Lipoaspirate-derived secretome activates NRF2 to restore redox homeostasis and attenuate pathological scar formation

Lipoaspirate-derived secretome activates NRF2 to restore redox homeostasis and attenuate pathological scar formation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Lipoaspirate-derived secretome activates NRF2 to restore redox homeostasis and attenuate pathological scar formation Xin Huang, Pengbing Ding, Zhixuan Sun, Haibo Xiang, Muqian Wei, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8578429/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background : Pathological scars are characterized by persistent fibroblast activation and excessive extracellular matrix (ECM) deposition. Although oxidative stress and dysregulated NRF2 signaling drive TGF-β1–mediated fibrosis in internal organs, their roles in cutaneous pathological scarring remain unclear. Adipose-derived stromal cell (ADSC) and lipoaspirate-derived extracellular vesicles (EVs) can promote wound repair and reduce fibrosis, but whether their bioactive components restore fibroblast redox homeostasis via NRF2 to mitigate cutaneous pathological scarring is unknown. Methods : Lipoaspirate fluid obtained during standard tumescent liposuction was processed by 100 kDa ultrafiltration to generate a lipoaspirate-derived secretome (LA). Secretome from adipose-derived stromal cell (ADSC) culture supernatant served as a comparator (CS). LA and CS were characterized by nanoparticle tracking analysis, transmission electron microscopy, and EV-associated marker immunoblotting. In vivo efficacy was evaluated in a rabbit ear pathological scar model with weekly intradermal LA injections, assessed by gross imaging, histology/collagen staining, and qPCR. LA versus CS proteomics (DIA LC–MS/MS) with enrichment analysis and single-cell RNA sequencing of paired scar/normal skin were performed. In vitro, TGF-β1–stimulated fibroblasts were treated with LA or CS ± ML385. Redox balance, NRF2 signaling, and profibrotic responses were assessed by fluorometric assays, qPCR, and immunoblotting. Results: LA showed a substantially higher particle yield than CS and was enriched in extracellular vesicles. Weekly intradermal LA injections reduced scar hypertrophy and improved collagen organization in the rabbit ear model. Proteomics (LA vs CS) highlighted cytoprotective pathways, including glutathione metabolism and NRF2-associated antioxidant signaling. scRNA-seq of paired human scar/normal skin samples showed NOX4 upregulation with reduced NRF2 signaling in scar fibroblasts. In vitro, LA (vs CS) attenuated TGF-β1–driven oxidative stress and profibrotic activation, improved GSH/GSSG balance, and suppressed NOX4 and ECM genes; ML385 abrogated these effects. Conclusion : LA is a clinically accessible, EV-enriched acellular therapy that corrects the redox–fibrotic imbalance of pathological scarring by activating NRF2 signaling, suppressing NOX4-linked oxidative stress, and attenuating TGF-β1–driven fibroblast profibrotic activation, thereby improving scar remodeling in vivo. Single-cell transcriptomics identified elevated NOX4 and impaired NRF2 signaling in scar fibroblasts, supporting this mechanism and suggesting LA as a scalable, autologous option for targeting oxidative stress and fibrosis. lipoaspirate secretome extracellular vesicles NRF2 reactive oxygen species pathological scar Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Background Pathological scar formation, including hypertrophic scars and keloids, represents a frequent and clinically challenging complication following trauma, burns, or surgical procedures [1]. Aberrant fibroblast activation is a central driver of this pathology, characterized by excessive proliferation, myofibroblast differentiation, and disproportionate deposition of extracellular matrix (ECM) components such as collagen type I, collagen type III, and fibronectin[2, 3]. A principal upstream regulator of fibrotic processes is transforming growth factor-β (TGF-β)[4], which not only promotes profibrotic gene expression in fibroblasts but also drives excessive reactive oxygen species (ROS) production, often linked to activation of NADPH oxidase 4 (NOX4)[5, 6]. Notably, ROS can reciprocally activate latent TGF-β1. In cell-free systems, ROS generated by ionizing radiation or metal-catalyzed ascorbate reactions can directly convert recombinant latent TGF-β1 to its active form. This oxidative activation appears specific to the TGF-β1 isoform and has been linked to modification of a key methionine residue (Met253) in the latency-associated peptide (LAP-β1) [7]. Together, these observations support the involvement of a TGF-β1-ROS feed-forward loop that sustains profibrotic signaling and promotes downstream ECM accumulation in fibrosis[8]. Although this feed-forward mechanism has been extensively characterized in fibrosis of internal organs (e.g., heart, liver, lung, and kidney)[5, 9-11], whether it is similarly engaged in cutaneous pathological scarring has not been defined. The transcription factor NRF2 serves as a master regulator of cellular antioxidant responses. Upon activation, NRF2 translocates to the nucleus and induces the expression of cytoprotective genes—including HMOX1, NQO1, SOD1/SOD2, GCLM, and GCLC—thereby enhancing glutathione metabolism and alleviating oxidative stress.[12] NRF2 activation has been shown to counteract fibrotic processes by attenuating TGF-β1‑driven ROS elevation and subsequent ECM overproduction[13]. Extracellular vesicles (EVs) derived from adipose‑derived stromal cells (ADSCs) exhibit promising antifibrotic properties[14]. They have been reported to inhibit hypertrophic scarring[15] and to ameliorate high‑glucose‑induced oxidative injury in fibroblasts, accelerating diabetic wound healing through modulation of the KEAP1/NRF2 axis[16]. Moreover, preconditioning stem cells under hypoxic conditions can modify the protein and RNA cargo of their EVs, potentially enhancing their therapeutic potency[17]. Liposuction—a common clinical procedure—subjects adipose tissue to transient hypoxia and mechanical shear. These stresses may enrich the lipoaspirate fluid with vesicular and non-vesicular stress‑responsive cytoprotective factors, altering its bioactive composition. Recent studies indicate that EVs isolated from lipoaspirate fluid can improve graft survival, modulate fibrotic responses[18], promote wound healing[19], and suppress inflammation[20]. Collectively, these findings suggest that lipoaspirate fluid, often discarded as clinical waste, constitutes an accessible and clinically translatable source of therapeutic secretome. However, it remains unclear whether the secretome derived from lipoaspirate can modulate fibroblast redox homeostasis, activate NRF2 signaling, and ultimately attenuate cutaneous pathological scarring. In this study, we demonstrate that the lipoaspirate-derived secretome (LA) possesses potent antioxidant and antifibrotic activity. Single-cell transcriptomic analysis showed that scar fibroblasts display elevated NOX4 expression together with reduced NRF2-associated antioxidant signaling and lower expression of canonical NRF2 target genes compared with normal skin. In line with this redox phenotype, we found that LA activates NRF2 signaling, restores redox balance, attenuates TGF‑β1‑associated oxidative stress and profibrotic activation and reduces pathological scar formation in vitro and in vivo. Our findings identify LA as a readily obtainable, clinically translatable, and acellular therapy for pathological scarring. 2. Materials and methods 2.1 Cell culture Fibroblasts (FBs) were purchased from GuangZhou Jennio Biotech Co., Ltd. (China) and maintained in high-glucose DMEM (DMEM-H) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S, v/v) at 37 °C in a humidified incubator with 5% CO₂. For mechanistic studies, FBs were treated with TGF-β1 (10 ng/mL) and/or secretome concentrates derived from lipoaspirate fluid or ADSC-conditioned medium (LA/CS; 100 μg/mL; prepared as described below), in the presence or absence of the NRF2 inhibitor ML385 (5 μM; vehicle-controlled). Adipose-derived stromal cells (ADSCs) were isolated from the adipose fraction of lipoaspirate collected under sterile conditions following standard tumescent liposuction. The fluid fraction was reserved for LA preparation, and ADSCs were isolated as previously described[21, 22]. ADSCs were cultured in DMEM-H supplemented with 10% FBS and 1% P/S (v/v) at 37 °C with 5% CO₂, and passages 2–5 (P2–P5) were used for subsequent experiments. 2.2 Processing of lipoaspirate fluid derived secretome (LA) Fresh lipoaspirate was centrifuged at 1,000 × g for 10 min at 4 °C to remove intact cells and large debris. After centrifugation, the upper adipose layer was collected for ADSC isolation (as described above), while the middle aqueous fraction was retained for secretome extraction. To remove residual debris, larger particles, and potential microbial contaminants, the fluid was sequentially filtered through 0.8 μm, 0.45 μm, and 0.22 μm sterile syringe filters. The clarified fluid was then concentrated using 100kDa molecular-weight-cutoff ultrafiltration tubes (Millipore, Cat. no. UFC9100) at 4,000 rpm for 20 min at 4°C, yielding a lipoaspirate-derived secretome concentrate. Final concentrate (~400–500 μL) was aliquoted and stored at −80°C. 2.3 Processing of ADSC culture supernatant derived secretome (CS) ADSCs were expanded to P2–P5 and, at 80–90% confluence, were washed with PBS and incubated in DMEM-H containing exosome-depleted FBS (Shanghai Nonin Biological Technology; Cat. no.C3801) for 48 h to allow collect ADSC-derived secretome while minimizing interference from serum-derived vesicles. The conditioned medium was collected and processed as described for LA, including sequential filtration and 100-kDa ultrafiltration. 2.4 Nanoparticle tracking analysis (NTA) Particle size distribution and concentration were determined using a ZetaView system (Particle Metrix, Germany). Samples were diluted in PBS to fall within the instrument’s optimal measurement range and analyzed under identical acquisition settings across samples. Particle concentrations were calculated from multiple video positions per sample (≥11 positions) and averaged for quantification. 2.5 Transmission electron microscopy (TEM) Secretome samples were diluted in PBS (LA was diluted 1:100 due to high particle abundance) and adsorbed onto carbon-coated copper grids for 1–2 min. Grids were then negatively stained with 2% uranyl acetate and imaged using a JEM-1400 transmission electron microscope (JEOL, Japan) operated at 120 kV. 2.6 Incucyte live-cell imaging proliferation assay Fibroblast proliferation was assessed using a live-cell imaging platform (IncuCyte S3, Sartorius). Fibroblasts were seeded in 96-well plates at 4 × 10³ cells/well in complete medium and allowed to attach overnight. Cells were then serum-starved for 12 h for cell-cycle synchronization and subsequently treated with vehicle, TGF-β1 (10 ng/mL), LA (100, 200, or 300 μg/mL), CS (100, 200, or 300 μg/mL), or the indicated combinations. Plates were placed into the Incucyte system, and phase-contrast images were acquired automatically every 4 h for up to 48 h using a 10× objective. For each well, four non-overlapping fields were imaged and analyzed. Cell proliferation was quantified as percent confluence using the Incucyte integrated analysis software (Incucyte®2024A). To account for baseline differences in seeding density, confluence values at each time point were normalized to the corresponding 0 h confluence for each well and expressed as a fold change relative to 0 h (0 h = 1.0). For statistical comparisons, normalized confluence at selected time points (e.g., 12, 24, 36, and 48 h) was used, and group differences were analyzed by one-way ANOVA followed by post hoc tests or by Student’s t test where appropriate, as detailed in the Statistical analysis section. 2.7 Intracellular ROS measurement. Intracellular ROS levels were assessed using the Reactive Oxygen Species Assay Kit (Beyotime, China; Cat. no. S0033S) according to the manufacturer’s instructions. Fibroblasts were assigned to the following groups: CTRL, CS, LA, H₂O₂, CS+H₂O₂, and LA+H₂O₂. Cells in the CS- and LA-related groups were treated with CS or LA (100 μg/mL). For oxidative stress induction, cells were exposed to 3% H₂O₂ for 2 h, with CS or LA pretreatment for 6 h in the combination groups. After treatments, cells were incubated with DCFH-DA working solution, washed, and imaged under a fluorescence microscope using the FITC channel. Fluorescence intensity was quantified in ImageJ and normalized to the CTRL group to obtain relative ROS levels. 2.8 RNA isolation and quantitative real-time PCR (qPCR). Total RNA was extracted from cultured fibroblasts and rabbit scar tissues using TRIZOL reagent (15596018CN; Invitrogen, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. cDNA was synthesized using a TIANGEN reverse transcription kit (TIANGEN, Beijing, China; Cat. no. KR116-02). qPCR was performed using a SYBR Green master mix (QIAGEN, Hilden, Germany; Cat. no. 1129280) on a Bio-Rad CFX real-time PCR system (Bio-Rad, USA). The qPCR primer sequences are listed in Table 1. Table 1 Primer sequences used for qPCR Gene name forward reverse Human-GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Human-COL1A1 GAGGGCCAAGACGAAGACATC CAGATCACGTCATCGCACAAC Human-COL3A1 TTGAAGGAGGATGTTCCCATCT ACAGACACATATTTGGCATGGTT Human-CTGF AAAAGTGCATCCGTACTCCCA CCGTCGGTACATACTCCACAG Human-TBP TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA Human-HPRT1 GACCAGTCAACAGGGGACAT CCTGACCAAGGAAAGCAAAG Human-NQO1 CCTGCCATTCTGAAAGGCTGGT GTGGTGATGGAAAGCACTGCCT Human-NOX4 GCCAGAGTATCACTACCTCCAC CTCGGAGGTAAGCCAAGAGTGT Human-SLC7A11 TCCTGCTTTGGCTCCATGAACG AGAGGAGTGTGCTTGCGGACAT Human-HMOX1 CCAGGCAGAGAATGCTGAGTTC AAGACTGGGCTCTCCTTGTTGC Rabbit-GAPDH AGTATGATTCCACCCACGGC GATGGCCTTCCCGTTGATGA Rabbit-TGFB1 CCAAGTGGACATCAACGGGA ATGTTGAGCCCGTTCCAGAG Rabbit-CTGF CACCCGGGTTACCAATGACA GCTCAAACTTGACCGGCTTG Rabbit-COL1A1 TGGATTGACCCCAACCAAGG GAACTGGAAGCCATCGGTCA Rabbit-FN1 TGCACAGACCATACTGTTTTGG AAGGGGAAGTGGCATAAGGC Rabbit-ACTA2 AGCACTGTCAGGAATCCCGT CAGCTCTTGGAGCATCGTCT 2.9 Western blot analysis. Total protein from LA and CS concentrates and cultured fibroblasts was extracted using RIPA buffer (Applygen, China; Cat. no. C1053) supplemented with protease inhibitors (Applygen, China; Cat. no. P1265). For fibroblasts, nuclear and cytoplasmic proteins were separated using a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, China; Cat. no. P0028). Protein concentrations were determined by the BCA assay, and equal amounts of protein were subjected to SDS–PAGE and transferred onto PVDF membranes (Millipore). Membranes were blocked with 5% non-fat milk and incubated with primary antibodies followed by HRP-conjugated secondary antibodies. Signals were developed using ECL reagents and imaged with a Bio-Rad ChemiDoc™ system. Band intensities were quantified using ImageJ and normalized to appropriate loading controls (GAPDH for total/cytoplasmic proteins and Lamin B for nuclear proteins). 2.10 Intracellular GSH/GSSG ratio detection Intracellular glutathione levels were measured using a GSH/GSSG Assay Kit (Beyotime, China; Cat. no. S0053) following the manufacturer’s instructions. Fibroblasts were seeded in 6-well plates at 2 × 10⁵ cells/well, allowed to adhere for 24 h, and serum-starved for 12 h. Cells were then treated with TGF-β1 (10 ng/mL), LA (100 μg/mL), ML385 (5 μM), or the indicated combinations for 24 h. Total GSH and GSSG were quantified using a microplate reader (412 nm), and the GSH/GSSG ratio was calculated as an index of intracellular redox status. 2.11 Animal model of pathological scar formation and intradermal LA treatment All animal procedures were approved by the Institutional Animal Care and Use Committee of Peking University Health Science Center(approval no. DLASBE0417). This study is reported in accordance with the ARRIVE guidelines 2.0. Twelve female New Zealand white rabbits (2.5–3.0 kg) were included in a paired, within-animal design. For each rabbit, the left ear received vehicle (tumescent solution) and the right ear received LA, resulting in 12 paired comparisons (24 ears in total, analyzed as paired data). On day 0, rabbits underwent unilateral inguinal lipoaspiration under general anesthesia. After disinfection, approximately 10 mL of tumescent solution (500 mL normal saline supplemented with 15 mL of 2% lidocaine and 1 mL of 1% epinephrine) was infiltrated into the groin fat pad, followed by manual aspiration using a 10-mL sterile syringe[23]. The collected lipoaspirate fluid was processed for LA secretome preparation as described above. A rabbit ear pathological scar model was established by creating four 7-mm full-thickness excisional wounds on the ventral surface of each ear (epidermis, dermis, and perichondrium removed)[24]. Wounds were dressed and allowed to heal, and re-epithelialization was typically completed by day 14[25], at which point intradermal injections were initiated. The left ear received tumescent solution (the solvent used for LA), whereas the right ear received LA secretome (40 μg per injection). Injections were delivered into the scar dermis and repeated weekly. Rabbits were euthanized at 1, 2, 3, or 4 weeks after the first injection (n = 3 per time point), and full-thickness scar tissues were harvested for downstream analyses. 2.12 Histological staining and quantitative assessment of scar morphology Excised rabbit ear scar tissues were fixed in 4% paraformaldehyde, dehydrated, paraffin-embedded, and sectioned. Sections were subjected to HE, Masson’s trichrome, and Sirius Red staining using standard protocols. In addition, 4-hydroxynonenal (4-HNE) immunofluorescence staining was performed using an Alexa Fluor 488–conjugated anti-4-HNE antibody (Bioss, Beijing, China; Cat. No. bs-6313R-BF488; 1:400) with DAPI counterstaining. Images were captured for quantitative analysis and measured in ImageJ. For morphometric assessment, the scar elevation index (SEI) was calculated on H&E-stained sections as: SEI = (total thickness of the scar tissue) / (thickness of adjacent normal dermis)[26]. For 4-HNE staining, mean fluorescence intensity (MFI) within the scar region of interest was quantified by an investigator blinded to group allocation. 2.13 Proteomic profiling and bioinformatic analysis Proteins were extracted in lysis buffer containing protease and phosphatase inhibitors, clarified by centrifugation (12,000 × g, 4 °C, 10 min), and quantified by BCA assay. Proteins were reduced, alkylated, diluted, and digested with trypsin, and the resulting peptides were desalted on Strata X SPE columns. Peptides were analyzed by nanoLC–MS/MS on a Vanquish Neo nano-UPLC coupled to an Orbitrap Astral mass spectrometer operated in data-independent acquisition (DIA) mode. Full MS scans were acquired at a resolution of 240,000 over m/z 380–980, and DIA MS/MS spectra were acquired at a resolution of 80,000 using HCD. DIA data were processed with DIA-NN (v1.8) against the Homo sapiens UniProt/Swiss-Prot database (Homo_sapiens_9606_SP_20231220.fasta) using a reverse decoy strategy. Trypsin/P specificity with up to one missed cleavage was assumed, carbamidomethyl (Cys) and N-terminal Met excision were set as fixed modifications, and peptide and protein identifications were filtered at FDR < 1%. Identified proteins were cross-referenced with ExoCarta to annotate extracellular vesicle–associated proteins. Label-free relative protein abundances were used for quantitative comparisons between groups. Fold change (FC) was calculated from mean intensities, and statistical significance was assessed using two-sided Student’s t tests on log2-transformed intensities. Proteins with FC > 1.5 or FC < 1/1.5 and P < 0.05 were considered differentially expressed;Functional enrichment analyses were performed using Fisher’s exact test with annotations from GO, KEGG, Reactome, and WikiPathways. For GO enrichment, the input list comprised proteins upregulated in LA relative to CS with FC > 1.5 and P 2 relative to CS. 2.14 Single-cell transcriptomic analysis Pathological scar (PS) tissue and matched normal skin (NS) tissue were obtained from two patients with approval from the Peking University Third Hospital Medical Science Research Ethics Committee (approval no. M20250686). Single-cell suspensions were prepared and libraries were constructed using the 10x Genomics platform. Sequencing data were processed with Cell Ranger, yielding 16,591 (N1), 11,397 (P1), 15,852 (N2), and 10,216 (P2) cells for downstream analyses. Downstream analyses were performed in R (v4.4.0) using Seurat (v5.1.0). Cells with 7,500 detected genes, or >10% mitochondrial transcripts were removed, and potential doublets were excluded using DoubletFinder (v2.0.4). Datasets were integrated using Harmony (v1.2.3), followed by identification of highly variable genes and PCA. Clustering was performed on the integrated embedding using a shared nearest-neighbor graph, and clusters were visualized using UMAP. Differentially expressed genes were identified with Seurat FindAllMarkers (Wilcoxon rank-sum test with Bonferroni correction). Cell types were annotated based on canonical markers from the literature[27-29], supported by CellMarker[30] and PanglaoDB[31]. For pathway-level quantification, Reactome gene sets related to ECM organization and NRF2/antioxidant signaling were retrieved via msigdbr (v25.1.1) and scored using Seurat AddModuleScore. Canonical NRF2 target genes were curated from the literature and visualized by heatmaps within fibroblasts across conditions. 2.15 Statistical analysis All data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism (version 10.1.2). Differences among multiple groups were assessed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc multiple comparison test. For pairwise comparisons where applicable, Student’s t test was used as specified in figure legends. A two-tailed P < 0.05 was considered statistically significant. Significance levels are indicated as: P < 0.05 (*)， P < 0.01 (**)， P < 0.001 (***) 3. Results 3.1 Lipoaspirate-derived secretome shows higher vesicular yield and EV-marker enrichment than cell-culture supernatant-derived secretome. Nanoparticle tracking analysis (NTA) (Fig. 1A-C) showed that LA had a significantly higher particle concentration and a smaller mean particle diameter (134.56 ± 60.50 nm) compared with CS (186.00 ± 105.42 nm) (P < 0.05), consistent with the abundant vesicle-like nanoparticles observed by transmission electron microscopy (Fig. 1D). Western blot analysis further confirmed the presence of classical EV-associated markers (CD63, ALIX, and TSG101) in the LA fraction (Fig. 1E). Under equal protein loading (30 μg per lane), these markers were barely detectable in the CS fraction, likely owing to its extremely low particle yield. As expected from the characteristics of ultrafiltration, the LA preparation also contained minor non-vesicular components, as indicated by weak detection of the endoplasmic-reticulum marker Calnexin. Together, these data indicate that lipoaspirate-derived LA represents an EV-enriched secretome concentrate with substantially higher particle yield and stronger EV-marker signals than secretome derived from conventional ADSC culture supernatants (CS). 3.2 LA suppresses scar hypertrophy and promotes physiological ECM remodeling in vivo In the rabbit pathological scar model (Fig. 2A), LA treatment produced a clear therapeutic benefit. Gross inspection showed that LA-treated scars became progressively flatter and less erythematous from W2 onward, with sustained improvement through W4 (Fig. 2B). Consistently, the scar elevation index (SEI) was comparable between groups at W1, but was significantly reduced in the LA group at W2–W4 (Fig. 2C), indicating attenuated scar overgrowth. At the molecular level, LA consistently suppressed fibrosis-associated transcripts, including FN1, COL1A1, COL3A1, LOX, and TGF-β1, from W1 to W4 (Fig. 2D). ACTA2 showed a transient increase at W1 and W2, consistent with early wound contraction, but subsequently decreased under LA treatment. Histological findings corroborated these macroscopic changes. At W4, Masson’s trichrome staining revealed a clear architectural difference: LA-treated scars exhibited a more dermis-like structure with finer, loosely organized collagen fibers and better-preserved adnexal structures, whereas scars treated with tumescent fluid remained hypercellular with densely packed, disorganized collagen bundles (Fig. 2E). Sirius Red staining further suggested a shift toward a more physiological collagen composition, as evidenced by an increased proportion of collagen III and a reduced collagen I/III ratio (Fig. 2F). To further evaluate oxidative stress within scar tissues, we performed 4-HNE immunofluorescence staining at W4. CTRL scars displayed strong 4-HNE signals across the scar dermis, whereas LA-treated scars exhibited markedly weaker staining. Quantification confirmed a significant reduction in 4-HNE mean fluorescence intensity (MFI) in the LA group compared with CTRL (Fig. 2G), indicating that LA attenuated lipid peroxidation and oxidative stress in vivo, consistent with its anti-fibrotic effects observed at both the transcriptional and histological levels. Together, these data indicate that LA limits pathological scar overgrowth, facilitates more physiological ECM remodeling, dampens fibroblast activation in vivo, and alleviates oxidative stress. 3.3 Proteomic Profiling Reveals NRF2-Centered Antioxidant Enrichment, Stronger NRF2 Activation, and ROS Reduction with LA Compared to CS To gain insight into the molecular basis of LA’s in vivo activity, we performed comparative proteomic profiling of LA and CS protein concentrates. Cross-referencing identified proteins with ExoCarta indicated that both preparations were EV-enriched, with 86% of proteins annotated as exosome-related (Fig. 3A). Unsupervised clustering clearly separated LA from CS, consistent with distinct secretome compositions (Fig. 3B). GO analysis of proteins upregulated in LA relative to CS supported a cytoprotective, stress-adaptive profile (Fig. 3C). In the Biological Process and Molecular Function categories, enrichment converged on redox homeostasis and antioxidant activities, together with metabolic processes and protein quality control, consistent with an enhanced capacity to buffer oxidative stress. In the Cellular Component category, enriched terms were mainly related to vesicle-associated luminal compartments and proteasome and peptidase complexes, suggesting enrichment of vesicle-linked components and proteasome-mediated proteolysis. Pathway enrichment analysis was performed using proteins significantly upregulated in LA relative to CS (fold change > 2) across KEGG, WikiPathways, and Reactome. Enriched pathways consistently highlighted antioxidant and cytoprotective programs, including glutathione metabolism, NRF2 signaling, KEAP1–NFE2L2 regulation, and cellular responses to chemical stress. (Fig. 3D). Guided by these results, we next assessed NRF2 pathway activity in fibroblasts under TGF-β1 stimulation. LA elicited a robust NRF2 response, with higher expression of HMOX1, NQO1, and SLC7A11, whereas CS induced markedly weaker changes. LA also reduced TGF-β1–induced NOX4 expression, while CS produced a more modest effect (Fig. 3E). To further investigate the impact of NOX4 inhibition on ROS levels, we quantified intracellular ROS accumulation (Fig. 3F). Both CS and LA reduced basal ROS, and upon H₂O₂ exposure, LA pre-treatment resulted in a more substantial reduction in ROS accumulation compared to CS. These findings suggest that the inhibition of NOX4 by LA not only suppresses ROS production but also enhances the cell’s overall antioxidant capacity, leading to more efficient attenuation of oxidative stress compared to CS. These data indicate that LA is enriched in NRF2-associated antioxidant proteins and engages NRF2 signaling in fibroblasts more efficiently than CS, while also suppressing NOX4 expression and reducing ROS production. 3.4 Single-cell analysis reveals NOX4 upregulation and impaired NRF2 antioxidant programs in fibroblasts from pathological scars Single-cell transcriptomic profiling delineated the major cellular constituents of pathological scars and normal skin, including fibroblasts, vascular endothelial cells, lymphatic endothelial cells, immune cells, and epidermal lineages (Fig. 4A). To map potential sources of oxidative stress in scar tissue, we profiled NOX4 expression across major cell types. NOX4 was elevated in fibroblasts as well as vascular and lymphatic endothelial cells in pathological scars (Fig. 4B). Given that fibroblasts represent the principal ECM-producing effector cells in skin fibrosis, we next focused on fibroblasts to examine the relationship between redox imbalance and fibrotic activation. Within fibroblasts, module score analysis demonstrated a reduction of NRF2 antioxidant signaling in pathological scars (Fig. 4C). In parallel, the ECM-related gene set score was markedly increased in scar-derived fibroblasts (Fig. 4D). To further substantiate NRF2 pathway suppression at the gene level, we examined canonical NRF2 target genes within fibroblasts. A panel of well-established NRF2-responsive transcripts—including HMOX1, SLC7A11, NQO1, GCLC, GCLM, and TXNRD1—exhibited coordinated downregulation in pathological scar-derived fibroblasts compared with normal skin (Fig. 4E). Together, these results support a pathological scar-associated fibroblast state characterized by increased oxidative stress, diminished NRF2-associated antioxidant capacity, and increased expression of ECM-related genes. 3.5 LA more effectively suppresses TGF-β1–driven profibrotic activation than CS. To compare the antifibrotic activity of LA and CS, we first monitored fibroblast proliferation under TGF-β1 stimulation. IncuCyte live-cell imaging showed that TGF-β1 markedly reduced proliferation compared with untreated controls (Fig. 5A), consistent with a shift toward a profibrotic, matrix-producing phenotype. Co-treatment with LA significantly alleviated this growth suppression from 12 h onward, whereas CS produced a weaker and less consistent effect (Fig. 5B). We next examined ECM-related gene expression. qPCR analysis showed that LA or CS alone did not increase basal expression of COL1A1, COL3A1, or CTGF, indicating that neither secretome is fibrogenic under resting conditions. In contrast, TGF-β1 robustly upregulated these genes, confirming fibroblast activation. Both LA and CS attenuated TGF-β1–induced ECM gene induction, with LA exerting a more pronounced overall suppression (Fig. 5C). Collectively, these data indicate that LA more effectively suppresses TGF-β1–driven profibrotic activation and ECM gene overexpression than CS. 3.6 NRF2 activation by LA restores redox homeostasis and attenuates profibrotic signaling. To determine whether the antifibrotic effects of LA depend on NRF2-mediated redox regulation, we evaluated glutathione homeostasis and NRF2 pathway readouts in fibroblasts treated with TGF-β1 in the presence or absence of the NRF2 inhibitor ML385. TGF-β1 markedly decreased the intracellular GSH/GSSG ratio, whereas LA substantially restored this redox imbalance (Fig. 6A). Importantly, ML385 abrogated the LA-mediated increase in GSH/GSSG, indicating that the redox-improving effect of LA is NRF2-dependent. Consistent with NRF2 activation under TGF-β1 stress, nuclear–cytoplasmic fractionation followed by western blotting showed increased nuclear NRF2 in the TGF-β1 plus LA group compared with TGF-β1 alone (Fig. 6B). Immunofluorescence quantification further showed a higher nuclear-to-cytoplasmic NRF2 fluorescence ratio in the TGF-β1 plus LA group (Fig. 6C). At both the transcriptional and protein levels, LA enhanced NRF2 pathway activity, and these effects were effectively suppressed by ML385 (Fig. 6D–G). Specifically, LA increased the expression of NRF2 target genes HMOX1, NQO1, and SLC7A11 (Fig. 6D), accompanied by elevated HO-1 protein abundance, which was largely abrogated upon NRF2 inhibition (Fig. 6E). In parallel, LA attenuated TGF-β1–induced upregulation of COL1A1/COL3A1 and CTGF transcripts, and this transcriptional repression was partially reversed by ML385 (Fig. 6F). However, although LA decreased COL1 protein levels both in the absence and presence of TGF-β1, ML385 failed to restore COL1 expression in LA-treated fibroblasts under TGF-β1 stimulation, despite effective NRF2 inhibition (Fig. 6G). This discrepancy suggests that LA may reduce COL1 protein abundance through additional NRF2-independent mechanisms beyond transcriptional regulation under these conditions. 4. Discussion Our study identifies lipoaspirate fluid as an unexpectedly rich source of a bioactive, acellular secretome and demonstrates that a simple ultrafiltration workflow can convert this routinely discarded surgical by-product into a therapeutic preparation that mitigates pathological scar formation. Compared with secretome derived from conventional ADSC culture supernatants, LA yielded substantially more vesicle-associated particles and showed greater enrichment of EV markers, accompanied by distinct bioactivity in fibroblast assays. Because adipose tissue is exposed to transient ischemia, hypoxia, and mechanical shear during aspiration [32], we speculate that liposuction may induce a stress-adaptive secretory response that shapes the vesicular and soluble factor milieu captured in lipoaspirate fluid. Although numerous studies suggest that MSC-derived EVs can attenuate scar formation, clinical translation is often limited by reliance on in vitro expansion, low recoverable material, time-consuming production workflows, and manufacturing cost. In contrast, lipoaspirate fluid is abundant and readily accessible, and LA can be prepared directly from freshly obtained lipoaspirate fluid by ultrafiltration within about an hour, without the need for cell culture or conditioned-medium collection. Routine abdominal liposuction can generate approximately 3–5 L of aspirate, and in our workflow only ~15 mL is sufficient for a single LA preparation. In practical terms, when normalized to the same starting volume, lipoaspirate fluid yielded secretome concentrates that were approximately four orders of magnitude greater than those obtained from ADSC culture supernatants. This difference directly impacts feasibility for repeat dosing, batch production, and standardization. Additionally, ultrafiltration enriches a mixture of vesicular and non-vesicular factors, which may contribute to the potent bioactivity of LA. Immunoblotting detected APOA1 in LA (Fig.S1), a principal component of high-density lipoproteins (HDL). In vivo, APOA1 self-assembles into HDL nanoparticles that undergo continuous remodeling during maturation[33]. HDL has also been reported to carry circulating miRNAs in plasma[34] and to exert anti-inflammatory, antioxidant, and anti-atherosclerotic effects[35, 36]. The presence of APOA1 in LA likely reflects contributions from interstitial fluid and/or minor bleeding during aspiration. Accordingly, APOA1 detection suggests that LA contains HDL-associated, non-vesicular components in addition to EVs. LA showed clear therapeutic benefit in vivo. In a rabbit ear pathological scar model, intradermal LA administration reduced scar elevation and improved dermal architecture and collagen organization, accompanied by a reduced collagen I/III ratio and downregulation of profibrotic markers including TGF-β1, LOX, COL1A1, COL3A1, FN1, and CTGF. Notably, LA also attenuated oxidative stress in scar tissues, as evidenced by decreased 4-HNE immunofluorescence intensity. Mechanistically, our data point to redox regulation as a key mechanism underlying the antifibrotic activity of LA. NRF2 signaling is a key protective regulator in many fibrotic disorders [37, 38]. Our single-cell data indicate that pathological scar fibroblasts display a redox imbalance, characterized by elevated NOX4 expression together with suppressed NRF2 antioxidant signaling and reduced expression of canonical NRF2 target genes.Comparative proteomic profiling of LA versus CS revealed enrichment of cytoprotective pathways, including glutathione metabolism and NRF2-associated stress responses, supporting NRF2-centered antioxidant activity as a distinguishing feature of LA. In fibroblasts, LA promoted NRF2 nuclear accumulation, restored glutathione redox buffering, and induced canonical NRF2 target genes (HMOX1, NQO1, SLC7A11), accompanied by reduced intracellular ROS. LA also attenuated TGF-β1–driven profibrotic activation and reduced oxidative stress, consistent with dampening TGF-β1–ROS feed-forward amplification in fibroblasts.NRF2 inhibition with ML385 markedly diminished LA-induced antioxidant readouts and partially reversed repression of profibrotic transcripts, supporting an NRF2-dependent component. Notably, ML385 did not restore COL1 protein abundance under TGF-β1 stimulation despite effective blockade of NRF2 downstream readouts, indicating that ECM protein output is not fully explained by NRF2-dependent transcription and may additionally reflect post-transcriptional control and/or matrix processing and turnover. This study has several limitations. First, LA is a tissue-derived, ultrafiltration-enriched mixture rather than a single defined entity, and the dominant cellular sources and specific active components responsible for its bioactivity remain unclear, which may complicate its standardization and clinical translation. Second, evidence for NRF2 engagement was obtained mainly in fibroblasts in vitro, the in vivo experiments did not include direct NRF2 gain- or loss-of-function testing. Third, the in vivo work relied on within-animal comparisons of LA versus vehicle control; Due to ethical and feasibility constraints in rabbits, a CS group was not included, and the limited availability of rabbit-reactive antibodies restricted pathway-level validation in scar tissue. Lastly, due to ethical constraints, the number of patients from whom both scar and adjacent normal skin samples could be obtained was limited, resulting in a small sample size for single-cell analysis. This may affect the generalizability of our findings. Although our analysis revealed an imbalance of oxidative stress and NRF2 signaling in scar tissue, consistent with studies in other fibrotic organs, larger cohorts are needed to validate these results. Additionally, the patterns of oxidative stress and NRF2 activation may vary across scar locations due to differences in local skin tension. Future studies should involve larger patient cohorts and genetically modified animal models to further investigate these findings and better address the limitations of this study. Conclusion Our study identifies lipoaspirate-derived secretome (LA) as an EV-enriched, acellular therapeutic agent that modulates redox homeostasis and attenuates pathological scar fibrosis. By activating NRF2-dependent antioxidant pathways and suppressing NOX4-driven oxidative stress, LA disrupts the TGF-β1–ROS feed-forward loop, improving scar architecture and promoting more favorable tissue remodeling in vivo. Single-cell transcriptomics of human pathological scars revealed a fibroblast state with heightened oxidative stress signaling and diminished NRF2-associated antioxidant capacity, which supports the use of LA as a redox-targeted therapeutic. These findings highlight the therapeutic promise of lipoaspirate fluid—a readily accessible, autologous, and scalable resource—as an antifibrotic and antioxidant strategy for mitigating pathological scarring. Abbreviations ADSC: adipose-derived stromal cells; CS: ADSC culture supernatant–derived secretome; ECM: extracellular matrix; EV(s): extracellular vesicle(s); GSH/GSSG: reduced glutathione/oxidized glutathione; LA: lipoaspirate-derived secretome; MSC: mesenchymal stromal cell(s); NOX4: NADPH oxidase 4; NRF2: nuclear factor erythroid 2–related factor 2; ROS: reactive oxygen species; SEI: scar elevation index; TGF-β1: transforming growth factor-beta 1 Declarations Ethics approval and consent to participate The study protocol involving human participants and/or human tissue was approved by the Medical Science Research Ethics Committee of Peking University Third Hospital (approval no. M20250915, A study on the collection of adipose-derived stem cells and extracellular vesicles from lipoaspirate obtained from healthy donors, approved on 20 October 2025; and approval no. IRB00006761-M20250686, Mechanistic study of YAP lactylation in regulating Treg cell function in pathological scars and its crosstalk with fibroblasts, approved on 4 August 2025). Written informed consent was obtained from all relevant patients prior to participation. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Peking University Health Science Center (approval No. DLASBE0417; protocol title: Extracellular Vesicles Derived from Liposuction Aspirate Inhibit Hypertrophic Scar Formation; approved on 18 April 2025). AI use statement ChatGPT was used to assist with English language editing and improving readability. All content was reviewed and revised by the authors, who take full responsibility for the integrity and accuracy of the work. Consent for publication Not applicable. Availability of data and materials The datasets supporting the conclusions of this article are included within the article and its additional files. Competing interests The authors declare that they have no competing interests. Funding This study was supported by Beijing Municipal Nature Science Foundation (Grant No. 7252151). Authors’ contributions Xin Huang : Conceptualization, Formal analysis, Investigation, Methodology, Project administration, Software, Supervision, Validation, Visualization, Writing – original draft. Writing – review & editing. Pengbing Ding : Methodology, Resources, Software. Zhixuan Sun : Methodology, Software. Haibo Xiang : Methodology, Project administration. Muqian Wei : Methodology, Project administration. Hongsen Bi: Conceptualization, Funding acquisition, Supervision, Validation. Zhenmin Zhao : Conceptualization, Data curation, Funding acquisition, Supervision, Validation, Writing – review & editing. Acknowledgements Thanks to the Central Laboratory of Peking University Third Hospital for providing access to experimental instruments, and thanks to the facility staff members for their technical guidance and support throughout this study. References Jeschke MG, Wood FM, Middelkoop E, Bayat A, Teot L, Ogawa R, et al. Scars. Nature Reviews Disease Primers. 2023;9(1). Chun Q, ZhiYong W, Fei S, XiQiao W. Dynamic biological changes in fibroblasts during hypertrophic scar formation and regression. Int Wound J. 2016;13(2):257-62. Broughton G, Janis JE, Attinger CE. The basic science of wound healing. Plastic and Reconstructive Surgery. 2006;117(7):12s-34s. Gauglitz GG, Korting HC, Pavicic T, Ruzicka T, Jeschke MG. Hypertrophic Scarring and Keloids: Pathomechanisms and Current and Emerging Treatment Strategies. Molecular Medicine. 2010;17(1-2):113-25. Cucoranu I, Clempus R, Dikalova A, Phelan PJ, Ariyan S, Dikalov S, et al. NAD(P)H Oxidase 4 Mediates Transforming Growth Factor-β1–Induced Differentiation of Cardiac Fibroblasts Into Myofibroblasts. Circulation Research. 2005;97(9):900-7. Piera-Velazquez S, Makul A, Jiménez SA. Increased expression of NAPDH oxidase 4 in systemic sclerosis dermal fibroblasts: regulation by transforming growth factor β. Arthritis Rheumatol. 2015;67(10):2749-58. Jobling MF, Mott JD, Finnegan MT, Jurukovski V, Erickson AC, Walian PJ, et al. Isoform-specific activation of latent transforming growth factor beta (LTGF-beta) by reactive oxygen species. Radiat Res. 2006;166(6):839-48. Jackson WM, Nesti LJ, Tuan RS. Mesenchymal stem cell therapy for attenuation of scar formation during wound healing. Stem Cell Res Ther. 2012;3(3):20. Hecker L, Vittal R, Jones T, Jagirdar R, Luckhardt TR, Horowitz JC, et al. NADPH oxidase-4 mediates myofibroblast activation and fibrogenic responses to lung injury. Nature Medicine. 2009;15(9):1077-81. Yu S, Wang Y, Shi Y, Yu S, Zhao B, Liao N, et al. Reduced glutathione enhances adipose tissue‐derived mesenchymal stem cell engraftment efficiency for liver fibrosis by targeting TGFβ1/SMAD3/NOX4 pathway. Bioengineering & Translational Medicine. 2024;10(2). Barnes JL, Gorin Y. Myofibroblast differentiation during fibrosis: role of NAD(P)H oxidases. Kidney International. 2011;79(9):944-56. Sies H, Berndt C, Jones DP. Oxidative Stress. Annu Rev Biochem. 2017;86:715-48. Qiao P, Sun Y, Wang Y, Lin S, An Y, Wang L, et al. Activation of NRF2 Signaling Pathway Delays the Progression of Hyperuricemic Nephropathy by Reducing Oxidative Stress. Antioxidants. 2023;12(5). Sun J, Shi CS, Wang DL. [Research advances on the roles of exosomes derived from mesenchymal stem cells in wound healing and prevention and treatment of hypertrophic scars]. Zhonghua Shao Shang Za Zhi. 2021;37(5):495-500. Zhu YZ, Hu X, Zhang J, Wang ZH, Wu S, Yi YY. Extracellular Vesicles Derived From Human Adipose-Derived Stem Cell Prevent the Formation of Hypertrophic Scar in a Rabbit Model. Ann Plast Surg. 2020;84(5):602-7. Tian C, Xu H, Li C, Gao J, Zhang H, Wang P, et al. ADSC exosomes improve high glucose induced fibroblast oxidative stress injury and accelerate DFU wound healing via regulating Keap1/Nrf2 axis. Cell Signal. 2025;134:111936. Su Y, Lu J, Liang F, Cheng J. Hypoxia-Induced Extracellular Vesicles Derived from Human Umbilical Cord Mesenchymal Stem Cells Regulate Macrophage Polarization and Enhance Angiogenesis to Promote Diabetic Wound Healing. Biomolecules. 2025;15(11):1504. Nie F, Ding P, Zhang C, Zhao Z, Bi H. Extracellular vesicles derived from lipoaspirate fluid promote fat graft survival. Adipocyte. 2021;10(1):293-309. Wu Y, Hong P, Liu P, Zhang Q, Zhang Y, Yang B, et al. Lipoaspirate fluid derived factors and extracellular vesicles accelerate wound healing in a rat burn model. Frontiers in Bioengineering and Biotechnology. 2023;11. Tian M, Ticer T, Wang Q, Walker S, Pham A, Suh A, et al. Adipose-Derived Biogenic Nanoparticles for Suppression of Inflammation. Small. 2020;16(10):e1904064. Mushahary D, Spittler A, Kasper C, Weber V, Charwat V. Isolation, cultivation, and characterization of human mesenchymal stem cells. Cytometry Part A. 2018;93(1):19-31. Deng C, Liu B, Zhang J. [Primary culture of adipose-derived stromal cells]. Sheng Wu Yi Xue Gong Cheng Xue Za Zhi. 2014;31(4):842-5. Pak I, Askarov M, Kissamedenov N, Klyuyev D, Kamyshanskiy Y. Experimental study on clinical and morphological determination of the optimal cannula diameter for lipoaspirate harvest from rabbit inguinal fat pad. Journal of Applied Biomedicine. 2023;21(2):99-105. Yang Z-R, Suo H, Fan J-W, Lv N, Du K, Ma T, et al. Endogenous stimuli-responsive separating microneedles to inhibit hypertrophic scar through remodeling the pathological microenvironment. Nature Communications. 2024;15(1). Nabai L, Ghahary A. Hypertrophic Scarring in the Rabbit Ear: A Practical Model for Studying Dermal Fibrosis. Fibrosis. Methods in Molecular Biology2017. p. 81-9. Guo S, Kang G, Phan DT, Hsu MN, Por YC, Chen CH. Polymerization-Induced Phase Separation Formation of Structured Hydrogel Particles via Microfluidics for Scar Therapeutics. Sci Rep-Uk. 2018;8(1). Deng C-C, Hu Y-F, Zhu D-H, Cheng Q, Gu J-J, Feng Q-L, et al. Single-cell RNA-seq reveals fibroblast heterogeneity and increased mesenchymal fibroblasts in human fibrotic skin diseases. Nature Communications. 2021;12(1). Vorstandlechner V, Laggner M, Kalinina P, Haslik W, Radtke C, Shaw L, et al. Deciphering the functional heterogeneity of skin fibroblasts using single‐cell RNA sequencing. The FASEB Journal. 2020;34(3):3677-92. Lendahl U, Muhl L, Betsholtz C. Identification, discrimination and heterogeneity of fibroblasts. Nature Communications. 2022;13(1). Hu C, Li T, Xu Y, Zhang X, Li F, Bai J, et al. CellMarker 2.0: an updated database of manually curated cell markers in human/mouse and web tools based on scRNA-seq data. Nucleic Acids Res. 2023;51(D1):D870-d6. Franzén O, Gan L-M, Björkegren JLM. PanglaoDB: a web server for exploration of mouse and human single-cell RNA sequencing data. Database. 2019;2019. Coleman S, Mazzola R. Coleman Fat Grafting: From Filling to Regeneration. People's Military Medical Press, Beijing. 2014. Mulder WJM, van Leent MMT, Lameijer M, Fisher EA, Fayad ZA, Pérez-Medina C. High-Density Lipoprotein Nanobiologics for Precision Medicine. Accounts of Chemical Research. 2017;51:127-37. Vickers KC, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. NATURE CELL BIoLogy. 2011;13:423-33. Beazer Jack D, Patanapirunhakit P, Gill Jason MR, Graham D, Karlsson H, Ljunggren S, et al. High-density lipoprotein’s vascular protective functions in metabolic and cardiovascular disease – could extracellular vesicles be at play? Clinical Science. 2020;134:2977-86. Barter PJ, Nicholls S, Rye K-A, Anantharamaiah GM, Navab M, Fogelman AM. Antiinflammatory Properties of HDL. Circulation Research. 2004;95:764-72. Zhang Z, Qu J, Zheng C, Zhang P, Zhou W, Cui W, et al. Nrf2 antioxidant pathway suppresses Numb-mediated epithelial–mesenchymal transition during pulmonary fibrosis. Cell Death & Disease. 2018;9(2). Xu W, Hellerbrand C, Köhler UA, Bugnon P, Kan Y-W, Werner S, et al. The Nrf2 transcription factor protects from toxin-induced liver injury and fibrosis. Laboratory Investigation. 2008;88(10):1068-78. Additional Declarations No competing interests reported. Supplementary Files Supplement1.tif AuthorChecklist.pdf singlecellrawdata.zip proteomicrawdata.zip Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 01 Apr, 2026 Reviews received at journal 26 Mar, 2026 Reviewers agreed at journal 06 Mar, 2026 Reviewers invited by journal 04 Mar, 2026 Editor assigned by journal 23 Feb, 2026 Submission checks completed at journal 04 Feb, 2026 First submitted to journal 02 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8578429","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":601956628,"identity":"56b3492b-6018-4ab0-ad77-3c9b32a9e999","order_by":0,"name":"Xin Huang","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Huang","suffix":""},{"id":601956637,"identity":"dfe5e986-6d4f-4974-9b61-66907ac8826d","order_by":1,"name":"Pengbing Ding","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Pengbing","middleName":"","lastName":"Ding","suffix":""},{"id":601956638,"identity":"759b42f7-1267-4215-ac52-011ca6b068fe","order_by":2,"name":"Zhixuan Sun","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhixuan","middleName":"","lastName":"Sun","suffix":""},{"id":601956639,"identity":"650e993e-cbd2-4fa8-8efc-31b19c558a8a","order_by":3,"name":"Haibo Xiang","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Haibo","middleName":"","lastName":"Xiang","suffix":""},{"id":601956640,"identity":"3fb1bdfd-7d95-4b94-93f9-08c6eb77b7d1","order_by":4,"name":"Muqian Wei","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Muqian","middleName":"","lastName":"Wei","suffix":""},{"id":601956644,"identity":"064783dd-9194-423c-b0eb-3dd3c4b85e9b","order_by":5,"name":"Hongsen Bi","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hongsen","middleName":"","lastName":"Bi","suffix":""},{"id":601956645,"identity":"e2d1d5cd-bd67-4398-813c-1329f6237668","order_by":6,"name":"Zhenmin Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYHACNhAhx8BMqhZj0rUkNhCtXr7/dNpjnj+H0+e38x78wFBjE01QC2PD2e3GvG2Hczcc5kuWYDiWlkvQOmbG3m3SvA1ALcw8BhKMQAZBLWzMvNukQQ6Tb+Yx/kGUFh42kBa2wwkMh3nMiLNFgod3u+HctnTDDUAtFgnE+EW+/+y2B2/+WMvL958xvvGhxoawFhBg4mFohrASiFEOAow/GOqIVTsKRsEoGAUjEQAAuUc5QgdDpFIAAAAASUVORK5CYII=","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":true,"prefix":"","firstName":"Zhenmin","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2026-01-12 07:23:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8578429/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8578429/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104405955,"identity":"80572893-3bce-42f7-98d8-3adc515b7c3d","added_by":"auto","created_at":"2026-03-11 12:24:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":323769,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of the lipoaspirate-derived secretome (LA) and the cell-culture supernatant–derived secretome (CS)\u003c/strong\u003e. (A–C) Nanoparticle tracking analysis (NTA) showing particle size distribution and concentration in LA and CS. LA displayed a higher particle concentration and smaller mean diameter than CS (mean ± SD; *P \u0026lt; 0.05). (D) Representative TEM images showing round, cup-shaped vesicular structures in CS (1) and LA (2). The LA sample was diluted 1:100 in PBS before imaging because of its high particle concentration. (E) Western blot analysis of EV-associated markers (30 μg/lane).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/3614abfce35b1878fdf82d18.png"},{"id":104310174,"identity":"f5178ca9-d922-4bf2-8263-26c1780edd9f","added_by":"auto","created_at":"2026-03-10 10:53:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":559274,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLA reduces scar hypertrophy and normalizes collagen architecture in vivo. \u003c/strong\u003e(A)Schematic overview of unilateral inguinal lipoaspirate for LA preparation and its subsequent intradermal application to rabbit ear scars. (B) Representative macroscopic images of rabbit ear scars from Day 0 through Week 4 (W1–W4) after treatment initiation, showing reduced scar size, elevation, and erythema in LA-treated ears compared with controls. (C) H\u0026amp;E staining of rabbit ear scars, with black lines indicating the maximal scar thickness and the thickness of adjacent normal dermis used for SEI calculation, and corresponding quantification of the scar elevation index (SEI). Data are shown as mean ± SD (n = 3) and analyzed by paired t-test. (D) Heatmap of fibrosis-associated gene expression in scars from W1 to W4. Values represent fold change (LA vs CTRL) by qPCR. (E) Masson’s trichrome staining at W4, illustrating denser, compact collagen bundles in control scars and looser, more dermis-like collagen organization in LA-treated scars. (F) Sirius Red staining under polarized light at W4 and quantification of the relative proportions of collagen I (red/orange birefringence) and collagen III (green birefringence).\u003cstrong\u003e (G)\u003c/strong\u003eRepresentative immunofluorescence images of 4-HNE immunofluorescence staining of rabbit ear scars (CTRL and LA), with DAPI counterstaining, and corresponding quantification of 4-HNE mean fluorescence intensity (MFI). Data are shown as mean ± SD (n = 3 Rabbits). *, **, *** indicate p \u0026lt; 0.05, p\u0026lt; 0.01 and p\u0026lt; 0.001 respectively.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/41c1d9b4ab1914dba29cd307.png"},{"id":104405113,"identity":"f774b1ae-21a5-4250-b788-1124d8c852fa","added_by":"auto","created_at":"2026-03-11 12:21:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":465872,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProteomic profiling and transcriptional validation highlight NRF2-centered antioxidant enrichment in LA.\u003c/strong\u003e (A) Pie chart showing the overlap of identified proteins with the ExoCarta database, indicating extracellular vesicle (EV) enrichment of the LA secretome. (B) Heatmap of differentially expressed proteins between LA and CS samples. (C) Gene Ontology enrichment analysis of proteins upregulated in LA (fold change \u0026gt; 2), shown for Biological Process, Cellular Component, and Molecular Function categories. (D) Pathway enrichment analysis of LA-upregulated proteins across KEGG, WikiPathways, and Reactome databases, highlighting terms related to glutathione metabolism, KEAP1–NFE2L2 (NRF2) signaling, and cellular response to chemical stress. (E) qPCR validation of NRF2-associated targets (HMOX1, NQO1, SLC7A11) and NOX4 expression in fibroblasts under the indicated treatments. Data are presented as mean ± SD (n = 3) and analyzed by one-way ANOVA with Tukey’s post hoc test. *, **, ***, **** denote p \u0026lt; 0.05, 0.01, 0.001, and 0.0001, respectively; ns, not significant. (F) DCFH-DA–based measurement of intracellular ROS, including representative fluorescence images and quantification of relative fluorescence intensity normalized to the CTRL group. *, ** denote p \u0026lt; 0.05 and p \u0026lt; 0.01 versus CTRL, and ###, #### denote p \u0026lt; 0.001 and p \u0026lt; 0.0001 versus the H₂O₂ group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/e9bfdd95d65ad9d737ec854d.png"},{"id":104310184,"identity":"961acd76-06f1-47c7-b172-0f3c79a3d352","added_by":"auto","created_at":"2026-03-10 10:53:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":184765,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSingle-cell transcriptomics reveals NOX4 enrichment and impaired NRF2 antioxidant programs in pathological scar fibroblasts.\u003c/strong\u003e (A)UMAP visualization of integrated single-cell RNA-seq data from paired pathological scar (PS) and normal skin (NS) samples, with major cell populations annotated using canonical markers and database-assisted references. (B)The proportion of NOX4-expressing cells across major cell types in PS and NS. (C-D) Fibroblast-focused comparison of pathway activity based on AddModuleScore using Reactome gene sets, including REACTOME_KEAP1_NFE2L2_PATHWAY and REACTOME_EXTRACELLULAR_MATRIX_ORGANIZATION. (E)Heatmap showing expression patterns of representative NRF2-responsive antioxidant genes in fibroblasts from PS versus NS.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/65127765d5e0f0aa1add79d2.png"},{"id":104779677,"identity":"10ef0ad1-6deb-4da5-b3fb-bd1bab292654","added_by":"auto","created_at":"2026-03-17 07:44:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":158624,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLA more effectively alleviates TGF-β1–associated fibroblast growth suppression and ECM gene induction than CS.\u003c/strong\u003e(A) Real-time proliferation curves acquired by IncuCyte live-cell imaging. Confluence was normalized to baseline (0 h). (B) Quantification of normalized confluence at 12, 24, 36, and 48 h. Data are shown as mean ± SD (n = 6). One-way ANOVA with Tukey’s post hoc test; *, **, *** indicate p \u0026lt; 0.05, 0.01 and 0.001, respectively. (C) qPCR analysis of ECM-related genes. Data are presented as mean ± SD and analyzed by one-way ANOVA followed by Tukey’s test. Data are shown as mean ± SD and analyzed by one-way ANOVA with Tukey’s post hoc test\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/7865d92ec7c59e59306fec9b.png"},{"id":104310176,"identity":"bda44d61-0109-4053-a821-4015dd15e210","added_by":"auto","created_at":"2026-03-10 10:53:01","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":311276,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLA-mediated redox regulation and profibrotic markers under ML385-mediated NRF2 blockade. \u003c/strong\u003e(A) GSH/GSSG ratio in fibroblasts treated with TGF-β1, LA, and/or the NRF2 inhibitor ML385. (B) Nuclear and cytosolic NRF2 protein levels assessed by western blotting after TGF-β1 and/or LA treatment. (C) Representative immunofluorescence images showing NRF2 localization (green) and nuclei (DAPI, blue) under the indicated treatments, with quantification of the nuclear-to-cytoplasmic NRF2 fluorescence intensity ratio. Scale bar, 20μm. (D) qPCR analysis of NRF2-responsive genes under the indicated treatments. (E) HO-1 protein abundance and densitometric quantification in response to TGF-β1, LA, and/or ML385; Data are shown as mean ± SE (n = 3). (F) qPCR analysis of ECM- and ROS-related genes under the indicated treatments. (G) COL1 protein expression and densitometric quantification under the indicated treatments; data are shown as mean ± SE (n = 3). Unless otherwise indicated, data are presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test; *, **, ***, **** indicate p \u0026lt; 0.05, 0.01, 0.001, and 0.0001, respectively.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/a853dfa0969c1f1e11b00825.png"},{"id":104784143,"identity":"3b3abb82-06e8-45da-9790-bdf74102c2ad","added_by":"auto","created_at":"2026-03-17 08:05:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3217266,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/83c73a48-2519-4383-932b-358a6e52e708.pdf"},{"id":104310178,"identity":"ccb918ad-8ae8-4855-93ed-fbbd34ecca6e","added_by":"auto","created_at":"2026-03-10 10:53:01","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":13248324,"visible":true,"origin":"","legend":"","description":"","filename":"Supplement1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/916b2255690ef2e91c65e885.tif"},{"id":104310172,"identity":"ab2a679a-1a47-4722-b711-d64a98bf3808","added_by":"auto","created_at":"2026-03-10 10:53:01","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":117149,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklist.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/167ec05b823f2479bc3651e9.pdf"},{"id":104310202,"identity":"ca69f697-cba0-4251-94e4-f0ff6306c331","added_by":"auto","created_at":"2026-03-10 10:53:21","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":415193451,"visible":true,"origin":"","legend":"","description":"","filename":"singlecellrawdata.zip","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/eefdd47495d21f9d5f8e4531.zip"},{"id":104310182,"identity":"fdbf1114-4dbc-4a9c-932e-fbd90e294867","added_by":"auto","created_at":"2026-03-10 10:53:05","extension":"zip","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":126703635,"visible":true,"origin":"","legend":"","description":"","filename":"proteomicrawdata.zip","url":"https://assets-eu.researchsquare.com/files/rs-8578429/v1/e5ba2ded336423f0601136e2.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Lipoaspirate-derived secretome activates NRF2 to restore redox homeostasis and attenuate pathological scar formation","fulltext":[{"header":"1. Background ","content":"\u003cp\u003ePathological scar formation, including hypertrophic scars and keloids, represents a frequent and clinically challenging complication following trauma, burns, or surgical procedures [1]. Aberrant fibroblast activation is a central driver of this pathology, characterized by excessive proliferation, myofibroblast differentiation, and disproportionate deposition of extracellular matrix (ECM) components such as collagen type I, collagen type III, and fibronectin[2, 3].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA principal upstream regulator of fibrotic processes is transforming growth factor-\u0026beta; (TGF-\u0026beta;)[4], \u0026nbsp;which not only promotes profibrotic gene expression in fibroblasts but also drives excessive reactive oxygen species (ROS) production, often linked to activation of NADPH oxidase 4 (NOX4)[5, 6]. Notably, ROS can reciprocally activate latent TGF-\u0026beta;1. In cell-free systems, ROS generated by ionizing radiation or metal-catalyzed ascorbate reactions can directly convert recombinant latent TGF-\u0026beta;1 to its active form. This oxidative activation appears specific to the TGF-\u0026beta;1 isoform and has been linked to modification of a key methionine residue (Met253) in the latency-associated peptide (LAP-\u0026beta;1) [7]. Together, these observations support the involvement of a TGF-\u0026beta;1-ROS feed-forward loop that sustains profibrotic signaling and promotes downstream ECM accumulation in fibrosis[8]. Although this feed-forward mechanism has been extensively characterized in fibrosis of internal organs (e.g., heart, liver, lung, and kidney)[5, 9-11], whether it is similarly engaged in cutaneous pathological scarring has not been defined.\u003c/p\u003e\n\u003cp\u003eThe transcription factor NRF2 serves as a master regulator of cellular antioxidant responses. Upon activation, NRF2 translocates to the nucleus and induces the expression of cytoprotective genes\u0026mdash;including\u0026nbsp;HMOX1,\u0026nbsp;NQO1, SOD1/SOD2, GCLM, and GCLC\u0026mdash;thereby enhancing glutathione metabolism and alleviating oxidative stress.[12] NRF2 activation has been shown to counteract fibrotic processes by attenuating TGF-\u0026beta;1‑driven ROS elevation and subsequent ECM overproduction[13].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eExtracellular vesicles (EVs) derived from adipose‑derived stromal cells (ADSCs) exhibit promising antifibrotic properties[14]. They have been reported to inhibit hypertrophic scarring[15] and to ameliorate high‑glucose‑induced oxidative injury in fibroblasts, accelerating diabetic wound healing through modulation of the KEAP1/NRF2 axis[16]. Moreover, preconditioning stem cells under hypoxic conditions can modify the protein and RNA cargo of their EVs, potentially enhancing their therapeutic potency[17].\u003c/p\u003e\n\u003cp\u003eLiposuction\u0026mdash;a common clinical procedure\u0026mdash;subjects adipose tissue to transient hypoxia and mechanical shear. These stresses may enrich the lipoaspirate fluid with vesicular and non-vesicular stress‑responsive cytoprotective factors, altering its bioactive composition. Recent studies indicate that EVs isolated from lipoaspirate fluid can improve graft survival, modulate fibrotic responses[18], promote wound healing[19], and suppress inflammation[20]. Collectively, these findings suggest that lipoaspirate fluid, often discarded as clinical waste, constitutes an accessible and clinically translatable source of therapeutic secretome. However, it remains unclear whether the secretome derived from lipoaspirate can modulate fibroblast redox homeostasis, activate NRF2 signaling, and ultimately attenuate cutaneous pathological scarring.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, we demonstrate that the lipoaspirate-derived secretome (LA) possesses potent antioxidant and antifibrotic activity. Single-cell transcriptomic analysis showed that scar fibroblasts display elevated NOX4 expression together with reduced NRF2-associated antioxidant signaling and lower expression of canonical NRF2 target genes compared with normal skin. In line with this redox phenotype, we found that LA activates NRF2 signaling, restores redox balance, attenuates TGF‑\u0026beta;1‑associated oxidative stress and profibrotic activation and reduces pathological scar formation in vitro and in vivo. Our findings identify LA as a readily obtainable, clinically translatable, and acellular therapy for pathological scarring.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFibroblasts (FBs) were purchased from GuangZhou Jennio Biotech Co., Ltd. (China) and maintained in high-glucose DMEM (DMEM-H) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S, v/v) at 37 \u0026deg;C in a humidified incubator with 5% CO₂. For mechanistic studies, FBs were treated with TGF-\u0026beta;1 (10 ng/mL) and/or secretome concentrates derived from lipoaspirate fluid or ADSC-conditioned medium (LA/CS; 100 \u0026mu;g/mL; prepared as described below), in the presence or absence of the NRF2 inhibitor ML385 (5 \u0026mu;M; vehicle-controlled).\u003c/p\u003e\n\u003cp\u003eAdipose-derived stromal cells (ADSCs) were isolated from the adipose fraction of lipoaspirate collected under sterile conditions following standard tumescent liposuction. The fluid fraction was reserved for LA preparation, and ADSCs were isolated as previously described[21, 22]. ADSCs were cultured in DMEM-H supplemented with 10% FBS and 1% P/S (v/v) at 37 \u0026deg;C with 5% CO₂, and passages 2\u0026ndash;5 (P2\u0026ndash;P5) were used for subsequent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Processing of lipoaspirate fluid derived secretome (LA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFresh lipoaspirate was centrifuged at 1,000 \u0026times; g for 10 min at 4 \u0026deg;C to remove intact cells and large debris. After centrifugation, the upper adipose layer was collected for ADSC isolation (as described above), while the middle aqueous fraction was retained for secretome extraction.\u003c/p\u003e\n\u003cp\u003eTo remove residual debris, larger particles, and potential microbial contaminants, the fluid was sequentially filtered through 0.8 \u0026mu;m, 0.45 \u0026mu;m, and 0.22 \u0026mu;m sterile syringe filters.\u003c/p\u003e\n\u003cp\u003eThe clarified fluid was then concentrated using 100kDa molecular-weight-cutoff ultrafiltration tubes (Millipore, Cat. no. UFC9100) at 4,000 rpm for 20 min at 4\u0026deg;C, yielding a lipoaspirate-derived secretome concentrate. Final concentrate (~400\u0026ndash;500 \u0026mu;L) was aliquoted and stored at \u0026minus;80\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Processing of ADSC culture supernatant derived secretome (CS)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eADSCs were expanded to P2\u0026ndash;P5 and, at 80\u0026ndash;90% confluence, were washed with PBS and incubated in DMEM-H containing exosome-depleted FBS (Shanghai Nonin Biological Technology; Cat. no.C3801) for 48 h to allow collect ADSC-derived secretome while minimizing interference from serum-derived vesicles. The conditioned medium was collected and processed as described for LA, including sequential filtration and 100-kDa ultrafiltration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Nanoparticle tracking analysis (NTA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eParticle size distribution and concentration were determined using a ZetaView system (Particle Metrix, Germany). Samples were diluted in PBS to fall within the instrument\u0026rsquo;s optimal measurement range and analyzed under identical acquisition settings across samples. Particle concentrations were calculated from multiple video positions per sample (\u0026ge;11 positions) and averaged for quantification.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Transmission electron microscopy (TEM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSecretome samples were diluted in PBS (LA was diluted 1:100 due to high particle abundance) and adsorbed onto carbon-coated copper grids for 1\u0026ndash;2 min. Grids were then negatively stained with 2% uranyl acetate and imaged using a JEM-1400 transmission electron microscope (JEOL, Japan) operated at 120 kV.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Incucyte live-cell imaging proliferation assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFibroblast proliferation was assessed using a live-cell imaging platform (IncuCyte S3, Sartorius). Fibroblasts were seeded in 96-well plates at 4 \u0026times; 10\u0026sup3; cells/well in complete medium and allowed to attach overnight. Cells were then serum-starved for 12 h for cell-cycle synchronization and subsequently treated with vehicle, TGF-\u0026beta;1 (10 ng/mL), LA (100, 200, or 300 \u0026mu;g/mL), CS (100, 200, or 300 \u0026mu;g/mL), or the indicated combinations.\u003c/p\u003e\n\u003cp\u003ePlates were placed into the Incucyte system, and phase-contrast images were acquired automatically every 4 h for up to 48 h using a 10\u0026times; objective. For each well, four non-overlapping fields were imaged and analyzed. Cell proliferation was quantified as percent confluence using the Incucyte integrated analysis software (Incucyte\u0026reg;2024A).\u003c/p\u003e\n\u003cp\u003eTo account for baseline differences in seeding density, confluence values at each time point were normalized to the corresponding 0 h confluence for each well and expressed as a fold change relative to 0 h (0 h = 1.0). For statistical comparisons, normalized confluence at selected time points (e.g., 12, 24, 36, and 48 h) was used, and group differences were analyzed by one-way ANOVA followed by post hoc tests or by Student\u0026rsquo;s t test where appropriate, as detailed in the Statistical analysis section.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Intracellular ROS measurement.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIntracellular ROS levels were assessed using the Reactive Oxygen Species Assay Kit (Beyotime, China; Cat. no. S0033S) according to the manufacturer\u0026rsquo;s instructions. Fibroblasts were assigned to the following groups: CTRL, CS, LA, H₂O₂, CS+H₂O₂, and LA+H₂O₂. Cells in the CS- and LA-related groups were treated with CS or LA (100 \u0026mu;g/mL). For oxidative stress induction, cells were exposed to 3% H₂O₂ for 2 h, with CS or LA pretreatment for 6 h in the combination groups. After treatments, cells were incubated with DCFH-DA working solution, washed, and imaged under a fluorescence microscope using the FITC channel. Fluorescence intensity was quantified in ImageJ and normalized to the CTRL group to obtain relative ROS levels.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 RNA isolation and quantitative real-time PCR (qPCR).\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cultured fibroblasts and rabbit scar tissues using TRIZOL reagent (15596018CN; Invitrogen, Thermo Fisher Scientific, USA) according to the manufacturer\u0026rsquo;s instructions. cDNA was synthesized using a TIANGEN reverse transcription kit (TIANGEN, Beijing, China; Cat. no. KR116-02). qPCR was performed using a SYBR Green master mix (QIAGEN, Hilden, Germany; Cat. no. 1129280) on a Bio-Rad CFX real-time PCR system (Bio-Rad, USA). The qPCR primer sequences are listed in Table 1.\u003c/p\u003e\n\u003cp\u003eTable 1 Primer sequences used for qPCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eGene name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eforward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003ereverse\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-GAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-COL1A1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eGAGGGCCAAGACGAAGACATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eCAGATCACGTCATCGCACAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-COL3A1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eTTGAAGGAGGATGTTCCCATCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eACAGACACATATTTGGCATGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-CTGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eAAAAGTGCATCCGTACTCCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eCCGTCGGTACATACTCCACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-TBP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eTGCACAGGAGCCAAGAGTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eCACATCACAGCTCCCCACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-HPRT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eGACCAGTCAACAGGGGACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eCCTGACCAAGGAAAGCAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-NQO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eCCTGCCATTCTGAAAGGCTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eGTGGTGATGGAAAGCACTGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-NOX4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eGCCAGAGTATCACTACCTCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eCTCGGAGGTAAGCCAAGAGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-SLC7A11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eTCCTGCTTTGGCTCCATGAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eAGAGGAGTGTGCTTGCGGACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eHuman-HMOX1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eCCAGGCAGAGAATGCTGAGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eAAGACTGGGCTCTCCTTGTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eRabbit-GAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eAGTATGATTCCACCCACGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eGATGGCCTTCCCGTTGATGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eRabbit-TGFB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eCCAAGTGGACATCAACGGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eATGTTGAGCCCGTTCCAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eRabbit-CTGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eCACCCGGGTTACCAATGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eGCTCAAACTTGACCGGCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eRabbit-COL1A1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eTGGATTGACCCCAACCAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eGAACTGGAAGCCATCGGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eRabbit-FN1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eTGCACAGACCATACTGTTTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eAAGGGGAAGTGGCATAAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 22.2022%;\"\u003e\n \u003cp\u003eRabbit-ACTA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2671%;\"\u003e\n \u003cp\u003eAGCACTGTCAGGAATCCCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 39.5307%;\"\u003e\n \u003cp\u003eCAGCTCTTGGAGCATCGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Western blot analysis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal protein from LA and CS concentrates and cultured fibroblasts was extracted using RIPA buffer (Applygen, China; Cat. no. C1053) supplemented with protease inhibitors (Applygen, China; Cat. no. P1265). For fibroblasts, nuclear and cytoplasmic proteins were separated using a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, China; Cat. no. P0028). Protein concentrations were determined by the BCA assay, and equal amounts of protein were subjected to SDS\u0026ndash;PAGE and transferred onto PVDF membranes (Millipore). Membranes were blocked with 5% non-fat milk and incubated with primary antibodies followed by HRP-conjugated secondary antibodies. Signals were developed using ECL reagents and imaged with a Bio-Rad ChemiDoc\u0026trade; system. Band intensities were quantified using ImageJ and normalized to appropriate loading controls (GAPDH for total/cytoplasmic proteins and Lamin B for nuclear proteins).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 Intracellular GSH/GSSG ratio detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIntracellular glutathione levels were measured using a GSH/GSSG Assay Kit (Beyotime, China; Cat. no. S0053) following the manufacturer\u0026rsquo;s instructions. Fibroblasts were seeded in 6-well plates at 2 \u0026times; 10⁵ cells/well, allowed to adhere for 24 h, and serum-starved for 12 h. Cells were then treated with TGF-\u0026beta;1 (10 ng/mL), LA (100 \u0026mu;g/mL), ML385 (5 \u0026mu;M), or the indicated combinations for 24 h. Total GSH and GSSG were quantified using a microplate reader (412 nm), and the GSH/GSSG ratio was calculated as an index of intracellular redox status.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11 Animal model of pathological scar formation and intradermal LA treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal procedures were approved by the Institutional Animal Care and Use Committee of Peking University Health Science Center(approval no. DLASBE0417). This study is reported in accordance with the ARRIVE guidelines 2.0.\u0026nbsp;Twelve female New Zealand white rabbits (2.5\u0026ndash;3.0 kg) were included in a paired, within-animal design. For each rabbit, the left ear received vehicle (tumescent solution) and the right ear received LA, resulting in 12 paired comparisons (24 ears in total, analyzed as paired data).\u003c/p\u003e\n\u003cp\u003eOn day 0, rabbits underwent unilateral inguinal lipoaspiration under general anesthesia. After disinfection, approximately 10 mL of tumescent solution (500 mL normal saline supplemented with 15 mL of 2% lidocaine and 1 mL of 1% epinephrine) was infiltrated into the groin fat pad, followed by manual aspiration using a 10-mL sterile syringe[23]. The collected lipoaspirate fluid was processed for LA secretome preparation as described above.\u003c/p\u003e\n\u003cp\u003eA rabbit ear pathological scar model was established by creating four 7-mm full-thickness excisional wounds on the ventral surface of each ear (epidermis, dermis, and perichondrium removed)[24]. Wounds were dressed and allowed to heal, and re-epithelialization was typically completed by day 14[25], at which point intradermal injections were initiated. The left ear received tumescent solution (the solvent used for LA), whereas the right ear received LA secretome (40 \u0026mu;g per injection). Injections were delivered into the scar dermis and repeated weekly. Rabbits were euthanized at 1, 2, 3, or 4 weeks after the first injection (n = 3 per time point), and full-thickness scar tissues were harvested for downstream analyses.\u003cstrong\u003e\u003cbr\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12 Histological staining and quantitative assessment of scar morphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExcised rabbit ear scar tissues were fixed in 4% paraformaldehyde, dehydrated, paraffin-embedded, and sectioned. Sections were subjected to HE, Masson\u0026rsquo;s trichrome, and Sirius Red staining using standard protocols. In addition, 4-hydroxynonenal (4-HNE) immunofluorescence staining was performed using an Alexa Fluor 488\u0026ndash;conjugated anti-4-HNE antibody (Bioss, Beijing, China; Cat. No. bs-6313R-BF488; 1:400) with DAPI counterstaining. Images were captured for quantitative analysis and measured in ImageJ.\u003c/p\u003e\n\u003cp\u003eFor morphometric assessment, the scar elevation index (SEI) was calculated on H\u0026amp;E-stained sections as: SEI = (total thickness of the scar tissue) / (thickness of adjacent normal dermis)[26]. For 4-HNE staining, mean fluorescence intensity (MFI) within the scar region of interest was quantified by an investigator blinded to group allocation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13 Proteomic profiling and bioinformatic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProteins were extracted in lysis buffer containing protease and phosphatase inhibitors, clarified by centrifugation (12,000 \u0026times; g, 4 \u0026deg;C, 10 min), and quantified by BCA assay. Proteins were reduced, alkylated, diluted, and digested with trypsin, and the resulting peptides were desalted on Strata X SPE columns.\u003c/p\u003e\n\u003cp\u003ePeptides were analyzed by nanoLC\u0026ndash;MS/MS on a Vanquish Neo nano-UPLC coupled to an Orbitrap Astral mass spectrometer operated in data-independent acquisition (DIA) mode. Full MS scans were acquired at a resolution of 240,000 over m/z 380\u0026ndash;980, and DIA MS/MS spectra were acquired at a resolution of 80,000 using HCD. DIA data were processed with DIA-NN (v1.8) against the Homo sapiens UniProt/Swiss-Prot database (Homo_sapiens_9606_SP_20231220.fasta) using a reverse decoy strategy. Trypsin/P specificity with up to one missed cleavage was assumed, carbamidomethyl (Cys) and N-terminal Met excision were set as fixed modifications, and peptide and protein identifications were filtered at FDR \u0026lt; 1%.\u003c/p\u003e\n\u003cp\u003eIdentified proteins were cross-referenced with ExoCarta to annotate extracellular vesicle\u0026ndash;associated proteins. Label-free relative protein abundances were used for quantitative comparisons between groups. Fold change (FC) was calculated from mean intensities, and statistical significance was assessed using two-sided Student\u0026rsquo;s t tests on log2-transformed intensities. Proteins with FC \u0026gt; 1.5 or FC \u0026lt; 1/1.5 and P \u0026lt; 0.05 were considered differentially expressed;Functional enrichment analyses were performed using Fisher\u0026rsquo;s exact test with annotations from GO, KEGG, Reactome, and WikiPathways. For GO enrichment, the input list comprised proteins upregulated in LA relative to CS with FC \u0026gt; 1.5 and P \u0026lt; 0.05. For pathway enrichment (KEGG/Reactome/WikiPathways), to focus on robustly induced signals, we used the subset of upregulated proteins with FC \u0026gt; 2 relative to CS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.14 Single-cell transcriptomic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePathological scar (PS) tissue and matched normal skin (NS) tissue were obtained from two patients with approval from the Peking University Third Hospital Medical Science Research Ethics Committee (approval no. M20250686). Single-cell suspensions were prepared and libraries were constructed using the 10x Genomics platform. Sequencing data were processed with Cell Ranger, yielding 16,591 (N1), 11,397 (P1), 15,852 (N2), and 10,216 (P2) cells for downstream analyses.\u003c/p\u003e\n\u003cp\u003eDownstream analyses were performed in R (v4.4.0) using Seurat (v5.1.0). Cells with \u0026lt;300 or \u0026gt;7,500 detected genes, or \u0026gt;10% mitochondrial transcripts were removed, and potential doublets were excluded using DoubletFinder (v2.0.4). Datasets were integrated using Harmony (v1.2.3), followed by identification of highly variable genes and PCA. Clustering was performed on the integrated embedding using a shared nearest-neighbor graph, and clusters were visualized using UMAP.\u003c/p\u003e\n\u003cp\u003eDifferentially expressed genes were identified with Seurat FindAllMarkers (Wilcoxon rank-sum test with Bonferroni correction). Cell types were annotated based on canonical markers from the literature[27-29], supported by CellMarker[30] and PanglaoDB[31]. For pathway-level quantification, Reactome gene sets related to ECM organization and NRF2/antioxidant signaling were retrieved via msigdbr (v25.1.1) and scored using Seurat AddModuleScore. Canonical NRF2 target genes were curated from the literature and visualized by heatmaps within fibroblasts across conditions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.15 Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are presented as mean \u0026plusmn; standard deviation (SD). Statistical analyses were performed using GraphPad Prism (version 10.1.2). Differences among multiple groups were assessed using one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post hoc multiple comparison test. For pairwise comparisons where applicable, Student\u0026rsquo;s t test was used as specified in figure legends. A two-tailed P \u0026lt; 0.05 was considered statistically significant. Significance levels are indicated as: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 (*)，\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 (**)，\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 (***)\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Lipoaspirate-derived secretome shows higher vesicular yield and EV-marker enrichment than cell-culture supernatant-derived secretome.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eNanoparticle tracking analysis (NTA) (Fig. 1A-C) showed that LA had a significantly higher particle concentration and a smaller mean particle diameter (134.56 \u0026plusmn; 60.50 nm) compared with CS (186.00 \u0026plusmn; 105.42 nm) (P \u0026lt; 0.05), consistent with the abundant vesicle-like nanoparticles observed by transmission electron microscopy (Fig. 1D).\u003c/p\u003e\n\u003cp\u003eWestern blot analysis further confirmed the presence of classical EV-associated markers (CD63, ALIX, and TSG101) in the LA fraction (Fig. 1E). Under equal protein loading (30 \u0026mu;g per lane), these markers were barely detectable in the CS fraction, likely owing to its extremely low particle yield. As expected from the characteristics of ultrafiltration, the LA preparation also contained minor non-vesicular components, as indicated by weak detection of the endoplasmic-reticulum marker Calnexin.\u003c/p\u003e\n\u003cp\u003eTogether, these data indicate that lipoaspirate-derived LA represents an EV-enriched secretome concentrate with substantially higher particle yield and stronger EV-marker signals than secretome derived from conventional ADSC culture supernatants (CS).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 LA suppresses scar hypertrophy and promotes physiological ECM remodeling in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the rabbit pathological scar model (Fig. 2A), LA treatment produced a clear therapeutic benefit. Gross inspection showed that LA-treated scars became progressively flatter and less erythematous from W2 onward, with sustained improvement through W4 (Fig. 2B). Consistently, the scar elevation index (SEI) was comparable between groups at W1, but was significantly reduced in the LA group at W2\u0026ndash;W4 (Fig. 2C), indicating attenuated scar overgrowth.\u003c/p\u003e\n\u003cp\u003eAt the molecular level, LA consistently suppressed fibrosis-associated transcripts, including FN1, COL1A1, COL3A1, LOX, and TGF-\u0026beta;1, from W1 to W4 (Fig. 2D). ACTA2 showed a transient increase at W1 and W2, consistent with early wound contraction, but subsequently decreased under LA treatment.\u003c/p\u003e\n\u003cp\u003eHistological findings corroborated these macroscopic changes. At W4, Masson\u0026rsquo;s trichrome staining revealed a clear architectural difference: LA-treated scars exhibited a more dermis-like structure with finer, loosely organized collagen fibers and better-preserved adnexal structures, whereas scars treated with tumescent fluid remained hypercellular with densely packed, disorganized collagen bundles (Fig. 2E). Sirius Red staining further suggested a shift toward a more physiological collagen composition, as evidenced by an increased proportion of collagen III and a reduced collagen I/III ratio (Fig. 2F).\u003c/p\u003e\n\u003cp\u003eTo further evaluate oxidative stress within scar tissues, we performed 4-HNE immunofluorescence staining at W4. CTRL scars displayed strong 4-HNE signals across the scar dermis, whereas LA-treated scars exhibited markedly weaker staining. Quantification confirmed a significant reduction in 4-HNE mean fluorescence intensity (MFI) in the LA group compared with CTRL (Fig. 2G), indicating that LA attenuated lipid peroxidation and oxidative stress in vivo, consistent with its anti-fibrotic effects observed at both the transcriptional and histological levels.\u003c/p\u003e\n\u003cp\u003eTogether, these data indicate that LA limits pathological scar overgrowth, facilitates more physiological ECM remodeling, dampens fibroblast activation in vivo, and alleviates oxidative stress.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Proteomic Profiling Reveals NRF2-Centered Antioxidant Enrichment, Stronger NRF2 Activation, and ROS Reduction with LA Compared to CS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain insight into the molecular basis of LA\u0026rsquo;s in vivo activity, we performed comparative proteomic profiling of LA and CS protein concentrates. Cross-referencing identified proteins with ExoCarta indicated that both preparations were EV-enriched, with 86% of proteins annotated as exosome-related (Fig. 3A). Unsupervised clustering clearly separated LA from CS, consistent with distinct secretome compositions (Fig. 3B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGO analysis of proteins upregulated in LA relative to CS supported a cytoprotective, stress-adaptive profile (Fig. 3C). In the Biological Process and Molecular Function categories, enrichment converged on redox homeostasis and antioxidant activities, together with metabolic processes and protein quality control, consistent with an enhanced capacity to buffer oxidative stress. In the Cellular Component category, enriched terms were mainly related to vesicle-associated luminal compartments and proteasome and peptidase complexes, suggesting enrichment of vesicle-linked components and proteasome-mediated proteolysis.\u003c/p\u003e\n\u003cp\u003ePathway enrichment analysis was performed using proteins significantly upregulated in LA relative to CS (fold change \u0026gt; 2) across KEGG, WikiPathways, and Reactome. Enriched pathways consistently highlighted antioxidant and cytoprotective programs, including glutathione metabolism, NRF2 signaling, KEAP1\u0026ndash;NFE2L2 regulation, and cellular responses to chemical stress. (Fig. 3D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGuided by these results, we next assessed NRF2 pathway activity in fibroblasts under TGF-\u0026beta;1 stimulation. LA elicited a robust NRF2 response, with higher expression of HMOX1, NQO1, and SLC7A11, whereas CS induced markedly weaker changes. LA also reduced TGF-\u0026beta;1\u0026ndash;induced NOX4 expression, while CS produced a more modest effect (Fig. 3E).\u003c/p\u003e\n\u003cp\u003eTo further investigate the impact of NOX4 inhibition on ROS levels, we quantified intracellular ROS accumulation (Fig. 3F). Both CS and LA reduced basal ROS, and upon H₂O₂ exposure, LA pre-treatment resulted in a more substantial reduction in ROS accumulation compared to CS. These findings suggest that the inhibition of NOX4 by LA not only suppresses ROS production but also enhances the cell\u0026rsquo;s overall antioxidant capacity, leading to more efficient attenuation of oxidative stress compared to CS.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThese data indicate that LA is enriched in NRF2-associated antioxidant proteins and engages NRF2 signaling in fibroblasts more efficiently than CS, while also suppressing NOX4 expression and reducing ROS production.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Single-cell analysis reveals NOX4 upregulation and impaired NRF2 antioxidant programs in fibroblasts from pathological scars\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSingle-cell transcriptomic profiling delineated the major cellular constituents of pathological scars and normal skin, including fibroblasts, vascular endothelial cells, lymphatic endothelial cells, immune cells, and epidermal lineages (Fig. 4A). To map potential sources of oxidative stress in scar tissue, we profiled NOX4 expression across major cell types. NOX4 was elevated in fibroblasts as well as vascular and lymphatic endothelial cells in pathological scars (Fig. 4B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGiven that fibroblasts represent the principal ECM-producing effector cells in skin fibrosis, we next focused on fibroblasts to examine the relationship between redox imbalance and fibrotic activation. Within fibroblasts, module score analysis demonstrated a reduction of NRF2 antioxidant signaling in pathological scars (Fig. 4C). In parallel, the ECM-related gene set score was markedly increased in scar-derived fibroblasts (Fig. 4D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further substantiate NRF2 pathway suppression at the gene level, we examined canonical NRF2 target genes within fibroblasts. A panel of well-established NRF2-responsive transcripts\u0026mdash;including HMOX1, SLC7A11, NQO1, GCLC, GCLM, and TXNRD1\u0026mdash;exhibited coordinated downregulation in pathological scar-derived fibroblasts compared with normal skin (Fig. 4E). Together, these results support a pathological scar-associated fibroblast state characterized by increased oxidative stress, diminished NRF2-associated antioxidant capacity, and increased expression of ECM-related genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 LA more effectively suppresses TGF-\u0026beta;1\u0026ndash;driven profibrotic activation than CS.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo compare the antifibrotic activity of LA and CS, we first monitored fibroblast proliferation under TGF-\u0026beta;1 stimulation. IncuCyte live-cell imaging showed that TGF-\u0026beta;1 markedly reduced proliferation compared with untreated controls (Fig. 5A), consistent with a shift toward a profibrotic, matrix-producing phenotype. Co-treatment with LA significantly alleviated this growth suppression from 12 h onward, whereas CS produced a weaker and less consistent effect (Fig. 5B).\u003c/p\u003e\n\u003cp\u003eWe next examined ECM-related gene expression. qPCR analysis showed that LA or CS alone did not increase basal expression of COL1A1, COL3A1, or CTGF, indicating that neither secretome is fibrogenic under resting conditions. In contrast, TGF-\u0026beta;1 robustly upregulated these genes, confirming fibroblast activation. Both LA and CS attenuated TGF-\u0026beta;1\u0026ndash;induced ECM gene induction, with LA exerting a more pronounced overall suppression (Fig. 5C).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Collectively, these data indicate that LA more effectively suppresses TGF-\u0026beta;1\u0026ndash;driven profibrotic activation and ECM gene overexpression than CS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 NRF2 activation by LA restores redox homeostasis and attenuates profibrotic signaling.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine whether the antifibrotic effects of LA depend on NRF2-mediated redox regulation, we evaluated glutathione homeostasis and NRF2 pathway readouts in fibroblasts treated with TGF-\u0026beta;1 in the presence or absence of the NRF2 inhibitor ML385.\u003c/p\u003e\n\u003cp\u003eTGF-\u0026beta;1 markedly decreased the intracellular GSH/GSSG ratio, whereas LA substantially restored this redox imbalance (Fig. 6A). Importantly, ML385 abrogated the LA-mediated increase in GSH/GSSG, indicating that the redox-improving effect of LA is NRF2-dependent. \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConsistent with NRF2 activation under TGF-\u0026beta;1 stress, nuclear\u0026ndash;cytoplasmic fractionation followed by western blotting showed increased nuclear NRF2 in the TGF-\u0026beta;1 plus LA group compared with TGF-\u0026beta;1 alone (Fig. 6B). Immunofluorescence quantification further showed a higher nuclear-to-cytoplasmic NRF2 fluorescence ratio in the TGF-\u0026beta;1 plus LA group (Fig. 6C).\u003c/p\u003e\n\u003cp\u003eAt both the transcriptional and protein levels, LA enhanced NRF2 pathway activity, and these effects were effectively suppressed by ML385 (Fig. 6D\u0026ndash;G). Specifically, LA increased the expression of NRF2 target genes HMOX1, NQO1, and SLC7A11 (Fig. 6D), accompanied by elevated HO-1 protein abundance, which was largely abrogated upon NRF2 inhibition (Fig. 6E). In parallel, LA attenuated TGF-\u0026beta;1\u0026ndash;induced upregulation of COL1A1/COL3A1 and CTGF transcripts, and this transcriptional repression was partially reversed by ML385 (Fig. 6F). However, although LA decreased COL1 protein levels both in the absence and presence of TGF-\u0026beta;1, ML385 failed to restore COL1 expression in LA-treated fibroblasts under TGF-\u0026beta;1 stimulation, despite effective NRF2 inhibition (Fig. 6G). This discrepancy suggests that LA may reduce COL1 protein abundance through additional NRF2-independent mechanisms beyond transcriptional regulation under these conditions.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOur study identifies lipoaspirate fluid as an unexpectedly rich source of a bioactive, acellular secretome and demonstrates that a simple ultrafiltration workflow can convert this routinely discarded surgical by-product into a therapeutic preparation that mitigates pathological scar formation. Compared with secretome derived from conventional ADSC culture supernatants, LA yielded substantially more vesicle-associated particles and showed greater enrichment of EV markers, accompanied by distinct bioactivity in fibroblast assays. Because adipose tissue is exposed to transient ischemia, hypoxia, and mechanical shear during aspiration [32], we speculate that liposuction may induce a stress-adaptive secretory response that shapes the vesicular and soluble factor milieu captured in lipoaspirate fluid.\u003c/p\u003e\n\u003cp\u003eAlthough numerous studies suggest that MSC-derived EVs can attenuate scar formation, clinical translation is often limited by reliance on in vitro expansion, low recoverable material, time-consuming production workflows, and manufacturing cost. In contrast, lipoaspirate fluid is abundant and readily accessible,\u0026nbsp;and LA can be prepared directly from freshly obtained lipoaspirate fluid by ultrafiltration within about an hour, without the need for cell culture or conditioned-medium collection. Routine abdominal liposuction can generate approximately 3–5 L of aspirate, and in our workflow only ~15 mL is sufficient for a single LA preparation. In practical terms, when normalized to the same starting volume, lipoaspirate fluid yielded secretome concentrates that were approximately four orders of magnitude greater than those obtained from ADSC culture supernatants. This difference directly impacts feasibility for repeat dosing, batch production, and standardization.\u003c/p\u003e\n\u003cp\u003eAdditionally, ultrafiltration enriches a mixture of vesicular and non-vesicular factors, which may contribute to the potent bioactivity of LA. Immunoblotting detected APOA1 in LA (Fig.S1), a principal component of high-density lipoproteins (HDL). In vivo, APOA1 self-assembles into HDL nanoparticles that undergo continuous remodeling during maturation[33]. HDL has also been reported to carry circulating miRNAs in plasma[34] and to exert anti-inflammatory, antioxidant, and anti-atherosclerotic effects[35, 36]. The presence of APOA1 in LA likely reflects contributions from interstitial fluid and/or minor bleeding during aspiration. Accordingly, APOA1 detection suggests that LA contains HDL-associated, non-vesicular components in addition to EVs.\u003c/p\u003e\n\u003cp\u003eLA showed clear therapeutic benefit in vivo. In a rabbit ear pathological scar model, intradermal LA administration reduced scar elevation and improved dermal architecture and collagen organization, accompanied by a reduced collagen I/III ratio and downregulation of profibrotic markers including TGF-β1, LOX, COL1A1, COL3A1, FN1, and CTGF. Notably, LA also attenuated oxidative stress in scar tissues, as evidenced by decreased 4-HNE immunofluorescence intensity.\u003c/p\u003e\n\u003cp\u003eMechanistically, our data point to redox regulation as a key mechanism underlying the antifibrotic activity of LA.\u0026nbsp;NRF2 signaling is a key protective regulator in many fibrotic disorders [37, 38]. Our single-cell data indicate that pathological scar fibroblasts display a redox imbalance, characterized by elevated NOX4 expression together with suppressed NRF2 antioxidant signaling and reduced expression of canonical NRF2 target genes.Comparative proteomic profiling of LA versus CS revealed enrichment of cytoprotective pathways, including glutathione metabolism and NRF2-associated stress responses, supporting NRF2-centered antioxidant activity as a distinguishing feature of LA.\u003c/p\u003e\n\u003cp\u003eIn fibroblasts, LA promoted NRF2 nuclear accumulation, restored glutathione redox buffering, and induced canonical NRF2 target genes (HMOX1, NQO1, SLC7A11), accompanied by reduced intracellular ROS. LA also attenuated TGF-β1–driven profibrotic activation and reduced oxidative stress, consistent with dampening\u0026nbsp;TGF-β1–ROS feed-forward amplification in fibroblasts.NRF2 inhibition with ML385 markedly diminished LA-induced antioxidant readouts and partially reversed repression of profibrotic transcripts, supporting an NRF2-dependent component. Notably, ML385 did not restore COL1 protein abundance under TGF-β1 stimulation despite effective blockade of NRF2 downstream readouts, indicating that ECM protein output is not fully explained by NRF2-dependent transcription and may additionally reflect post-transcriptional control and/or matrix processing and turnover.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study has several limitations. First, LA is a tissue-derived, ultrafiltration-enriched mixture rather than a single defined entity, and the dominant cellular sources and specific active components responsible for its bioactivity remain unclear, which may complicate its standardization and clinical translation. Second, evidence for NRF2 engagement was obtained mainly in fibroblasts in vitro, the in vivo experiments did not include direct NRF2 gain- or loss-of-function testing. Third, the in vivo work relied on within-animal comparisons of LA versus vehicle control; Due to ethical and feasibility constraints in rabbits, a CS group was not included, and the limited availability of rabbit-reactive antibodies restricted pathway-level validation in scar tissue. Lastly, due to ethical constraints, the number of patients from whom both scar and adjacent normal skin samples could be obtained was limited, resulting in a small sample size for single-cell analysis. This may affect the generalizability of our findings. Although our analysis revealed an imbalance of oxidative stress and NRF2 signaling in scar tissue, consistent with studies in other fibrotic organs, larger cohorts are needed to validate these results. Additionally, the patterns of oxidative stress and NRF2 activation may vary across scar locations due to differences in local skin tension. Future studies should involve larger patient cohorts and genetically modified animal models to further investigate these findings and better address the limitations of this study.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study identifies lipoaspirate-derived secretome (LA) as an EV-enriched, acellular therapeutic agent that modulates redox homeostasis and attenuates pathological scar fibrosis. By activating NRF2-dependent antioxidant pathways and suppressing NOX4-driven oxidative stress, LA disrupts the TGF-β1–ROS feed-forward loop, improving scar architecture and promoting more favorable tissue remodeling in vivo. Single-cell transcriptomics of human pathological scars revealed a fibroblast state with heightened oxidative stress signaling and diminished NRF2-associated antioxidant capacity, which supports the use of LA as a redox-targeted therapeutic. These findings highlight the therapeutic promise of lipoaspirate fluid—a readily accessible, autologous, and scalable resource—as an antifibrotic and antioxidant strategy for mitigating pathological scarring.\u003c/p\u003e\n"},{"header":"Abbreviations","content":"\u003cp\u003eADSC: adipose-derived stromal cells; CS: ADSC culture supernatant–derived secretome; ECM: extracellular matrix; EV(s): extracellular vesicle(s); GSH/GSSG: reduced glutathione/oxidized glutathione; LA: lipoaspirate-derived secretome; MSC: mesenchymal stromal cell(s); NOX4: NADPH oxidase 4; NRF2: nuclear factor erythroid 2–related factor 2; ROS: reactive oxygen species; SEI: scar elevation index; TGF-β1: transforming growth factor-beta 1\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol involving human participants and/or human tissue was approved by the Medical Science Research Ethics Committee of Peking University Third Hospital (approval no. M20250915, A study on the collection of adipose-derived stem cells and extracellular vesicles from lipoaspirate obtained from healthy donors, approved on 20 October 2025; and approval no. IRB00006761-M20250686, Mechanistic study of YAP lactylation in regulating Treg cell function in pathological scars and its crosstalk with fibroblasts, approved on 4 August 2025). Written informed consent was obtained from all relevant patients prior to participation. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Peking University Health Science Center (approval No. DLASBE0417; protocol title: Extracellular Vesicles Derived from Liposuction Aspirate Inhibit Hypertrophic Scar Formation; approved on 18 April 2025).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAI use statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChatGPT was used to assist with English language editing and improving readability. All content was reviewed and revised by the authors, who take full responsibility for the integrity and accuracy of the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets supporting the conclusions of this article are included within the article and its additional files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study was supported by \u003cstrong\u003eBeijing Municipal Nature Science Foundation\u003c/strong\u003e (Grant No. 7252151).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eXin Huang\u003c/strong\u003e: Conceptualization, Formal analysis, Investigation, Methodology, Project administration, Software, Supervision, Validation, Visualization, Writing – original draft. Writing – review \u0026amp; editing. \u003cstrong\u003ePengbing Ding\u003c/strong\u003e: Methodology, Resources, Software. \u003cstrong\u003eZhixuan Sun\u003c/strong\u003e: Methodology, Software. \u003cstrong\u003eHaibo Xiang\u003c/strong\u003e: Methodology, Project administration. \u003cstrong\u003eMuqian Wei\u003c/strong\u003e: Methodology, Project administration. \u003cstrong\u003eHongsen Bi:\u003c/strong\u003e Conceptualization, Funding acquisition, Supervision, Validation.\u003cstrong\u003e\u0026nbsp;Zhenmin Zhao\u003c/strong\u003e: Conceptualization, Data curation, Funding acquisition, Supervision, Validation, Writing – review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThanks to the Central Laboratory of Peking University Third Hospital for providing access to experimental instruments, and thanks to the facility staff members for their technical guidance and support throughout this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eJeschke MG, Wood FM, Middelkoop E, Bayat A, Teot L, Ogawa R, et al. Scars. Nature Reviews Disease Primers. 2023;9(1).\u003c/li\u003e\n \u003cli\u003eChun Q, ZhiYong W, Fei S, XiQiao W. Dynamic biological changes in fibroblasts during hypertrophic scar formation and regression. Int Wound J. 2016;13(2):257-62.\u003c/li\u003e\n \u003cli\u003eBroughton G, Janis JE, Attinger CE. The basic science of wound healing. Plastic and Reconstructive Surgery. 2006;117(7):12s-34s.\u003c/li\u003e\n \u003cli\u003eGauglitz GG, Korting HC, Pavicic T, Ruzicka T, Jeschke MG. Hypertrophic Scarring and Keloids: Pathomechanisms and Current and Emerging Treatment Strategies. Molecular Medicine. 2010;17(1-2):113-25.\u003c/li\u003e\n \u003cli\u003eCucoranu I, Clempus R, Dikalova A, Phelan PJ, Ariyan S, Dikalov S, et al. NAD(P)H Oxidase 4 Mediates Transforming Growth Factor-\u0026beta;1\u0026ndash;Induced Differentiation of Cardiac Fibroblasts Into Myofibroblasts. Circulation Research. 2005;97(9):900-7.\u003c/li\u003e\n \u003cli\u003ePiera-Velazquez S, Makul A, Jim\u0026eacute;nez SA. Increased expression of NAPDH oxidase 4 in systemic sclerosis dermal fibroblasts: regulation by transforming growth factor \u0026beta;. Arthritis Rheumatol. 2015;67(10):2749-58.\u003c/li\u003e\n \u003cli\u003eJobling MF, Mott JD, Finnegan MT, Jurukovski V, Erickson AC, Walian PJ, et al. Isoform-specific activation of latent transforming growth factor beta (LTGF-beta) by reactive oxygen species. Radiat Res. 2006;166(6):839-48.\u003c/li\u003e\n \u003cli\u003eJackson WM, Nesti LJ, Tuan RS. Mesenchymal stem cell therapy for attenuation of scar formation during wound healing. Stem Cell Res Ther. 2012;3(3):20.\u003c/li\u003e\n \u003cli\u003eHecker L, Vittal R, Jones T, Jagirdar R, Luckhardt TR, Horowitz JC, et al. NADPH oxidase-4 mediates myofibroblast activation and fibrogenic responses to lung injury. Nature Medicine. 2009;15(9):1077-81.\u003c/li\u003e\n \u003cli\u003eYu S, Wang Y, Shi Y, Yu S, Zhao B, Liao N, et al. Reduced glutathione enhances adipose tissue‐derived mesenchymal stem cell engraftment efficiency for liver fibrosis by targeting TGF\u0026beta;1/SMAD3/NOX4 pathway. Bioengineering \u0026amp; Translational Medicine. 2024;10(2).\u003c/li\u003e\n \u003cli\u003eBarnes JL, Gorin Y. Myofibroblast differentiation during fibrosis: role of NAD(P)H oxidases. Kidney International. 2011;79(9):944-56.\u003c/li\u003e\n \u003cli\u003eSies H, Berndt C, Jones DP. Oxidative Stress. Annu Rev Biochem. 2017;86:715-48.\u003c/li\u003e\n \u003cli\u003eQiao P, Sun Y, Wang Y, Lin S, An Y, Wang L, et al. Activation of NRF2 Signaling Pathway Delays the Progression of Hyperuricemic Nephropathy by Reducing Oxidative Stress. Antioxidants. 2023;12(5).\u003c/li\u003e\n \u003cli\u003eSun J, Shi CS, Wang DL. [Research advances on the roles of exosomes derived from mesenchymal stem cells in wound healing and prevention and treatment of hypertrophic scars]. Zhonghua Shao Shang Za Zhi. 2021;37(5):495-500.\u003c/li\u003e\n \u003cli\u003eZhu YZ, Hu X, Zhang J, Wang ZH, Wu S, Yi YY. Extracellular Vesicles Derived From Human Adipose-Derived Stem Cell Prevent the Formation of Hypertrophic Scar in a Rabbit Model. Ann Plast Surg. 2020;84(5):602-7.\u003c/li\u003e\n \u003cli\u003eTian C, Xu H, Li C, Gao J, Zhang H, Wang P, et al. ADSC exosomes improve high glucose induced fibroblast oxidative stress injury and accelerate DFU wound healing via regulating Keap1/Nrf2 axis. Cell Signal. 2025;134:111936.\u003c/li\u003e\n \u003cli\u003eSu Y, Lu J, Liang F, Cheng J. Hypoxia-Induced Extracellular Vesicles Derived from Human Umbilical Cord Mesenchymal Stem Cells Regulate Macrophage Polarization and Enhance Angiogenesis to Promote Diabetic Wound Healing. Biomolecules. 2025;15(11):1504.\u003c/li\u003e\n \u003cli\u003eNie F, Ding P, Zhang C, Zhao Z, Bi H. Extracellular vesicles derived from lipoaspirate fluid promote fat graft survival. Adipocyte. 2021;10(1):293-309.\u003c/li\u003e\n \u003cli\u003eWu Y, Hong P, Liu P, Zhang Q, Zhang Y, Yang B, et al. Lipoaspirate fluid derived factors and extracellular vesicles accelerate wound healing in a rat burn model. Frontiers in Bioengineering and Biotechnology. 2023;11.\u003c/li\u003e\n \u003cli\u003eTian M, Ticer T, Wang Q, Walker S, Pham A, Suh A, et al. Adipose-Derived Biogenic Nanoparticles for Suppression of Inflammation. Small. 2020;16(10):e1904064.\u003c/li\u003e\n \u003cli\u003eMushahary D, Spittler A, Kasper C, Weber V, Charwat V. Isolation, cultivation, and characterization of human mesenchymal stem cells. Cytometry Part A. 2018;93(1):19-31.\u003c/li\u003e\n \u003cli\u003eDeng C, Liu B, Zhang J. [Primary culture of adipose-derived stromal cells]. Sheng Wu Yi Xue Gong Cheng Xue Za Zhi. 2014;31(4):842-5.\u003c/li\u003e\n \u003cli\u003ePak I, Askarov M, Kissamedenov N, Klyuyev D, Kamyshanskiy Y. Experimental study on clinical and morphological determination of the optimal cannula diameter for lipoaspirate harvest from rabbit inguinal fat pad. Journal of Applied Biomedicine. 2023;21(2):99-105.\u003c/li\u003e\n \u003cli\u003eYang Z-R, Suo H, Fan J-W, Lv N, Du K, Ma T, et al. Endogenous stimuli-responsive separating microneedles to inhibit hypertrophic scar through remodeling the pathological microenvironment. Nature Communications. 2024;15(1).\u003c/li\u003e\n \u003cli\u003eNabai L, Ghahary A. Hypertrophic Scarring in the Rabbit Ear: A Practical Model for Studying Dermal Fibrosis. Fibrosis. Methods in Molecular Biology2017. p. 81-9.\u003c/li\u003e\n \u003cli\u003eGuo S, Kang G, Phan DT, Hsu MN, Por YC, Chen CH. Polymerization-Induced Phase Separation Formation of Structured Hydrogel Particles via Microfluidics for Scar Therapeutics. Sci Rep-Uk. 2018;8(1).\u003c/li\u003e\n \u003cli\u003eDeng C-C, Hu Y-F, Zhu D-H, Cheng Q, Gu J-J, Feng Q-L, et al. Single-cell RNA-seq reveals fibroblast heterogeneity and increased mesenchymal fibroblasts in human fibrotic skin diseases. Nature Communications. 2021;12(1).\u003c/li\u003e\n \u003cli\u003eVorstandlechner V, Laggner M, Kalinina P, Haslik W, Radtke C, Shaw L, et al. Deciphering the functional heterogeneity of skin fibroblasts using single‐cell RNA sequencing. The FASEB Journal. 2020;34(3):3677-92.\u003c/li\u003e\n \u003cli\u003eLendahl U, Muhl L, Betsholtz C. Identification, discrimination and heterogeneity of fibroblasts. Nature Communications. 2022;13(1).\u003c/li\u003e\n \u003cli\u003eHu C, Li T, Xu Y, Zhang X, Li F, Bai J, et al. CellMarker 2.0: an updated database of manually curated cell markers in human/mouse and web tools based on scRNA-seq data. Nucleic Acids Res. 2023;51(D1):D870-d6.\u003c/li\u003e\n \u003cli\u003eFranz\u0026eacute;n O, Gan L-M, Bj\u0026ouml;rkegren JLM. PanglaoDB: a web server for exploration of mouse and human single-cell RNA sequencing data. Database. 2019;2019.\u003c/li\u003e\n \u003cli\u003eColeman S, Mazzola R. Coleman Fat Grafting: From Filling to Regeneration. People\u0026apos;s Military Medical Press, Beijing. 2014.\u003c/li\u003e\n \u003cli\u003eMulder WJM, van Leent MMT, Lameijer M, Fisher EA, Fayad ZA, P\u0026eacute;rez-Medina C. High-Density Lipoprotein Nanobiologics for Precision Medicine. Accounts of Chemical Research. 2017;51:127-37.\u003c/li\u003e\n \u003cli\u003eVickers KC, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. NATURE CELL BIoLogy. 2011;13:423-33.\u003c/li\u003e\n \u003cli\u003eBeazer Jack D, Patanapirunhakit P, Gill Jason MR, Graham D, Karlsson H, Ljunggren S, et al. High-density lipoprotein\u0026rsquo;s vascular protective functions in metabolic and cardiovascular disease \u0026ndash; could extracellular vesicles be at play? Clinical Science. 2020;134:2977-86.\u003c/li\u003e\n \u003cli\u003eBarter PJ, Nicholls S, Rye K-A, Anantharamaiah GM, Navab M, Fogelman AM. Antiinflammatory Properties of HDL. Circulation Research. 2004;95:764-72.\u003c/li\u003e\n \u003cli\u003eZhang Z, Qu J, Zheng C, Zhang P, Zhou W, Cui W, et al. Nrf2 antioxidant pathway suppresses Numb-mediated epithelial\u0026ndash;mesenchymal transition during pulmonary fibrosis. Cell Death \u0026amp; Disease. 2018;9(2).\u003c/li\u003e\n \u003cli\u003eXu W, Hellerbrand C, K\u0026ouml;hler UA, Bugnon P, Kan Y-W, Werner S, et al. The Nrf2 transcription factor protects from toxin-induced liver injury and fibrosis. Laboratory Investigation. 2008;88(10):1068-78.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"lipoaspirate, secretome, extracellular vesicles, NRF2, reactive oxygen species, pathological scar","lastPublishedDoi":"10.21203/rs.3.rs-8578429/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8578429/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Pathological scars are characterized by persistent fibroblast activation and excessive extracellular matrix (ECM) deposition. Although oxidative stress and dysregulated NRF2 signaling drive TGF-β1–mediated fibrosis in internal organs, their roles in cutaneous pathological scarring remain unclear. Adipose-derived stromal cell (ADSC) and lipoaspirate-derived extracellular vesicles (EVs) can promote wound repair and reduce fibrosis, but whether their bioactive components restore fibroblast redox homeostasis via NRF2 to mitigate cutaneous pathological scarring is unknown.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: Lipoaspirate fluid obtained during standard tumescent liposuction was processed by 100 kDa ultrafiltration to generate a lipoaspirate-derived secretome (LA). Secretome from adipose-derived stromal cell (ADSC) culture supernatant served as a comparator (CS). LA and CS were characterized by nanoparticle tracking analysis, transmission electron microscopy, and EV-associated marker immunoblotting. In vivo efficacy was evaluated in a rabbit ear pathological scar model with weekly intradermal LA injections, assessed by gross imaging, histology/collagen staining, and qPCR. LA versus CS proteomics (DIA LC–MS/MS) with enrichment analysis and single-cell RNA sequencing of paired scar/normal skin were performed. In vitro, TGF-β1–stimulated fibroblasts were treated with LA or CS ± ML385. Redox balance, NRF2 signaling, and profibrotic responses were assessed by fluorometric assays, qPCR, and immunoblotting.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e LA showed a substantially higher particle yield than CS and was enriched in extracellular vesicles. Weekly intradermal LA injections reduced scar hypertrophy and improved collagen organization in the rabbit ear model. Proteomics (LA vs CS) highlighted cytoprotective pathways, including glutathione metabolism and NRF2-associated antioxidant signaling. scRNA-seq of paired human scar/normal skin samples showed NOX4 upregulation with reduced NRF2 signaling in scar fibroblasts. In vitro, LA (vs CS) attenuated TGF-β1–driven oxidative stress and profibrotic activation, improved GSH/GSSG balance, and suppressed NOX4 and ECM genes; ML385 abrogated these effects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: LA is a clinically accessible, EV-enriched acellular therapy that corrects the redox–fibrotic imbalance of pathological scarring by activating NRF2 signaling, suppressing NOX4-linked oxidative stress, and attenuating TGF-β1–driven fibroblast profibrotic activation, thereby improving scar remodeling in vivo. Single-cell transcriptomics identified elevated NOX4 and impaired NRF2 signaling in scar fibroblasts, supporting this mechanism and suggesting LA as a scalable, autologous option for targeting oxidative stress and fibrosis.\u003c/p\u003e","manuscriptTitle":"Lipoaspirate-derived secretome activates NRF2 to restore redox homeostasis and attenuate pathological scar formation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-10 10:52:56","doi":"10.21203/rs.3.rs-8578429/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-01T15:59:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-26T20:52:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"139624287781648434209960676204604437545","date":"2026-03-06T14:47:40+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-04T05:55:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-23T09:07:28+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-04T10:28:21+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2026-02-03T04:41:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"11177920-798e-40b0-8de8-d2543ff2aedc","owner":[],"postedDate":"March 10th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-17T13:25:31+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-10 10:52:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8578429","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8578429","identity":"rs-8578429","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}