Oral Delivery of dsRNA Targeting a Female-Biased Flight Muscle Actin Impairs Flight in the Malaria Vector, Anopheles Albimanus. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Oral Delivery of dsRNA Targeting a Female-Biased Flight Muscle Actin Impairs Flight in the Malaria Vector, Anopheles Albimanus. Claudia Paiz-Reyes, Mabel L. Taracena, Pamela Flores-Ayuso, Catherine Hunt, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-114640/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Despite the progress to eliminate malaria in Central America, focalized transmission persists, and insecticide resistance is on the rise in the primary vector, Anopheles albimanus . Many of the new control methods being developed depend on the release of a large number of male mosquitoes that must be sorted prior to release. However, An. albimanus manual pupal-sex-sorting is not feasible, and therefore, we explored the use of RNA interference (RNAi) targeting genes with a sex-biased expression for female elimination. Here, we evaluated the effect of feeding larvae with dsRNA for a female-biased orthologue of the flight muscle actin gene. Results Two sex-biased actin forms were identified in An. albimanus . Gene expression analysis showed a >40-fold higher expression of the AALB015469 transcript in female pupae (p = 0.0048) and adults (p = 0.0078) when compared to males. Tissue-specific analysis also suggests this female-biased actin can be an orthologue of the flight muscle actin of Aedes aegypti . At the same time, the AALB015481 transcript showed a >40-fold higher expression in male pupae and adults when compared to females, with no detectable expression in flight muscle. The potential effects of oral-induced RNAi for the female-biased actin were evaluated. Larvae were fed a diet containing either dsRNA for the female-biased actin 3'-UTR alone or for the UTR with an adjoining portion of the C-terminal coding region. A significant number of flightless females resulted from feedings with 3' UTR alone (10.50 ± 5.92 %, p < 0.05) or with the coding region (6.00 ± 2.16 %, p < 0.01). Treatment with the 3' UTR alone resulted in a significant number of flightless males (8.25 ± 3.10 %, p < 0.01). Both diets produced significant mortality in both female and male adults (p < 0.0001). Conclusions Feeding of An. albimanus larvae with dsRNA targeting the female-biased flight muscle actin orthologue impairs flight in both sexes and affects the overall survival of female and male mosquitoes. Providing dsRNA in the larval diet shows promise as a method for screening other differentially expressed genes as potential targets for female elimination in mosquito breeding facilities. Parasitology female-biased actin flight RNA interference flightless Anopheles albimanus Sterile Insect Technique Figures Figure 1 Figure 1 Figure 2 Figure 2 Figure 3 Figure 3 Background Malaria is a parasitic disease that affects millions of people worldwide. It is caused by Plasmodium parasites, and it is transmitted by the bite of female Anopheles mosquitoes. In the Mesoamerican region, northern South America and the Caribbean, An. albimanus is one of the main vectors of the disease ( 1 – 4 ). The incidence of malaria in this region decreased 20% between 2010 and 2014, but it has been increasing since then ( 5 ). Indoor residual spraying (IRS) and the use of insecticide-treated mosquito nets (ITN) have been effective in reducing the vector population ( 6 ), but new vector control strategies are needed as insecticide resistance is widespread ( 7 – 12 ). New potential vector control strategies using genetically modified or sterile mosquitoes are being considered to overcome this problem. However, these strategies depend upon the release of large numbers of males, and therefore separating males from females before releasing the mosquitoes to the field is imperative ( 13 , 14 ). The methodologies for sex-sorting and ultimately sex-separation of mosquitoes vary greatly and depend on the sexual dimorphisms of each species ( 15 ). For many years, the efforts to develop sex-separation methods have been limited by the difficulty to scale up the technologies, and the complexity of building functional genetic systems ( 16 ). Previous research with transgenes in Ae. aegypti to obtain flightless females ( 17 ) has opened the consideration of such approaches as a genetic sexing tool in mosquitoes. In this strategy, one of the four actin genes found in Ae. aegypti , actin - 4 , was found to be essential for female flight. This and other studies in model organisms, such as Drosophila melanogaster , have shown that the identification of the specific functions of particular actin genes in each species can be complex, as they are highly conserved and can show more than 90% similarity between isoforms ( 18 – 23 ). AeAct-4 and a similar orthologue have been reported as a female-biased gene in adults of Ae. aegypti and Anopheles stephensi ( 24 , 25 ). Interruption of the promoter of this gene has been used to produce flightless females using the Release of Insects carrying a Dominant Lethal (RIDL) technology ( 16 , 24 – 26 ). The last decade has seen staggering progress in the creation of genetic tools for mosquito studies, with major breakthroughs in genetic analysis derived from the development of germline transformation and RNA interference (RNAi) (reviewed by Adolfi and Lycett ( 29 )). RNAi could provide a viable and inexpensive technology ( 30 – 33 ) to knock down the expression of sex-biased genes ( 30 , 34 , 35 ) for sex-sorting and sex-separation in Anopheles . RNAi is part of the natural cellular defense systems that insects have against viruses ( 36 ). It is triggered by double-stranded RNA (dsRNA), and therefore its response is sequence-specific ( 37 ). When exogenous dsRNA is delivered to the cells, mRNA complementary to the dsRNA is cleaved and degraded, effectively silencing the gene expression of the target gene ( 38 ). The method has been used successfully to silence a wide variety of genes in insects, mostly for reverse genetic studies (reviewed by Huvenne & Smagghe in 2010 and updated by Jin et al. in 2020 ( 32 , 33 )). Currently, several pest-control and vector-control strategies based on RNAi are being proposed. In most of these strategies, the delivery of the dsRNA is the crucial most challenging part of the method development, and several delivery methods have been proposed for mosquitoes. Encapsulation of the dsRNA in chitosan, agarose, yeast, and bacteria have been evaluated for oral delivery to mosquito larvae, all with various degrees of success ( 30 , 35 , 39 – 41 ). To our knowledge, to date there have been no reports of RNAi experiments in An. albimanus , and one of the main goals of this work, is to set grounds for more reverse genetic studies in this species. Additionally, in the recent annotation of the genome of An. albimanus ( 42 ), the muscle actins were not characterized. Thus, the second aim of this study was to search for a sex-biased actin in An. albimanus and to determine the viability of using RNAi to silence it to obtain flightless phenotypes, similar to Ae. aegypti. Results Primary identification of sex-biased actins Due to conservation in their coding regions, actin genes can be distinguished by differences in their unique 3'-UTR sequences ( 25 ). Using 3'-UTR analysis, we found several actins expressed during the larval (Additional File 1), pupal, and adult stages (Fig. 1 a). 3' Rapid amplification of cDNA ends (3'-RACE) resulted in a fragment of 600 bp that showed higher expression in females than males, here designated as female-biased actin. Conversely, a 500 bp fragment showed higher expression in males and designated as male-biased actin. The other putative actin genes (~ 700 and ~ 900 bp), although expressed in both male and female pupae and adults, were not studied further in this study. Both PCR products (500 bp and 600 bp) represent different 3'-UTR sequences preceded by a highly conserved coding region. Each sex-biased UTR was identical in pupae and adults. VectorBase nucleotide BLAST of the sequences of each product confirmed they are different actin genes located on different chromosomes. VectorBase BLAST showed 99.6% identity between the An. albimanus Sanarate strain female-biased actin and the An. albimanus Stecla strain AALB015489 gene transcript within the 3R chromosome (Fig. 1 b, 1 c). A BLAST search with other anophelines and aedines showed a coding region plus 3'-UTR conservation only in the new world anopheline, An. darlingi Coari strain in 86.5% (Additional File 2). A homologue search of AALB015489 transcript within VectorBase showed 98.94% similarity with the Ae. aegypti flight muscle actin ( actin-4 ). BLAST analysis of the male-biased actin showed a 99.3% identity between the An. albimanus Sanarate strain and the An. albimanus Stecla strain AALB015481 gene transcript within the 2R chromosome (Fig. 1 c). VectorBase homologue search of this transcript showed 100% similarity with several genes annotated as actins of several anopheline mosquitoes and 98.4% identity with Ae. Aegypti actin-3 (Fig. 1 b). Spatiotemporal analysis of the sex-biased actins expression Quantitative Real-Time PCR (qPCR) analysis showed that the female-biased actin (AALB015489) was expressed > 40-fold higher in female pupae (p = 0.0048) and female adults (p = 0.0078),compared to males of the same stages, and remained low in the larval stages (Fig. 2 a).Expression was detected in flight muscle, and to a lesser extent, in ovaries, abdomen, and gut (Fig. 2 b). qPCR showed that the male-biased actin (AALB015481) was expressed > 90-fold higher in male adults (p = 0.0103) than in female adults and remained low in the larval stages (Fig. 2 a). In addition, expression was detected in the male abdomen, midgut and reproductive tissues, but not in the flight muscle (Additional File 3). Feeding female-biased actin dsRNA affects flight and survival in both sexes RNAi experiments were performed to determine if the female-biased actin was implicated in the flight of An. albimanus . We fed larvae with a dsRNA fragment that contains the 3'UTR sequence only (designated as Actin A) and another fragment that contains the carboxy-terminal coding region with its 3'UTR sequence (designated as Actin B). Some of the adults from both groups presented a flightless phenotype (Fig. 3 , Additional File 4). A significant effect was observed on the flight in both sexes of adults emerging from larvae fed with 3'UTR dsRNA (Actin A), with approximately 10% females (10.50 ± 5.92%, Student's t, p < 0.05) and 8% males (8.25 ± 3.10%, Student's t, p < 0.01) unable to fly one day after emergence. With Actin B (3'UTR plus the C-terminal coding region), the percentage of flightless mosquitoes (6.00 ± 2.16%, Student's t, p < 0.01) observed was significantly different from controls (fed the ANT dsRNA) only in females. Survival was affected considerably in both females and males fed with Actin A or Actin B (Log-rank test, p < 0.0001). To verify the association of the flightless phenotype with gene expression, transcript levels of the female-biased actin were measured in pupae. Our results showed a measurable decrease in the mRNA expression, but due to sample size and deviation, no statistically significant reduction was obtained (Additional File 5). Discussion Current insecticide-based control methods, such as IRS and ITNs, are threatened by increasing insecticide resistance in malaria vectors. The design of novel vector control strategies is a pressing need to alleviate or eliminate the burden of vector-transmitted diseases, particularly in developing countries where most vulnerable populations have limited access to medical services ( 43 ). Innovation is limited in regions where local vector species are not actively studied. As a vector with a geographical distribution limited to the Meso-American region, Caribbean and northern South America ( 2 – 4 ), research on An. albimanus has been limited compared to other malaria vectors such as Anopheles gambiae . The genome of An. albimanus was sequenced as part of the 16 Anopheles Genomes Project ( 42 ), and published only in 2015, more than ten years after the An. gambiae genome ( 44 ). Given the divergence of the neotropical anopheline species from their African counterparts, the importance of the study of this species' genome cannot be overstated, and more transcriptomic studies, such as the comparative transcriptomic study by Papa et al, 2017 ( 45 ), are needed. Using the current version of the An. albimanus genome (Vectobase Gene Set AAlbS2.6), we found an orthologue of the Ae. aegypti female-biased flight muscle actin gene ( actin-4 ) and determined that the An. albimanus form also had higher expression in female pupae and adults as compared to males. Given the high similarity between coding regions of different actin genes or actin isoforms within an organism, we confirmed the previous expression analysis of the An. albimanus sex-biased actin genes by the use of the highly divergent 3' UTR and qPCR to complement the RNA-seq available data ( 45 ), as short RNA-seq reads within coding region of homologous genes could be mapped to multiple locations ( 46 ). Females and males have different morphological, behavioral and physiological characteristics, many of which can arise from sex-biased gene expression ( 45 ). We confirmed that this actin gene is involved in flight in both sexes after obtaining flightless phenotypes upon oral delivery of the actin 3' UTR dsRNA. However, feeding dsRNA for this actin gene accelerated mortality in males three weeks after emergence, suggesting that even the low expression levels that were detected in this sex, are essential for flight or other biological processes that we did not characterize. As the flightless phenotype only occurred in a limited sub-section of the treated groups, further analysis will be needed to identify the factors that made these mosquitoes more susceptible to the treatment or why the RNAi effect was more pronounced in those individuals. The low frequency of the phenotype may also be related to the efficiency of delivery RNAi for this target gene. Given that the targeted actin gene in An. albimanus is expressed in the flight muscle; the dsRNA delivered in the midgut has to travel a significant distance to reach the target cells. Marked differences in the stability and production of short interfering RNAs after dsRNA oral delivery occur among insect species ( 50 ). Different tissues are also differentially susceptible to RNAi in various insects, as reviewed by Wynant et al, 2014 ( 51 ). Finally, the dose and the construct size can also produce different effects, sometimes with a saturation effect due to high doses (reviewed by Joga et al, 2016 ( 52 )). Despite the high variability in RNAi efficiency across insect species and target genes, dsRNA produced in bacteria or yeast has a high potential as heat-killed mosquito larvicide, as recently reviewed by Wiltshire and Duman-Scheel ( 53 ). We believe that, to obtain higher percentages of individuals with the phenotype, several parameters in the delivery system must be optimized ( 30 , 54 , 55 ). In our experiments, we designed enough negative controls for the delivery system (Additional File 6), to allow us to rule out an association of the phenotype with the method rather than with the specific RNAi for actin. When appropriate genes are available, positive controls will be useful to help optimize the feeding parameters, and further research to identify such genes in An. albimanus should be done. The partial and short-lived effect on both sexes may also be due to non-specific degradation in the gut, to variability in the doses ingested by individuals and/or possible compensation with other actin isoforms ( 56 – 59 ). Additionally, functional studies using RNAi injections could determine if higher concentrations of the dsRNA and crossing tissue barriers can effectively induce a longer lasting flightless phenotype. Sex-biased genes can arise via gene duplication, in which the parental copy of the gene may remain unchanged, whereas the new copy may present sex-biased expression ( 47 ). A sex-biased expression can vary during different times of development and between tissues ( 48 , 49 ). Given that the expression of the flight muscle actin begins during the larval stages, we fed larvae heat-inactivated bacterial lysates with isoform-specific dsRNA produced by E. coli HT115(DE3), starting at the L2 stage until pupation. We saw a flightless phenotype in both female and male adults; however, the phenotype was observed only in around 10% of individuals of either sex. We did not detect a significant effect on gene expression in pupae, possibly because of the low frequency of the flightless phenotype and a dilution from pooling individuals for therelative expression analysis. Our results indicate that the female-biased actin gene is involved in flight in both sexes and silencing of this gene resulted in the reduced female and male survival. In Drosophila , mutations in the jumping muscle actin gene can be compensated by a low level expression of the flight muscle actin, although there is no evidence of actin compensation in the flight muscle ( 39 ). Mosquitoes may require sex-biased flight muscle actin due to different flight requirements for each sex. After a blood meal, females can double or triple their total weight and they must carry this additional weight until the blood meal is processed ( 60 ). This extra weight requires that the mosquitoes exert additional aerodynamic forces generated by beating wings to take off; these aerodynamic forces are generated by indirect flight power muscles ( 61 ). Furthermore, differences in wing beat frequencies exist between males and females during the swarming and mating process that may require a different pattern of expression of actin in thoracic muscles ( 62 ). Altogether, our results show for the first time that there is a female-biased, sexually-differentiated expression of the flight muscle orthologous actin gene in An. albimanus , and that it is possible to target this gene through oral mediated RNAi using its 3' UTR sequence, affecting flight in both sexes. We recently showed in An. gambiae that oral delivery of dsRNA for a female-specific doublesex gene could skew sex ratios towards males ( 35 ). Development of an efficient means of separating the sexes by targeting other sex-biased genes could provide new tools for female removal in genetic-based strategies to improve vector-control strategies in the region. Conclusion We isolated a female-biased flight muscle actin gene from pupae and adults of An. albimanus that is implicated in the flight and survival of both females and males. Future studies will characterize other sex-biased genes as potential targets for An. albimanus control strategies. Methods Mosquito rearing : Two strains of An. albimanus were used for this work: 1) An. albimanus Sanarate strain (Biosamples ID: SAMN10341946) ( 8 ), was used for gene characterization and quantification of basal gene expression. Rearing of this strain took place at the Universidad del Valle de Guatemala (UVG). Insectary conditions were 28 °C +/- 1 °C and relative humidity of 80% +/- 10%, with a photoperiod of 12:12 light-dark cycle. Colony larvae were fed daily a mixture of baby food Nestum® 5 cereals (Nestlé) and active yeast. Adults were fed ad libitum on a 10% sugar solution in sterile water and females were fed commercially available defibrinated sheep blood (Actividades Lucrativas, Guatemala, Guatemala) via a membrane feeder (Hemotek, United Kingdom) covered with Parafilm. 2) An. albimanus Santa Tecla (Stecla) strain (MRA-112 BioDefense Emerging Infections (BEI), Malaria Research and Reference Reagent Resource Center (MR4), Centers for Disease Control and Prevention (CDC), Atlanta, Georgia, USA) was used for RNAi experiments. Rearing conditions at the CDC were 27 °C, relative humidity of 80%, and a photoperiod of 12:12 light-dark cycle with a 30-minute dawn and dusk period. Colony larvae were fed Damien's diet ( 63 ) according to the MR4 rearing protocol ( 64 ). Adults were fed ad libitum on a 10% sugar solution with 0.2% methylparaben dissolved in sterile water, and females were fed commercially available defibrinated rabbit blood (Hemostat, Dixon, CA, USA) via a Parafilm covered glass feeding bell (Lily, Atlanta, GA, USA). RNA extraction : For 3' RACE and PCR evaluation of the sex-biased actins expression, we extracted RNA from pools of: 1) 15 one-day-old virgin females, 2) 15 one-day-old virgin males, 3) five female pupae, 4) five male pupae, 5) seven L4 larvae, and 6) 40 L3 larvae of An. albimanus strain Sanarate. The number of individuals per pool was selected based on previous normalizations of RNA obtained per wet body weight. The extractions were performed using the SV total RNA isolation system kit (Promega, WI, USA), following the manufacturer's protocol. Briefly, mosquitoes were homogenized using a pellet pestle cordless motor and sterile pestles in 175 µl of lysis buffer and incubated in a cold rack for 20 min. 350 µl of RNA dilution buffer was added and mixed by inversion. This lysate was centrifuged at 13,000 rpm, 10 min at room temperature, the supernatant was removed and mixed with 200 µl 95% ethanol, transferred to spin column and centrifuged at 13,000 rpm for 1 min. The column was washed with 600 µl of RNA wash solution, and the sample was treated with DNAse incubation mix for 30 min, followed by the addition of 200 µl stop solution. The column was centrifuged at the same conditions as before and washed twice with RNA wash solution. RNA was eluted with 100 µl of RNase free water. For the evaluation of female-biased actin expression in several adult tissues, two pools of five individuals per biological replica (n = 3) were dissected in ice-cold PBS. RNA extractions were performed using the RNeasy Micro kit (Qiagen, MD, USA) according to the manufacturer's protocol. For cloning of the female-biased actin, RNA was extracted from a pool of eight adult female mosquitoes and five female pupae of An. albimanus Stecla strain using the RNeasy Mini Kit according to manufacturer´s protocol (Qiagen, MD, USA). Briefly, samples were homogenized using a pellet pestle cordless motor and sterile pestles in 350 µl of RLT buffer. After centrifugation, one volume of 70% ethanol was added to the lysate and transferred to the RNeasy Mini spin column. Two consecutive washes with 700 µl of RW1 buffer and one with 500 µl of RPE buffer were done before resuspending the RNA in 30 µl of RNase-free water. Quantification of RNA was done with a Nanodrop OneC (Thermo Fisher, MA, USA) and 1 µg of RNA was treated with 1.5 units of RQ1 DNase (Promega, WI, USA) for 1 h at 37 °C, followed by inactivation for 10 min at 65 °C. 3' Rapid amplification of cDNA ends (RACE) : We performed 3' RACE with the kit 3' RACE System for Rapid Amplification of cDNA Ends (Invitrogen, MA, USA). One µg of total RNA was used to generate the cDNA by the manufacturer's instructions. Then 1 µl of this cDNA was used to amplify the 3' UTR region using 0.4 µM of actin primer FMActRace_1F (5'- CGATCAAGATCAAGATCATTGCC-3') and 0.4 µM of UAP primer provided by the manufacturer in a 25 µl reaction using the GoTaq Hot Start colorless Master Mix (Promega). We performed the amplification as follows: 95 °C for 2 min, 30 cycles of 95 °C for 30 s, 61 °C for 30 s and 72 °C-1 min and a final extension of 72 °C for 5 min. We gel pricked the 600 bp and 500 bp bands that showed differential expression in females and males and amplified using the same conditions described earlier, with the only modification that 20 cycles of amplification were used. Both fragments were ligated to the pGEM-T easy vector (Promega) and transformed it into E. coli XL-1 blue. Clones of each fragment were sequenced and the sequences used to design female-biased and male-biased actin specific primers within the 3' UTR. Sex-biased actin expression : Quantitative PCR was done to assess the expression level of the sex-biased actins during the life cycle and in the different tissues of the adults of An. albimanus mosquitoes. RNA extraction was performed as previously described. The cDNA was generated from 1 µg of total RNA using the GoScript Reverse Transcription Kit with a mixture of Random primers plus oligo(dT) (Promega) as per manufacturer's instructions. The following primers were used: qPCRfemaleUTR_2F (5´-GACATCCAATCACTACATCC-3´) and qPCRfemaleUTR_2R (5´-CAAAGGCAAACACAGCTAAC-3´) for the female-biased actin, and qPCR_Male3UTR_1F (5´-CCAACATCAACACCAACTTC-3´) and qPCR_Male3UTR_1R (5´-GTCGAAGAAGATTTGCACAG-3´) for the male-biased actin amplification. The RpS4 (AALB005332) and RpL49 (AALB008968) reference genes were amplified with the following primers: qPCR_RpS4_1F (5'-AGGTGATGGAGGTGCTGAAG-3´) with qPCR_RpS4_1R (5'- CGATGATGAACACGTTGGAG-3') and qPCR_RpL49_1F (5'-AGGGTGGAAGGTGATATCTG-3') with qPCR_RpL49_1R (5'- ACATGGTCGCCCTTAAATG-3'). To measure expression in each biological replicate of the different life-stages, qPCR was carried out with Power Up SYBR green master mix (Thermo Fisher) with 0.33 µM of each primer and 2.5 µl of cDNA diluted at 1:500 in a final volume of 10 µl. All samples were run in technical triplicates. Genes were amplified in the Lightcycler 96 (Roche, Switzerland) thermal cycler as follows: 50 °C for 60 s and 95 °C for 120 s, followed by 50 cycles of: 95 °C for 15 s and 60 °C for 60 s. Melting curves of 95 °C for 15 s, 60 °C for 60 s and 95 °C for 16 s were done after each run. Delta cycle threshold (∆Ct) method was performed using the average Cts of both Rps4 and Rps49 reference genes and performing the comparison of the relative expression to the L3 stage. Samples were analyzed using ANOVA test with Tukey's comparisons. To measure expression in each biological replicate of the different tissues, qPCR was prepared as before with the difference that the cDNA was diluted at 1:20. All samples were run in technical duplicate. PCR was run in a Quant Studio 6 (Applied Biosystems, CA, USA) thermal cycler as follow: 50 °C for 2 min, 95 °C for 10 min, and 50 cycles of 95 °C for 15 s and 60 °C for 60 s. Melting curves of 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 sec were done for each run. Delta-delta Ct (∆∆Ct) analysis was performed using the average of Cts of both Ribosomal protein S7 (Rps7) and Actin housekeeping HK reference genes for analysis of transcript levels of pupa that receive actin A dsRNA and Rps7 only for pupae that were fed with Actin B and compared to pupae fed dsRNA of the ant gene as a control. Female-biased actin cloning : Primers for two dsRNA were designed based on the sequenced regions. For 3´-UTR: AaACT3UTR_F: (5´-GCACAAATGATGGTGGCTAAAG-3´) and AaACT3UTR_R_T7: (5´- TAATACGACTCACTATAGGG CTCAAAGGCAAACACAGCTAAC-3´) (designated Actin A) and for coding region plus 3´-UTR: FMActRace_1F and AaACT3UTR_R_T7 (designated Actin B). The T7 promoter of the pGEM-T Easy vector and the T7 added in the reverse primers (underlined) were used to produce both strands of the dsRNA. Complementary DNA was produced using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) with a mixture of random primers and oligo(dT). Conventional PCRs were performed with 0.4 µM of each primer and the AccuStart™ II GelTrack™ PCR SuperMix (Quantabio, MA, USA), using a 1:5 dilution of cDNA from female and male pupae and adults of An. albimanus as a template to corroborate the expression and the following program: 94 °C for 3 min, 30 cycles of 94 °C for 45 sec, 61 °C for 30 sec, and 72 °C for 30 sec, followed by a last step at 72 °C for 5 min. The obtained fragments were cloned into the pGEM-T-easy vector and then transformed into E. coli HT115 (DE3) for production of dsRNA. Transformation of E. coli HT115 (DE3) was performed as described by Timmons et al, 2001 ( 37 ). Preparation of dsRNA : Pricks of fresh bacteria colonies were used for inoculum of overnight cultures. The bacteria used were either E. coli HT115(DE3)-Actin (Actin A or B) and E. coli HT115(DE3)-Ant, a non-related gene from Arabidopsis thaliana (GenBank: U41339.1), which is an APETALA2-like gene with pleiotropic roles in ovule development and floral organ growth, that we had previously cloned into E. coli HT115 (DE3) for control( 65 )). Colonies from Luria-Bertani (LB) agar plates with tetracycline (12.5 µg/ml) and ampicillin (100 µg/ml) were used as inoculum for each starting culture (10 ml). An overnight incubation in LB broth with tetracycline (12.5 µg/ml) and ampicillin (100 µg/ml) was done at 37 °C and 170 rpm. This culture was diluted 15:100 with 2xYT medium plus both antibiotics (same concentration as before) and incubated at 37 °C at 170 rpm until they reached OD 600 = 0.4 (approximately 0.5 h). Once the culture reached OD 600 = 0.4, the dsRNA production was induced with the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG), 0.4 mM final concentration, and a two-hour incubation at the same conditions (3.35 × 10 7 – 4.02 × 10 7 CFU/ml). This culture was centrifuged for 10 min at 4,000 rpm and 10 °C, and the cell pellet was washed twice in one volume of sodium phosphate buffer (PBS) (Thermo Fisher) and later re-suspended in half the initial volume in PBS. The E. coli cells were heat-killed by placing the tube with the resuspended pellet in boiling water for 15 min. The resuspended inactivated cells were aliquoted and stored at -70 °C. dsRNA quantification We used 3 aliquots of 250 µl of the inactivated cells to extract and quantify dsRNA. We centrifuged each tube of cells at 3,700 x g for 10 min at 4 °C, removed the supernatant, resuspended the pellet with 50 µl of 1% SDS in PBS and boiled them for 2 min in a water bath. After 10 min at room temperature, 64 µl of RNAse buffer (300 mM sodium acetate, 10 mM Tris-HCl pH 7.5 and 5 mM EDTA) and 2 µg of RNase A (Sigma Aldrich, MO, USA) were added and the mixture incubated at 37 °C for 5 min to degrade single stranded RNA. We extracted the dsRNA with 750 µl of Trizol LS Reagent (Invitrogen, MA, USA) according to manufacturer instructions. The RNA pellet was resuspended in 20 µl of DEPC water and 1 µl of the suspension was quantified on a Nanodrop one C (Thermo Fisher). RNAi feeding experiments in larvae : Groups of 20 larvae (L2) of An. albimanus Stecla were set in individual 150 mm x 25 mm Petri dishes with 80 ml of water. Insectary conditions of temperature, humidity, and light were maintained as described in the mosquito rearing section. Feeding conditions were as following: an artificial bacterial diet (ABD), previously described by Taracena et al. 2019 ( 35 ), was added to the Petri dishes with the larvae, for a space of 4 h per day. Briefly, 200 µl of inactivated bacteria in PBS were complemented with 200 mg of a mixture of food (40% fish food (Goldfish, Tetra, Germany), 43% guar gum (Sigma-Aldrich) and 17% Active Yeast) and fed to each replica. After the 4 h, the dsRNA mixture was removed and we fed the larvae with conventional food (in this case, Baby 5 cereals Nestum® and active yeast). Negative controls for method validation were established in the following groups: 1) food without bacteria, 2) food with bacteria without plasmid for dsRNA production, 3) food with bacteria with a plasmid for the target dsRNA, but non induced, and 4) food with bacteria with non-related dsRNA. After the determination that no significant difference was observed amongst the negative controls (Additional File 6), the group of Ant-dsRNA was kept for reference in all experiments with actin genes. The larvae were fed daily with ABD until they reached pupation. Quantification of the dsRNA allowed to determine that the feedings were delivering an equivalent of approximately 5.75 µg of Ant-dsRNA, 11.90 µg for Actin A, and 9.0 µg for Actin B at the beginning of each feeding. Degradation of the dsRNA in the medium or inside the larvae was not measured. For each biological replicate (N = 80) we had four internal replicates, each with 20 larvae. Observed phenotypes were recorded for all experiments. T-test was performed in comparison to the control group for the flightless phenotype. The Log-Rank Mantel-Cox test was performed for survival curves in comparison to the control group. Expression analyses : Real-time expression analysis was done from 3 samples per group, each sample was composed of a pool of 3 male pupae or 3 female pupae. RNA extractions and cDNA synthesis were done as described in previous sections with the RNeasy Mini Kit (Qiagen) and High-Capacity cDNA Reverse transcription kit (Thermo Fischer). Actin housekeeping (HK) (AALB015483) and Ribosomal protein S7 (Rps7) (AALB010399) were used as reference genes and were amplified with the following primers: Actin F (5'-TACAACTCGATCATGAAGTGCGA-3´) and ActinR (5'-CCCGGGTACATGGTGGTACCGCCGGA-3´) and RpS7F (5'AGAACCAGCAGACCACCATC-3') and RpS7R (5'-ACAACCAGCAACGGTTATGT-3´). The q-RT PCR reaction was carried out with the Power Up SYBR green master mix (Thermo Fisher) with 0.33 µM of each primer and 5 µl of cDNA diluted at 1:500 in a final volume of 15 µl. All samples were run in technical triplicate. The genes were amplified as described previously for the tissue-specific qPCR. Delta-delta Ct (∆∆Ct) analysis was performed using the average of Cts of both Rps7 and Actin HK reference genes for analysis of transcript levels of pupae that received actin A dsRNA and Rps7 only for pupae that were fed with Actin B and compared to pupae fed dsRNA of the ant gene as a control. T-test was performed in comparison to the control group. Bioinformatics analysis A nucleotide BLAST search using the 500 bp or 600 bp fragment was performed using the VectorBase blast tool with default parameters ( 66 ), using the Aedes and Anopheles data sets. Clustal Muscle software was used to align the two actins with gene transcript accession numbers AALB015469-RA and AALB015489-RA ( An. albimanus Stecla Gene set AalbS2.6 in VectorBase). The female-biased sequence was aligned with A. darlingi Coari strain (Gene set AdarC3.8 from Vector Base) genomic scaffold_1503 using Clustal muscle software. A homologue search was done for the AALB015469 and AALB014489 genes within the VectorBase gene tab. Molecular phylogenetic analysis : Phylogenetic tree was built using the Maximum likelihood method based on the Tamura-Nei model ( 67 ). Analysis was done with cDNA sequences of the An. albimanus sex-biased actins, An. albimanus Stecla strain actins (Vector base: AALB015481 and AALB015469), Aedes aegypti flight muscle actin-4 (VectorBase: AAEL001951), muscle actin-1 (VectorBase: AAEL001928) and actin-3 (VectorBase: AAEL0094551); Anopheles gambiae actin-4 homolog (VectorBase: AGAP011515) and D. melanogaster flight actin 88F (Ensembl: FBtr0083143). An initial tree was obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. Analyses were conducted using the Mega 7.0.18 software ( 68 ). Data Analysis One-way ANOVA with Tukey's multiple comparisons, Student's t-tests, and Log-Rank Mantel-Cox test were performed with GraphPad Prism Software version 8.02 (Graphpad Software, CA, USAS). All significant values have a p-value of less than 0.05. Abbreviations 3'RACE: 3'Rapid amplification of cDNA ends ABD: Artificial bacterial diet ANOVA: Analysis of variance ANT: Aintegumenta gene bp: base pair CDC: Centers for Disease Control and Prevention cDNA: complementary DNA Ct: Cycle treshold dsRNA: double-stranded RNA EDTA: Ethylenediaminetetraacetic acid FA: female adult FP: female pupae HK: housekeeping IPTG: Isopropyl b-thiogalactopyranoside L3: third instar larva L4: fourth instar larva LB: Luria-Bertani broth MA: male adult MP: male pupae MR4: Malaria Research ad Reference Reagent Resource Center PBS: Sodium phosphate buffer PCR: Polymerase Chain Reaction qPCR: quantitative-Real Time PCR RNAi: RNA interference RNAse: Ribonuclease rpm: revolutions per minute SDS: Sodium dodecyl sulfate SIT: sterile insect technique Tris-HCl: Tris hydrochloride Declarations Ethics approval and consent to participate: Not applicable Consent for publication: Not applicable Availability of data and material: The data that support the findings of this study are available on request from the corresponding author on reasonable request [PP]. Competing interests: The authors declare that there are no competing interests. Funding: This research was funded by a program supported by a grant from the Good Ventures Foundation and the Open Philanthropy to the Centers for Disease Control Foundation to support cryopreservation and suppression of female development in Mosquitoes to Assist Research for Malaria, Open Philanthropy project, 2017 to Pamela Pennington and Ellen Dotson. This research project was also supported by International Atomic Energy Agency research contract no. 18786 to Pamela Pennington, as part of the Agency's Coordinated Research Project "Comparing Rearing Efficiency and Competitiveness of Sterile Male Strains Produced by Genetics, Transgenic or Symbiont-based Technologies" and from funds from Center for Biotechnology Studies and Center for Health Studies from Universidad del Valle de Guatemala. Authors' contributions CP, MT, PF, PP and ED developed the experiment design. CP, PF, MT, CH, KI, MM and AB performed biological assays and experiments. CP, MT and PP analyzed and interpreted experimental data. CP and MT wrote the manuscript. NP contributed with laboratory and insectary installations. PP, ED and NP made substantial contributions for data acquisition and data analysis and interpretation and revised the final manuscript. All authors read and approved the final manuscript. Acknowledgments This research project was supported by International Atomic Energy Agency research contract no. 18786 as part of the Agency's Coordinated Research Project "Comparing Rearing Efficiency and Competitiveness of Sterile Male Strains Produced by Genetics, Transgenic or Symbiont-based Technologies”. The authors would like to thank Jorge Sincal for his help in rearing the mosquitoes at the Universidad del Valle facilities. We thank the Center for Health Studies for providing An. albimanus Sanarate strain, insectary, and laboratory facilities. We would like to thank the staff and scientists with the Entomology Branch and the Division of Parasitic Diseases and Malaria for assistance in training for the laboratory work. All primers used in this work were provided by the Biotech Core facilities at CDC. The findings and conclusions in this manuscript are those of the authors and do not necessarily represent the official views of the CDC. References Zimmerman RH. Ecology of malaria vectors in the Americas and future direction. Mem Inst Oswaldo Cruz. 1992; 87 Suppl 3:371–83. Sinka ME, Bangs MJ, Manguin S, Rubio-Palis Y, Chareonviriyaphap T, Coetzee M, Mbogo CM, Hemingway J, Patil AP, Temperley WH, Gething PW, Kabaria CW, Burkot TR HR and HS. A global map of dominant malaria vectors. Parasit Vectors. 2012;5(1):69. Sinka ME, Rubio-Palis Y, Manguin S, Patil AP, Temperley W H, Gething P, Boeckel TV, Kabaria CW, Harbach RE HS. The dominant Anopheles vectors of human malaria in the Americas: occurrence data, distribution maps and bionomic précis. Parasit Vectors. 2010;3(1):72. Fuller DO, Ahumada ML, Quiñones ML, Herrera S, Beier JC. Near-present and future distribution of Anopheles albimanus in Mesoamerica and the Caribbean Basin modeled with climate and topographic data. Int J Health Geogr. 2012;11:13. Geneva: World Health Organization. World Malaria Report 2017. Vol. Licence: C. 2017. 1–163 p. Yang G-G, Kim D, Pham A, Paul CJ. A Meta-regression analysis of the effectiveness of mosquito nets for malaria control: the value of long-lasting insecticide nets. Int J Environ Res Public Health. 2018;15(546). Penilla PR, Rodríguez AD, Hemingway J, Torres JL, Arredondo-Jiménez JI, Rodríguez MH. Resistance management strategies in malaria vector mosquito control. Baseline data for a large-scale field trial against Anopheles albimanus in Mexico. Med Vet Entomol. 1998;12(3):217–33. Lol JC, Castellanos ME, Liebman KA, Lenhart A, Pennington PM, Padilla NR. Molecular evidence for historical presence of knock-down resistance in Anopheles albimanus , a key malaria vector in Latin America. Parasit Vectors. 2013;6:268. Brogdon WG, McAllister JC, Corwin AM, Cordon-Rosales C. Oxidase-based DDT–pyrethroid cross-resistance in Guatemalan Anopheles albimanus . Pestic Biochem Physiol. 1999;64(2):101–11. Penilla RP, Rodríguez AD, Hemingway J, Trejo A, López AD, Rodríguez MH. Cytochrome P450-based resistance mechanism and pyrethroid resistance in the field Anopheles albimanus resistance management trial. Pestic Biochem Physiol. 2007;89(2):111–7. Quiñones ML, Norris DE, Conn JE, Moreno M, Burkot TR, Bugoro H, et al. Insecticide resistance in areas under investigation by the International Centers of Excellence for Malaria Research: A challenge for malaria control and elimination. Am J Trop Med Hyg. 2015;93Suppl 3:69–78. Breeland SG, Kliewer JW, Austin JR, Miller CW. Observations on malathion-resistant adults of Anopheles albimanus Wiedemann in coastal El Salvador. Bull World Health Organ. 1970;43(4):627–31. Knipling EF. Possibilities of insect control or eradication through the use of sexually sterile males. J Econ Entomol. 1955;48(4):459–62. Alphey L, Benedict M, Bellini R, Clark GG, Dame DA, Service MW, et al. Sterile-insect methods for control of mosquito-borne diseases: an analysis. Vector Borne Zoonotic Dis. 2010;10(3):295–311. Papathanos PA, Bossin HC, Benedict MQ, Catteruccia F, Malcolm CA, Alphey L, et al. Sex separation strategies: Past experience and new approaches. Malar J. 2009; 8(SUPPL. 2). Papathanos PA, Bourtzis K, Tripet F, Bossin H, Virginio JF, Capurro ML, et al. A perspective on the need and current status of efficient sex separation methods for mosquito genetic control. Parasit Vectors. 2018;11(Suppl 2). Fu G, Lees RS, Nimmo D, Aw D, Jin L, Gray P, et al. Female-specific flightless phenotype for mosquito control. Proc Natl Acad Sci U S A. 2010;107(10):4550–4. Rubenstein PA. The functional importance of multiple actin isoforms. BioEssays;1990;12(7):309–15. Vyazunova I, Lan Q. Stage-specific expression of two actin genes in the yellow fever mosquito, Aedes aegypti . Insect Mol Biol. 2004;13(3):241–9. Fyrberg EA, Bond BJ, Hershey ND, Mixter KS, Davidson N. The actin genes of drosophila: Protein coding regions are highly conserved but intron positions are not. Cell. 1981;24(1):107–16. Fyrberg EA, Kindle KL, Davidson N, Sodja A. The actin genes of drosophila: a dispersed multigene family. Cell. 1980;19(2):365–78. Hiromi Y, Hotta Y. Actin gene mutations in Drosophila; heat shock activation in the indirect flight muscles. EMBO J. 1985; 4(7):1681–7. Hennessey ES, Drummond DR, Sparrow JC. Molecular genetics of actin function. Biochem J. 1993;291 ( Pt 3(Pt 3):657–71. Jiang X, Biedler JK, Qi Y, Hall AB, Tu Z. Complete dosage compensation in Anopheles stephensi and the evolution of sex-biased genes in mosquitoes. Genome Biol Evol. 2015;7(7):1914–24. Muñoz D, Jimenez A, Marinotti O, James a a. The AeAct-4 gene is expressed in the developing flight muscles of female Aedes aegypti . Insect Mol Biol. 2004;13(5):563–8. Marinotti O, Jasinskiene N, Fazekas A, Scaife S, Fu G, Mattingly ST, et al. Development of a population suppression strain of the human malaria vector mosquito, Anopheles stephensi . Malar J. 2013;12(1):142. Heinrich JC, Scott MJ. A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proc Natl Acad Sci. 2000;97(15):8229–32. Labbé GMC, Scaife S, Morgan SA, Curtis ZH, Alphey LL. Female-specific flightless (fsRIDL) phenotype for control of Aedes albopictus . McCall PJ, editor. PLoS Negl Trop Dis. 2012;6(7):e1724. Adolfi A, Lycett J. Opening the toolkit for genetic analysis and control of Anopheles mosquito vectors. Curr Opin. 2018;30:8–18. Whyard S, Erdelyan C, Partridge AL, Singh AD, Beebe NW, Capina R. Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs. Parasit Vectors. 2015;8(1):96. Whyard S, Singh AD, Wong S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem Mol Biol. 2009;39(11):824–32. Huvenne H, Smagghe G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. J Insect Physiol. 2010;56(3):227–35. Jin H, Patil BL, Vélez AM, Christiaens O, Whyard S, Smagghe G. Double-stranded RNA technology to control insect pests: Current status and challenges. 2020;11. Mysore K, Sun L, Tomchaney M, Sullivan G, Adams H, Piscoya AS, et al. siRNA-mediated silencing of doublesex during female development of the dengue vector mosquito Aedes aegypti . James AA, editor. PLoS Negl Trop Dis. 2015;9(11):1–21. Taracena ML, Hunt CM, Benedict MQ, Pennington PM, Dotson EM. Downregulation of female doublesex expression by oral-mediated RNA interference reduces number and fitness of Anopheles gambiae adult females. Parasites and Vectors. 2019;12:1–11. Gammon DB, Mello CC. RNA interference-mediated antiviral defense in insects. Curr Opin Insect Sci. 2015;8:111–20. Timmons L, Court DL, Fire A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans . Gene. 2001;263(1–2):103–12. Mello CC, Conte D. Revealing the world of RNA interference. Nature. 2004;431(7006):338–42. Zhang X, Mysore K, Flannery E, Michel K, Severson DW, Zhu KY, et al. Chitosan/interfering RNA nanoparticle mediated gene silencing in disease vector mosquito larvae. J Vis Exp. 2015;97. Hapairai LK, Mysore K, Chen Y, Harper EI, Scheel MP, Lesnik AM, et al. Lure-and-kill yeast interfering RNA larvicides targeting neural genes in the human disease vector mosquito Aedes aegypti . Sci Rep. 2017;7(1). Airs P, Bartholomay LC. RNA interference for mosquito and mosquito-borne disease control. Insects. 2017;8(4). Neafsey DE, Waterhouse RM, Abai MR, Aganezov SS, Alekseyev MA, Allen JE, et al. Mosquito genomics. Highly evolvable malaria vectors: the genomes of 16 Anopheles mosquitoes. Science. 2015;347(6217):1–20. McGraw EA, O'Neill SL. Beyond insecticides: New thinking on an ancient problem. Vol. 11, Nature Reviews Microbiology. 2013;181–93. Holt RA, Subramanian GM, Halpern A, Sutton GG, Charlab R, Nusskern DR, et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 2002;298(5591). 129-149. Papa F, Windbichler N, Waterhouse RM, Cagnetti A, D'Amato R, Persampieri T, et al. Rapid evolution of female-biased genes among four species of Anopheles malaria mosquitoes. Genome Res. 2017;27(9):1536–48. Pas ßaniuc B, Zaitlen N, Halperin E. Accurate Estimation of Expression Levels of Homologous Genes in RNA-seq Experiments. Journal of Compt Biol. 2011;18(3): 459-468. Parsch J, Ellegren H. The evolutionary causes and consequences of sex-biased gene expression. Nat Rev Genet. 2013;14(2):83–7. Baker DA, Nolan T, Fischer B, Pinder A, Crisanti A, Russell S. A comprehensive gene expression atlas of sex- and tissue-specificity in the malaria vector, Anopheles gambiae . BMC Genomics. 2011;12. Meisel RP, Malone JH, Clark AG. Disentangling the relationship between sex-biased gene expression and X-linkage. Genome Res. 2012;22(7):1255–65. Singh IK, Singh S, Mogilicherla K, Shukla JN, Palli SR. Comparative analysis of double-stranded RNA degradation and processing in insects. Sci Rep. 2017;7(1):1–12. Wynant N, Santos D, Vanden Broeck J. Biological mechanisms determining the success of RNA interference in insects. In: International Review of Cell and Molecular Biology. Elsevier Inc.; 2014. p. 139–67. Joga MR, Zotti MJ, Smagghe G, Christiaens O. RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: What we know so far. Front Physiol. 2016;7:1–14. Wiltshire RM, Duman-Scheel M. Advances in oral RNAi for disease vector mosquito research and control. Vol. 40, Current Opinion in Insect Science. Elsevier Inc.; 2020. p. 18–23. Ali MW, Zheng WW, Sohail S, Li Q, Zheng WW, Zhang H. A genetically enhanced sterile insect technique against the fruit fly, Bactrocera dorsalis (Hendel) by feeding adult double-stranded RNAs. Sci Rep. 2017;7(1):4063. McLoughlin AG, Wytinck N, Walker PL, Girard IJ, Rashid KY, de Kievit T, et al. Identification and application of exogenous dsRNA confers plant protection against Sclerotinia sclerotiorum and Botrytis cinerea . Sci Rep. 2018;8(1):7320. Wagner CR, Mahowald AP, Miller KG. One of the two cytoplasmic actin isoforms in Drosophila is essential. Proc Natl Acad Sci USA. 2002;99(12):8037–42. Vedula P, Kurosaka S, Leu NA, Wolf YI, Shabalina SA, Wang J, et al. Diverse functions of homologous actin isoforms are defined by their nucleotide, rather than their amino acid sequence. Elife. 2017;6. Dohn TE, Cripps RM. Absence of the Drosophila jump muscle actin Act79B is compensated by up-regulation of Act88F. Dev Dyn. 2018;247(4):642–9. Fyrberg EA, Fyrberg CC, Biggs JR, Saville D, Beall CJ, Ketchum A. Functional nonequivalence of Drosophila actin isoforms. Biochem Genet. 1998;36(7–8):271–87. Roitberg BD, Mondor EB, Tyerman JGA. Pouncing spider, flying mosquito: blood acquisition increases predation risk in mosquitoes. Behav Ecol. 2003;14(5):736–40. Muijres FT, Chang SW, van Veen WG, Spitzen J, Biemans BT, Koehl MAR, et al. Escaping blood-fed malaria mosquitoes minimize tactile detection without compromising on take-off speed. J Exp Biol. 2017;220(20):3751–62. Iwamoto H. Structure, function and evolution of insect flight muscle. Biophysics (Oxf). 2011;7:21–8. Damiens D, Benedict MQ, Wille M, Gilles JRL, Damiens D, Benedict MQ, et al. An Inexpensive and Effective Larval Diet for Anopheles arabiensis (Diptera: Culicidae): Eat Like a Horse, a Bird, or a Fish? Journal of Medical Entomol. 2012;49(5):1001–11. Benedict MQ. Methods in Anopheles Research. bei Resour. 2007. Atlanta, CDC. Malaria Research and Reference Reagent Resource Center. Taracena ML, Oliveira PL, Almendares O, Umaña C, Lowenberger C, Dotson EM, et al. Genetically modifying the insect gut microbiota to control Chagas disease vectors through systemic RNAi. PLoS Negl Trop Dis. 2015;9(2):1–14. Giraldo-Calderón GI, Calderón C, Emrich SJ, Maccallum RM, Maslen G, Dialynas E, et al. VectorBase: an updated bioinformatics resource for invertebrate vectors and other organisms related with human diseases. Nucleic Acids Res. 2015;43:707–13. TamuraK, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993;10(3). Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870–4. Supplementary Files ActinBCDCvideo.mp4 ActinBCDCvideo.mp4 SupplementaryFigure1.jpg Actin genes expressed during the larval stages. We amplified the 3' UTR with a conserved actin primer using 3' RACE. Molecular weight marker (MWM) 100bp ladder (Novagen). SupplementaryFigure1.jpg Actin genes expressed during the larval stages. We amplified the 3' UTR with a conserved actin primer using 3' RACE. Molecular weight marker (MWM) 100bp ladder (Novagen). Supplementaryfigure2.pdf The An. albimanus Sanarate female-biased actin 3'-UTR of An. albimanus and A. darlingi, Neotropical anophelines. The female-biased sequence was aligned with A. darlingi Coari strain genomic scaffold_1503. Primers used to create dsRNA are shown: FMActRace_1F (red) and AaACT3UTR_R (green) to generate a dsRNA fragment that includes a small coding region and a second dsRNA using the primer AaACT3UTR_F (yellow) that targets the 3'-UTR only. Coding region underlined, stop codon bold. Supplementaryfigure2.pdf The An. albimanus Sanarate female-biased actin 3'-UTR of An. albimanus and A. darlingi, Neotropical anophelines. The female-biased sequence was aligned with A. darlingi Coari strain genomic scaffold_1503. Primers used to create dsRNA are shown: FMActRace_1F (red) and AaACT3UTR_R (green) to generate a dsRNA fragment that includes a small coding region and a second dsRNA using the primer AaACT3UTR_F (yellow) that targets the 3'-UTR only. Coding region underlined, stop codon bold. SupplementaryFigure3.jpg Expression of male-biased actin in different tissues of the adult mosquito. Relative expression of male-biased actin in male adult gut, flight muscle, abdomen and testis. Delta Ct (∆Ct) analysis was done using Rps4 and RpL49 as reference genes for three biological replicas. Data are presented as mean of relative expression and bars represent standard deviation. Samples were analyzed using ANOVA test with Tukey´s comparisons * (p < 0.05); **(p < 0.01); ns, not significant. SupplementaryFigure3.jpg Expression of male-biased actin in different tissues of the adult mosquito. Relative expression of male-biased actin in male adult gut, flight muscle, abdomen and testis. Delta Ct (∆Ct) analysis was done using Rps4 and RpL49 as reference genes for three biological replicas. Data are presented as mean of relative expression and bars represent standard deviation. Samples were analyzed using ANOVA test with Tukey´s comparisons * (p < 0.05); **(p < 0.01); ns, not significant. SupplementaryFigure4.jpg Gene expression analysis of Anopheles albimanus pupae after feeding larvae the female-biased actin 3'-UTR dsRNA. Gene expression levels actin A (a) and actin B (b) were analyzed, using pools of three female and three male pupae per sample. The analysis was performed in three biological replicates. Ctrl, dsRNA targeting aintegumenta gene from Arabidopsis thaliana as a control. Data are presented as means of relative expression and bars represent standard deviation. T-test was performed in comparison to Ctrl. All values were non-significant. SupplementaryFigure4.jpg Gene expression analysis of Anopheles albimanus pupae after feeding larvae the female-biased actin 3'-UTR dsRNA. Gene expression levels actin A (a) and actin B (b) were analyzed, using pools of three female and three male pupae per sample. The analysis was performed in three biological replicates. Ctrl, dsRNA targeting aintegumenta gene from Arabidopsis thaliana as a control. Data are presented as means of relative expression and bars represent standard deviation. T-test was performed in comparison to Ctrl. All values were non-significant. SupplementaryFigure5.jpg Negative controls implemented to evaluate effects of the specific diet with E. coli HT115 (DE3). Development and survival analysis of An. albimanus fed on ABD diet for control groups (40 % fish food, 43 % guar gum and 17 % Active Yeast) in the following groups: 1) food without bacteria, 2) food with bacteria without plasmid for dsRNA production, 3) food with bacteria with a plasmid for the target dsRNA, but non induced, and 4) food with bacteria with non-related dsRNA. After the determination that no significant difference was observed amongst the negative controls (ANOVA test with Tukey´s comparisons * (p < 0.05); **(p < 0.01)). SupplementaryFigure5.jpg Negative controls implemented to evaluate effects of the specific diet with E. coli HT115 (DE3). Development and survival analysis of An. albimanus fed on ABD diet for control groups (40 % fish food, 43 % guar gum and 17 % Active Yeast) in the following groups: 1) food without bacteria, 2) food with bacteria without plasmid for dsRNA production, 3) food with bacteria with a plasmid for the target dsRNA, but non induced, and 4) food with bacteria with non-related dsRNA. After the determination that no significant difference was observed amongst the negative controls (ANOVA test with Tukey´s comparisons * (p < 0.05); **(p < 0.01)). graphicalabstractAalbimanusactins1.jpg graphicalabstractAalbimanusactins1.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-114640","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":5228933,"identity":"8056a591-028e-4ca3-ab51-e5d925ffaaae","order_by":0,"name":"Claudia Paiz-Reyes","email":"","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":false,"prefix":"","firstName":"Claudia","middleName":"","lastName":"Paiz-Reyes","suffix":""},{"id":5228934,"identity":"c735b452-3a3d-4347-8ea1-1ff93acecd1e","order_by":1,"name":"Mabel L. Taracena","email":"","orcid":"","institution":"Centers for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Mabel","middleName":"L.","lastName":"Taracena","suffix":""},{"id":5228935,"identity":"1b99fe9f-459d-4f95-9029-2a9dc4327ca0","order_by":2,"name":"Pamela Flores-Ayuso","email":"","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":false,"prefix":"","firstName":"Pamela","middleName":"","lastName":"Flores-Ayuso","suffix":""},{"id":5228936,"identity":"b9b3c466-2b67-4f92-85e7-e3db79e238c0","order_by":3,"name":"Catherine Hunt","email":"","orcid":"","institution":"Centers for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Catherine","middleName":"","lastName":"Hunt","suffix":""},{"id":5228937,"identity":"c923f88f-8a3b-4c28-aca3-e26fa19850a7","order_by":4,"name":"Ana Cristina Benedict","email":"","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Cristina","lastName":"Benedict","suffix":""},{"id":5228938,"identity":"11dfb9c2-2aa1-45fe-a3b9-8bd7b9b703d1","order_by":5,"name":"Katia Illescas","email":"","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":false,"prefix":"","firstName":"Katia","middleName":"","lastName":"Illescas","suffix":""},{"id":5228939,"identity":"1cb8172e-7dcd-402d-9849-fa70c780a4c6","order_by":6,"name":"Mariana Morales","email":"","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"","lastName":"Morales","suffix":""},{"id":5228940,"identity":"891aff95-be24-4b94-9bd7-bb4c56fd4f70","order_by":7,"name":"Norma Padilla","email":"","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":false,"prefix":"","firstName":"Norma","middleName":"","lastName":"Padilla","suffix":""},{"id":5228941,"identity":"6d9b0ba3-71d2-41ce-a7de-a65ff848676f","order_by":8,"name":"Ellen M Dotson","email":"","orcid":"","institution":"Centers for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Ellen","middleName":"M","lastName":"Dotson","suffix":""},{"id":5228942,"identity":"8359843c-488d-4598-bd9c-9231c1b074b0","order_by":9,"name":"Pamela M Pennington","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYLCCBwwMchAWG7FaEhgYjBFaiNIG1JLYQLQWc/bTiQ8Sau6kb7iRfoHhQ9lhBvn4BvxaLHtyNxskHHuWu+FGTgHjjHOHGQyPEbDF4EDuNokEtsO5G86cSWDmbQNqaSOk5fzb7T8S/h1ONwBp+UuUlhu52xgS2w4nGBxvP8DMCNQiT8j7ljPebpZI7HtmOPN4D8PBnnPpPAZsCfi1mPPnbvzw4dsdeb7D7A8f/CizlpNvPkDAYRAKpIrHAEESqYX9AZgp30BAyygYBaNgFIw4AADnmkzw+F+VAAAAAABJRU5ErkJggg==","orcid":"","institution":"Universidad del Valle de Guatemala","correspondingAuthor":true,"prefix":"","firstName":"Pamela","middleName":"M","lastName":"Pennington","suffix":""}],"badges":[],"createdAt":"2020-11-23 23:31:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-114640/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-114640/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":3927585,"identity":"8a15d795-e88a-41b7-95f8-22d4dd9cd7b8","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":865737,"visible":true,"origin":"","legend":"The An. albimanus Sanarate female-biased actin is a cytoplasmic actin orthologue mapping to chromosome three. a. The 3' UTR was amplified with conserved actin primers using 3'RACE. Female-biased actin fragments (red arrow). b. Maximun likehood tree of sex-biased actins and other mosquito species flight muscle and muscle actins c. Alignment between 600bp fragment and An. albimanus Stecla strain AALB015469 partial transcript sequence. Primers FMActRace_1F (red) and AaACT3UTR_F (yellow) were used to produce the template sequence for dsRNA for the 3'-UTR alone (designated Actin A) and the forward primer (red) and reverse primer AaACT3UTR_R (green) to generate the template for dsRNA fragment to include a short C terminal coding region (designated Actin B). Coding region underlined, stop codon in italics and bold.","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/48312a8010089af1c177db48.jpg"},{"id":3927574,"identity":"2d50692f-5231-4962-90cb-e72b97a2b460","added_by":"auto","created_at":"2020-12-01 18:02:29","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":865737,"visible":true,"origin":"","legend":"The An. albimanus Sanarate female-biased actin is a cytoplasmic actin orthologue mapping to chromosome three. a. The 3' UTR was amplified with conserved actin primers using 3'RACE. Female-biased actin fragments (red arrow). b. Maximun likehood tree of sex-biased actins and other mosquito species flight muscle and muscle actins c. Alignment between 600bp fragment and An. albimanus Stecla strain AALB015469 partial transcript sequence. Primers FMActRace_1F (red) and AaACT3UTR_F (yellow) were used to produce the template sequence for dsRNA for the 3'-UTR alone (designated Actin A) and the forward primer (red) and reverse primer AaACT3UTR_R (green) to generate the template for dsRNA fragment to include a short C terminal coding region (designated Actin B). Coding region underlined, stop codon in italics and bold.","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/e175c7f695ca040b001683f2.jpg"},{"id":3927587,"identity":"eb614d5f-caeb-469c-8c8e-47f0a8b01244","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2082550,"visible":true,"origin":"","legend":"Sex-biased actin genes are differentially expressed across stages with female-biased actin expression in flight muscle. a. Relative expression across developmental stages and sexes compared to third instar larvae. b. Relative expression of female-biased actin in adult female gut, flight muscle, abdomen and ovaries. Delta Ct (∆Ct) analysis was done using Rps4 and RpL49 as reference genes for three biological replicas. Data are presented as a mean of relative expression and bars represent standard deviation. Data was analyzed using ANOVA test with Tukey´s comparisons * (p \u003c 0.05); **(p \u003c 0.01); ns, not significant. ","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/2ead53209c2ea7a85d4a4cbd.jpg"},{"id":3927576,"identity":"a7a2116b-ce14-4aad-91a0-e6497830f5df","added_by":"auto","created_at":"2020-12-01 18:02:29","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2082550,"visible":true,"origin":"","legend":"Sex-biased actin genes are differentially expressed across stages with female-biased actin expression in flight muscle. a. Relative expression across developmental stages and sexes compared to third instar larvae. b. Relative expression of female-biased actin in adult female gut, flight muscle, abdomen and ovaries. Delta Ct (∆Ct) analysis was done using Rps4 and RpL49 as reference genes for three biological replicas. Data are presented as a mean of relative expression and bars represent standard deviation. Data was analyzed using ANOVA test with Tukey´s comparisons * (p \u003c 0.05); **(p \u003c 0.01); ns, not significant. ","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/d176def07de690632b13e3bf.jpg"},{"id":3927589,"identity":"378163b7-5c72-4d33-8450-c3bcb1ec1539","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2507145,"visible":true,"origin":"","legend":"Flight and adult survival are affected after feeding larvae the female-biased actin 3' -UTR dsRNA. The proportion of flightless adult females and males one-day post-emergence after feeding on a) Actin A or b) Actin B. Adult survival over 30 days is presented for mosquitoes fed c) Actin A or d) Actin B. Ctrl, dsRNA targeting aintegumenta gene from A. thaliana as a control. The analysis includes four biological replicates (n=80 each), each one with 3-4 groups of 20 individuals. Data are presented as mean of relative expression and bars represent standard deviation. T-test was performed in comparison to Ctrl group for flightless phenotype *(p = 0.0121) ** (p = 0.00015) for females and ** (p = 0.0018) for males; ns, non-significant. Log-Rank Mantel-Cox test was performed for survival curves in comparison to Ctrl group *** (p \u003c 0.0001).","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/4981c16c918bc834f61dbf8c.jpg"},{"id":3927578,"identity":"e79f54ad-5d87-4e6b-a679-2ef9f261ab8c","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2507145,"visible":true,"origin":"","legend":"Flight and adult survival are affected after feeding larvae the female-biased actin 3' -UTR dsRNA. The proportion of flightless adult females and males one-day post-emergence after feeding on a) Actin A or b) Actin B. Adult survival over 30 days is presented for mosquitoes fed c) Actin A or d) Actin B. Ctrl, dsRNA targeting aintegumenta gene from A. thaliana as a control. The analysis includes four biological replicates (n=80 each), each one with 3-4 groups of 20 individuals. Data are presented as mean of relative expression and bars represent standard deviation. T-test was performed in comparison to Ctrl group for flightless phenotype *(p = 0.0121) ** (p = 0.00015) for females and ** (p = 0.0018) for males; ns, non-significant. Log-Rank Mantel-Cox test was performed for survival curves in comparison to Ctrl group *** (p \u003c 0.0001).","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/447ca950610873ae77e846a6.jpg"},{"id":13621020,"identity":"c218558d-d706-4ea2-998d-becb2aadcc58","added_by":"auto","created_at":"2021-09-17 07:08:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1105643,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/222eaf7d-0def-4b13-9cdc-3c3d10ebe478.pdf"},{"id":3927586,"identity":"0e5ef8b9-5719-4b62-a9ef-a84f14f90274","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"mp4","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10403074,"visible":true,"origin":"","legend":"","description":"","filename":"ActinBCDCvideo.mp4","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/cb1817ca823fecab344ea396.mp4"},{"id":3927575,"identity":"c4c68331-73e9-4cfe-a2c9-4f6e7ef800df","added_by":"auto","created_at":"2020-12-01 18:02:29","extension":"mp4","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10403074,"visible":true,"origin":"","legend":"","description":"","filename":"ActinBCDCvideo.mp4","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/b1ceaf95b64bff7d6c11669f.mp4"},{"id":3927588,"identity":"fa0c24cc-149a-499b-be73-f3f00dfc7882","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":616433,"visible":true,"origin":"","legend":"Actin genes expressed during the larval stages. \nWe amplified the 3' UTR with a conserved actin primer using 3' RACE. Molecular weight marker (MWM) 100bp ladder (Novagen).\n","description":"","filename":"SupplementaryFigure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/df1b7dccec8f07d8f4d8f733.jpg"},{"id":3927577,"identity":"9e294efb-3aae-4798-a1b5-3281ef5743fa","added_by":"auto","created_at":"2020-12-01 18:02:29","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":616433,"visible":true,"origin":"","legend":"Actin genes expressed during the larval stages. \nWe amplified the 3' UTR with a conserved actin primer using 3' RACE. Molecular weight marker (MWM) 100bp ladder (Novagen).\n","description":"","filename":"SupplementaryFigure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/436c3dc54e0e018708c665e7.jpg"},{"id":3927590,"identity":"9d0f30c5-6a84-46d5-8be7-f83378a2f407","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":89828,"visible":true,"origin":"","legend":"The An. albimanus Sanarate female-biased actin 3'-UTR of An. albimanus and A. darlingi, Neotropical anophelines. \nThe female-biased sequence was aligned with A. darlingi Coari strain genomic scaffold_1503. Primers used to create dsRNA are shown: FMActRace_1F (red) and AaACT3UTR_R (green) to generate a dsRNA fragment that includes a small coding region and a second dsRNA using the primer AaACT3UTR_F (yellow) that targets the 3'-UTR only. Coding region underlined, stop codon bold.\n","description":"","filename":"Supplementaryfigure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/56290eb8b254b087320cf47f.pdf"},{"id":3927579,"identity":"7e28a470-dcc3-43b4-a2d7-75d965b12369","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":89828,"visible":true,"origin":"","legend":"The An. albimanus Sanarate female-biased actin 3'-UTR of An. albimanus and A. darlingi, Neotropical anophelines. \nThe female-biased sequence was aligned with A. darlingi Coari strain genomic scaffold_1503. Primers used to create dsRNA are shown: FMActRace_1F (red) and AaACT3UTR_R (green) to generate a dsRNA fragment that includes a small coding region and a second dsRNA using the primer AaACT3UTR_F (yellow) that targets the 3'-UTR only. Coding region underlined, stop codon bold.\n","description":"","filename":"Supplementaryfigure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/77d4787caf33e62353540014.pdf"},{"id":3927591,"identity":"d90d2d0a-577c-4fc3-be92-821c13dac8e3","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1009551,"visible":true,"origin":"","legend":"Expression of male-biased actin in different tissues of the adult mosquito. \nRelative expression of male-biased actin in male adult gut, flight muscle, abdomen and testis. Delta Ct (∆Ct) analysis was done using Rps4 and RpL49 as reference genes for three biological replicas. Data are presented as mean of relative expression and bars represent standard deviation. Samples were analyzed using ANOVA test with Tukey´s comparisons * (p \u003c 0.05); **(p \u003c 0.01); ns, not significant.\n","description":"","filename":"SupplementaryFigure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/ee2d755e73eec013bb14217a.jpg"},{"id":3927580,"identity":"a6bcf78d-34b2-4d40-9509-6aa0f532579c","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1009551,"visible":true,"origin":"","legend":"Expression of male-biased actin in different tissues of the adult mosquito. \nRelative expression of male-biased actin in male adult gut, flight muscle, abdomen and testis. Delta Ct (∆Ct) analysis was done using Rps4 and RpL49 as reference genes for three biological replicas. Data are presented as mean of relative expression and bars represent standard deviation. Samples were analyzed using ANOVA test with Tukey´s comparisons * (p \u003c 0.05); **(p \u003c 0.01); ns, not significant.\n","description":"","filename":"SupplementaryFigure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/88f7de8386342c46e7044167.jpg"},{"id":3927592,"identity":"b3ee278a-480e-49b6-8d5c-4cadd8c80b74","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1840860,"visible":true,"origin":"","legend":"Gene expression analysis of Anopheles albimanus pupae after feeding larvae the female-biased actin 3'-UTR dsRNA. \nGene expression levels actin A (a) and actin B (b) were analyzed, using pools of three female and three male pupae per sample. The analysis was performed in three biological replicates. Ctrl, dsRNA targeting aintegumenta gene from Arabidopsis thaliana as a control. Data are presented as means of relative expression and bars represent standard deviation. T-test was performed in comparison to Ctrl. All values were non-significant.\n","description":"","filename":"SupplementaryFigure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/7a9cc6ad86bc2d4d415c9b4b.jpg"},{"id":3927581,"identity":"6d9ec5d1-9267-49d1-938c-7c175f356222","added_by":"auto","created_at":"2020-12-01 18:02:30","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1840860,"visible":true,"origin":"","legend":"Gene expression analysis of Anopheles albimanus pupae after feeding larvae the female-biased actin 3'-UTR dsRNA. \nGene expression levels actin A (a) and actin B (b) were analyzed, using pools of three female and three male pupae per sample. The analysis was performed in three biological replicates. Ctrl, dsRNA targeting aintegumenta gene from Arabidopsis thaliana as a control. Data are presented as means of relative expression and bars represent standard deviation. T-test was performed in comparison to Ctrl. All values were non-significant.\n","description":"","filename":"SupplementaryFigure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/2bb32ce8ac9a0d13211701a6.jpg"},{"id":3927582,"identity":"c871edb5-3235-4424-a201-a8e18ef681cd","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":118543,"visible":true,"origin":"","legend":"Negative controls implemented to evaluate effects of the specific diet with E. coli HT115 (DE3). \nDevelopment and survival analysis of An. albimanus fed on ABD diet for control groups (40 % fish food, 43 % guar gum and 17 % Active Yeast) in the following groups: 1) food without bacteria, 2) food with bacteria without plasmid for dsRNA production, 3) food with bacteria with a plasmid for the target dsRNA, but non induced, and 4) food with bacteria with non-related dsRNA. After the determination that no significant difference was observed amongst the negative controls (ANOVA test with Tukey´s comparisons * (p \u003c 0.05); **(p \u003c 0.01)).\n","description":"","filename":"SupplementaryFigure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/8ff4aaf99af0500572ab86fb.jpg"},{"id":3927593,"identity":"aab5b0dc-8204-4ed1-9127-a9c5b189534d","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":118543,"visible":true,"origin":"","legend":"Negative controls implemented to evaluate effects of the specific diet with E. coli HT115 (DE3). \nDevelopment and survival analysis of An. albimanus fed on ABD diet for control groups (40 % fish food, 43 % guar gum and 17 % Active Yeast) in the following groups: 1) food without bacteria, 2) food with bacteria without plasmid for dsRNA production, 3) food with bacteria with a plasmid for the target dsRNA, but non induced, and 4) food with bacteria with non-related dsRNA. After the determination that no significant difference was observed amongst the negative controls (ANOVA test with Tukey´s comparisons * (p \u003c 0.05); **(p \u003c 0.01)).\n","description":"","filename":"SupplementaryFigure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/0f857a39f776ebd34a86bccf.jpg"},{"id":3927594,"identity":"3ab2cd52-f4bf-43c7-829a-4a0fcc15161a","added_by":"auto","created_at":"2020-12-01 18:02:32","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":191931,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstractAalbimanusactins1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/da29469392dbc9ab237a947c.jpg"},{"id":3927583,"identity":"0889c0ba-3514-49fc-8eac-9e1ed7c1636f","added_by":"auto","created_at":"2020-12-01 18:02:31","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":191931,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstractAalbimanusactins1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-114640/v1/b90812c47e2d9064bea249cd.jpg"}],"financialInterests":"","formattedTitle":"\u003cp\u003eOral Delivery of dsRNA Targeting a Female-Biased Flight Muscle Actin Impairs Flight in the Malaria Vector, Anopheles Albimanus.\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eMalaria is a parasitic disease that affects millions of people worldwide. It is caused by \u003cem\u003ePlasmodium\u003c/em\u003e parasites, and it is transmitted by the bite of female \u003cem\u003eAnopheles\u003c/em\u003e mosquitoes. In the Mesoamerican region, northern South America and the Caribbean, \u003cem\u003eAn. albimanus\u003c/em\u003e is one of the main vectors of the disease (\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). The incidence of malaria in this region decreased 20% between 2010 and 2014, but it has been increasing since then (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Indoor residual spraying (IRS) and the use of insecticide-treated mosquito nets (ITN) have been effective in reducing the vector population (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e), but new vector control strategies are needed as insecticide resistance is widespread (\u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). New potential vector control strategies using genetically modified or sterile mosquitoes are being considered to overcome this problem. However, these strategies depend upon the release of large numbers of males, and therefore separating males from females before releasing the mosquitoes to the field is imperative (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe methodologies for sex-sorting and ultimately sex-separation of mosquitoes vary greatly and depend on the sexual dimorphisms of each species (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). For many years, the efforts to develop sex-separation methods have been limited by the difficulty to scale up the technologies, and the complexity of building functional genetic systems (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Previous research with transgenes in \u003cem\u003eAe. aegypti\u003c/em\u003e to obtain flightless females (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e) has opened the consideration of such approaches as a genetic sexing tool in mosquitoes. In this strategy, one of the four \u003cem\u003eactin\u003c/em\u003e genes found in \u003cem\u003eAe. aegypti\u003c/em\u003e, \u003cem\u003eactin\u003c/em\u003e-\u003cem\u003e4\u003c/em\u003e, was found to be essential for female flight. This and other studies in model organisms, such as \u003cem\u003eDrosophila melanogaster\u003c/em\u003e, have shown that the identification of the specific functions of particular actin genes in each species can be complex, as they are highly conserved and can show more than 90% similarity between isoforms (\u003cspan additionalcitationids=\"CR19 CR20 CR21 CR22\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). \u003cem\u003eAeAct-4\u003c/em\u003e and a similar orthologue have been reported as a female-biased gene in adults of \u003cem\u003eAe. aegypti\u003c/em\u003e and \u003cem\u003eAnopheles stephensi\u003c/em\u003e (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Interruption of the promoter of this gene has been used to produce flightless females using the Release of Insects carrying a Dominant Lethal (RIDL) technology (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe last decade has seen staggering progress in the creation of genetic tools for mosquito studies, with major breakthroughs in genetic analysis derived from the development of germline transformation and RNA interference (RNAi) (reviewed by Adolfi and Lycett (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e)). RNAi could provide a viable and inexpensive technology (\u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e) to knock down the expression of sex-biased genes (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) for sex-sorting and sex-separation in \u003cem\u003eAnopheles\u003c/em\u003e. RNAi is part of the natural cellular defense systems that insects have against viruses (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). It is triggered by double-stranded RNA (dsRNA), and therefore its response is sequence-specific (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). When exogenous dsRNA is delivered to the cells, mRNA complementary to the dsRNA is cleaved and degraded, effectively silencing the gene expression of the target gene (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). The method has been used successfully to silence a wide variety of genes in insects, mostly for reverse genetic studies (reviewed by Huvenne \u0026amp; Smagghe in 2010 and updated by Jin et al. in 2020 (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e)).\u003c/p\u003e \u003cp\u003eCurrently, several pest-control and vector-control strategies based on RNAi are being proposed. In most of these strategies, the delivery of the dsRNA is the crucial most challenging part of the method development, and several delivery methods have been proposed for mosquitoes. Encapsulation of the dsRNA in chitosan, agarose, yeast, and bacteria have been evaluated for oral delivery to mosquito larvae, all with various degrees of success (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). To our knowledge, to date there have been no reports of RNAi experiments in \u003cem\u003eAn. albimanus\u003c/em\u003e, and one of the main goals of this work, is to set grounds for more reverse genetic studies in this species. Additionally, in the recent annotation of the genome of \u003cem\u003eAn. albimanus\u003c/em\u003e (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e), the muscle actins were not characterized. Thus, the second aim of this study was to search for a sex-biased actin in \u003cem\u003eAn. albimanus\u003c/em\u003e and to determine the viability of using RNAi to silence it to obtain flightless phenotypes, similar to \u003cem\u003eAe. aegypti.\u003c/em\u003e\u003c/p\u003e "},{"header":"Results","content":" \u003cp\u003e \u003cstrong\u003ePrimary identification of sex-biased actins\u003c/strong\u003e \u003cp\u003eDue to conservation in their coding regions, actin genes can be distinguished by differences in their unique 3'-UTR sequences (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Using 3'-UTR analysis, we found several actins expressed during the larval (Additional File 1), pupal, and adult stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). 3' Rapid amplification of cDNA ends (3'-RACE) resulted in a fragment of 600\u0026nbsp;bp that showed higher expression in females than males, here designated as female-biased actin. Conversely, a 500\u0026nbsp;bp fragment showed higher expression in males and designated as male-biased actin. The other putative actin genes (~\u0026thinsp;700 and ~\u0026thinsp;900\u0026nbsp;bp), although expressed in both male and female pupae and adults, were not studied further in this study. Both PCR products (500\u0026nbsp;bp and 600\u0026nbsp;bp) represent different 3'-UTR sequences preceded by a highly conserved coding region. Each sex-biased UTR was identical in pupae and adults. VectorBase nucleotide BLAST of the sequences of each product confirmed they are different \u003cem\u003eactin\u003c/em\u003e genes located on different chromosomes. VectorBase BLAST showed 99.6% identity between the \u003cem\u003eAn. albimanus\u003c/em\u003e Sanarate strain female-biased actin and the \u003cem\u003eAn. albimanus\u003c/em\u003e Stecla strain AALB015489 gene transcript within the 3R chromosome (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). A BLAST search with other anophelines and aedines showed a coding region plus 3'-UTR conservation only in the new world anopheline, \u003cem\u003eAn. darlingi\u003c/em\u003e Coari strain in 86.5% (Additional File 2). A homologue search of AALB015489 transcript within VectorBase showed 98.94% similarity with the \u003cem\u003eAe. aegypti\u003c/em\u003e flight muscle actin (\u003cem\u003eactin-4\u003c/em\u003e). BLAST analysis of the male-biased actin showed a 99.3% identity between the \u003cem\u003eAn. albimanus\u003c/em\u003e Sanarate strain and the \u003cem\u003eAn. albimanus\u003c/em\u003e Stecla strain AALB015481 gene transcript within the 2R chromosome (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). VectorBase homologue search of this transcript showed 100% similarity with several genes annotated as actins of several anopheline mosquitoes and 98.4% identity with \u003cem\u003eAe. Aegypti actin-3\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eSpatiotemporal analysis of the sex-biased actins expression\u003c/strong\u003e \u003cp\u003eQuantitative Real-Time PCR (qPCR) analysis showed that the female-biased actin (AALB015489) was expressed\u0026thinsp;\u0026gt;\u0026thinsp;40-fold higher in female pupae (p\u0026thinsp;=\u0026thinsp;0.0048) and female adults (p\u0026thinsp;=\u0026thinsp;0.0078),compared to males of the same stages, and remained low in the larval stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).Expression was detected in flight muscle, and to a lesser extent, in ovaries, abdomen, and gut (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). qPCR showed that the male-biased actin (AALB015481) was expressed\u0026thinsp;\u0026gt;\u0026thinsp;90-fold higher in male adults (p\u0026thinsp;=\u0026thinsp;0.0103) than in female adults and remained low in the larval stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). In addition, expression was detected in the male abdomen, midgut and reproductive tissues, but not in the flight muscle (Additional File 3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eFeeding female-biased actin dsRNA affects flight and survival in both sexes\u003c/strong\u003e \u003cp\u003eRNAi experiments were performed to determine if the female-biased actin was implicated in the flight of \u003cem\u003eAn. albimanus\u003c/em\u003e. We fed larvae with a dsRNA fragment that contains the 3'UTR sequence only (designated as Actin A) and another fragment that contains the carboxy-terminal coding region with its 3'UTR sequence (designated as Actin B). Some of the adults from both groups presented a flightless phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Additional File 4). A significant effect was observed on the flight in both sexes of adults emerging from larvae fed with 3'UTR dsRNA (Actin A), with approximately 10% females (10.50\u0026thinsp;\u0026plusmn;\u0026thinsp;5.92%, Student's t, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and 8% males (8.25\u0026thinsp;\u0026plusmn;\u0026thinsp;3.10%, Student's t, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) unable to fly one day after emergence. With Actin B (3'UTR plus the C-terminal coding region), the percentage of flightless mosquitoes (6.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.16%, Student's t, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) observed was significantly different from controls (fed the ANT dsRNA) only in females. Survival was affected considerably in both females and males fed with Actin A or Actin B (Log-rank test, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). To verify the association of the flightless phenotype with gene expression, transcript levels of the female-biased actin were measured in pupae. Our results showed a measurable decrease in the mRNA expression, but due to sample size and deviation, no statistically significant reduction was obtained (Additional File 5).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e "},{"header":"Discussion","content":" \u003cp\u003eCurrent insecticide-based control methods, such as IRS and ITNs, are threatened by increasing insecticide resistance in malaria vectors. The design of novel vector control strategies is a pressing need to alleviate or eliminate the burden of vector-transmitted diseases, particularly in developing countries where most vulnerable populations have limited access to medical services (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). Innovation is limited in regions where local vector species are not actively studied. As a vector with a geographical distribution limited to the Meso-American region, Caribbean and northern South America (\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e), research on \u003cem\u003eAn. albimanus\u003c/em\u003e has been limited compared to other malaria vectors such as \u003cem\u003eAnopheles gambiae\u003c/em\u003e. The genome of \u003cem\u003eAn. albimanus\u003c/em\u003e was sequenced as part of the 16 Anopheles Genomes Project (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e), and published only in 2015, more than ten years after the \u003cem\u003eAn. gambiae\u003c/em\u003e genome (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Given the divergence of the neotropical anopheline species from their African counterparts, the importance of the study of this species' genome cannot be overstated, and more transcriptomic studies, such as the comparative transcriptomic study by Papa et al, 2017 (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), are needed.\u003c/p\u003e \u003cp\u003eUsing the current version of the \u003cem\u003eAn. albimanus\u003c/em\u003e genome (Vectobase Gene Set AAlbS2.6), we found an orthologue of the \u003cem\u003eAe. aegypti\u003c/em\u003e female-biased flight muscle actin gene (\u003cem\u003eactin-4\u003c/em\u003e) and determined that the \u003cem\u003eAn. albimanus\u003c/em\u003e form also had higher expression in female pupae and adults as compared to males. Given the high similarity between coding regions of different actin genes or actin isoforms within an organism, we confirmed the previous expression analysis of the \u003cem\u003eAn. albimanus\u003c/em\u003e sex-biased actin genes by the use of the highly divergent 3' UTR and qPCR to complement the RNA-seq available data (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), as short RNA-seq reads within coding region of homologous genes could be mapped to multiple locations (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFemales and males have different morphological, behavioral and physiological characteristics, many of which can arise from sex-biased gene expression (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). We confirmed that this actin gene is involved in flight in both sexes after obtaining flightless phenotypes upon oral delivery of the actin 3' UTR dsRNA. However, feeding dsRNA for this actin gene accelerated mortality in males three weeks after emergence, suggesting that even the low expression levels that were detected in this sex, are essential for flight or other biological processes that we did not characterize. As the flightless phenotype only occurred in a limited sub-section of the treated groups, further analysis will be needed to identify the factors that made these mosquitoes more susceptible to the treatment or why the RNAi effect was more pronounced in those individuals. The low frequency of the phenotype may also be related to the efficiency of delivery RNAi for this target gene. Given that the targeted actin gene in \u003cem\u003eAn. albimanus\u003c/em\u003e is expressed in the flight muscle; the dsRNA delivered in the midgut has to travel a significant distance to reach the target cells. Marked differences in the stability and production of short interfering RNAs after dsRNA oral delivery occur among insect species (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Different tissues are also differentially susceptible to RNAi in various insects, as reviewed by Wynant et al, 2014 (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). Finally, the dose and the construct size can also produce different effects, sometimes with a saturation effect due to high doses (reviewed by Joga et al, 2016 (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e)). Despite the high variability in RNAi efficiency across insect species and target genes, dsRNA produced in bacteria or yeast has a high potential as heat-killed mosquito larvicide, as recently reviewed by Wiltshire and Duman-Scheel (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe believe that, to obtain higher percentages of individuals with the phenotype, several parameters in the delivery system must be optimized (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). In our experiments, we designed enough negative controls for the delivery system (Additional File 6), to allow us to rule out an association of the phenotype with the method rather than with the specific RNAi for actin. When appropriate genes are available, positive controls will be useful to help optimize the feeding parameters, and further research to identify such genes in \u003cem\u003eAn. albimanus\u003c/em\u003e should be done. The partial and short-lived effect on both sexes may also be due to non-specific degradation in the gut, to variability in the doses ingested by individuals and/or possible compensation with other actin isoforms (\u003cspan additionalcitationids=\"CR57 CR58\" citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). Additionally, functional studies using RNAi injections could determine if higher concentrations of the dsRNA and crossing tissue barriers can effectively induce a longer lasting flightless phenotype.\u003c/p\u003e \u003cp\u003eSex-biased genes can arise via gene duplication, in which the parental copy of the gene may remain unchanged, whereas the new copy may present sex-biased expression (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). A sex-biased expression can vary during different times of development and between tissues (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Given that the expression of the flight muscle actin begins during the larval stages, we fed larvae heat-inactivated bacterial lysates with isoform-specific dsRNA produced by \u003cem\u003eE. coli\u003c/em\u003e HT115(DE3), starting at the L2 stage until pupation. We saw a flightless phenotype in both female and male adults; however, the phenotype was observed only in around 10% of individuals of either sex. We did not detect a significant effect on gene expression in pupae, possibly because of the low frequency of the flightless phenotype and a dilution from pooling individuals for therelative expression analysis.\u003c/p\u003e \u003cp\u003eOur results indicate that the female-biased actin gene is involved in flight in both sexes and silencing of this gene resulted in the reduced female and male survival. In \u003cem\u003eDrosophila\u003c/em\u003e, mutations in the jumping muscle actin gene can be compensated by a low level expression of the flight muscle actin, although there is no evidence of actin compensation in the flight muscle (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Mosquitoes may require sex-biased flight muscle actin due to different flight requirements for each sex. After a blood meal, females can double or triple their total weight and they must carry this additional weight until the blood meal is processed (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). This extra weight requires that the mosquitoes exert additional aerodynamic forces generated by beating wings to take off; these aerodynamic forces are generated by indirect flight power muscles (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). Furthermore, differences in wing beat frequencies exist between males and females during the swarming and mating process that may require a different pattern of expression of actin in thoracic muscles (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAltogether, our results show for the first time that there is a female-biased, sexually-differentiated expression of the flight muscle orthologous actin gene in \u003cem\u003eAn. albimanus\u003c/em\u003e, and that it is possible to target this gene through oral mediated RNAi using its 3' UTR sequence, affecting flight in both sexes. We recently showed in \u003cem\u003eAn. gambiae\u003c/em\u003e that oral delivery of dsRNA for a female-specific doublesex gene could skew sex ratios towards males (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Development of an efficient means of separating the sexes by targeting other sex-biased genes could provide new tools for female removal in genetic-based strategies to improve vector-control strategies in the region.\u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eWe isolated a female-biased flight muscle actin gene from pupae and adults of \u003cem\u003eAn. albimanus\u003c/em\u003e that is implicated in the flight and survival of both females and males. Future studies will characterize other sex-biased genes as potential targets for \u003cem\u003eAn. albimanus\u003c/em\u003e control strategies.\u003c/p\u003e "},{"header":"Methods","content":" \u003cp\u003e \u003cb\u003eMosquito rearing\u003c/b\u003e: Two strains of \u003cem\u003eAn. albimanus\u003c/em\u003e were used for this work: 1) \u003cem\u003eAn. albimanus\u003c/em\u003e Sanarate strain (Biosamples ID: SAMN10341946) (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), was used for gene characterization and quantification of basal gene expression. Rearing of this strain took place at the Universidad del Valle de Guatemala (UVG). Insectary conditions were 28\u0026nbsp;\u0026deg;C +/- 1\u0026nbsp;\u0026deg;C and relative humidity of 80% +/- 10%, with a photoperiod of 12:12 light-dark cycle. Colony larvae were fed daily a mixture of baby food Nestum\u0026reg; 5 cereals (Nestl\u0026eacute;) and active yeast. Adults were fed ad libitum on a 10% sugar solution in sterile water and females were fed commercially available defibrinated sheep blood (Actividades Lucrativas, Guatemala, Guatemala) via a membrane feeder (Hemotek, United Kingdom) covered with Parafilm. 2) \u003cem\u003eAn. albimanus\u003c/em\u003e Santa Tecla (Stecla) strain (MRA-112 BioDefense Emerging Infections (BEI), Malaria Research and Reference Reagent Resource Center (MR4), Centers for Disease Control and Prevention (CDC), Atlanta, Georgia, USA) was used for RNAi experiments. Rearing conditions at the CDC were 27\u0026nbsp;\u0026deg;C, relative humidity of 80%, and a photoperiod of 12:12 light-dark cycle with a 30-minute dawn and dusk period. Colony larvae were fed Damien's diet (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e) according to the MR4 rearing protocol (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). Adults were fed ad libitum on a 10% sugar solution with 0.2% methylparaben dissolved in sterile water, and females were fed commercially available defibrinated rabbit blood (Hemostat, Dixon, CA, USA) via a Parafilm covered glass feeding bell (Lily, Atlanta, GA, USA).\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA extraction\u003c/b\u003e: For 3' RACE and PCR evaluation of the sex-biased actins expression, we extracted RNA from pools of: 1) 15 one-day-old virgin females, 2) 15 one-day-old virgin males, 3) five female pupae, 4) five male pupae, 5) seven L4 larvae, and 6) 40 L3 larvae of \u003cem\u003eAn. albimanus\u003c/em\u003e strain Sanarate. The number of individuals per pool was selected based on previous normalizations of RNA obtained per wet body weight. The extractions were performed using the SV total RNA isolation system kit (Promega, WI, USA), following the manufacturer's protocol. Briefly, mosquitoes were homogenized using a pellet pestle cordless motor and sterile pestles in 175\u0026nbsp;\u0026micro;l of lysis buffer and incubated in a cold rack for 20\u0026nbsp;min. 350\u0026nbsp;\u0026micro;l of RNA dilution buffer was added and mixed by inversion. This lysate was centrifuged at 13,000\u0026nbsp;rpm, 10\u0026nbsp;min at room temperature, the supernatant was removed and mixed with 200\u0026nbsp;\u0026micro;l 95% ethanol, transferred to spin column and centrifuged at 13,000\u0026nbsp;rpm for 1\u0026nbsp;min. The column was washed with 600\u0026nbsp;\u0026micro;l of RNA wash solution, and the sample was treated with DNAse incubation mix for 30\u0026nbsp;min, followed by the addition of 200\u0026nbsp;\u0026micro;l stop solution. The column was centrifuged at the same conditions as before and washed twice with RNA wash solution. RNA was eluted with 100\u0026nbsp;\u0026micro;l of RNase free water.\u003c/p\u003e \u003cp\u003eFor the evaluation of female-biased actin expression in several adult tissues, two pools of five individuals per biological replica (n\u0026thinsp;=\u0026thinsp;3) were dissected in ice-cold PBS. RNA extractions were performed using the RNeasy Micro kit (Qiagen, MD, USA) according to the manufacturer's protocol.\u003c/p\u003e \u003cp\u003eFor cloning of the female-biased actin, RNA was extracted from a pool of eight adult female mosquitoes and five female pupae of \u003cem\u003eAn. albimanus\u003c/em\u003e Stecla strain using the RNeasy Mini Kit according to manufacturer\u0026acute;s protocol (Qiagen, MD, USA). Briefly, samples were homogenized using a pellet pestle cordless motor and sterile pestles in 350\u0026nbsp;\u0026micro;l of RLT buffer. After centrifugation, one volume of 70% ethanol was added to the lysate and transferred to the RNeasy Mini spin column. Two consecutive washes with 700\u0026nbsp;\u0026micro;l of RW1 buffer and one with 500\u0026nbsp;\u0026micro;l of RPE buffer were done before resuspending the RNA in 30\u0026nbsp;\u0026micro;l of RNase-free water. Quantification of RNA was done with a Nanodrop OneC (Thermo Fisher, MA, USA) and 1\u0026nbsp;\u0026micro;g of RNA was treated with 1.5 units of RQ1 DNase (Promega, WI, USA) for 1\u0026nbsp;h at 37\u0026nbsp;\u0026deg;C, followed by inactivation for 10\u0026nbsp;min at 65\u0026nbsp;\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3' Rapid amplification of cDNA ends (RACE)\u003c/b\u003e: We performed 3' RACE with the kit 3' RACE System for Rapid Amplification of cDNA Ends (Invitrogen, MA, USA). One \u0026micro;g of total RNA was used to generate the cDNA by the manufacturer's instructions. Then 1\u0026nbsp;\u0026micro;l of this cDNA was used to amplify the 3' UTR region using 0.4\u0026nbsp;\u0026micro;M of actin primer FMActRace_1F (5'- CGATCAAGATCAAGATCATTGCC-3') and 0.4\u0026nbsp;\u0026micro;M of UAP primer provided by the manufacturer in a 25\u0026nbsp;\u0026micro;l reaction using the GoTaq Hot Start colorless Master Mix (Promega). We performed the amplification as follows: 95\u0026nbsp;\u0026deg;C for 2\u0026nbsp;min, 30 cycles of 95\u0026nbsp;\u0026deg;C for 30\u0026nbsp;s, 61\u0026nbsp;\u0026deg;C for 30\u0026nbsp;s and 72\u0026nbsp;\u0026deg;C-1\u0026nbsp;min and a final extension of 72\u0026nbsp;\u0026deg;C for 5\u0026nbsp;min. We gel pricked the 600\u0026nbsp;bp and 500\u0026nbsp;bp bands that showed differential expression in females and males and amplified using the same conditions described earlier, with the only modification that 20 cycles of amplification were used. Both fragments were ligated to the pGEM-T easy vector (Promega) and transformed it into \u003cem\u003eE. coli\u003c/em\u003e XL-1 blue. Clones of each fragment were sequenced and the sequences used to design female-biased and male-biased actin specific primers within the 3' UTR.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSex-biased actin expression\u003c/b\u003e: Quantitative PCR was done to assess the expression level of the sex-biased actins during the life cycle and in the different tissues of the adults of \u003cem\u003eAn. albimanus\u003c/em\u003e mosquitoes. RNA extraction was performed as previously described. The cDNA was generated from 1\u0026nbsp;\u0026micro;g of total RNA using the GoScript Reverse Transcription Kit with a mixture of Random primers plus oligo(dT) (Promega) as per manufacturer's instructions. The following primers were used: qPCRfemaleUTR_2F (5\u0026acute;-GACATCCAATCACTACATCC-3\u0026acute;) and qPCRfemaleUTR_2R (5\u0026acute;-CAAAGGCAAACACAGCTAAC-3\u0026acute;) for the female-biased actin, and qPCR_Male3UTR_1F (5\u0026acute;-CCAACATCAACACCAACTTC-3\u0026acute;) and qPCR_Male3UTR_1R (5\u0026acute;-GTCGAAGAAGATTTGCACAG-3\u0026acute;) for the male-biased actin amplification. The RpS4 (AALB005332) and RpL49 (AALB008968) reference genes were amplified with the following primers: qPCR_RpS4_1F (5'-AGGTGATGGAGGTGCTGAAG-3\u0026acute;) with qPCR_RpS4_1R (5'- CGATGATGAACACGTTGGAG-3') and qPCR_RpL49_1F (5'-AGGGTGGAAGGTGATATCTG-3') with qPCR_RpL49_1R (5'- ACATGGTCGCCCTTAAATG-3'). To measure expression in each biological replicate of the different life-stages, qPCR was carried out with Power Up SYBR green master mix (Thermo Fisher) with 0.33\u0026nbsp;\u0026micro;M of each primer and 2.5\u0026nbsp;\u0026micro;l of cDNA diluted at 1:500 in a final volume of 10\u0026nbsp;\u0026micro;l. All samples were run in technical triplicates. Genes were amplified in the Lightcycler 96 (Roche, Switzerland) thermal cycler as follows: 50\u0026nbsp;\u0026deg;C for 60\u0026nbsp;s and 95\u0026nbsp;\u0026deg;C for 120\u0026nbsp;s, followed by 50 cycles of: 95\u0026nbsp;\u0026deg;C for 15\u0026nbsp;s and 60\u0026nbsp;\u0026deg;C for 60\u0026nbsp;s. Melting curves of 95\u0026nbsp;\u0026deg;C for 15\u0026nbsp;s, 60\u0026nbsp;\u0026deg;C for 60\u0026nbsp;s and 95\u0026nbsp;\u0026deg;C for 16\u0026nbsp;s were done after each run. Delta cycle threshold (∆Ct) method was performed using the average Cts of both Rps4 and Rps49 reference genes and performing the comparison of the relative expression to the L3 stage. Samples were analyzed using ANOVA test with Tukey's comparisons. To measure expression in each biological replicate of the different tissues, qPCR was prepared as before with the difference that the cDNA was diluted at 1:20. All samples were run in technical duplicate. PCR was run in a Quant Studio 6 (Applied Biosystems, CA, USA) thermal cycler as follow: 50\u0026nbsp;\u0026deg;C for 2\u0026nbsp;min, 95\u0026nbsp;\u0026deg;C for 10\u0026nbsp;min, and 50 cycles of 95\u0026nbsp;\u0026deg;C for 15\u0026nbsp;s and 60\u0026nbsp;\u0026deg;C for 60\u0026nbsp;s. Melting curves of 95\u0026nbsp;\u0026deg;C for 15\u0026nbsp;s, 60\u0026nbsp;\u0026deg;C for 60\u0026nbsp;s, and 95\u0026nbsp;\u0026deg;C for 15 sec were done for each run. Delta-delta Ct (∆∆Ct) analysis was performed using the average of Cts of both Ribosomal protein S7 (Rps7) and Actin housekeeping HK reference genes for analysis of transcript levels of pupa that receive actin A dsRNA and Rps7 only for pupae that were fed with Actin B and compared to pupae fed dsRNA of the \u003cem\u003eant\u003c/em\u003e gene as a control.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFemale-biased actin cloning\u003c/b\u003e: Primers for two dsRNA were designed based on the sequenced regions. For 3\u0026acute;-UTR: AaACT3UTR_F: (5\u0026acute;-GCACAAATGATGGTGGCTAAAG-3\u0026acute;) and AaACT3UTR_R_T7: (5\u0026acute;-\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eCTCAAAGGCAAACACAGCTAAC-3\u0026acute;) (designated Actin A) and for coding region plus 3\u0026acute;-UTR: FMActRace_1F and AaACT3UTR_R_T7 (designated Actin B). The T7 promoter of the pGEM-T Easy vector and the T7 added in the reverse primers (underlined) were used to produce both strands of the dsRNA. Complementary DNA was produced using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) with a mixture of random primers and oligo(dT). Conventional PCRs were performed with 0.4\u0026nbsp;\u0026micro;M of each primer and the AccuStart\u0026trade; II GelTrack\u0026trade; PCR SuperMix (Quantabio, MA, USA), using a 1:5 dilution of cDNA from female and male pupae and adults of \u003cem\u003eAn. albimanus\u003c/em\u003e as a template to corroborate the expression and the following program: 94\u0026nbsp;\u0026deg;C for 3\u0026nbsp;min, 30 cycles of 94\u0026nbsp;\u0026deg;C for 45 sec, 61\u0026nbsp;\u0026deg;C for 30 sec, and 72\u0026nbsp;\u0026deg;C for 30 sec, followed by a last step at 72\u0026nbsp;\u0026deg;C for 5\u0026nbsp;min. The obtained fragments were cloned into the pGEM-T-easy vector and then transformed into \u003cem\u003eE. coli\u003c/em\u003e HT115 (DE3) for production of dsRNA. Transformation of \u003cem\u003eE. coli\u003c/em\u003e HT115 (DE3) was performed as described by Timmons et al, 2001 (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of dsRNA\u003c/b\u003e: Pricks of fresh bacteria colonies were used for inoculum of overnight cultures. The bacteria used were either \u003cem\u003eE. coli\u003c/em\u003e HT115(DE3)-Actin (Actin A or B) and \u003cem\u003eE. coli\u003c/em\u003e HT115(DE3)-Ant, a non-related gene from \u003cem\u003eArabidopsis thaliana\u003c/em\u003e (GenBank: U41339.1), which is an APETALA2-like gene with pleiotropic roles in ovule development and floral organ growth, that we had previously cloned into \u003cem\u003eE. coli\u003c/em\u003e HT115 (DE3) for control(\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e)). Colonies from Luria-Bertani (LB) agar plates with tetracycline (12.5\u0026nbsp;\u0026micro;g/ml) and ampicillin (100\u0026nbsp;\u0026micro;g/ml) were used as inoculum for each starting culture (10\u0026nbsp;ml). An overnight incubation in LB broth with tetracycline (12.5\u0026nbsp;\u0026micro;g/ml) and ampicillin (100\u0026nbsp;\u0026micro;g/ml) was done at 37\u0026nbsp;\u0026deg;C and 170\u0026nbsp;rpm. This culture was diluted 15:100 with 2xYT medium plus both antibiotics (same concentration as before) and incubated at 37\u0026nbsp;\u0026deg;C at 170\u0026nbsp;rpm until they reached OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.4 (approximately 0.5\u0026nbsp;h). Once the culture reached OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.4, the dsRNA production was induced with the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG), 0.4\u0026nbsp;mM final concentration, and a two-hour incubation at the same conditions (3.35\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e \u0026ndash; 4.02\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e CFU/ml). This culture was centrifuged for 10\u0026nbsp;min at 4,000\u0026nbsp;rpm and 10\u0026nbsp;\u0026deg;C, and the cell pellet was washed twice in one volume of sodium phosphate buffer (PBS) (Thermo Fisher) and later re-suspended in half the initial volume in PBS. The \u003cem\u003eE. coli\u003c/em\u003e cells were heat-killed by placing the tube with the resuspended pellet in boiling water for 15\u0026nbsp;min. The resuspended inactivated cells were aliquoted and stored at -70\u0026nbsp;\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003edsRNA quantification\u003c/strong\u003e \u003cp\u003eWe used 3 aliquots of 250\u0026nbsp;\u0026micro;l of the inactivated cells to extract and quantify dsRNA. We centrifuged each tube of cells at 3,700 x g for 10\u0026nbsp;min at 4\u0026nbsp;\u0026deg;C, removed the supernatant, resuspended the pellet with 50\u0026nbsp;\u0026micro;l of 1% SDS in PBS and boiled them for 2\u0026nbsp;min in a water bath. After 10\u0026nbsp;min at room temperature, 64\u0026nbsp;\u0026micro;l of RNAse buffer (300\u0026nbsp;mM sodium acetate, 10\u0026nbsp;mM Tris-HCl pH 7.5 and 5\u0026nbsp;mM EDTA) and 2\u0026nbsp;\u0026micro;g of RNase A (Sigma Aldrich, MO, USA) were added and the mixture incubated at 37\u0026nbsp;\u0026deg;C for 5\u0026nbsp;min to degrade single stranded RNA. We extracted the dsRNA with 750\u0026nbsp;\u0026micro;l of Trizol LS Reagent (Invitrogen, MA, USA) according to manufacturer instructions. The RNA pellet was resuspended in 20\u0026nbsp;\u0026micro;l of DEPC water and 1\u0026nbsp;\u0026micro;l of the suspension was quantified on a Nanodrop one C (Thermo Fisher).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRNAi feeding experiments in larvae\u003c/b\u003e: Groups of 20 larvae (L2) of \u003cem\u003eAn. albimanus\u003c/em\u003e Stecla were set in individual 150\u0026nbsp;mm x 25\u0026nbsp;mm Petri dishes with 80\u0026nbsp;ml of water. Insectary conditions of temperature, humidity, and light were maintained as described in the mosquito rearing section. Feeding conditions were as following: an artificial bacterial diet (ABD), previously described by Taracena et al. 2019 (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), was added to the Petri dishes with the larvae, for a space of 4\u0026nbsp;h per day. Briefly, 200\u0026nbsp;\u0026micro;l of inactivated bacteria in PBS were complemented with 200\u0026nbsp;mg of a mixture of food (40% fish food (Goldfish, Tetra, Germany), 43% guar gum (Sigma-Aldrich) and 17% Active Yeast) and fed to each replica. After the 4\u0026nbsp;h, the dsRNA mixture was removed and we fed the larvae with conventional food (in this case, Baby 5 cereals Nestum\u0026reg; and active yeast). Negative controls for method validation were established in the following groups: 1) food without bacteria, 2) food with bacteria without plasmid for dsRNA production, 3) food with bacteria with a plasmid for the target dsRNA, but non induced, and 4) food with bacteria with non-related dsRNA. After the determination that no significant difference was observed amongst the negative controls (Additional File 6), the group of Ant-dsRNA was kept for reference in all experiments with actin genes. The larvae were fed daily with ABD until they reached pupation. Quantification of the dsRNA allowed to determine that the feedings were delivering an equivalent of approximately 5.75\u0026nbsp;\u0026micro;g of Ant-dsRNA, 11.90\u0026nbsp;\u0026micro;g for Actin A, and 9.0\u0026nbsp;\u0026micro;g for Actin B at the beginning of each feeding. Degradation of the dsRNA in the medium or inside the larvae was not measured. For each biological replicate (N\u0026thinsp;=\u0026thinsp;80) we had four internal replicates, each with 20 larvae. Observed phenotypes were recorded for all experiments. T-test was performed in comparison to the control group for the flightless phenotype. The Log-Rank Mantel-Cox test was performed for survival curves in comparison to the control group.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression analyses\u003c/b\u003e: Real-time expression analysis was done from 3 samples per group, each sample was composed of a pool of 3 male pupae or 3 female pupae. RNA extractions and cDNA synthesis were done as described in previous sections with the RNeasy Mini Kit (Qiagen) and High-Capacity cDNA Reverse transcription kit (Thermo Fischer). Actin housekeeping (HK) (AALB015483) and Ribosomal protein S7 (Rps7) (AALB010399) were used as reference genes and were amplified with the following primers: Actin F (5'-TACAACTCGATCATGAAGTGCGA-3\u0026acute;) and ActinR (5'-CCCGGGTACATGGTGGTACCGCCGGA-3\u0026acute;) and RpS7F (5'AGAACCAGCAGACCACCATC-3') and RpS7R (5'-ACAACCAGCAACGGTTATGT-3\u0026acute;). The q-RT PCR reaction was carried out with the Power Up SYBR green master mix (Thermo Fisher) with 0.33\u0026nbsp;\u0026micro;M of each primer and 5\u0026nbsp;\u0026micro;l of cDNA diluted at 1:500 in a final volume of 15\u0026nbsp;\u0026micro;l. All samples were run in technical triplicate. The genes were amplified as described previously for the tissue-specific qPCR. Delta-delta Ct (∆∆Ct) analysis was performed using the average of Cts of both Rps7 and Actin HK reference genes for analysis of transcript levels of pupae that received actin A dsRNA and Rps7 only for pupae that were fed with Actin B and compared to pupae fed dsRNA of the \u003cem\u003eant\u003c/em\u003e gene as a control. T-test was performed in comparison to the control group.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eBioinformatics analysis\u003c/strong\u003e \u003cp\u003eA nucleotide BLAST search using the 500\u0026nbsp;bp or 600\u0026nbsp;bp fragment was performed using the VectorBase blast tool with default parameters (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e), using the Aedes and Anopheles data sets. Clustal Muscle software was used to align the two actins with gene transcript accession numbers AALB015469-RA and AALB015489-RA (\u003cem\u003eAn. albimanus\u003c/em\u003e Stecla Gene set AalbS2.6 in VectorBase). The female-biased sequence was aligned with \u003cem\u003eA. darlingi\u003c/em\u003e Coari strain (Gene set AdarC3.8 from Vector Base) genomic scaffold_1503 using Clustal muscle software. A homologue search was done for the AALB015469 and AALB014489 genes within the VectorBase gene tab.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular phylogenetic analysis\u003c/b\u003e: Phylogenetic tree was built using the Maximum likelihood method based on the Tamura-Nei model (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e). Analysis was done with cDNA sequences of the \u003cem\u003eAn. albimanus\u003c/em\u003e sex-biased actins, \u003cem\u003eAn. albimanus\u003c/em\u003e Stecla strain actins (Vector base: AALB015481 and AALB015469), \u003cem\u003eAedes aegypti\u003c/em\u003e flight muscle actin-4 (VectorBase: AAEL001951), muscle actin-1 (VectorBase: AAEL001928) and actin-3 (VectorBase: AAEL0094551); \u003cem\u003eAnopheles gambiae actin-4\u003c/em\u003e homolog (VectorBase: AGAP011515) and \u003cem\u003eD. melanogaster\u003c/em\u003e flight actin 88F (Ensembl: FBtr0083143). An initial tree was obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. Analyses were conducted using the Mega 7.0.18 software (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eData Analysis\u003c/strong\u003e \u003cp\u003eOne-way ANOVA with Tukey's multiple comparisons, Student's t-tests, and Log-Rank Mantel-Cox test were performed with GraphPad Prism Software version 8.02 (Graphpad Software, CA, USAS). All significant values have a p-value of less than 0.05.\u003c/p\u003e \u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003e3'RACE: 3'Rapid amplification of cDNA ends\u003c/p\u003e\n\u003cp\u003eABD: Artificial bacterial diet\u003c/p\u003e\n\u003cp\u003eANOVA: Analysis of variance\u003c/p\u003e\n\u003cp\u003eANT: Aintegumenta gene\u003c/p\u003e\n\u003cp\u003ebp: base pair\u003c/p\u003e\n\u003cp\u003eCDC: Centers for Disease Control and Prevention\u003c/p\u003e\n\u003cp\u003ecDNA: complementary DNA\u003c/p\u003e\n\u003cp\u003eCt: Cycle treshold\u003c/p\u003e\n\u003cp\u003edsRNA: double-stranded RNA\u003c/p\u003e\n\u003cp\u003eEDTA: Ethylenediaminetetraacetic acid\u003c/p\u003e\n\u003cp\u003eFA: female adult\u003c/p\u003e\n\u003cp\u003eFP: female pupae\u003c/p\u003e\n\u003cp\u003eHK: housekeeping\u003c/p\u003e\n\u003cp\u003eIPTG: Isopropyl b-thiogalactopyranoside\u003c/p\u003e\n\u003cp\u003eL3: third instar larva\u003c/p\u003e\n\u003cp\u003eL4: fourth instar larva\u003c/p\u003e\n\u003cp\u003eLB: Luria-Bertani broth\u003c/p\u003e\n\u003cp\u003eMA: male adult\u003c/p\u003e\n\u003cp\u003eMP: male pupae\u003c/p\u003e\n\u003cp\u003eMR4: Malaria Research ad Reference Reagent Resource Center\u003c/p\u003e\n\u003cp\u003ePBS: Sodium phosphate buffer\u003c/p\u003e\n\u003cp\u003ePCR: Polymerase Chain Reaction\u003c/p\u003e\n\u003cp\u003eqPCR: quantitative-Real Time PCR\u003c/p\u003e\n\u003cp\u003eRNAi: RNA interference\u003c/p\u003e\n\u003cp\u003eRNAse: Ribonuclease\u003c/p\u003e\n\u003cp\u003erpm: revolutions per minute\u003c/p\u003e\n\u003cp\u003eSDS: Sodium dodecyl sulfate\u003c/p\u003e\n\u003cp\u003eSIT: sterile insect technique\u003c/p\u003e\n\u003cp\u003eTris-HCl: Tris hydrochloride\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate: \u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication: \u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material: \u003c/strong\u003eThe data that support the findings of this study are available on request from the corresponding author on reasonable request [PP].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests: \u003c/strong\u003eThe authors declare that there are no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding: \u003c/strong\u003eThis research was funded by a program supported by a grant from the Good Ventures Foundation and the Open Philanthropy to the Centers for Disease Control Foundation to support cryopreservation and suppression of female development in Mosquitoes to Assist Research for Malaria, Open Philanthropy project, 2017 to Pamela Pennington and Ellen Dotson. This research project was also supported by International Atomic Energy Agency research contract no. 18786 to Pamela Pennington, as part of the Agency's Coordinated Research Project \"Comparing Rearing Efficiency and Competitiveness of Sterile Male Strains Produced by Genetics, Transgenic or Symbiont-based Technologies\" and from funds from Center for Biotechnology Studies and Center for Health Studies from Universidad del Valle de Guatemala.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCP, MT, PF, PP and ED developed the experiment design. CP, PF, MT, CH, KI, MM and AB performed biological assays and experiments. CP, MT and PP analyzed and interpreted experimental data. CP and MT wrote the manuscript. NP contributed with laboratory and insectary installations. PP, ED and NP made substantial contributions for data acquisition and data analysis and interpretation and revised the final manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research project was supported by International Atomic Energy Agency research contract no. 18786 as part of the Agency's Coordinated Research Project \"Comparing Rearing Efficiency and Competitiveness of Sterile Male Strains Produced by Genetics, Transgenic or Symbiont-based Technologies\u0026rdquo;. The authors would like to thank Jorge Sincal for his help in rearing the mosquitoes at the Universidad del Valle facilities. We thank the Center for Health Studies for providing \u003cem\u003eAn. albimanus\u003c/em\u003e Sanarate strain, insectary, and laboratory facilities. We would like to thank the staff and scientists with the Entomology Branch and the Division of Parasitic Diseases and Malaria for assistance in training for the laboratory work. All primers used in this work were provided by the Biotech Core facilities at CDC. The findings and conclusions in this manuscript are those of the authors and do not necessarily represent the official views of the CDC.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZimmerman RH. Ecology of malaria vectors in the Americas and future direction. Mem Inst Oswaldo Cruz. 1992; 87 Suppl 3:371\u0026ndash;83.\u003c/li\u003e\n\u003cli\u003eSinka ME, Bangs MJ, Manguin S, Rubio-Palis Y, Chareonviriyaphap T, Coetzee M, Mbogo CM, Hemingway J, Patil AP, Temperley WH, Gething PW, Kabaria CW, Burkot TR HR and HS. A global map of dominant malaria vectors. Parasit Vectors. 2012;5(1):69.\u003c/li\u003e\n\u003cli\u003eSinka ME, Rubio-Palis Y, Manguin S, Patil AP, Temperley W H, Gething P, Boeckel TV, Kabaria CW, Harbach RE HS. The dominant Anopheles vectors of human malaria in the Americas: occurrence data, distribution maps and bionomic pr\u0026eacute;cis. Parasit Vectors. 2010;3(1):72.\u003c/li\u003e\n\u003cli\u003eFuller DO, Ahumada ML, Qui\u0026ntilde;ones ML, Herrera S, Beier JC. Near-present and future distribution of Anopheles albimanus in Mesoamerica and the Caribbean Basin modeled with climate and topographic data. Int J Health Geogr. 2012;11:13.\u003c/li\u003e\n\u003cli\u003eGeneva: World Health Organization. World Malaria Report 2017. Vol. Licence: C. 2017. 1\u0026ndash;163 p.\u003c/li\u003e\n\u003cli\u003eYang G-G, Kim D, Pham A, Paul CJ. A Meta-regression analysis of the effectiveness of mosquito nets for malaria control: the value of long-lasting insecticide nets. Int J Environ Res Public Health. 2018;15(546).\u003c/li\u003e\n\u003cli\u003ePenilla PR, Rodr\u0026iacute;guez AD, Hemingway J, Torres JL, Arredondo-Jim\u0026eacute;nez JI, Rodr\u0026iacute;guez MH. Resistance management strategies in malaria vector mosquito control. Baseline data for a large-scale field trial against \u003cem\u003eAnopheles albimanus\u003c/em\u003e in Mexico. Med Vet Entomol. 1998;12(3):217\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eLol JC, Castellanos ME, Liebman KA, Lenhart A, Pennington PM, Padilla NR. Molecular evidence for historical presence of knock-down resistance in \u003cem\u003eAnopheles albimanus\u003c/em\u003e, a key malaria vector in Latin America. Parasit Vectors. 2013;6:268.\u003c/li\u003e\n\u003cli\u003eBrogdon WG, McAllister JC, Corwin AM, Cordon-Rosales C. Oxidase-based DDT\u0026ndash;pyrethroid cross-resistance in Guatemalan \u003cem\u003eAnopheles albimanus\u003c/em\u003e. Pestic Biochem Physiol. 1999;64(2):101\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003ePenilla RP, Rodr\u0026iacute;guez AD, Hemingway J, Trejo A, L\u0026oacute;pez AD, Rodr\u0026iacute;guez MH. Cytochrome P450-based resistance mechanism and pyrethroid resistance in the field \u003cem\u003eAnopheles albimanus\u003c/em\u003e resistance management trial. Pestic Biochem Physiol. 2007;89(2):111\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eQui\u0026ntilde;ones ML, Norris DE, Conn JE, Moreno M, Burkot TR, Bugoro H, et al. Insecticide resistance in areas under investigation by the International Centers of Excellence for Malaria Research: A challenge for malaria control and elimination. Am J Trop Med Hyg. 2015;93Suppl 3:69\u0026ndash;78.\u003c/li\u003e\n\u003cli\u003eBreeland SG, Kliewer JW, Austin JR, Miller CW. Observations on malathion-resistant adults of \u003cem\u003eAnopheles albimanus\u003c/em\u003e Wiedemann in coastal El Salvador. Bull World Health Organ. 1970;43(4):627\u0026ndash;31.\u003c/li\u003e\n\u003cli\u003eKnipling EF. Possibilities of insect control or eradication through the use of sexually sterile males. J Econ Entomol. 1955;48(4):459\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eAlphey L, Benedict M, Bellini R, Clark GG, Dame DA, Service MW, et al. Sterile-insect methods for control of mosquito-borne diseases: an analysis. Vector Borne Zoonotic Dis. 2010;10(3):295\u0026ndash;311.\u003c/li\u003e\n\u003cli\u003ePapathanos PA, Bossin HC, Benedict MQ, Catteruccia F, Malcolm CA, Alphey L, et al. Sex separation strategies: Past experience and new approaches. Malar J. 2009; 8(SUPPL. 2).\u003c/li\u003e\n\u003cli\u003ePapathanos PA, Bourtzis K, Tripet F, Bossin H, Virginio JF, Capurro ML, et al. A perspective on the need and current status of efficient sex separation methods for mosquito genetic control. Parasit Vectors. 2018;11(Suppl 2).\u003c/li\u003e\n\u003cli\u003eFu G, Lees RS, Nimmo D, Aw D, Jin L, Gray P, et al. Female-specific flightless phenotype for mosquito control. Proc Natl Acad Sci U S A. 2010;107(10):4550\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eRubenstein PA. The functional importance of multiple actin isoforms. BioEssays;1990;12(7):309\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eVyazunova I, Lan Q. Stage-specific expression of two actin genes in the yellow fever mosquito, \u003cem\u003eAedes aegypti\u003c/em\u003e. Insect Mol Biol. 2004;13(3):241\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eFyrberg EA, Bond BJ, Hershey ND, Mixter KS, Davidson N. The actin genes of drosophila: Protein coding regions are highly conserved but intron positions are not. Cell. 1981;24(1):107\u0026ndash;16.\u003c/li\u003e\n\u003cli\u003eFyrberg EA, Kindle KL, Davidson N, Sodja A. The actin genes of drosophila: a dispersed multigene family. Cell. 1980;19(2):365\u0026ndash;78.\u003c/li\u003e\n\u003cli\u003eHiromi Y, Hotta Y. Actin gene mutations in Drosophila; heat shock activation in the indirect flight muscles. EMBO J. 1985; 4(7):1681\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eHennessey ES, Drummond DR, Sparrow JC. Molecular genetics of actin function. Biochem J. 1993;291 ( Pt 3(Pt 3):657\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003eJiang X, Biedler JK, Qi Y, Hall AB, Tu Z. Complete dosage compensation in \u003cem\u003eAnopheles stephensi\u003c/em\u003e and the evolution of sex-biased genes in mosquitoes. Genome Biol Evol. 2015;7(7):1914\u0026ndash;24.\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz D, Jimenez A, Marinotti O, James a a. The AeAct-4 gene is expressed in the developing flight muscles of female \u003cem\u003eAedes aegypti\u003c/em\u003e. Insect Mol Biol. 2004;13(5):563\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eMarinotti O, Jasinskiene N, Fazekas A, Scaife S, Fu G, Mattingly ST, et al. Development of a population suppression strain of the human malaria vector mosquito, \u003cem\u003eAnopheles stephensi\u003c/em\u003e. Malar J. 2013;12(1):142.\u003c/li\u003e\n\u003cli\u003eHeinrich JC, Scott MJ. A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proc Natl Acad Sci. 2000;97(15):8229\u0026ndash;32.\u003c/li\u003e\n\u003cli\u003eLabb\u0026eacute; GMC, Scaife S, Morgan SA, Curtis ZH, Alphey LL. Female-specific flightless (fsRIDL) phenotype for control of \u003cem\u003eAedes albopictus\u003c/em\u003e. McCall PJ, editor. PLoS Negl Trop Dis. 2012;6(7):e1724.\u003c/li\u003e\n\u003cli\u003eAdolfi A, Lycett J. Opening the toolkit for genetic analysis and control of Anopheles mosquito vectors. Curr Opin. 2018;30:8\u0026ndash;18.\u003c/li\u003e\n\u003cli\u003eWhyard S, Erdelyan C, Partridge AL, Singh AD, Beebe NW, Capina R. Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs. Parasit Vectors. 2015;8(1):96.\u003c/li\u003e\n\u003cli\u003eWhyard S, Singh AD, Wong S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem Mol Biol. 2009;39(11):824\u0026ndash;32.\u003c/li\u003e\n\u003cli\u003eHuvenne H, Smagghe G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. J Insect Physiol. 2010;56(3):227\u0026ndash;35.\u003c/li\u003e\n\u003cli\u003eJin H, Patil BL, V\u0026eacute;lez AM, Christiaens O, Whyard S, Smagghe G. Double-stranded RNA technology to control insect pests: Current status and challenges. 2020;11.\u003c/li\u003e\n\u003cli\u003eMysore K, Sun L, Tomchaney M, Sullivan G, Adams H, Piscoya AS, et al. siRNA-mediated silencing of \u003cem\u003edoublesex\u003c/em\u003e during female development of the dengue vector mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e. James AA, editor. PLoS Negl Trop Dis. 2015;9(11):1\u0026ndash;21.\u003c/li\u003e\n\u003cli\u003eTaracena ML, Hunt CM, Benedict MQ, Pennington PM, Dotson EM. Downregulation of female \u003cem\u003edoublesex\u003c/em\u003e expression by oral-mediated RNA interference reduces number and fitness of \u003cem\u003eAnopheles gambiae \u003c/em\u003eadult females. Parasites and Vectors. 2019;12:1\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eGammon DB, Mello CC. RNA interference-mediated antiviral defense in insects. Curr Opin Insect Sci. 2015;8:111\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eTimmons L, Court DL, Fire A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e. Gene. 2001;263(1\u0026ndash;2):103\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eMello CC, Conte D. Revealing the world of RNA interference. Nature. 2004;431(7006):338\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003eZhang X, Mysore K, Flannery E, Michel K, Severson DW, Zhu KY, et al. Chitosan/interfering RNA nanoparticle mediated gene silencing in disease vector mosquito larvae. J Vis Exp. 2015;97.\u003c/li\u003e\n\u003cli\u003eHapairai LK, Mysore K, Chen Y, Harper EI, Scheel MP, Lesnik AM, et al. Lure-and-kill yeast interfering RNA larvicides targeting neural genes in the human disease vector mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e. Sci Rep. 2017;7(1).\u003c/li\u003e\n\u003cli\u003eAirs P, Bartholomay LC. RNA interference for mosquito and mosquito-borne disease control. Insects. 2017;8(4).\u003c/li\u003e\n\u003cli\u003eNeafsey DE, Waterhouse RM, Abai MR, Aganezov SS, Alekseyev MA, Allen JE, et al. Mosquito genomics. Highly evolvable malaria vectors: the genomes of 16 Anopheles mosquitoes. Science. 2015;347(6217):1\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eMcGraw EA, O'Neill SL. Beyond insecticides: New thinking on an ancient problem. Vol. 11, Nature Reviews Microbiology. 2013;181\u0026ndash;93.\u003c/li\u003e\n\u003cli\u003eHolt RA, Subramanian GM, Halpern A, Sutton GG, Charlab R, Nusskern DR, et al. The genome sequence of the malaria mosquito \u003cem\u003eAnopheles gambiae.\u003c/em\u003e Science. 2002;298(5591). 129-149.\u003c/li\u003e\n\u003cli\u003ePapa F, Windbichler N, Waterhouse RM, Cagnetti A, D'Amato R, Persampieri T, et al. Rapid evolution of female-biased genes among four species of Anopheles malaria mosquitoes. Genome Res. 2017;27(9):1536\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003ePas \u0026szlig;aniuc B, Zaitlen N, Halperin E. Accurate Estimation of Expression Levels of Homologous Genes in RNA-seq Experiments. Journal of Compt Biol. 2011;18(3): 459-468.\u003c/li\u003e\n\u003cli\u003eParsch J, Ellegren H. The evolutionary causes and consequences of sex-biased gene expression. Nat Rev Genet. 2013;14(2):83\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eBaker DA, Nolan T, Fischer B, Pinder A, Crisanti A, Russell S. A comprehensive gene expression atlas of sex- and tissue-specificity in the malaria vector, \u003cem\u003eAnopheles gambiae\u003c/em\u003e. BMC Genomics. 2011;12.\u003c/li\u003e\n\u003cli\u003eMeisel RP, Malone JH, Clark AG. Disentangling the relationship between sex-biased gene expression and X-linkage. Genome Res. 2012;22(7):1255\u0026ndash;65.\u003c/li\u003e\n\u003cli\u003eSingh IK, Singh S, Mogilicherla K, Shukla JN, Palli SR. Comparative analysis of double-stranded RNA degradation and processing in insects. Sci Rep. 2017;7(1):1\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eWynant N, Santos D, Vanden Broeck J. Biological mechanisms determining the success of RNA interference in insects. In: International Review of Cell and Molecular Biology. Elsevier Inc.; 2014. p. 139\u0026ndash;67.\u003c/li\u003e\n\u003cli\u003eJoga MR, Zotti MJ, Smagghe G, Christiaens O. RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: What we know so far. Front Physiol. 2016;7:1\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eWiltshire RM, Duman-Scheel M. Advances in oral RNAi for disease vector mosquito research and control. Vol. 40, Current Opinion in Insect Science. Elsevier Inc.; 2020. p. 18\u0026ndash;23.\u003c/li\u003e\n\u003cli\u003eAli MW, Zheng WW, Sohail S, Li Q, Zheng WW, Zhang H. A genetically enhanced sterile insect technique against the fruit fly, \u003cem\u003eBactrocera dorsalis\u003c/em\u003e (Hendel) by feeding adult double-stranded RNAs. Sci Rep. 2017;7(1):4063.\u003c/li\u003e\n\u003cli\u003eMcLoughlin AG, Wytinck N, Walker PL, Girard IJ, Rashid KY, de Kievit T, et al. Identification and application of exogenous dsRNA confers plant protection against \u003cem\u003eSclerotinia sclerotiorum\u003c/em\u003e and \u003cem\u003eBotrytis cinerea\u003c/em\u003e. Sci Rep. 2018;8(1):7320.\u003c/li\u003e\n\u003cli\u003eWagner CR, Mahowald AP, Miller KG. One of the two cytoplasmic actin isoforms in Drosophila is essential. Proc Natl Acad Sci USA. 2002;99(12):8037\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003eVedula P, Kurosaka S, Leu NA, Wolf YI, Shabalina SA, Wang J, et al. Diverse functions of homologous actin isoforms are defined by their nucleotide, rather than their amino acid sequence. Elife. 2017;6.\u003c/li\u003e\n\u003cli\u003eDohn TE, Cripps RM. Absence of the Drosophila jump muscle actin Act79B is compensated by up-regulation of Act88F. Dev Dyn. 2018;247(4):642\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eFyrberg EA, Fyrberg CC, Biggs JR, Saville D, Beall CJ, Ketchum A. Functional nonequivalence of Drosophila actin isoforms. Biochem Genet. 1998;36(7\u0026ndash;8):271\u0026ndash;87.\u003c/li\u003e\n\u003cli\u003eRoitberg BD, Mondor EB, Tyerman JGA. Pouncing spider, flying mosquito: blood acquisition increases predation risk in mosquitoes. Behav Ecol. 2003;14(5):736\u0026ndash;40.\u003c/li\u003e\n\u003cli\u003eMuijres FT, Chang SW, van Veen WG, Spitzen J, Biemans BT, Koehl MAR, et al. Escaping blood-fed malaria mosquitoes minimize tactile detection without compromising on take-off speed. J Exp Biol. 2017;220(20):3751\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eIwamoto H. Structure, function and evolution of insect flight muscle. Biophysics (Oxf). 2011;7:21\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eDamiens D, Benedict MQ, Wille M, Gilles JRL, Damiens D, Benedict MQ, et al. An Inexpensive and Effective Larval Diet for \u003cem\u003eAnopheles arabiensis\u003c/em\u003e (Diptera: Culicidae): Eat Like a Horse, a Bird, or a Fish? Journal of Medical Entomol. 2012;49(5):1001\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eBenedict MQ. Methods in Anopheles Research. bei Resour. 2007. Atlanta, CDC. Malaria Research and Reference Reagent Resource Center.\u003c/li\u003e\n\u003cli\u003eTaracena ML, Oliveira PL, Almendares O, Uma\u0026ntilde;a C, Lowenberger C, Dotson EM, et al. Genetically modifying the insect gut microbiota to control Chagas disease vectors through systemic RNAi. PLoS Negl Trop Dis. 2015;9(2):1\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eGiraldo-Calder\u0026oacute;n GI, Calder\u0026oacute;n C, Emrich SJ, Maccallum RM, Maslen G, Dialynas E, et al. VectorBase: an updated bioinformatics resource for invertebrate vectors and other organisms related with human diseases. Nucleic Acids Res. 2015;43:707\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eTamuraK, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993;10(3).\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870\u0026ndash;4.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"female-biased, actin, flight, RNA interference, flightless, Anopheles albimanus, Sterile Insect Technique","lastPublishedDoi":"10.21203/rs.3.rs-114640/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-114640/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground\u003c/p\u003e\u003cp\u003eDespite the progress to eliminate malaria in Central America, focalized transmission persists, and insecticide resistance is on the rise in the primary vector, \u003cem\u003eAnopheles albimanus\u003c/em\u003e.\u0026nbsp;Many of the new control methods being developed depend on the release of a large number of male mosquitoes that must be sorted prior to release. However, \u003cem\u003eAn. albimanus\u003c/em\u003e manual pupal-sex-sorting is not feasible, and therefore, we explored the use of RNA interference (RNAi) targeting genes with a sex-biased expression for female elimination. Here, we evaluated the effect of feeding larvae with dsRNA for a female-biased orthologue of the flight muscle actin gene.\u003c/p\u003e\u003cp\u003eResults\u003c/p\u003e\u003cp\u003eTwo sex-biased actin forms were identified in \u003cem\u003eAn. albimanus\u003c/em\u003e. Gene expression analysis showed a \u0026gt;40-fold higher expression of the AALB015469 transcript in female pupae (p = 0.0048) and adults (p\u0026nbsp;=\u0026nbsp;0.0078) when compared to males. Tissue-specific analysis also suggests this female-biased actin can be an orthologue of the flight muscle actin of \u003cem\u003eAedes aegypti\u003c/em\u003e.\u0026nbsp;\u0026nbsp;At the same time, the AALB015481 transcript showed a \u0026gt;40-fold higher expression in male pupae and adults when compared to females, with no detectable expression in flight muscle. The potential effects of oral-induced RNAi for the female-biased actin were evaluated.\u0026nbsp;Larvae were fed a diet containing either dsRNA for the female-biased actin 3'-UTR alone or for the UTR with an adjoining portion of the C-terminal coding region. A significant number of flightless females resulted from feedings with 3' UTR alone (10.50 ± 5.92 %, p \u0026lt; 0.05) or with the coding region (6.00\u0026nbsp;±\u0026nbsp;2.16\u0026nbsp;%, p \u0026lt; 0.01). Treatment with the 3' UTR alone resulted in a significant number of flightless males (8.25\u0026nbsp;±\u0026nbsp;3.10 %, p \u0026lt; 0.01).\u0026nbsp;Both diets produced significant mortality in both female and male adults (p \u0026lt; 0.0001). \u003c/p\u003e\u003cp\u003eConclusions\u003c/p\u003e\u003cp\u003e\u003cspan class=\"ql-cursor\"\u003e\u003c/span\u003eFeeding of \u003cem\u003eAn. albimanus\u003c/em\u003e larvae with dsRNA targeting the female-biased flight muscle actin orthologue impairs flight in both sexes and affects the overall survival of female and male mosquitoes.\u0026nbsp;Providing dsRNA in the larval diet shows promise as a method for screening other differentially expressed genes as potential targets for female elimination in mosquito breeding facilities.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Oral Delivery of dsRNA Targeting a Female-Biased Flight Muscle Actin Impairs Flight in the Malaria Vector, Anopheles Albimanus.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-12-01 18:02:27","doi":"10.21203/rs.3.rs-114640/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5498211d-18d1-42d3-a75f-406818e9adcf","owner":[],"postedDate":"December 1st, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":1232237,"name":"Parasitology"}],"tags":[],"updatedAt":"2020-12-01T18:02:28+00:00","versionOfRecord":[],"versionCreatedAt":"2020-12-01 18:02:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-114640","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-114640","identity":"rs-114640","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.