414-420.\u003c/li\u003e\n\u003cli\u003eGore B, Izikki M, Mercier O, Dewachter L, Fadel E, Humbert M, Dartevelle P, Simonneau G, Naeije R, Lebrin F, Eddahibi S: Key role of the endothelial TGF-beta/ALK1/endoglin signaling pathway in humans and rodents pulmonary hypertension. PLoS One 2014, 9:e100310.\u003c/li\u003e\n\u003cli\u003eSmith KA, Schumacker PT: Sensors and signals: the role of reactive oxygen species in hypoxic pulmonary vasoconstriction. J Physiol 2019, 597:1033-1043.\u003c/li\u003e\n\u003cli\u003eBonnet S, Boucherat O: The ROS controversy in hypoxic pulmonary hypertension revisited. Eur Respir J 2018, 51.\u003c/li\u003e\n\u003cli\u003eXu Z, Rothstein SJ: ROS-Induced anthocyanin production provides feedback protection by scavenging ROS and maintaining photosynthetic capacity in Arabidopsis. Plant Signal Behav 2018, 13:e1451708.\u003c/li\u003e\n\u003cli\u003eZuo L, Chuang CC, Clark AD, Garrison DE, Kuhlman JL, Sypert DC: Reactive Oxygen Species in COPD-Related Vascular Remodeling. Adv Exp Med Biol 2017, 967:399-411.\u003c/li\u003e\n\u003cli\u003eJaitovich A, Jourd'heuil D: A Brief Overview of Nitric Oxide and Reactive Oxygen Species Signaling in Hypoxia-Induced Pulmonary Hypertension. Adv Exp Med Biol 2017, 967:71-81.\u003c/li\u003e\n\u003cli\u003eRoberto D, Micucci P, Sebastian T, Graciela F, Anesini C: Antioxidant activity of limonene on normal murine lymphocytes: relation to H2O2 modulation and cell proliferation. Basic Clin Pharmacol Toxicol 2010, 106:38-44.\u003c/li\u003e\n\u003cli\u003eHwang JW, Kim EK, Lee SJ, Kim YS, Moon SH, Jeon BT, Sung SH, Kim ET, Park PJ: Antioxidant activity and protective effect of anthocyanin oligomers on H(2)O(2)-triggered G2/M arrest in retinal cells. J Agric Food Chem 2012, 60:4282-4288.\u003c/li\u003e\n\u003cli\u003eLo YC, Lin YC, Huang YF, Hsieh CP, Wu CC, Chang IL, Chen CL, Cheng CH, Chen HY: Carnosol-Induced ROS Inhibits Cell Viability of Human Osteosarcoma by Apoptosis and Autophagy. Am J Chin Med 2017, 45:1761-1772.\u003c/li\u003e\n\u003cli\u003eCosta RM, Filgueira FP, Tostes RC, Carvalho MH, Akamine EH, Lobato NS: H2O2 generated from mitochondrial electron transport chain in thoracic perivascular adipose tissue is crucial for modulation of vascular smooth muscle contraction. Vascul Pharmacol 2016, 84:28-37.\u003c/li\u003e\n\u003cli\u003eLi Z, Fang F, Xu F: Effects of different states of oxidative stress on fetal rat alveolar type II epithelial cells in vitro and ROSinduced changes in Wnt signaling pathway expression. Mol Med Rep 2013, 7:1528-1532.\u003c/li\u003e\n\u003cli\u003eSigaud S, Evelson P, Gonzalez-Flecha B: H2O2-induced proliferation of primary alveolar epithelial cells is mediated by MAP kinases. Antioxid Redox Signal 2005, 7:6-13.\u003c/li\u003e\n\u003cli\u003eWang YX, Liu ML, Zhang B, Fu EQ, Li ZC: Fasudil alleviated hypoxia-induced pulmonary hypertension by stabilizing the expression of angiotensin-(1-7) in rats. Eur Rev Med Pharmacol Sci 2016, 20:3304-3312.\u003c/li\u003e\n\u003cli\u003eTakano M, Nagahiro M, Yumoto R: Transport Mechanism of Nicotine in Primary Cultured Alveolar Epithelial Cells. J Pharm Sci 2016, 105:982-988.\u003c/li\u003e\n\u003cli\u003eWang J, Dong MQ, Liu ML, Xu DQ, Luo Y, Zhang B, Liu LL, Xu M, Zhao PT, Gao YQ, Li ZC: Tanshinone IIA modulates pulmonary vascular response to agonist and hypoxia primarily via inhibiting Ca2+ influx and release in normal and hypoxic pulmonary hypertension rats. Eur J Pharmacol 2010, 640:129-138.\u003c/li\u003e\n\u003cli\u003eHauge A: Hypoxia and pulmonary vascular resistance. The relative effects of pulmonary arterial and alveolar PO2. Acta Physiol Scand 1969, 76:121-130.\u003c/li\u003e\n\u003cli\u003eLourenco AP, Fontoura D, Henriques-Coelho T, Leite-Moreira AF: Current pathophysiological concepts and management of pulmonary hypertension. Int J Cardiol 2012, 155:350-361.\u003c/li\u003e\n\u003cli\u003eSong T, Zheng YM, Wang YX: Cross Talk Between Mitochondrial Reactive Oxygen Species and Sarcoplasmic Reticulum Calcium in Pulmonary Arterial Smooth Muscle Cells. Adv Exp Med Biol 2017, 967:289-298.\u003c/li\u003e\n\u003cli\u003eMcCord JM, Fridovich I: Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J Biol Chem 1969, 244:6049-6055.\u003c/li\u003e\n\u003cli\u003eMasri FA, Comhair SA, Dostanic-Larson I, Kaneko FT, Dweik RA, Arroliga AC, Erzurum SC: Deficiency of lung antioxidants in idiopathic pulmonary arterial hypertension. Clin Transl Sci 2008, 1:99-106.\u003c/li\u003e\n\u003cli\u003eNozik-Grayck E, Woods C, Stearman RS, Venkataraman S, Ferguson BS, Swain K, Bowler RP, Geraci MW, Ihida-Stansbury K, Stenmark KR, et al: Histone deacetylation contributes to low extracellular superoxide dismutase expression in human idiopathic pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol 2016, 311:L124-134.\u003c/li\u003e\n\u003cli\u003eHirobe T, Shibata T, Sato K: Human fibroblasts treated with hydrogen peroxide stimulate human melanoblast proliferation and melanocyte differentiation, but inhibit melanocyte proliferation in serum-free co-culture system. J Dermatol Sci 2016, 84:282-295.\u003c/li\u003e\n\u003cli\u003ePark WH: Exogenous H2O2 induces growth inhibition and cell death of human pulmonary artery smooth muscle cells via glutathione depletion. Mol Med Rep 2016, 14:936-942.\u003c/li\u003e\n\u003cli\u003ePorter KM, Kang BY, Adesina SE, Murphy TC, Hart CM, Sutliff RL: Chronic hypoxia promotes pulmonary artery endothelial cell proliferation through H2O2-induced 5-lipoxygenase. PLoS One 2014, 9:e98532.\u003c/li\u003e\n\u003cli\u003eJin N, Rhoades RA: Activation of tyrosine kinases in H2O2-induced contraction in pulmonary artery. Am J Physiol 1997, 272:H2686-2692.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"respiratory-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rere","sideBox":"Learn more about [Respiratory Research](http://respiratory-research.biomedcentral.com/)","snPcode":"12931","submissionUrl":"https://submission.nature.com/new-submission/12931/3","title":"Respiratory Research","twitterHandle":"@RespiratoryBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"alveolar epithelial cells, hypoxic pulmonary hypertension, pulmonary vascular remodeling and constriction, reactive oxygen species","lastPublishedDoi":"10.21203/rs.3.rs-129956/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-129956/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Hypoxic pulmonary hypertension (HPH) is a common type of pulmonary hypertension. Alveolar epithelial cells (AECs) are the first to perceive hypoxia of alveolar, however, the role of AECs in HPH remain unclear. HPH is characterized by pulmonary vascular remodeling and constriction. The present study was to whether AECs was involved in pulmonary vascular remodeling and constriction.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e Rat HPH models were built and pulmonary artery smooth cells (PASMCs) and AECs were treatment with hypoxia. Hemodynamic and morphological indicators were measured in samples from rat HPH models. Superoxide dismutase 2 (SOD2), catalase (CAT) and reactive oxygen species (ROS) were detected in AECs or AECs culture medium. To find out the effect of AECs on pulmonary vascular remodeling and constriction, AECs and PASMCs were co-cultured under hypoxia, PASMCs and isolated pulmonary artery (PA) were treatment with AECs hypoxic culture medium. To explore the mechanism of AECs on pulmonary vascular remodeling and constriction, ROS inhibitor N-acetylcysteine (NAC) was used.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e In vivo, hypoxia resulted in elevation in pulmonary vascular remodeling and pressure, but had no effect on non-pulmonary vascular. In vitro, hypoxia caused an imbalance of superoxide dismutase 2 (SOD2) and catalase (CAT) and an increase of reactive oxygen species (ROS) in AECs, as well as an increase of hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) in AECs culture medium. Also, AECs led to pulmonary artery smooth cells (PASMCs) proliferation under hypoxia by co-culture or substituting culture medium. AECs hypoxic culture medium enhanced the constriction of isolated pulmonary artery (PA). Further, these responses were abrogated by ROS inhibitor N-acetylcysteine (NAC). \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e The findings of present study demonstrated that AECs involved in pulmonary vascular remodeling and constriction under hypoxia by secreting H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2 \u003c/sub\u003eto the pulmonary microenvironment.\u003c/p\u003e","manuscriptTitle":"Alveolar Epithelial Cells Involved in Pulmonary Vascular Remodeling and Constriction of Hypoxic Pulmonary Hypertension","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-12-18 16:48:17","doi":"10.21203/rs.3.rs-129956/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-01-10T00:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-01-07T00:00:00+00:00","index":3,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorInvitedReview","content":"","date":"2020-12-28T00:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorInvitedReview","content":"","date":"2020-12-27T00:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewerAgreed","content":"","date":"2020-12-23T00:00:00+00:00","index":3,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-12-21T01:00:00+00:00","index":2,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-12-21T00:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-12-21T00:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2020-12-15T00:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-12-14T23:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-12-14T23:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-12-11T00:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"respiratory-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rere","sideBox":"Learn more about [Respiratory Research](http://respiratory-research.biomedcentral.com/)","snPcode":"12931","submissionUrl":"https://submission.nature.com/new-submission/12931/3","title":"Respiratory Research","twitterHandle":"@RespiratoryBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2d378ba3-3aaf-414d-a4b9-58c67bf4abb2","owner":[],"postedDate":"December 18th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":1538737,"name":"Pulmonology"}],"tags":[],"updatedAt":"2021-06-13T22:40:32+00:00","versionOfRecord":[],"versionCreatedAt":"2020-12-18 16:48:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-129956","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-129956","identity":"rs-129956","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}