Immunomodulatory effects of stem cell-derived extracellular vesicles on NLRP3 inflammasome activation in the brain after chronic ethanol exposure | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Immunomodulatory effects of stem cell-derived extracellular vesicles on NLRP3 inflammasome activation in the brain after chronic ethanol exposure Susana Mellado, Victoria Moreno-Manzano, Consuelo Guerri, María Pascual This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7957853/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Apr, 2026 Read the published version in Molecular Biology Reports → Version 1 posted 9 You are reading this latest preprint version Abstract NOD-like receptors (NLRs) and inflammasome complexes play critical roles in the neuroinflammatory responses triggered by chronic ethanol exposure. While our previous work demonstrated that mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) attenuate binge ethanol-induced NLRP3 inflammasome activation in the adolescent hippocampus, their broader effects on other NLR pathways and brain regions remains unclear. Here, we investigated the therapeutic potential of intravenously administered adipose-derived MSC-EVs (20 µg/dose every 10 days) in a murine model of chronic alcoholism (10% ethanol in drinking water for 3 months), focusing on their ability to modulate multiple inflammasome sensors (NLRP3, NLRC4, NLRP1, AIM2) and downstream effectors (caspase-1, caspase-11/4, IL-1β, IL-18) across the prefrontal cortex, hippocampus and striatum. qPCR analysis revealed that chronic ethanol exposure significantly upregulated the expression of these inflammasome-related components in all three brain regions, whereas MSC-EV treatment effectively suppressed their activation. Notably, MSC-EVs normalized ethanol-induced overexpression of inflammasome sensors and downstream effectors, indicating a broad attenuation of inflammasome-driven neuroinflammatory responses. These findings expand current understanding of MSC-EVs as a multifaceted therapy for ethanol-related neuropathology, highlighting their capacity to simultaneously mitigate diverse NLR inflammasome pathways across key brain areas involved in addiction and cognitive dysfunction. Ethanol chronic treatment extracellular vesicles mesenchymal stem cells NLRP3 neuroinflammation inflammasome Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Chronic alcohol consumption represents a major public health challenge and one of the leading risk factors for preventable disease and premature mortality. According to the World Health Organization, harmful alcohol use accounts for approximately 5% of the global burden of disease and contributes to over 2.6 million deaths annually (WHO 2024). Excessive alcohol intake is strongly linked to liver cirrhosis, cardiovascular disease, gastrointestinal disorders, and several forms of cancer, as well as increased susceptibility to infections due to its profound effects on immune function (GBD 2016 Alcohol Collaborators 2018 ; Aslam and Kwo 2023 ). Moreover, alcohol misuse is a significant contributor to accidents, violence, and social harm, further amplifying its societal impact. Beyond these systemic consequences, chronic alcohol exposure exerts profound effects on the central nervous system, where it is associated with structural and functional alterations, including white matter atrophy, axonal degeneration, and demyelination, that ultimately drive cognitive decline and psychiatric comorbidities such as depression, anxiety, and alcohol use disorder itself(Pascual et al. 2021 ). A growing body of evidence indicates that the detrimental effects of chronic alcohol exposure are largely mediated by neuroimmune dysregulation (Xu et al. 2025 ). Ethanol activates brain-resident immune cells, particularly microglia and astrocytes, triggering the stimulation of pattern-recognition receptors (PRRs) such as Toll-like receptors (TLRs) (Alfonso-Loeches et al. 2014 ). Activation of these receptors initiates pro-inflammatory signaling cascades that enhance cytokines and chemokines production, ultimately promoting persistent neuroinflammatory states that compromise neuronal integrity and function (Montesinos et al. 2016 ). Among the key mechanisms sustaining these inflammatory processes, the assembly and activation of inflammasomes have received particular attention. These multiprotein complexes act as central regulators of innate immunity by converging on caspase-1 activation, which drives the cleavage and release of the pro-inflammatory cytokines interleukin-1β (IL-1β) and interleukin-18 (IL-18). Several members of the NOD-like receptor (NLR) family, including NLRP1, NLRC4, AIM2, and particularly NLRP3, are capable of forming canonical inflammasome complexes (Yao et al. 2024 ; Xu et al. 2025 ). Dysregulation of these inflammasomes amplifies inflammatory cascades, exacerbates neuronal damage, and has been increasingly implicated in the neuropathological consequences of chronic alcohol consumption (Alfonso-Loeches et al. 2016 ). In recent years, mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) have emerged as promising therapeutic tools for modulating neuroinflammatory pathways (Mellado et al. 2023 , 2025a ). These nanosized vesicles, enriched in proteins, lipids, and microRNAs (miRNAs), can cross the blood–brain barrier and deliver their bioactive cargo to target cells, thereby regulating glial activation, inhibiting inflammasome signaling, and promoting neuronal survival. Notably, MSC-EVs have also been shown to support synaptic plasticity and remyelination, processes essential for preserving cognitive and behavioral functions (Izquierdo-Altarejos et al. 2023 ; Mincheva et al. 2024 ; Yu et al. 2025 ). Consistent with these observations, our previous studies demonstrated that systemic administration of MSC-EVs attenuated ethanol-induced neuroinflammation and NLRP3 inflammasome activation, while restoring synaptic integrity and myelin structure in adolescent mouse brains exposed to binge-like alcohol consumption (Mellado et al. 2023 , 2025a ). Building on these findings, the present study extends this investigation to a model of chronic alcohol exposure in adult mice. We specifically evaluated the impact of MSC-EVs on inflammasome-related pathways across multiple brain regions critically affected by alcohol—namely, the prefrontal cortex, hippocampus, and striatum. By quantifying the expression of key inflammasome components (NLRP1, NLRP3, NLRC4, AIM2) and effector caspases (caspase-1 and caspase-11/4) using RT-qPCR, we aimed to elucidate the therapeutic potential of MSC-EVs in mitigating ethanol-induced neuroinflammatory damage. MATERIALS AND METHODS MSC isolation, culture and isolation of MSC-EVs Human adipose tissue was obtained as surgical surplus from knee replacement procedures performed on four donors under sterile conditions, with all samples anonymized to protect patient confidentiality. The study protocol was approved by the Regional Ethics Committee for Clinical Research with Medicines and Health Products (Code of Practice 2014/01). Exclusion criteria included any history of cancer or active infectious diseases (viral or bacterial). All participating donors provided written informed consent for the use of their adipose tissue. MSCs were isolated, expanded, and characterized according to established protocols (Mellado-López et al. 2017 ; Muñoz-Criado et al. 2017 ). For EVs isolation, conditioned media were sequentially processed by differential centrifugation. Briefly, samples were centrifuged at 300 × g for 10 min to remove cells, followed by a 2 000 × g spin for 10 minutes to eliminate cellular debris. A subsequent 10 000 × g spin for 30 minutes removed apoptotic bodies and residual particulates. The clarified supernatant was then ultracentrifuged at 100 000 × g for 1 hour to pellet EVs. After washing with phosphate-buffered saline (PBS) and repeating ultracentrifugation under identical conditions, the purified EV pellet was resuspended in PBS at a final concentration of 20 µg/100 µL and stored at − 80°C until use. Freshly isolated EVs were also used for characterization by transmission electron microscopy, Western blot, and nanoparticle tracking analysis, as previously described by Mellado et al. (Mellado et al. 2023 ) (Fig. 1 ). Animals and treatments Thirty-six female C57BL/6 wild-type mice (two-month-old; Harlan Ibérica, Barcelona, Spain) were used. Animals were housed in groups of three to four per cage under controlled environmental conditions (12 h light/dark cycle, 23°C, 60% humidity) with ad libitum access to food and water. All the experimental procedures were carried out in accordance with the guidelines approved by European Communities Council Directive (86/609/ECC) and Spanish Royal Decree 53/2013 with the approval of the Ethical Committee of Animal Experimentation of the Príncipe Felipe Research Centre (Valencia, Spain) and the Generalitat Valenciana (Project identification code: 2022/VSC/PEA/0294). Mice were exposed to chronic ethanol by providing 10% (v/v) ethanol in drinking water ad libitum for three months, following established protocols (Alfonso-Loeches et al. 2010 ). Control animals received standard drinking water. During the treatment period, subsets of animals received intravenous injections of either MSC-EVs (20 µg/dose) or vehicle (0.9% saline) via the tail vein every ten days. Animals were randomly assigned to four experimental groups: control + vehicle, control + MSC-EVs, ethanol + vehicle, ethanol + MSC-EVs (n = 8/9 per group). Consistent with previous findings (Pascual et al. 2017 ), blood ethanol concentrations during the dark cycle averaged 125 ± 20 mg/dL in ethanol-exposed groups, confirming that MSC-EV administration did not affect ethanol metabolism. At the end of the treatment period, mice were deeply anesthetized with sodium pentobarbital (60 mg/kg, i.p.) and euthanized by cervical dislocation. Brains were rapidly removed, and the prefrontal cortex, striatum, and hippocampus were dissected, flash-frozen in liquid nitrogen, and stored at -80°C for subsequent analysis. The experimental timeline is illustrated in Fig. 1 . RNA isolation, reverse transcription and quantitative RT-PCR Total RNA was extracted from frozen prefrontal cortex, hippocampus, and striatum samples using TRIzol reagent (T9424, Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. Reverse transcription was performed with the NZY First-Strand cDNA Synthesis Kit (MB40001, NZYTech, Lisbon, Portugal). Quantitative PCR (qPCR) was carried out on a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with AceQ® qPCR SYBR Green Master Mix (NB-54-0171-02, NeoBiotech, Nanterre, France). Non-template controls were included in each run, and all reactions were performed in triplicate. Cyclophilin A mRNA served as the internal reference gene for normalization. Relative gene expression was calculated using the ΔΔCq method (Schmittgen and Livak 2008 ) with QuantStudio™ Design & Analysis Software v1.5.3 (Applied Biosystems). Primer sequences are listed in Table 1 . Table 1 Nucleotide sequences of the primers used for the RT-PCR of genes. Gene Primer sequences (5’ to 3’) Nlrp3 F: AAGTCCTGCCCCAAGCCCCA R: GGAAGGGCAGCCTCTGGCAG Casp-1 F: GGCACATTTCCAGGACTGACTG R: GCAAGACGAGTACGAGTGGTTG Il1b F: GACCCCAAAAGATGAAGGGCT R: TGTGCTGCTGCGAGATTTGA Il18 F: ACTGTACAACCGCAGTAATACGG R: AGTGAACATTACAGATTTATCCC Nlrp1 F: TCCAAGAGAGGGTCCACTGA R: CCTTGCTGAAACCAGGAGAC Aim2 F: GTCACCAGTTCCTCAGTTGTG R: TGTCTCCTTCCTCGCACTTT Nlrc4 F: TGATGCTGCCTTGGTGCT R: ATCCGTCACTGCTCACACAG Casp-11/4 F: CCGAGACAAAACAGGAGGC R: GGTGGGCATCTGGGAATGA Irak1 F: GGACTTCCACAGTTCGAGGTAC R: GGTCTTTGCACCTTGTGTCCTC Tlr4 F: TGCCTCTCTTGCATCTGGCTGG R: CTGTCAGTACCAAGGTTGAGAGCTGG Cyclophilin A F: GTCTCCTTCGAGCTGTTTGC R: GATGCCAGGACCTGTATGCT Statistical analysis Data are presented as mean ± SEM. Statistical analyses were performed using SPSS v28. Normality was assessed using the with the Shapiro–Wilk test. For parametric data, two-way ANOVA followed by Bonferroni post hoc comparisons was applied, whereas the Kruskal–Wallis test was used as the non-parametric data. A p value < 0.05 was considered statistically significant. RESULTS Our previous study demonstrated that adipose-derived MSC-EVs ameliorate neuroinflammation and NLRP3 inflammasome activation in the hippocampus induced by binge-like alcohol consumption in adolescent mice (Mellado et al. 2025a ). Building on these findings, we sought to determine whether MSC-EVs exert similar protective effects in a model of chronic alcoholism in adult mice, focusing on brain regions highly vulnerable to alcohol-induced damage, including the prefrontal cortex, hippocampus, and striatum. To address this question, we first evaluated the components of the NLRP3 inflammasome complex (Almeida-da-Silva et al. 2023 ). As shown in Fig. 2 A, chronic ethanol exposure significantly increased the gene expression of Nlrp3 [prefrontal cortex, p < 0.05; hippocampus, p < 0.001; striatum, p < 0.001] and Casp-1 [prefrontal cortex, p < 0.01; hippocampus, p < 0.01], compared with control mice. Cytokine analysis revealed that ethanol markedly upregulated Il1b [prefrontal cortex, p < 0.001; hippocampus, p < 0.001; striatum, p < 0.001] and Il18 [prefrontal cortex, p < 0.05; hippocampus, p < 0.05; striatum, p < 0.001] mRNA levels (Fig. 2 B). Notably, MSC-EVs treatment mitigated the ethanol-induced upregulation of these inflammation-related genes in the prefrontal cortex [ Nlrp3 , p < 0.05; Casp-1 , p < 0.01; Il1b , p < 0.01; Il18 , p < 0.05], hippocampus [ Nlrp3 , p < 0.001; Casp-1 , p < 0.01; Il1b , p < 0.001; Il18 , p < 0.01], and striatum [ Nlrp3 , p < 0.001; Il1b , p < 0.001; Il18 , p < 0.001]. In addition, ethanol-treated animals showed a marked elevation in NLRP3-related gene expression when compared to control + MSC-EVs group across all brain regions [prefrontal cortex: Nlrp3 , p < 0.001; Casp-1 , p < 0.01; Il1b , p < 0.01; Il18 , p < 0.05; hippocampus: Nlrp3 , p < 0.001; Casp-1 , p < 0.05; Il1b , p < 0.01; Il18 , p < 0.001; and striatum: Nlrp3 , p < 0.05; Il1b , p < 0.01; Il18 , p < 0.001]. Given that molecules such as caspase-11/4, TLR4, and IRAK1 are implicated in the upstream regulation of the NLRP3/caspase-1 inflammasome pathway (Paik et al. 2025 ), we next assessed the expression of these genes to determine whether chronic ethanol altered their levels and whether EV treatment exerted modulatory effects. Ethanol significantly increased the mRNA expression of Casp-11/4 [prefrontal cortex, p < 0.01; hippocampus, p < 0.01; striatum, p < 0.001] and Tlr4 [prefrontal cortex, p < 0.05; hippocampus, p < 0.001; striatum, p < 0.01] compared with controls (Fig. 3 ). Remarkably, MSC-EV treatment attenuated these ethanol-induced changes, reducing Casp-11/4 expression [prefrontal cortex, p < 0.001; hippocampus, p < 0.01; striatum, p < 0.001] and Tlr4 expression [prefrontal cortex, p < 0.05; hippocampus, p < 0.001; striatum, p < 0.001]. Significant differences were likewise observed between the control + MSC-EV group and the ethanol group in prefrontal cortex [ Casp-11/4 , p < 0.001; Tlr4 , p < 0.05], hippocampus [ Casp-11/4 , p < 0.05; Tlr4 , p < 0.001] and striatum [ Casp-11/4 , p < 0.001; Tlr4 , p < 0.01]. No significant changes were detected in Irak1 gene expression. Finally, to evaluate the potential involvement of additional inflammasome-forming NLRs, we analyzed the expression of Nlrp1 , Aim2 and Nlrc4 in mice exposed to chronic alcohol. Figure 4 shows that chronic ethanol treatment significantly upregulated the expression of all three inflammasome-related genes Nlrp1 [prefrontal cortex, p < 0.05; striatum, p < 0.001], Aim2 [prefrontal cortex, p < 0.001; hippocampus, p < 0.001; striatum, p < 0.05] and Nlrc4 [prefrontal cortex, p < 0.01; hippocampus, p < 0.01; striatum, p < 0.05]. Importantly, MSC-EV administration significantly reversed these ethanol-induced increased, normalizing expression of Nlrp1 [prefrontal cortex, p < 0.05; striatum, p < 0.001], Aim2 [prefrontal cortex, p < 0.01; hippocampus, p < 0.01; striatum, p < 0.01] and Nlrc4 [prefrontal cortex, p < 0.001; hippocampus, p < 0.05; striatum, p < 0.001]. Significant group differences were also found between the EV-treated and ethanol groups for Nlrp1 [prefrontal cortex, p < 0.05; striatum, p < 0.01], Aim2 [prefrontal cortex, p < 0.001; hippocampus, p < 0.01; striatum, p < 0.05] and Nlrc4 [prefrontal cortex, p < 0.001; hippocampus, p < 0.05; striatum, p < 0.001]. DISCUSSION Our study expands on previous evidence demonstrating the therapeutic potential of MSC-EVs in counteracting ethanol-induced brain damage. We recently demonstrated that systemic administration of adipose-derived MSC-EVs attenuates NLRP3 inflammasome activation and neuroinflammatory responses in the hippocampus of adolescent mice exposed to binge-like ethanol treatment (Mellado et al. 2023 ). Here, we extend those findings by demonstrating that chronic ethanol exposure in adult mice induces profound alterations in brain structure and function, as revealed by imaging, behavioral assessments, and molecular analyses of inflammation-related genes (Mellado et al. 2025b ). These results highlight the ability of MSC-EVs to modulate key innate immune pathways triggered by chronic alcohol exposure, thereby mitigating neuroinflammation and reducing neuronal vulnerability. MSC-EVs have demonstrated potent immunomodulatory and regenerative effects across a variety of disease models. For example, MSC-EVs regulate tissue damage, exert anti-inflammatory and pro-proliferative actions, and promote repair of tissues such as heart, lung, intestine, and skin (Wang et al. 2025 ). They also foster tubular regeneration, suppress oxidative stress and fibrosis, reduce proinflammatory cytokines, and improve renal function (Birtwistle et al. 2021 ). Beyond peripheral organ repair, MSC-EVs show significant therapeutic potential in neurological disorders. In Alzheimer’s disease models, MSC-EVs attenuate neuroinflammation, reduce amyloid-β deposition, and improve cognitive deficits (Gomes et al. 2022 ; Garcia-Contreras and Thakor 2023 ). Similar neuroprotective effects have been reported in models of Parkinson’s disease (Volarevic et al. 2025 ), traumatic brain injury, and spinal cord injury (Dutta et al. 2021 ; Lim et al. 2024 ). In the context of alcohol-induced damage, where chronic neuroinflammation drives neuronal dysfunction and degeneration (Anand et al. 2023 ), MSC-EVs may counteract these deleterious processes (Mellado et al. 2023 ). Our results support this view, showing that systemic EV treatment effectively attenuates the ethanol-induced activation of key inflammasome components, reinforcing their clinical relevance for alcohol-related neuropathologies. Among the various inflammasome-forming receptors, NLRP3 is most consistently implicated in alcohol-induced neuroinflammation (Alfonso-Loeches et al. 2014 , 2016 ). In the present study, chronic ethanol exposure significantly upregulated the expression of Nlrp3 and Casp-1 across the prefrontal cortex, hippocampus, and striatum, in parallel with marked increases in the pro-inflammatory cytokines Il1b and Il18 . These findings underscore the central role of NLRP3 inflammasome activation in driving persistent inflammatory signaling, cytokine release, and ultimately neuronal injury. Consistent with our observations, MSC-EVs have been reported to mitigate NLRP3 activation and pro-inflammatory cytokines release, thereby improving myelin repair in neurodegeneration disorders (Askari et al. 2025 ), reducing β-amyloid pathology in mouse model of Alzheimer’s disease (Lee et al. 2018 ) or alleviating diabetic cardiomyopathy (Zhang et al. 2025b ). Importantly, MSC-EV treatment in our model normalized ethanol-induced upregulation of both the receptor complex and its downstream cytokines, suggesting a broad regulatory effect on inflammasome activation and highlighting their therapeutic potential against chronic ethanol-driven neuroinflammation. Our results also reveal that chronic ethanol exposure activates additional inflammasome-related receptors, including NLRP1, AIM2, and NLRC4, indicating that alcohol-induced neuroinflammation involves multiple innate immune pathways rather than a single axis. MSC-EVs significantly reduced the expression of these receptors across all studied regions, suggesting broad immunomodulatory effects. This is consistent with previous evidence showing that MSC-EVs can modulate inflammasome signaling in diverse pathological contexts, for example, inhibiting AIM2 inflammasome assembly and promoting neuronal survival in vascular dementia (Zhang et al. 2025a ). Furthermore, we found that ethanol elevated Casp-11/4 and Tlr4 expression (Zheng et al. 2020 ), key molecules in non-canonical inflammasome activation and TLR signaling, both of which potentiate NLRP3 activity and cytokine release (Alfonso-Loeches et al. 2016 ). Notably, MSC-EVs normalized these changes, indicating that their therapeutic actions extend to upstream checkpoints of inflammasome regulation and may help counteract redundant inflammatory cascades in alcohol-related brain damage. The prefrontal cortex, hippocampus, and striatum are fundamental for regulating executive function, memory consolidation, emotional control, and reward-related behaviors (Izuma et al. 2008 ; Squire et al. 2015 ; Menon and D’Esposito 2022 ). These brain regions are also among the most vulnerable to the detrimental effects of chronic alcohol exposure, which disrupts their structural and functional integrity, and induce synaptic dysfunction, neurodegeneration, and impaired neurotransmitter signaling (Anand et al. 2023 ; Tochon et al. 2023 ; Mellado et al. 2025b ). In this context, our results showing that MSC-EVs attenuate inflammasome activation across these areas underscore their therapeutic potential. By reducing inflammatory responses in regions central to cognition and behavior, MSC-EVs may help neural circuitry and preventing the long-term neurological and psychiatric consequences of chronic alcohol consumption. This study has several limitations. First, we used EVs derived from human MSC and administered them into mice. Although human MSC-EVs are widely employed in preclinical rodent models and display conserved therapeutic actions across species (Tolomeo et al. 2023 ), potential differences in vesicle composition, biodistribution, and immunogenicity cannot be fully excluded, which may limit direct extrapolation of our findings to humans. Second, the small size of the sampled brain regions prevents deeper analysis of protein expression changes. Second, the small size of the sampled brain regions prevented deeper analysis of protein expression changes. Future studies using larger cohorts and more extensive molecular characterization will be needed to overcome these limitations and provide a more comprehensive understanding of the mechanisms underlying the therapeutic effects of MSC-EVs. Taken together, our findings reinforce the therapeutic potential of MSC-EVs as regulators of neuroinflammation in alcohol-related brain injury. By targeting multiple inflammasome pathways, their upstream regulators, and the downstream cytokines that drive neuronal dysfunction, MSC-EVs exhibit a robust capacity to counteract the deleterious molecular consequences of chronic ethanol exposure. Importantly, their protective effects were observed across brain regions essential for higher-order functions, underscoring the translational relevance of these findings. This study therefore not only advances our understanding of the mechanisms underlying alcohol-induced neuroinflammation but also highlights MSC-EVs as promising candidates for future therapeutic strategies aimed at preventing or ameliorating alcohol-related neurological disorders. Declarations FUNDING DECLARATION This work has been supported by grants from the Spanish Ministry of Health-PNSD (2023-I024), GVA (CIAICO/2021/203 and CIAICO/2024/122), the Carlos III Institute, and the Primary Addiction Care Research Network (RD21/0009/0005), PID2023-146865OB-I00 funded by MCIN/AEI/ 10.13039/501100011033/FEDER . CONFLICT OF INTEREST All authors declare there is no competing interest in research conduction and paper writing. Author Contribution MP and SM conceived and designed the experiments. SM performed the experiments and analyzed the data. SM and MP wrote the manuscript, SM, VMM, CG and MP revised the manuscript. All authors read and approved the final manuscript. Data Availability The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. References Alfonso-Loeches S, Pascual-Lucas M, Blanco AM, et al (2010) Pivotal role of TLR4 receptors in alcohol-induced neuroinflammation and brain damage. J Neurosci Off J Soc Neurosci 30:8285–8295. https://doi.org/10.1523/JNEUROSCI.0976-10.2010 Alfonso-Loeches S, Ureña-Peralta J, Morillo-Bargues MJ, et al (2016) Ethanol-Induced TLR4/NLRP3 Neuroinflammatory Response in Microglial Cells Promotes Leukocyte Infiltration Across the BBB. Neurochem Res 41:193–209. https://doi.org/10.1007/s11064-015-1760-5 Alfonso-Loeches S, Ureña-Peralta JR, Morillo-Bargues MJ, et al (2014) Role of mitochondria ROS generation in ethanol-induced NLRP3 inflammasome activation and cell death in astroglial cells. Front Cell Neurosci 8:216. https://doi.org/10.3389/fncel.2014.00216 Almeida-da-Silva CLC, Savio LEB, Coutinho-Silva R, Ojcius DM (2023) The role of NOD-like receptors in innate immunity. Front Immunol 14:1122586. https://doi.org/10.3389/fimmu.2023.1122586 Anand SK, Ahmad MH, Sahu MR, et al (2023) Detrimental Effects of Alcohol-Induced Inflammation on Brain Health: From Neurogenesis to Neurodegeneration. Cell Mol Neurobiol 43:1885–1904. https://doi.org/10.1007/s10571-022-01308-2 Askari H, Yavarpour-Bali H, Shirzad M, et al (2025) Combination therapy with exosomes and NLRP3 inhibition enhances myelin repair in a cuprizone-induced demyelination model. Eur J Pharmacol 1002:177851. https://doi.org/10.1016/j.ejphar.2025.177851 Aslam A, Kwo PY (2023) Epidemiology and Disease Burden of Alcohol Associated Liver Disease. J Clin Exp Hepatol 13:88–102. https://doi.org/10.1016/j.jceh.2022.09.001 Birtwistle L, Chen X-M, Pollock C (2021) Mesenchymal Stem Cell-Derived Extracellular Vesicles to the Rescue of Renal Injury. Int J Mol Sci 22:6596. https://doi.org/10.3390/ijms22126596 Dutta D, Khan N, Wu J, Jay SM (2021) Extracellular Vesicles as an Emerging Frontier in Spinal Cord Injury Pathobiology and Therapy. Trends Neurosci 44:492–506. https://doi.org/10.1016/j.tins.2021.01.003 Garcia-Contreras M, Thakor AS (2023) Extracellular vesicles in Alzheimer’s disease: from pathology to therapeutic approaches. Neural Regen Res 18:18–22. https://doi.org/10.4103/1673-5374.343882 GBD 2016 Alcohol Collaborators (2018) Alcohol use and burden for 195 countries and territories, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet Lond Engl 392:1015–1035. https://doi.org/10.1016/S0140-6736(18)31310-2 Gomes P, Tzouanou F, Skolariki K, et al (2022) Extracellular vesicles and Alzheimer’s disease in the novel era of Precision Medicine: implications for disease progression, diagnosis and treatment. Exp Neurol 358:114183. https://doi.org/10.1016/j.expneurol.2022.114183 Izquierdo-Altarejos P, Cabrera-Pastor A, Martínez-García M, et al (2023) Extracellular vesicles from mesenchymal stem cells reduce neuroinflammation in hippocampus and restore cognitive function in hyperammonemic rats. J Neuroinflammation 20:1. https://doi.org/10.1186/s12974-022-02688-4 Izuma K, Saito DN, Sadato N (2008) Processing of social and monetary rewards in the human striatum. Neuron 58:284–294. https://doi.org/10.1016/j.neuron.2008.03.020 Lee M, Ban J-J, Yang S, et al (2018) The exosome of adipose-derived stem cells reduces β-amyloid pathology and apoptosis of neuronal cells derived from the transgenic mouse model of Alzheimer’s disease. Brain Res 1691:87–93. https://doi.org/10.1016/j.brainres.2018.03.034 Lim Y-J, Park W-T, Lee GW (2024) Extracellular vesicles for neural regeneration after spinal cord injury. Neural Regen Res 19:491–492. https://doi.org/10.4103/1673-5374.380894 Mellado S, Cuesta CM, Montagud S, et al (2023) Therapeutic role of mesenchymal stem cell-derived extracellular vesicles in neuroinflammation and cognitive dysfunctions induced by binge-like ethanol treatment in adolescent mice. CNS Neurosci Ther 29:4018–4031. https://doi.org/10.1111/cns.14326 Mellado S, Morillo-Bargues MJ, Perpiñá-Clérigues C, et al (2025a) The emerging role of mesenchymal stem cell-derived extracellular vesicles to ameliorate hippocampal NLRP3 inflammation induced by binge-like ethanol treatment in adolescence. Neural Regen Res 20:1153–1163. https://doi.org/10.4103/NRR.NRR-D-23-01397 Mellado S, Touahri N, Montagud-Romero S, et al (2025b) Role of miRNAs from mesenchymal stem cell-derived extracellular vesicles in neuroinflammation and behavioral impairments induced by chronic alcohol consumption in female mice. Neural Regen Res. https://doi.org/10.4103/NRR.NRR-D-24-01260 Mellado-López M, Griffeth RJ, Meseguer-Ripolles J, et al (2017) Plasma Rich in Growth Factors Induces Cell Proliferation, Migration, Differentiation, and Cell Survival of Adipose-Derived Stem Cells. Stem Cells Int 2017:5946527. https://doi.org/10.1155/2017/5946527 Menon V, D’Esposito M (2022) The role of PFC networks in cognitive control and executive function. Neuropsychopharmacol Off Publ Am Coll Neuropsychopharmacol 47:90–103. https://doi.org/10.1038/s41386-021-01152-w Mincheva G, Moreno-Manzano V, Felipo V, Llansola M (2024) Extracellular vesicles from mesenchymal stem cells improve neuroinflammation and neurotransmission in hippocampus and cognitive impairment in rats with mild liver damage and minimal hepatic encephalopathy. Stem Cell Res Ther 15:472. https://doi.org/10.1186/s13287-024-04076-6 Montesinos J, Alfonso-Loeches S, Guerri C (2016) Impact of the Innate Immune Response in the Actions of Ethanol on the Central Nervous System. Alcohol Clin Exp Res 40:2260–2270. https://doi.org/10.1111/acer.13208 Muñoz-Criado I, Meseguer-Ripolles J, Mellado-López M, et al (2017) Human Suprapatellar Fat Pad-Derived Mesenchymal Stem Cells Induce Chondrogenesis and Cartilage Repair in a Model of Severe Osteoarthritis. Stem Cells Int 2017:4758930. https://doi.org/10.1155/2017/4758930 Paik S, Kim JK, Shin HJ, et al (2025) Updated insights into the molecular networks for NLRP3 inflammasome activation. Cell Mol Immunol 22:563–596. https://doi.org/10.1038/s41423-025-01284-9 Pascual M, Calvo-Rodriguez M, Núñez L, et al (2021) Toll-like receptors in neuroinflammation, neurodegeneration, and alcohol-induced brain damage. IUBMB Life 73:900–915. https://doi.org/10.1002/iub.2510 Pascual M, Montesinos J, Montagud-Romero S, et al (2017) TLR4 response mediates ethanol-induced neurodevelopment alterations in a model of fetal alcohol spectrum disorders. J Neuroinflammation 14:145. https://doi.org/10.1186/s12974-017-0918-2 Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108. https://doi.org/10.1038/nprot.2008.73 Squire LR, Genzel L, Wixted JT, Morris RG (2015) Memory consolidation. Cold Spring Harb Perspect Biol 7:a021766. https://doi.org/10.1101/cshperspect.a021766 Tochon L, Vouimba R-M, Corio M, et al (2023) Chronic alcohol consumption shifts learning strategies and synaptic plasticity from hippocampus to striatum-dependent pathways. Front Psychiatry 14:1129030. https://doi.org/10.3389/fpsyt.2023.1129030 Tolomeo AM, Zuccolotto G, Malvicini R, et al (2023) Biodistribution of Intratracheal, Intranasal, and Intravenous Injections of Human Mesenchymal Stromal Cell-Derived Extracellular Vesicles in a Mouse Model for Drug Delivery Studies. Pharmaceutics 15:548. https://doi.org/10.3390/pharmaceutics15020548 Volarevic A, Harrell CR, Arsenijevic A, et al (2025) Therapeutic Potential of Mesenchymal Stem Cell-Derived Extracellular Vesicles in the Treatment of Parkinson’s Disease. Cells 14:600. https://doi.org/10.3390/cells14080600 Wang N, Ma F, Song H, et al (2025) Mesenchymal Stem Cell-Derived Extracellular Vesicles for Regenerative Applications and Radiotherapy. Cell Transplant 34:9636897241311019. https://doi.org/10.1177/09636897241311019 WHO (ed) (2024) World health statistics 2024. World Health Organization Xu W, Huang Y, Zhou R (2025) NLRP3 inflammasome in neuroinflammation and central nervous system diseases. Cell Mol Immunol 22:341–355. https://doi.org/10.1038/s41423-025-01275-w Yao J, Sterling K, Wang Z, et al (2024) The role of inflammasomes in human diseases and their potential as therapeutic targets. Signal Transduct Target Ther 9:10. https://doi.org/10.1038/s41392-023-01687-y Yu M, Ma H, Lai X, et al (2025) Stem cell extracellular vesicles: a new dawn for anti-inflammatory treatment of neurodegenerative diseases. Front Aging Neurosci 17:1592578. https://doi.org/10.3389/fnagi.2025.1592578 Zhang Y, Jiang L, Wu R, et al (2025a) An AIM2 inflammasome biomimetic mineralization inhibitor for vascular dementia therapy. Theranostics 15:6347–6368. https://doi.org/10.7150/thno.110389 Zhang Y, Zhang L, Li P, et al (2025b) Extracellular vesicles from adipose-derived stem cell alleviate diabetic cardiomyopathy by regulating Chit1/NLRP3/Caspase-1-Mediated pyroptosis. Int Immunopharmacol 146:113860. https://doi.org/10.1016/j.intimp.2024.113860 Zheng D, Liwinski T, Elinav E (2020) Inflammasome activation and regulation: toward a better understanding of complex mechanisms. Cell Discov 6:36. https://doi.org/10.1038/s41421-020-0167-x Additional Declarations No competing interests reported. Supplementary Files Table1.docx Cite Share Download PDF Status: Published Journal Publication published 07 Apr, 2026 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 16 Jan, 2026 Reviews received at journal 11 Nov, 2025 Reviewers agreed at journal 08 Nov, 2025 Reviewers agreed at journal 05 Nov, 2025 Reviewers agreed at journal 03 Nov, 2025 Reviewers invited by journal 03 Nov, 2025 Editor assigned by journal 28 Oct, 2025 Submission checks completed at journal 28 Oct, 2025 First submitted to journal 26 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7957853","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":543444113,"identity":"4eb49b2c-0f85-4897-8baf-14d98b37ab10","order_by":0,"name":"Susana Mellado","email":"","orcid":"","institution":"University of Valencia","correspondingAuthor":false,"prefix":"","firstName":"Susana","middleName":"","lastName":"Mellado","suffix":""},{"id":543444114,"identity":"afb742e7-6f54-47fd-9bb0-bc324cc13ff9","order_by":1,"name":"Victoria Moreno-Manzano","email":"","orcid":"","institution":"Centro de Investigacion Principe Felipe","correspondingAuthor":false,"prefix":"","firstName":"Victoria","middleName":"","lastName":"Moreno-Manzano","suffix":""},{"id":543444115,"identity":"c9aeace7-f617-4f42-a303-5374a83c8cd9","order_by":2,"name":"Consuelo Guerri","email":"","orcid":"","institution":"Centro de Investigacion Principe Felipe","correspondingAuthor":false,"prefix":"","firstName":"Consuelo","middleName":"","lastName":"Guerri","suffix":""},{"id":543444116,"identity":"7d724cef-89b1-4b5a-86f7-4d136086e0b4","order_by":3,"name":"María Pascual","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIiWNgGAWjYJCCA3DWgwqStSScIdm+xDYiFOm2n3144AfDHXn59jOGHxLnHU5sYG9/gFeL2Zl0g4M9DM8MN5zJMZZI3AbUwnPGAL+WA2kMB3gYDjNukOAxAGkxZpDIwe8ws/PPGA7+YThsP38Gj/GPxDlALfLPCTjsRhrDYaAtiQ03eMwkEhsOyzFIMBBw2I1nDIdlDJ4lbziTVmaRcCxdjo0nh4CW82nMH99U3LGd3354840PNdY8/OzH8TsMAgwOINhsRKgHgQMEVYyCUTAKRsEIBgAYRknwroVJmgAAAABJRU5ErkJggg==","orcid":"","institution":"University of Valencia","correspondingAuthor":true,"prefix":"","firstName":"María","middleName":"","lastName":"Pascual","suffix":""}],"badges":[],"createdAt":"2025-10-27 12:17:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7957853/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7957853/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-026-11774-2","type":"published","date":"2026-04-07T15:59:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":95824021,"identity":"12e28452-1492-4d7d-aaab-aa331fdb58bb","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1236699,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptMBR.docx","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/cd00aa3b8f83e413f0ac79f8.docx"},{"id":95824022,"identity":"b8fc3ba4-cf89-4676-aca4-935ac72fa20f","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":897522,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/d8989c0d6afc8de20454cb36.tif"},{"id":95824039,"identity":"f1b3a2d0-52a9-44f8-9d71-acd21255afeb","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18519224,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/8fcf4004814419706424928e.tif"},{"id":96239354,"identity":"c80297e9-41d5-4c91-9e00-0c56e35483d7","added_by":"auto","created_at":"2025-11-19 07:06:22","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62025,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/68b11d39f3ec10a5e2d2ad43.docx"},{"id":96239198,"identity":"d7fa3ba1-d475-4d6c-a5b2-b4983d080bc5","added_by":"auto","created_at":"2025-11-19 07:05:06","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13747450,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/b636aba5970307d39adc89c5.tif"},{"id":96239999,"identity":"6cfd1a88-085d-4f3e-82f8-449a161a28ea","added_by":"auto","created_at":"2025-11-19 07:08:07","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13747450,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/4c30603532583264e119fb6d.tif"},{"id":95824024,"identity":"dc91971d-10db-4fe3-b96f-6068ed6e9c4b","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"json","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5895,"visible":true,"origin":"","legend":"","description":"","filename":"5f328a9619634ea283b949a981e810d8.json","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/6c96203289b025ef49c511e5.json"},{"id":95824026,"identity":"8210d4fb-0a5d-4d19-a0a1-79f997544c32","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":106668,"visible":true,"origin":"","legend":"","description":"","filename":"5f328a9619634ea283b949a981e810d81enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/992f9163aef194733ccc9c56.xml"},{"id":95824025,"identity":"36ce71c7-fce2-4fb8-8c38-3211cde57534","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":897522,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/9c457e7d90cb07c9b300e26e.tif"},{"id":95824037,"identity":"cda01be0-5109-4cdf-a2a6-d2a92a9651d7","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18519224,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/aa5cd970d5ff464a9baa08cc.tif"},{"id":96239020,"identity":"ca01fa3f-a502-4731-b0e6-fbbebff97999","added_by":"auto","created_at":"2025-11-19 07:01:24","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13747450,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/4e70811660eb82aac3f790fe.tif"},{"id":95824035,"identity":"6f7791eb-32ee-4114-acce-58e9b1c3bc3f","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13747450,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/791ff98e690c9eb01810a082.tif"},{"id":96239282,"identity":"30048784-ab48-4466-9c4f-aa9a9f6e7d9c","added_by":"auto","created_at":"2025-11-19 07:05:59","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":229772,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/4dd3a0d265726b17d579309d.jpeg"},{"id":96239085,"identity":"c3edc13a-162d-42a8-8845-6963d74f8324","added_by":"auto","created_at":"2025-11-19 07:02:29","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":248478,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/fc4e0a184b440f1915444e13.jpeg"},{"id":96239628,"identity":"8b2e4d3d-0921-4de2-bc2a-1d4d69e38a8f","added_by":"auto","created_at":"2025-11-19 07:07:13","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":308424,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/7d7ed8b34e01bbd0a9ce17b3.jpeg"},{"id":95824027,"identity":"2f8a0211-0f4b-4adf-9fc5-688b7a1fd2bf","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":320202,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/c3a63ffe9819b0b542d8258d.jpeg"},{"id":95824032,"identity":"49f93d0d-0399-4f9b-bf0c-a3718ecd88b2","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100279,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/e7661cefa7f3a703b00cfed3.png"},{"id":96239229,"identity":"0c6cb321-e54e-4f1b-9881-c41102072acb","added_by":"auto","created_at":"2025-11-19 07:05:45","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":179681,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/371ef37aa136b8f2b894af24.png"},{"id":96239500,"identity":"72216790-0873-4a86-b663-21d6f103ae3e","added_by":"auto","created_at":"2025-11-19 07:06:50","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140171,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/10ddd53196eddbc27bc8b287.png"},{"id":96239361,"identity":"63a5c64f-f0fc-4e3c-a8fd-feb27fc49ee8","added_by":"auto","created_at":"2025-11-19 07:06:23","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":146214,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/fd3c2e4cc5007098fe45507a.png"},{"id":96239143,"identity":"ad2dc79d-a79f-4b0e-87bd-f9cfb76d758b","added_by":"auto","created_at":"2025-11-19 07:03:10","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28315,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/0d00c1aab884a7be3189037f.png"},{"id":96239428,"identity":"3c6c69ee-1d3d-4734-a0e1-64bb80c38c53","added_by":"auto","created_at":"2025-11-19 07:06:37","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":48915,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/d0fcdf94b33700fadfe5f4fa.png"},{"id":96239078,"identity":"7a2138ea-e75e-4267-a127-8a2162e7e299","added_by":"auto","created_at":"2025-11-19 07:02:23","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57030,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/0389ea9be28c04f89292ac11.png"},{"id":95824045,"identity":"2aed7bd4-af20-45b5-8ea6-f9f8c0774f4e","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59366,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/3d1bb4b92fa0306f454f3b73.png"},{"id":95824046,"identity":"adc3c250-db05-49ed-afbb-a55b8b77d95b","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"xml","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":103395,"visible":true,"origin":"","legend":"","description":"","filename":"5f328a9619634ea283b949a981e810d81structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/1f0d59814865fad062b5cc5f.xml"},{"id":95824041,"identity":"d59ef169-18f6-4fa1-b01b-9f59694a3d17","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"html","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113690,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/1932ce9e54015c9d286c6099.html"},{"id":96239216,"identity":"4ca823e9-645c-4bad-b866-35ae1114466f","added_by":"auto","created_at":"2025-11-19 07:05:42","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":891869,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the experimental design. Mesenchymal stem cell-derived extracellular vesicles (EVs) were isolated from human adipose tissue and characterized as previously described (Mellado et al. 2025b). Female mice were exposed to 10% ethanol in drinking water for 3 months received intravenous (IV) injections of EVs every 10 days. EV administration attenuated the activation of the NLRP3 inflammasome complex and other inflammasome-related receptors (NLRP1, NLRC4, AIM2), as well as ethanol-induced alterations in the expression of inflammatory genes in the prefrontal cortex, hippocampus, and striatum.\u003c/p\u003e","description":"","filename":"Fig1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/bf80870342986f7fafb115f3.jpg"},{"id":96239451,"identity":"7078f4db-a9ab-4a9d-ba9e-cb33037288ad","added_by":"auto","created_at":"2025-11-19 07:06:41","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1146856,"visible":true,"origin":"","legend":"\u003cp\u003eMesenchymal stem cell-derived extracellular vesicles (MSC-EVs) administration mitigated chronic ethanol–induced activation of the NLRP3 inflammasome complex.\u003cstrong\u003e (A)\u003c/strong\u003e mRNA levels of key NRLP3 inflammasome complex, such as \u003cem\u003eNlrp3\u003c/em\u003e and \u003cem\u003ecaspase-1\u003c/em\u003e (\u003cem\u003eCasp-1\u003c/em\u003e) in the prefrontal cortex, hippocampus and striatum. \u003cstrong\u003e(B)\u003c/strong\u003e mRNA expression of the proinflammatory \u003cem\u003eIl1b\u003c/em\u003e and \u003cem\u003eIl18\u003c/em\u003e in the same regions. Data are represented as mean ± SEM, n=8-9 mice/group. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 and *** p \u0026lt; 0.001, vs. respective saline-treated group; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 and ### p \u0026lt; 0.001, vs. respective ethanol-treated group.\u003c/p\u003e","description":"","filename":"Fig2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/2f78fa7122d0aaa3edf98abe.jpg"},{"id":95824016,"identity":"e094f7ba-fcd0-4cbf-9bc1-15ea5b276a4a","added_by":"auto","created_at":"2025-11-13 11:07:19","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":928209,"visible":true,"origin":"","legend":"\u003cp\u003eMesenchymal stem cell-derived extracellular vesicles (MSC-EVs) treatment reduced ethanol-induced upregulation of upstream inflammasome regulators. mRNA levels of \u003cem\u003eCasp-11/4\u003c/em\u003e, \u003cem\u003eTlr4\u003c/em\u003e, and \u003cem\u003eIrak1 \u003c/em\u003ein prefrontal cortex, hippocampus and striatum. Data represent mean ± SEM, n=8/9 mice/group. * p \u0026lt; 0.05, ** p \u0026lt; 0.01, and *** p \u0026lt; 0.001, vs. respective saline-treated group; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 and ### p \u0026lt; 0.001, vs. respective ethanol-treated group.\u003c/p\u003e","description":"","filename":"Fig3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/47f432442d142943e4154c35.jpg"},{"id":95824020,"identity":"b0c3b969-e084-4a87-861b-a55977545a20","added_by":"auto","created_at":"2025-11-13 11:07:20","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":954926,"visible":true,"origin":"","legend":"\u003cp\u003eMesenchymal stem cell-derived extracellular vesicles (MSC-EVs) administration counteracted ethanol-induced signaling through other NLR inflammasome pathways. The mRNA expression of the NLRs, \u003cem\u003eNlrp1\u003c/em\u003e, \u003cem\u003eAim2\u003c/em\u003eand \u003cem\u003eNlrc4\u003c/em\u003e in prefrontal cortex, hippocampus and striatum. Data are presented as mean ± SEM, n=8-9 mice/group. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 and *** p \u0026lt; 0.001, vs. respective saline-treated group; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 and ### p \u0026lt; 0.001, vs. respective ethanol-treated group.\u003c/p\u003e","description":"","filename":"Fig4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/1ab14db295fc50aec551a3de.jpg"},{"id":106809322,"identity":"08345e29-b85b-45a4-9e93-937283a17932","added_by":"auto","created_at":"2026-04-13 16:09:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4450624,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/9c85f1d5-369d-4ece-9ab2-139f47dc173b.pdf"},{"id":95824015,"identity":"695a6c7f-9b9d-44df-8d49-a3400aa8189c","added_by":"auto","created_at":"2025-11-13 11:07:19","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":62025,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7957853/v1/741f9e1fea19e416b62e3eb3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Immunomodulatory effects of stem cell-derived extracellular vesicles on NLRP3 inflammasome activation in the brain after chronic ethanol exposure","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eChronic alcohol consumption represents a major public health challenge and one of the leading risk factors for preventable disease and premature mortality. According to the World Health Organization, harmful alcohol use accounts for approximately 5% of the global burden of disease and contributes to over 2.6\u0026nbsp;million deaths annually (WHO 2024). Excessive alcohol intake is strongly linked to liver cirrhosis, cardiovascular disease, gastrointestinal disorders, and several forms of cancer, as well as increased susceptibility to infections due to its profound effects on immune function (GBD 2016 Alcohol Collaborators \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Aslam and Kwo \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Moreover, alcohol misuse is a significant contributor to accidents, violence, and social harm, further amplifying its societal impact. Beyond these systemic consequences, chronic alcohol exposure exerts profound effects on the central nervous system, where it is associated with structural and functional alterations, including white matter atrophy, axonal degeneration, and demyelination, that ultimately drive cognitive decline and psychiatric comorbidities such as depression, anxiety, and alcohol use disorder itself(Pascual et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eA growing body of evidence indicates that the detrimental effects of chronic alcohol exposure are largely mediated by neuroimmune dysregulation (Xu et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Ethanol activates brain-resident immune cells, particularly microglia and astrocytes, triggering the stimulation of pattern-recognition receptors (PRRs) such as Toll-like receptors (TLRs) (Alfonso-Loeches et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Activation of these receptors initiates pro-inflammatory signaling cascades that enhance cytokines and chemokines production, ultimately promoting persistent neuroinflammatory states that compromise neuronal integrity and function (Montesinos et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAmong the key mechanisms sustaining these inflammatory processes, the assembly and activation of inflammasomes have received particular attention. These multiprotein complexes act as central regulators of innate immunity by converging on caspase-1 activation, which drives the cleavage and release of the pro-inflammatory cytokines interleukin-1β (IL-1β) and interleukin-18 (IL-18). Several members of the NOD-like receptor (NLR) family, including NLRP1, NLRC4, AIM2, and particularly NLRP3, are capable of forming canonical inflammasome complexes (Yao et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Xu et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Dysregulation of these inflammasomes amplifies inflammatory cascades, exacerbates neuronal damage, and has been increasingly implicated in the neuropathological consequences of chronic alcohol consumption (Alfonso-Loeches et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn recent years, mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) have emerged as promising therapeutic tools for modulating neuroinflammatory pathways (Mellado et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e). These nanosized vesicles, enriched in proteins, lipids, and microRNAs (miRNAs), can cross the blood\u0026ndash;brain barrier and deliver their bioactive cargo to target cells, thereby regulating glial activation, inhibiting inflammasome signaling, and promoting neuronal survival. Notably, MSC-EVs have also been shown to support synaptic plasticity and remyelination, processes essential for preserving cognitive and behavioral functions (Izquierdo-Altarejos et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Mincheva et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Consistent with these observations, our previous studies demonstrated that systemic administration of MSC-EVs attenuated ethanol-induced neuroinflammation and NLRP3 inflammasome activation, while restoring synaptic integrity and myelin structure in adolescent mouse brains exposed to binge-like alcohol consumption (Mellado et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBuilding on these findings, the present study extends this investigation to a model of chronic alcohol exposure in adult mice. We specifically evaluated the impact of MSC-EVs on inflammasome-related pathways across multiple brain regions critically affected by alcohol\u0026mdash;namely, the prefrontal cortex, hippocampus, and striatum. By quantifying the expression of key inflammasome components (NLRP1, NLRP3, NLRC4, AIM2) and effector caspases (caspase-1 and caspase-11/4) using RT-qPCR, we aimed to elucidate the therapeutic potential of MSC-EVs in mitigating ethanol-induced neuroinflammatory damage.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cb\u003eMSC isolation, culture and isolation of MSC-EVs\u003c/b\u003e\u003c/p\u003e\u003cp\u003eHuman adipose tissue was obtained as surgical surplus from knee replacement procedures performed on four donors under sterile conditions, with all samples anonymized to protect patient confidentiality. The study protocol was approved by the Regional Ethics Committee for Clinical Research with Medicines and Health Products (Code of Practice 2014/01). Exclusion criteria included any history of cancer or active infectious diseases (viral or bacterial). All participating donors provided written informed consent for the use of their adipose tissue.\u003c/p\u003e\u003cp\u003eMSCs were isolated, expanded, and characterized according to established protocols (Mellado-L\u0026oacute;pez et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Mu\u0026ntilde;oz-Criado et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). For EVs isolation, conditioned media were sequentially processed by differential centrifugation. Briefly, samples were centrifuged at 300 \u0026times; g for 10 min to remove cells, followed by a 2 000 \u0026times; g spin for 10 minutes to eliminate cellular debris. A subsequent 10 000 \u0026times; g spin for 30 minutes removed apoptotic bodies and residual particulates. The clarified supernatant was then ultracentrifuged at 100 000 \u0026times; g for 1 hour to pellet EVs. After washing with phosphate-buffered saline (PBS) and repeating ultracentrifugation under identical conditions, the purified EV pellet was resuspended in PBS at a final concentration of 20 \u0026micro;g/100 \u0026micro;L and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until use. Freshly isolated EVs were also used for characterization by transmission electron microscopy, Western blot, and nanoparticle tracking analysis, as previously described by Mellado et al. (Mellado et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eAnimals and treatments\u003c/h2\u003e\u003cp\u003eThirty-six female C57BL/6 wild-type mice (two-month-old; Harlan Ib\u0026eacute;rica, Barcelona, Spain) were used. Animals were housed in groups of three to four per cage under controlled environmental conditions (12 h light/dark cycle, 23\u0026deg;C, 60% humidity) with \u003cem\u003ead libitum\u003c/em\u003e access to food and water. All the experimental procedures were carried out in accordance with the guidelines approved by European Communities Council Directive (86/609/ECC) and Spanish Royal Decree 53/2013 with the approval of the Ethical Committee of Animal Experimentation of the Pr\u0026iacute;ncipe Felipe Research Centre (Valencia, Spain) and the Generalitat Valenciana (Project identification code: 2022/VSC/PEA/0294).\u003c/p\u003e\u003cp\u003eMice were exposed to chronic ethanol by providing 10% (v/v) ethanol in drinking water ad libitum for three months, following established protocols (Alfonso-Loeches et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Control animals received standard drinking water. During the treatment period, subsets of animals received intravenous injections of either MSC-EVs (20 \u0026micro;g/dose) or vehicle (0.9% saline) via the tail vein every ten days. Animals were randomly assigned to four experimental groups: control\u0026thinsp;+\u0026thinsp;vehicle, control\u0026thinsp;+\u0026thinsp;MSC-EVs, ethanol\u0026thinsp;+\u0026thinsp;vehicle, ethanol\u0026thinsp;+\u0026thinsp;MSC-EVs (n\u0026thinsp;=\u0026thinsp;8/9 per group). Consistent with previous findings (Pascual et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), blood ethanol concentrations during the dark cycle averaged 125\u0026thinsp;\u0026plusmn;\u0026thinsp;20 mg/dL in ethanol-exposed groups, confirming that MSC-EV administration did not affect ethanol metabolism. At the end of the treatment period, mice were deeply anesthetized with sodium pentobarbital (60 mg/kg, i.p.) and euthanized by cervical dislocation. Brains were rapidly removed, and the prefrontal cortex, striatum, and hippocampus were dissected, flash-frozen in liquid nitrogen, and stored at -80\u0026deg;C for subsequent analysis. The experimental timeline is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eRNA isolation, reverse transcription and quantitative RT-PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from frozen prefrontal cortex, hippocampus, and striatum samples using TRIzol reagent (T9424, Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer\u0026rsquo;s instructions. Reverse transcription was performed with the NZY First-Strand cDNA Synthesis Kit (MB40001, NZYTech, Lisbon, Portugal).\u003c/p\u003e\u003cp\u003eQuantitative PCR (qPCR) was carried out on a QuantStudio\u0026trade; 5 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with AceQ\u0026reg; qPCR SYBR Green Master Mix (NB-54-0171-02, NeoBiotech, Nanterre, France). Non-template controls were included in each run, and all reactions were performed in triplicate. Cyclophilin A mRNA served as the internal reference gene for normalization. Relative gene expression was calculated using the ΔΔCq method (Schmittgen and Livak \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) with QuantStudio\u0026trade; Design \u0026amp; Analysis Software v1.5.3 (Applied Biosystems). Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eNucleotide sequences of the primers used for the RT-PCR of genes.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequences (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eNlrp3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AAGTCCTGCCCCAAGCCCCA\u003c/p\u003e\u003cp\u003eR: GGAAGGGCAGCCTCTGGCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCasp-1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGCACATTTCCAGGACTGACTG\u003c/p\u003e\u003cp\u003eR: GCAAGACGAGTACGAGTGGTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIl1b\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GACCCCAAAAGATGAAGGGCT\u003c/p\u003e\u003cp\u003eR: TGTGCTGCTGCGAGATTTGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIl18\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ACTGTACAACCGCAGTAATACGG\u003c/p\u003e\u003cp\u003eR: AGTGAACATTACAGATTTATCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eNlrp1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TCCAAGAGAGGGTCCACTGA\u003c/p\u003e\u003cp\u003eR: CCTTGCTGAAACCAGGAGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAim2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GTCACCAGTTCCTCAGTTGTG\u003c/p\u003e\u003cp\u003eR: TGTCTCCTTCCTCGCACTTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eNlrc4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TGATGCTGCCTTGGTGCT\u003c/p\u003e\u003cp\u003eR: ATCCGTCACTGCTCACACAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCasp-11/4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CCGAGACAAAACAGGAGGC\u003c/p\u003e\u003cp\u003eR: GGTGGGCATCTGGGAATGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIrak1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGACTTCCACAGTTCGAGGTAC\u003c/p\u003e\u003cp\u003eR: GGTCTTTGCACCTTGTGTCCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTlr4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TGCCTCTCTTGCATCTGGCTGG\u003c/p\u003e\u003cp\u003eR: CTGTCAGTACCAAGGTTGAGAGCTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCyclophilin A\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GTCTCCTTCGAGCTGTTTGC\u003c/p\u003e\u003cp\u003eR: GATGCCAGGACCTGTATGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical analyses were performed using SPSS v28. Normality was assessed using the with the Shapiro\u0026ndash;Wilk test. For parametric data, two-way ANOVA followed by Bonferroni post hoc comparisons was applied, whereas the Kruskal\u0026ndash;Wallis test was used as the non-parametric data. A p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003eOur previous study demonstrated that adipose-derived MSC-EVs ameliorate neuroinflammation and NLRP3 inflammasome activation in the hippocampus induced by binge-like alcohol consumption in adolescent mice (Mellado et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e). Building on these findings, we sought to determine whether MSC-EVs exert similar protective effects in a model of chronic alcoholism in adult mice, focusing on brain regions highly vulnerable to alcohol-induced damage, including the prefrontal cortex, hippocampus, and striatum. To address this question, we first evaluated the components of the NLRP3 inflammasome complex (Almeida-da-Silva et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, chronic ethanol exposure significantly increased the gene expression of \u003cem\u003eNlrp3\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001] and \u003cem\u003eCasp-1\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01], compared with control mice. Cytokine analysis revealed that ethanol markedly upregulated \u003cem\u003eIl1b\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001] and \u003cem\u003eIl18\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001] mRNA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Notably, MSC-EVs treatment mitigated the ethanol-induced upregulation of these inflammation-related genes in the prefrontal cortex [\u003cem\u003eNlrp3\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003cem\u003eCasp-1\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl1b\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl18\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05], hippocampus [\u003cem\u003eNlrp3\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eCasp-1\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl1b\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eIl18\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01], and striatum [\u003cem\u003eNlrp3\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eIl1b\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eIl18\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001]. In addition, ethanol-treated animals showed a marked elevation in NLRP3-related gene expression when compared to control\u0026thinsp;+\u0026thinsp;MSC-EVs group across all brain regions [prefrontal cortex: \u003cem\u003eNlrp3\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eCasp-1\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl1b\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl18\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; hippocampus: \u003cem\u003eNlrp3\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eCasp-1\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003cem\u003eIl1b\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl18\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; and striatum: \u003cem\u003eNlrp3\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003cem\u003eIl1b\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003cem\u003eIl18\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eGiven that molecules such as caspase-11/4, TLR4, and IRAK1 are implicated in the upstream regulation of the NLRP3/caspase-1 inflammasome pathway (Paik et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), we next assessed the expression of these genes to determine whether chronic ethanol altered their levels and whether EV treatment exerted modulatory effects. Ethanol significantly increased the mRNA expression of \u003cem\u003eCasp-11/4\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001] and \u003cem\u003eTlr4\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01] compared with controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Remarkably, MSC-EV treatment attenuated these ethanol-induced changes, reducing \u003cem\u003eCasp-11/4\u003c/em\u003e expression [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001] and \u003cem\u003eTlr4\u003c/em\u003e expression [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001]. Significant differences were likewise observed between the control\u0026thinsp;+\u0026thinsp;MSC-EV group and the ethanol group in prefrontal cortex [\u003cem\u003eCasp-11/4\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eTlr4\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05], hippocampus [\u003cem\u003eCasp-11/4\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003cem\u003eTlr4\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001] and striatum [\u003cem\u003eCasp-11/4\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003eTlr4\u003c/em\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01]. No significant changes were detected in \u003cem\u003eIrak1\u003c/em\u003e gene expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFinally, to evaluate the potential involvement of additional inflammasome-forming NLRs, we analyzed the expression of \u003cem\u003eNlrp1\u003c/em\u003e, \u003cem\u003eAim2\u003c/em\u003e and \u003cem\u003eNlrc4\u003c/em\u003e in mice exposed to chronic alcohol. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows that chronic ethanol treatment significantly upregulated the expression of all three inflammasome-related genes \u003cem\u003eNlrp1\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001], \u003cem\u003eAim2\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05] and \u003cem\u003eNlrc4\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05]. Importantly, MSC-EV administration significantly reversed these ethanol-induced increased, normalizing expression of \u003cem\u003eNlrp1\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001], \u003cem\u003eAim2\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01] and \u003cem\u003eNlrc4\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001]. Significant group differences were also found between the EV-treated and ethanol groups for \u003cem\u003eNlrp1\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01], \u003cem\u003eAim2\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05] and \u003cem\u003eNlrc4\u003c/em\u003e [prefrontal cortex, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; hippocampus, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; striatum, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOur study expands on previous evidence demonstrating the therapeutic potential of MSC-EVs in counteracting ethanol-induced brain damage. We recently demonstrated that systemic administration of adipose-derived MSC-EVs attenuates NLRP3 inflammasome activation and neuroinflammatory responses in the hippocampus of adolescent mice exposed to binge-like ethanol treatment (Mellado et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Here, we extend those findings by demonstrating that chronic ethanol exposure in adult mice induces profound alterations in brain structure and function, as revealed by imaging, behavioral assessments, and molecular analyses of inflammation-related genes (Mellado et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e). These results highlight the ability of MSC-EVs to modulate key innate immune pathways triggered by chronic alcohol exposure, thereby mitigating neuroinflammation and reducing neuronal vulnerability.\u003c/p\u003e\u003cp\u003eMSC-EVs have demonstrated potent immunomodulatory and regenerative effects across a variety of disease models. For example, MSC-EVs regulate tissue damage, exert anti-inflammatory and pro-proliferative actions, and promote repair of tissues such as heart, lung, intestine, and skin (Wang et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). They also foster tubular regeneration, suppress oxidative stress and fibrosis, reduce proinflammatory cytokines, and improve renal function (Birtwistle et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Beyond peripheral organ repair, MSC-EVs show significant therapeutic potential in neurological disorders. In Alzheimer\u0026rsquo;s disease models, MSC-EVs attenuate neuroinflammation, reduce amyloid-β deposition, and improve cognitive deficits (Gomes et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Garcia-Contreras and Thakor \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Similar neuroprotective effects have been reported in models of Parkinson\u0026rsquo;s disease (Volarevic et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), traumatic brain injury, and spinal cord injury (Dutta et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Lim et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In the context of alcohol-induced damage, where chronic neuroinflammation drives neuronal dysfunction and degeneration (Anand et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), MSC-EVs may counteract these deleterious processes (Mellado et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our results support this view, showing that systemic EV treatment effectively attenuates the ethanol-induced activation of key inflammasome components, reinforcing their clinical relevance for alcohol-related neuropathologies.\u003c/p\u003e\u003cp\u003eAmong the various inflammasome-forming receptors, NLRP3 is most consistently implicated in alcohol-induced neuroinflammation (Alfonso-Loeches et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In the present study, chronic ethanol exposure significantly upregulated the expression of \u003cem\u003eNlrp3\u003c/em\u003e and \u003cem\u003eCasp-1\u003c/em\u003e across the prefrontal cortex, hippocampus, and striatum, in parallel with marked increases in the pro-inflammatory cytokines \u003cem\u003eIl1b\u003c/em\u003e and \u003cem\u003eIl18\u003c/em\u003e. These findings underscore the central role of NLRP3 inflammasome activation in driving persistent inflammatory signaling, cytokine release, and ultimately neuronal injury. Consistent with our observations, MSC-EVs have been reported to mitigate NLRP3 activation and pro-inflammatory cytokines release, thereby improving myelin repair in neurodegeneration disorders (Askari et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), reducing β-amyloid pathology in mouse model of Alzheimer\u0026rsquo;s disease (Lee et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) or alleviating diabetic cardiomyopathy (Zhang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e). Importantly, MSC-EV treatment in our model normalized ethanol-induced upregulation of both the receptor complex and its downstream cytokines, suggesting a broad regulatory effect on inflammasome activation and highlighting their therapeutic potential against chronic ethanol-driven neuroinflammation.\u003c/p\u003e\u003cp\u003eOur results also reveal that chronic ethanol exposure activates additional inflammasome-related receptors, including NLRP1, AIM2, and NLRC4, indicating that alcohol-induced neuroinflammation involves multiple innate immune pathways rather than a single axis. MSC-EVs significantly reduced the expression of these receptors across all studied regions, suggesting broad immunomodulatory effects. This is consistent with previous evidence showing that MSC-EVs can modulate inflammasome signaling in diverse pathological contexts, for example, inhibiting AIM2 inflammasome assembly and promoting neuronal survival in vascular dementia (Zhang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e). Furthermore, we found that ethanol elevated \u003cem\u003eCasp-11/4\u003c/em\u003e and \u003cem\u003eTlr4\u003c/em\u003e expression (Zheng et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), key molecules in non-canonical inflammasome activation and TLR signaling, both of which potentiate NLRP3 activity and cytokine release (Alfonso-Loeches et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Notably, MSC-EVs normalized these changes, indicating that their therapeutic actions extend to upstream checkpoints of inflammasome regulation and may help counteract redundant inflammatory cascades in alcohol-related brain damage.\u003c/p\u003e\u003cp\u003eThe prefrontal cortex, hippocampus, and striatum are fundamental for regulating executive function, memory consolidation, emotional control, and reward-related behaviors (Izuma et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Squire et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Menon and D\u0026rsquo;Esposito \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These brain regions are also among the most vulnerable to the detrimental effects of chronic alcohol exposure, which disrupts their structural and functional integrity, and induce synaptic dysfunction, neurodegeneration, and impaired neurotransmitter signaling (Anand et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Tochon et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Mellado et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e). In this context, our results showing that MSC-EVs attenuate inflammasome activation across these areas underscore their therapeutic potential. By reducing inflammatory responses in regions central to cognition and behavior, MSC-EVs may help neural circuitry and preventing the long-term neurological and psychiatric consequences of chronic alcohol consumption.\u003c/p\u003e\u003cp\u003eThis study has several limitations. First, we used EVs derived from human MSC and administered them into mice. Although human MSC-EVs are widely employed in preclinical rodent models and display conserved therapeutic actions across species (Tolomeo et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), potential differences in vesicle composition, biodistribution, and immunogenicity cannot be fully excluded, which may limit direct extrapolation of our findings to humans. Second, the small size of the sampled brain regions prevents deeper analysis of protein expression changes. Second, the small size of the sampled brain regions prevented deeper analysis of protein expression changes. Future studies using larger cohorts and more extensive molecular characterization will be needed to overcome these limitations and provide a more comprehensive understanding of the mechanisms underlying the therapeutic effects of MSC-EVs.\u003c/p\u003e\u003cp\u003eTaken together, our findings reinforce the therapeutic potential of MSC-EVs as regulators of neuroinflammation in alcohol-related brain injury. By targeting multiple inflammasome pathways, their upstream regulators, and the downstream cytokines that drive neuronal dysfunction, MSC-EVs exhibit a robust capacity to counteract the deleterious molecular consequences of chronic ethanol exposure. Importantly, their protective effects were observed across brain regions essential for higher-order functions, underscoring the translational relevance of these findings. This study therefore not only advances our understanding of the mechanisms underlying alcohol-induced neuroinflammation but also highlights MSC-EVs as promising candidates for future therapeutic strategies aimed at preventing or ameliorating alcohol-related neurological disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cb\u003eFUNDING DECLARATION\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis work has been supported by grants from the Spanish Ministry of Health-PNSD (2023-I024), GVA (CIAICO/2021/203 and CIAICO/2024/122), the Carlos III Institute, and the Primary Addiction Care Research Network (RD21/0009/0005), PID2023-146865OB-I00 funded by MCIN/AEI/\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.13039/501100011033/FEDER\u003c/span\u003e\u003cspan address=\"10.13039/501100011033/FEDER\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/p\u003e\u003ch2\u003eCONFLICT OF INTEREST\u003c/h2\u003e\u003cp\u003eAll authors declare there is no competing interest in research conduction and paper writing.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eMP and SM conceived and designed the experiments. SM performed the experiments and analyzed the data. SM and MP wrote the manuscript, SM, VMM, CG and MP revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlfonso-Loeches S, Pascual-Lucas M, Blanco AM, et al (2010) Pivotal role of TLR4 receptors in alcohol-induced neuroinflammation and brain damage. J Neurosci Off J Soc Neurosci 30:8285\u0026ndash;8295. https://doi.org/10.1523/JNEUROSCI.0976-10.2010\u003c/li\u003e\n\u003cli\u003eAlfonso-Loeches S, Ure\u0026ntilde;a-Peralta J, Morillo-Bargues MJ, et al (2016) Ethanol-Induced TLR4/NLRP3 Neuroinflammatory Response in Microglial Cells Promotes Leukocyte Infiltration Across the BBB. Neurochem Res 41:193\u0026ndash;209. https://doi.org/10.1007/s11064-015-1760-5\u003c/li\u003e\n\u003cli\u003eAlfonso-Loeches S, Ure\u0026ntilde;a-Peralta JR, Morillo-Bargues MJ, et al (2014) Role of mitochondria ROS generation in ethanol-induced NLRP3 inflammasome activation and cell death in astroglial cells. Front Cell Neurosci 8:216. https://doi.org/10.3389/fncel.2014.00216\u003c/li\u003e\n\u003cli\u003eAlmeida-da-Silva CLC, Savio LEB, Coutinho-Silva R, Ojcius DM (2023) The role of NOD-like receptors in innate immunity. Front Immunol 14:1122586. https://doi.org/10.3389/fimmu.2023.1122586\u003c/li\u003e\n\u003cli\u003eAnand SK, Ahmad MH, Sahu MR, et al (2023) Detrimental Effects of Alcohol-Induced Inflammation on Brain Health: From Neurogenesis to Neurodegeneration. Cell Mol Neurobiol 43:1885\u0026ndash;1904. https://doi.org/10.1007/s10571-022-01308-2\u003c/li\u003e\n\u003cli\u003eAskari H, Yavarpour-Bali H, Shirzad M, et al (2025) Combination therapy with exosomes and NLRP3 inhibition enhances myelin repair in a cuprizone-induced demyelination model. Eur J Pharmacol 1002:177851. https://doi.org/10.1016/j.ejphar.2025.177851\u003c/li\u003e\n\u003cli\u003eAslam A, Kwo PY (2023) Epidemiology and Disease Burden of Alcohol Associated Liver Disease. J Clin Exp Hepatol 13:88\u0026ndash;102. https://doi.org/10.1016/j.jceh.2022.09.001\u003c/li\u003e\n\u003cli\u003eBirtwistle L, Chen X-M, Pollock C (2021) Mesenchymal Stem Cell-Derived Extracellular Vesicles to the Rescue of Renal Injury. Int J Mol Sci 22:6596. https://doi.org/10.3390/ijms22126596\u003c/li\u003e\n\u003cli\u003eDutta D, Khan N, Wu J, Jay SM (2021) Extracellular Vesicles as an Emerging Frontier in Spinal Cord Injury Pathobiology and Therapy. Trends Neurosci 44:492\u0026ndash;506. https://doi.org/10.1016/j.tins.2021.01.003\u003c/li\u003e\n\u003cli\u003eGarcia-Contreras M, Thakor AS (2023) Extracellular vesicles in Alzheimer\u0026rsquo;s disease: from pathology to therapeutic approaches. Neural Regen Res 18:18\u0026ndash;22. https://doi.org/10.4103/1673-5374.343882\u003c/li\u003e\n\u003cli\u003eGBD 2016 Alcohol Collaborators (2018) Alcohol use and burden for 195 countries and territories, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet Lond Engl 392:1015\u0026ndash;1035. https://doi.org/10.1016/S0140-6736(18)31310-2\u003c/li\u003e\n\u003cli\u003eGomes P, Tzouanou F, Skolariki K, et al (2022) Extracellular vesicles and Alzheimer\u0026rsquo;s disease in the novel era of Precision Medicine: implications for disease progression, diagnosis and treatment. Exp Neurol 358:114183. https://doi.org/10.1016/j.expneurol.2022.114183\u003c/li\u003e\n\u003cli\u003eIzquierdo-Altarejos P, Cabrera-Pastor A, Mart\u0026iacute;nez-Garc\u0026iacute;a M, et al (2023) Extracellular vesicles from mesenchymal stem cells reduce neuroinflammation in hippocampus and restore cognitive function in hyperammonemic rats. J Neuroinflammation 20:1. https://doi.org/10.1186/s12974-022-02688-4\u003c/li\u003e\n\u003cli\u003eIzuma K, Saito DN, Sadato N (2008) Processing of social and monetary rewards in the human striatum. Neuron 58:284\u0026ndash;294. https://doi.org/10.1016/j.neuron.2008.03.020\u003c/li\u003e\n\u003cli\u003eLee M, Ban J-J, Yang S, et al (2018) The exosome of adipose-derived stem cells reduces \u0026beta;-amyloid pathology and apoptosis of neuronal cells derived from the transgenic mouse model of Alzheimer\u0026rsquo;s disease. Brain Res 1691:87\u0026ndash;93. https://doi.org/10.1016/j.brainres.2018.03.034\u003c/li\u003e\n\u003cli\u003eLim Y-J, Park W-T, Lee GW (2024) Extracellular vesicles for neural regeneration after spinal cord injury. Neural Regen Res 19:491\u0026ndash;492. https://doi.org/10.4103/1673-5374.380894\u003c/li\u003e\n\u003cli\u003eMellado S, Cuesta CM, Montagud S, et al (2023) Therapeutic role of mesenchymal stem cell-derived extracellular vesicles in neuroinflammation and cognitive dysfunctions induced by binge-like ethanol treatment in adolescent mice. CNS Neurosci Ther 29:4018\u0026ndash;4031. https://doi.org/10.1111/cns.14326\u003c/li\u003e\n\u003cli\u003eMellado S, Morillo-Bargues MJ, Perpi\u0026ntilde;\u0026aacute;-Cl\u0026eacute;rigues C, et al (2025a) The emerging role of mesenchymal stem cell-derived extracellular vesicles to ameliorate hippocampal NLRP3 inflammation induced by binge-like ethanol treatment in adolescence. Neural Regen Res 20:1153\u0026ndash;1163. https://doi.org/10.4103/NRR.NRR-D-23-01397\u003c/li\u003e\n\u003cli\u003eMellado S, Touahri N, Montagud-Romero S, et al (2025b) Role of miRNAs from mesenchymal stem cell-derived extracellular vesicles in neuroinflammation and behavioral impairments induced by chronic alcohol consumption in female mice. Neural Regen Res. https://doi.org/10.4103/NRR.NRR-D-24-01260\u003c/li\u003e\n\u003cli\u003eMellado-L\u0026oacute;pez M, Griffeth RJ, Meseguer-Ripolles J, et al (2017) Plasma Rich in Growth Factors Induces Cell Proliferation, Migration, Differentiation, and Cell Survival of Adipose-Derived Stem Cells. Stem Cells Int 2017:5946527. https://doi.org/10.1155/2017/5946527\u003c/li\u003e\n\u003cli\u003eMenon V, D\u0026rsquo;Esposito M (2022) The role of PFC networks in cognitive control and executive function. Neuropsychopharmacol Off Publ Am Coll Neuropsychopharmacol 47:90\u0026ndash;103. https://doi.org/10.1038/s41386-021-01152-w\u003c/li\u003e\n\u003cli\u003eMincheva G, Moreno-Manzano V, Felipo V, Llansola M (2024) Extracellular vesicles from mesenchymal stem cells improve neuroinflammation and neurotransmission in hippocampus and cognitive impairment in rats with mild liver damage and minimal hepatic encephalopathy. Stem Cell Res Ther 15:472. https://doi.org/10.1186/s13287-024-04076-6\u003c/li\u003e\n\u003cli\u003eMontesinos J, Alfonso-Loeches S, Guerri C (2016) Impact of the Innate Immune Response in the Actions of Ethanol on the Central Nervous System. Alcohol Clin Exp Res 40:2260\u0026ndash;2270. https://doi.org/10.1111/acer.13208\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz-Criado I, Meseguer-Ripolles J, Mellado-L\u0026oacute;pez M, et al (2017) Human Suprapatellar Fat Pad-Derived Mesenchymal Stem Cells Induce Chondrogenesis and Cartilage Repair in a Model of Severe Osteoarthritis. Stem Cells Int 2017:4758930. https://doi.org/10.1155/2017/4758930\u003c/li\u003e\n\u003cli\u003ePaik S, Kim JK, Shin HJ, et al (2025) Updated insights into the molecular networks for NLRP3 inflammasome activation. Cell Mol Immunol 22:563\u0026ndash;596. https://doi.org/10.1038/s41423-025-01284-9\u003c/li\u003e\n\u003cli\u003ePascual M, Calvo-Rodriguez M, N\u0026uacute;\u0026ntilde;ez L, et al (2021) Toll-like receptors in neuroinflammation, neurodegeneration, and alcohol-induced brain damage. IUBMB Life 73:900\u0026ndash;915. https://doi.org/10.1002/iub.2510\u003c/li\u003e\n\u003cli\u003ePascual M, Montesinos J, Montagud-Romero S, et al (2017) TLR4 response mediates ethanol-induced neurodevelopment alterations in a model of fetal alcohol spectrum disorders. J Neuroinflammation 14:145. https://doi.org/10.1186/s12974-017-0918-2\u003c/li\u003e\n\u003cli\u003eSchmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101\u0026ndash;1108. https://doi.org/10.1038/nprot.2008.73\u003c/li\u003e\n\u003cli\u003eSquire LR, Genzel L, Wixted JT, Morris RG (2015) Memory consolidation. Cold Spring Harb Perspect Biol 7:a021766. https://doi.org/10.1101/cshperspect.a021766\u003c/li\u003e\n\u003cli\u003eTochon L, Vouimba R-M, Corio M, et al (2023) Chronic alcohol consumption shifts learning strategies and synaptic plasticity from hippocampus to striatum-dependent pathways. Front Psychiatry 14:1129030. https://doi.org/10.3389/fpsyt.2023.1129030\u003c/li\u003e\n\u003cli\u003eTolomeo AM, Zuccolotto G, Malvicini R, et al (2023) Biodistribution of Intratracheal, Intranasal, and Intravenous Injections of Human Mesenchymal Stromal Cell-Derived Extracellular Vesicles in a Mouse Model for Drug Delivery Studies. Pharmaceutics 15:548. https://doi.org/10.3390/pharmaceutics15020548\u003c/li\u003e\n\u003cli\u003eVolarevic A, Harrell CR, Arsenijevic A, et al (2025) Therapeutic Potential of Mesenchymal Stem Cell-Derived Extracellular Vesicles in the Treatment of Parkinson\u0026rsquo;s Disease. Cells 14:600. https://doi.org/10.3390/cells14080600\u003c/li\u003e\n\u003cli\u003eWang N, Ma F, Song H, et al (2025) Mesenchymal Stem Cell-Derived Extracellular Vesicles for Regenerative Applications and Radiotherapy. Cell Transplant 34:9636897241311019. https://doi.org/10.1177/09636897241311019\u003c/li\u003e\n\u003cli\u003eWHO (ed) (2024) World health statistics 2024. World Health Organization\u003c/li\u003e\n\u003cli\u003eXu W, Huang Y, Zhou R (2025) NLRP3 inflammasome in neuroinflammation and central nervous system diseases. Cell Mol Immunol 22:341\u0026ndash;355. https://doi.org/10.1038/s41423-025-01275-w\u003c/li\u003e\n\u003cli\u003eYao J, Sterling K, Wang Z, et al (2024) The role of inflammasomes in human diseases and their potential as therapeutic targets. Signal Transduct Target Ther 9:10. https://doi.org/10.1038/s41392-023-01687-y\u003c/li\u003e\n\u003cli\u003eYu M, Ma H, Lai X, et al (2025) Stem cell extracellular vesicles: a new dawn for anti-inflammatory treatment of neurodegenerative diseases. Front Aging Neurosci 17:1592578. https://doi.org/10.3389/fnagi.2025.1592578\u003c/li\u003e\n\u003cli\u003eZhang Y, Jiang L, Wu R, et al (2025a) An AIM2 inflammasome biomimetic mineralization inhibitor for vascular dementia therapy. Theranostics 15:6347\u0026ndash;6368. https://doi.org/10.7150/thno.110389\u003c/li\u003e\n\u003cli\u003eZhang Y, Zhang L, Li P, et al (2025b) Extracellular vesicles from adipose-derived stem cell alleviate diabetic cardiomyopathy by regulating Chit1/NLRP3/Caspase-1-Mediated pyroptosis. Int Immunopharmacol 146:113860. https://doi.org/10.1016/j.intimp.2024.113860\u003c/li\u003e\n\u003cli\u003eZheng D, Liwinski T, Elinav E (2020) Inflammasome activation and regulation: toward a better understanding of complex mechanisms. Cell Discov 6:36. https://doi.org/10.1038/s41421-020-0167-x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Ethanol chronic treatment, extracellular vesicles, mesenchymal stem cells, NLRP3, neuroinflammation, inflammasome","lastPublishedDoi":"10.21203/rs.3.rs-7957853/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7957853/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNOD-like receptors (NLRs) and inflammasome complexes play critical roles in the neuroinflammatory responses triggered by chronic ethanol exposure. While our previous work demonstrated that mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) attenuate binge ethanol-induced NLRP3 inflammasome activation in the adolescent hippocampus, their broader effects on other NLR pathways and brain regions remains unclear. Here, we investigated the therapeutic potential of intravenously administered adipose-derived MSC-EVs (20 \u0026micro;g/dose every 10 days) in a murine model of chronic alcoholism (10% ethanol in drinking water for 3 months), focusing on their ability to modulate multiple inflammasome sensors (NLRP3, NLRC4, NLRP1, AIM2) and downstream effectors (caspase-1, caspase-11/4, IL-1β, IL-18) across the prefrontal cortex, hippocampus and striatum. qPCR analysis revealed that chronic ethanol exposure significantly upregulated the expression of these inflammasome-related components in all three brain regions, whereas MSC-EV treatment effectively suppressed their activation. Notably, MSC-EVs normalized ethanol-induced overexpression of inflammasome sensors and downstream effectors, indicating a broad attenuation of inflammasome-driven neuroinflammatory responses. These findings expand current understanding of MSC-EVs as a multifaceted therapy for ethanol-related neuropathology, highlighting their capacity to simultaneously mitigate diverse NLR inflammasome pathways across key brain areas involved in addiction and cognitive dysfunction.\u003c/p\u003e","manuscriptTitle":"Immunomodulatory effects of stem cell-derived extracellular vesicles on NLRP3 inflammasome activation in the brain after chronic ethanol exposure","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-13 11:07:15","doi":"10.21203/rs.3.rs-7957853/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-16T09:53:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-11T15:56:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"144797921456181844239564598914721885334","date":"2025-11-08T23:07:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"99391476481317055765228863786688746382","date":"2025-11-05T09:20:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"261381843391838300829538740585506880709","date":"2025-11-03T16:34:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-03T16:25:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-28T12:37:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-28T12:37:10+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2025-10-26T16:54:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c3e46b36-ccaa-458f-b6e3-da28d8f6fd05","owner":[],"postedDate":"November 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-04-13T16:06:40+00:00","versionOfRecord":{"articleIdentity":"rs-7957853","link":"https://doi.org/10.1007/s11033-026-11774-2","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2026-04-07 15:59:24","publishedOnDateReadable":"April 7th, 2026"},"versionCreatedAt":"2025-11-13 11:07:15","video":"","vorDoi":"10.1007/s11033-026-11774-2","vorDoiUrl":"https://doi.org/10.1007/s11033-026-11774-2","workflowStages":[]},"version":"v1","identity":"rs-7957853","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7957853","identity":"rs-7957853","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.