Ginsenoside Rd protects against acute liver injury by regulating the autophagy-NLRP3 inflammasome pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Ginsenoside Rd protects against acute liver injury by regulating the autophagy-NLRP3 inflammasome pathway Xiaomei Zhong, Yibin Sun, Yanxiang Lin, Shan Deng, Huan Wang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5176123/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Context: Ginsenoside Rd (Rd) is a bioactive compound predominantly found in Panax ginseng C.A. Meyer and Panax notoginseng (Burkill) F.H. Chen ex C.H. Chow, both species belonging to genus Panax in the Araliaceae family. However, its hepatic protective effect against acute liver injury and related mechanistic action remain unexplored. Objective: To investigate the protective effect of Rd against thioacetamide (TAA)-induced acute liver injury and assess its underlying regulatory mechanisms related to autophagy and inflammation. Materials and methods: Forty-eight C57BL/6 mice were treated with saline (control or model group), Rd (12.5 mg/kg, 25 mg/kg or 50 mg/kg), and diammonium glycyrrhizinate (DG, 30 mg/kg) for three days. Then the mice were stimulated with TAA to establish acute liver injury model, excluding the control group. HSC-T6 cells were treated with Rd at concentrations of 2.5, 5, or 10 μM, for 12 hours with or without LPS stimulation at 100 ng/mL. RT-qPCR, immunofluorescence staining and Western blot were employed to analyze the expressions of genes and proteins associated with inflammation and autophagy. To validate the role of Rd in regulating autophagy and inflammation, the autophagy inducers, rapamycin and GSK621, were utilised in reverse validation experiments in cells. Results: Rd exhibited significant hepatic protective effects in mice with acute liver injury. It exhibited strong anti-inflammatory effect by reducing the gene and protein expressions of various pro-inflammatory modulators in liver tissue, and inhibited LPS-induced autophagy and inflammation in HSC-T6 cells.Rd suppressed autophagy in mice via the AMPK/mTOR/ULK1 pathway. The inhibitory effects of Rd on autophagy and inflammation in HSC-T6 cells were partially blocked by rapamycin and GSK621. Discussion and Conclusion: Rd is a promising therapeutic agent to protect liver against TAA-induced acute liver injury. Biological sciences/Biochemistry Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Cell biology Biological sciences/Molecular biology Health sciences/Biomarkers Health sciences/Gastroenterology Health sciences/Medical research Ginsenoside Rd Acute liver injury Autophagy Inflammation AMPK/mTOR/ULK1 pathway thioacetamide hepatic stellate cell line Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction The liver is an organ with a unique immune system, comprised of hepatocytes, sinusoidal cells, and perisinusoidal cells. Acute liver injury (ALI), which includes drug-induced, chemical-induced, and immune-mediated liver injury in clinical classifications, can lead to liver dysfunction[1]. Long-term liver injury can lead to hepatic fibrosis, cirrhosis, and even life-threatening conditions such as liver failure and liver cancer. Therefore, preventing and treating liver injury is determinant in halting its progression, thus emphasizing the fundamental significance of developing hepatoprotective therapeutic agents. Chemical-induced liver injury is a prevalent form of liver damage, and in studies aiming to induce liver injury models, substances such as TAA, carbon tetrachloride (CCl4), and D-galactosamine are often utilized [2]. TAA is a hepatotoxic compound that undergoes metabolism by CYP450 enzymes, leading to the formation of TAA-sulfur oxide within the body. This metabolic process disrupts hepatic metabolism, impacting proteins and lipids, and triggering oxidative stress [3]. Notably, the activation of autophagy in hepatic stellate cells plays a critical role in TAA-induced liver injury and fibrosis. Abnormal autophagy levels can significantly influence the progression of liver diseases. Autophagy, a self-defense mechanism in the body, degrades damaged cellular organelles and recycles biomolecules to prevent cellular damage and dysfunction[4]. This process is influenced by various factors such as stress, inflammation, and apoptosis, serving as a means of cellular self-protection under oxidative stress conditions [5]. However, excessive autophagy can induce pathological changes in tissues [6]. Indeed, while moderate autophagy eliminates damaged organelles and proteins, excessive autophagy can exacerbate liver diseases [7] and promote hepatic stellate cell activation, thereby worsening liver fibrosis [8]. This indicates that autophagy plays a dual role in liver diseases. Regulating autophagy has been demonstrated to alleviate liver injury, highlighting its potential as a significant therapeutic approach for various liver diseases [9, 10]. This discovery opens opportunities to explore the regulatory effects of drugs on autophagy to identify potential treatments for liver injury. Extensive studies have also validated the efficacy of Traditional Chinese Medicine (TCM) in hepatoprotective approaches [11, 12]. TCM's rich repository of medicinal resources includes ginsenoside Rd (Rd), the structural formula is C 48 H 82 O 18 (Figure 1A),an active component commonly found in Panax ginseng C.A. Meyer and Panax notoginseng (Burkill) F.H. Chen ex C.H. Chow, both species belonging to genus Panax in the Araliaceae family, which has shown significant protective effects on the nervous and cardiovascular systems [13, 14]. Rd impacts several regulatory pathways of significance to autophagy. Studies have suggested that Rd can down-regulate NF-κB, resulting in the inhibition of iNOS and COX-2 levels in RAW 264.7 macrophage cells [15]. It has been found to inhibit the TGF-β/Smad pathway, reduce cellular autophagy, and thus suppress hepatic stellate cells (HSCs) activation [16]. Suppression of ferroptosis, alleviating CCl4-induced liver injury in mice through the cGAS/STING pathway [17], has been observed. Additionally, regulating the ERRα-mediated P2X7r pathway can reduce both fibrogenesis and inflammation in hepatic fibrosis [18]. There is also evidence that Rd, when used in combination with Phosphoarginine, can suppress liver cancer by reducing HIF-1α through the PI3K/AKT/mTOR signaling pathway[19]. However, the potential protective effect of RD in modulation of autophagy on TAA-induced acute liver injury remains to be investigated. Here, for the first time, an investigation on the hepatoprotective effect of Rd against acute liver injury induced by TAA in mice is presented. We assess the underlying mechanisms that are implicated in autophagy and inflammation. The experimental findings provide valuable evidence for prevention and treatment of acute liver injury. Materials and methods Regents and chemicals TAA (no. C17J11H115325) and Rd (no. J11HS184464, purity ≥ 95.0%, HPLC) were obtained from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Diammonium glycyrrhizinate was purchased from Zhengda Tianqing Pharmaceutical Group Co., Ltd. (Nanjing, China). Rapamycin (MCE, HY-10219) and GSK621(MCE, HY-100548) were purchased from Med Chem Express Biotech Co. Ltd. (NJ, USA). Aspartate aminotransferase (AST), alanine aminotransferase (ALT), glutathione S-transferase (GSH-ST), and lactate dehydrogenase (LDH) assay kits were obtained from Nanjing Jiancheng Bioengineering Research Institute (Nanjing, China). H&E staining kit was acquired from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). The Rabbit mAb of SQSTM1/P62, LC3II/I Beclin1, phospho ULK1, ULK1, phospho mTOR, mTOR, and NLRP3 were obtained from Cell Signaling Technology (MA, USA). Rabbit mAb of COX-2, iNOS, and AMPK, as well as HRP Goat Anti-Mouse IgG (H+L) and HRP Goat Anti-Rabbit IgG (H+L), were purchased from Proteintech Group, Inc. (Wuhan, China). Rabbit mAb of phospho AMPK, IL-18, and IL-1β were purchased from Abcam Ltd. (Cambridge, UK). β-actin Mouse mAb was purchased from TransGen Biotech Co., Ltd. (Beijing, China). Unless otherwise indicated, all other reagents and chemicals were sourced from Beijing Chemical Factory (Beijing, China). Animals A total of 48 healthy specific pathogen-free (SPF) C57BL/6 mice, obtained from Shanghai Slac Laboratory Animal Co. Ltd. [Shanghai, China, Production License: SCXK (Zhejiang) 2019-2020], with body weight of 20 ± 2 g, were utilized in the animal experiments. The mice were accommodated at the Experimental Animal Center of Fujian University of Traditional Chinese Medicine [SYXK (Min) 2019-0007), with ad libitum access to food and water, under a 12 h light-dark cycle. All procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health, comply with the ARRIVE guidelines and the study was approved by the Animal Care and Use Committee of the Fujian University of Traditional Chinese Medicine, and all procedures strictly adhered to the regulations regarding animal welfare (Approval Number: FJTCM IACUC2021068). Animal experimental design Forty-eight C57BL/6 mice were randomly assigned into the following groups (n = 8): control group (CON), model group (MOD), Rd low dose (12.5 mg/kg, Rd-12.5), medium dose (25 mg/kg, Rd-25), high dose (50 mg/kg, Rd-50) groups, and diammonium glycyrrhizinate group (DG, 30 mg/kg). DG and Rd were suspended in 0.5% sodium carboxymethylcellulose (CMC-Na) solution. The mice were given gavage 10 mL/kg, once a day for three days continuously. Two hours after the last drug administration, TAA (5 mg/mL/kg) dissolved in physiological saline was injected into the abdominal cavity to induce modeling. After modeling, food was restricted, but water was allowed. The mice were weighed and sacrificed by using 1.5% sodium pentobarbital (0.15 ml/10g) for anesthesia. The livers were isolated and weighed. Liver index (%) = liver weight / body weight × 100%. Measurement of serum transaminase enzymes The blood was collected and centrifugated at 3500 rpm for 8 min to collect the upper layer of serum and stored in a -80°C freezer. The levels of AST, ALT, LDH, and GST in the serum were measured strictly, according to the instructions provided in the corresponding commercial kits [20]. Pathological staining of liver tissues The procedure for pathological staining was conducted in accordance with our previous study [21]. Briefly, liver tissues were collected, fixed, and then washed with PBS buffer. A 0.5 cm × 0.5 cm × 0.5 cm section of liver tissue was cut and used for pathological staining. The tissues underwent dehydration using increasing ethanol concentrations, followed by rinsing with xylene I (50% ethanol, 50% xylene) and xylene II (100% xylene). Subsequently, the tissues were embedded in paraffin. The paraffin-embedded section was sliced into 4 μm thickness and dried using heat. After cleaning the paraffin section with xylene I and xylene II, it was hydrated with decreasing ethanol concentrations. Following H&E staining, the liver tissue sections were dehydrated, and pathological changes were observed under an optical microscope. Representative areas were then captured by the microscope. Cells experimental design A rat hepatic stellate cell line (HSC-T6) was procured from Kunming Cell Bank of Chinese Academy of Sciences in Kunming, China. The HSC-T6 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) and maintained at a temperature of 37°C under a 5% CO 2 atmosphere. HSC-T6 cells were treated with G-Rd at concentrations of 2.5, 5, or 10 μM, either with or without LPS stimulation at 100 ng/mL. In addition, a group of cells treated with G-Rd at 10μM was co-incubated with the mTOR inhibitor RAPA at 2μM, or the AMPK activator GSK621 at 10 μM. The cells were then further incubated for a period of 12 h, after which protein extraction was carried out. Cell viability assays Briefly, the MTT proliferation assay was employed to assess the cell viability of HSC-T6 cells and primary mouse hepatocytes. Initially, a 96-well culture plate was prepared, with each well containing 5 × 10 4 cells in 1 mL of culture medium. After 24 h, Rd was added to each well (100 μL of drug volume per well). Another 24 h later, 22 μL of 5 mg/mL MTT solution was added to each well, resulting in a final concentration of MTT of 0.5 mg/mL. The plate was then placed in an incubator for 4 h, followed by careful removal of the supernatant. Subsequently, 200 μL of DMSO was added to each well. The plate was placed in a microplate reader, shaken for 5-10 min to facilitate the dissolution of the formazan crystals, and the optical density (OD value) was measured at a wavelength of 490 nm. Immunofluorescence staining assay Liver tissue sections with a thickness of 5 μm were reprocessed with xylene, followed by a gradient of ethanol. Then, the sections were incubated with a normal goat serum-blocking solution by adding it dropwise and incubating at room temperature for 20 min. The LC3Ⅱ primary antibody (dilution ratio of 1:70) was added dropwise and incubated at 4°C overnight. The following day, the sections were taken out, allowed to warm up, washed once with PBS, and air-dried. Fluorescent-labeled secondary antibody (IgG) was added dropwise, incubated at 37°C in the dark for 20 min, washed once with PBS, air-dried, and then mounted with neutral resin. Fluorescence inverted microscope (Leica, DMi8, Germany) was used for image capture and analysis. qPCR analysis of IL-6、TNF-α、iNOS、COX-2 mRNA expressions The total RNA was extracted from the powdered frozen liver tissues, and the quantity and purity were assessed using a Thermo Fisher Scientific nanodrop spectrophotometer. The RT Reverse Transcription kit was used to reverse transcribe 200 ng of total RNA into cDNA according to the kit's instructions. The protocol involved incubating the reaction mixture at 25.0°C for 5 min, 42.0°C for 60 min, 70.0°C for 5 min, followed by cooling to 4.0°C. The resulting cDNA samples were diluted with RNase-free ddH 2 O and mixed with the ChamQ SYBR qPCR Master Mix before undergoing stem-loop RT-PCR using the ABI7900 system from Applied Biosystems, a division of Thermo Fisher Scientific. Each 9 μL reaction mixture contained 4 μL of ChamQ SYBR qPCR Master Mix, 1 μL of each primer, 1 μL of ROX Reference Dye 1, 1 μL of cDNA, and 2 μL of RNase-free dH 2 O. The primer sequences for IL-6, TNF-α, iNOS, and COX-2 are available in Table 1. The reaction conditions for the targeted genes were set as follows: initial heat activation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60 °C for 30 s, extension at 95°C for 15 s and final extension at 95°C for 15 s. Data analysis was performed using the comparative CT method ( ΔΔCT Method) with β-actin mRNA levels serving as the normalization control. The fold change in gene expression between the different treatments was determined. Table 1. The primer sequences used in qPCR analysis. Primers Forward (5’→3’) Reverse (5’→3’) IL-6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG TNF-α GCCGATGGGTTGTACCTTGT TCTTGACGGCAGAGAGGAGG iNOS GAAGGGGACGAACTCAGTGG GTGGCTCCCATGTTGCATTG COX-2 GCCTGGTCTGATGATGTATGC CCTATGAGTATGAGTCTGCTGGTT β-actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAG Western blot analysis The total protein was extracted from each group’s liver tissues with 0.5 mL RIPA assay buffer containing 1% protease/phosphatase inhibitor cocktail. Total protein was mixed with 5× protein loading buffer at a concentration 0.5 mg/mL and denatured at 100°C for 10 min. Subsequently, the proteins were separated by SDS-PAGE electrophoresis (PowerPac HC, BioRAD) at 90 V for 90 min using protein gels. The proteins in the gel were then transferred onto a polyvinylidene difluoride membrane and incubated with 5% skim milk dissolved in TBST for 70-90 min at room temperature. The membranes were subsequently incubated overnight at 4°C with the following primary antibodies: anti-COX-2 (1:1000), anti-iNOS (1:1000), anti-NLRP3 (1:1000), anti-IL-18 (1:1000), anti- IL-1β (1:1000), anti-β-actin (1:7500), anti-SQSTM1/p62 (1:1000), anti-p-AMPK (1:750), anti-AMPK (1:750), anti-p-mTOR (1:1000), and anti-mTOR (1:1000), anti-LC3Ⅰ/Ⅱ (1:1000), anti-Beclin1 (1:1000), anti-p-ULK1 (1:1000), and anti-ULK1 (1:1000). After three washes with TBST buffer, they were co-incubated for 1 h with either anti-rabbit or anti-mouse secondary antibodies conjugated with horseradish peroxidase (1:8000). β-actin, purchased from TransGen Biotech, Beijing, China (1:2000), served as the internal control. The immunoreactive bands were visualized. Image Lab 6.0 was utilized for band intensity quantification. Statistical analysis All data was analyzed using SPSS 26.0 statistical software, and the values were expressed as mean ± standard error of the mean (SEM). Statistical analysis was conducted using one-way analysis of variance (ANOVA). In cases where the data did not follow a normal distribution, the non-parametric Mann-Whitney U test was utilized. When the data followed a normal distribution and exhibited equal variances, the LSD test was used. In instances of unequal variances, the Games-Howell test was employed for statistical analysis. Statistical significance was considered at values of p < 0.05. Results Rd exhibited protection against TAA-induced acute liver injury In this study, a commonly used animal model of acute liver injury was established through the injection of TAA [22]. This model is characterized by heightened levels of ALT, AST, LDH, and other markers in the serum [23], along with histological changes and pathological alterations in liver tissue. Insert Figure 1 To investigate whether Rd had hepatoprotective effects, the TAA-induced acute liver injury model in mice was pre-treated with Rd. No mortality was observed among the experimental mice in each group. Compared with the control group, the model group showed significant increase in serum levels of AST ( p < 0.001), ALT ( p < 0.01), GST ( p < 0.001), and LDH ( p < 0.05). All mice in the DG (30 mg/kg) and Rd groups showed a noteworthy reduction in the levels of AST, ALT, and GST ( p < 0.05 or p < 0.01) compared to the model group (Figure 1B). While there was a measurable degree of decline in liver tissue LDH levels, no statistical significance was found for the DG and Rd pre-treated groups (Figure 1C). Moreover, moderate effects are observed for the liver index, with an increase for the acute liver injury model group, and a decrease in the DG and Rd groups. However, as observed in Figure 1D, the high-dose group of Rd exhibited a significant reduction in liver index compared to the model group. Morphologic observation of the liver revealed a smooth surface with normal color in the control group, while the model group exhibited numerous dark red spots on the liver surface. Comparatively, the DG and Rd groups showed varying degrees of improvement, with the medium dose Rd (25 mg/kg) group exhibiting the most prominent effect (Figure 1E). To assess whether Rd leads to pathological changes in liver tissue, pathological staining was performed. Histopathological analysis of the control group using HE staining showed, as expected, well-organized liver cells with normal hepatic cord morphology and intact hepatic lobule structure. In contrast, the model group displayed nuclear pyknosis, abnormal hepatocyte arrangement, tissue infiltration of inflammatory cells, and areas of hemorrhage. Intervention with Rd and DG ameliorated these pathological changes (Figure 1F), resulting in restoration of normal hepatic lobule structure, alleviated infiltration of inflammatory cells and diminished bleeding. Rd inhibited inflammatory response in acute liver injury Insert Figure 2 During the development of acute liver injury, various pathological mechanisms are involved, with inflammation-induced hepatocellular damage being one of the key mechanisms. Herein, after injury, the RT-qPCR results revealed a significant increase ( p < 0.05 or p < 0.001) in the mRNA expression of pro-inflammatory cytokines (COX-2, TNF-α, IL-6, and iNOS) in the model group. After low dose of Rd (12.5 mg/kg) and DG treatments, there was no significant effect on the mRNA expression of COX-2 and IL-6. However, the medium and high doses (25, 50 mg/kg) of Rd demonstrated a significant downregulation effect on their expression ( p < 0.05 or p < 0.01) (Figure 2A). Concomitantly, after injury Western blot analysis revealed a significant upregulation ( p < 0.05, or p < 0.01, or p < 0.001) in the protein expression levels of inflammatory markers COX-2, iNOS NLRP3, ASC, IL-18 and IL-1β, in the liver tissue of the model group compared to the control group. However, after intervention with DG and Rd, there was a notable reduction ( p < 0.05 or p < 0.01) observed in these markers (Figure 2B). Rd regulated autophagy in acute liver injury via inhibiting the AMPK/mTOR/ULK1 axis Insert Figure 3 Studies have shown that regulating autophagy can alleviate inflammation and stress levels to improve acute liver injury[24, 25]. To investigate the impact of Rd on autophagy in this ALI model, the expression levels of autophagy-related proteins and upstream signaling pathways were examined. Immunofluorescence analysis revealed a significant elevation ( p < 0.001) in both the area and intensity of LC3II in the liver tissue of the model group. In the DG group, there was a partial decrease of fluorescence intensity and area (Figure 3A). Notably, Rd demonstrated a significant decrease in both the fluorescence area and intensity of LC3II ( p < 0.001). Western blot results showed that significant higher levels of autophagy-associated proteins LC3II/I in the model group compared to the control group ( p < 0.001), and a noticeable increase in the autophagy substrate p62. Compared with the model group, the levels of Beclin1 and LC3II/I were considerably decreased, and the expression level of p62 was further increased after Rd treatment ( p < 0.05, p < 0.01, or p < 0.001) (Figure 3B). Insert Figure 4 A significant increase in the phosphorylation levels of AMPK and ULK1( p < 0.05 or p < 0.001) was also observed in hepatic tissue. Concomitantly, treatment with DG and Rd led to a reduction in the phosphorylation levels of AMPK and ULK1, along with decreased phosphorylation levels of mTOR (Figure 4). Rd exerted an intervention effect on LPS-induced inflammation and autophagy in HSC-T6 cells Insert Figure 5 The activation of hepatic stellate cells (HSCs) is a critical pathological process during acute liver injury and serves as an important in vitro research target for liver injury. Therefore, in vitro experiments using HSC-T6 cells were conducted to examine the impact of Rd on the regulation of autophagy. First, we evaluated the concentration of Rd affecting cell viability. Results from an MTT assay showed that after 24 h of incubation, Rd does not significantly affect cell viability up to a concentration of 160 μM ( p < 0.01). A significant effect was observed at 320 μM ( p < 0.001). Therefore, the selected concentrations of Rd (2.5-10 μM) in our experiments did not exhibit significant toxicity to HSC-T6 cells (Figure 5A). After the activation of HSC-T6 by LPS, the expression levels of NLRP3 and COX-2 were significantly increased compared to the control group ( p < 0.01). However, following intervention with Rd, the expression levels of NLRP3 and COX-2 were significantly decreased compared to the model group ( p < 0.05 or p < 0.01) (Figure 5B). Numerous studies have demonstrated that the activation of HSC-T6 cells is accompanied by an increase in autophagy levels [26], which can be blocked by autophagy inhibitors. Insert Figure 6 The expression levels of autophagy-related genes showed significant changes, as evidenced by the data presented in Figure 6. Compared with the control group, the expressions of autophagy-related gene 5 (ATG5) and autophagy-related gene 7 (ATG7) were significantly increased ( p < 0.01). Concomitantly, the levels of Beclin1 and LC3II/I were also significantly increased ( p < 0.05 or p < 0.01), and the expression of p62 decreased ( p < 0.05). After intervention with Rd, the levels of ATG5, ATG7, LC3II/I and Beclin1 decreased significantly ( p < 0.05 or p < 0.01), while the expression of p62 increased ( p < 0.05). Insert Figure 7 To assess potential regulatory effects of Rd on the AMPK/mTOR/ULK1 pathway in HSC-T6 cells, Western blot experiments were performed. In comparison to the control group, LPS substantially increased the phosphorylation levels of p-AMPK and p-ULK1 proteins ( p < 0.01), while decreasing the phosphorylation level of p-mTOR ( p < 0.05). Following Rd intervention, as compared to the model group, there was a decrease in the phosphorylation levels of AMPK and ULK1 ( p < 0.01) and an increase in the phosphorylation level of mTOR ( p < 0.05) (Figure 7). Rd co-treated with Rapamycin and GSK621 intervened in autophagy and inflammation in HSC-T6 cells Insert Figure 8 The results from the previous section of in vitro experiments demonstrated that Rd regulated autophagy through the AMPK/mTOR/ULK1 signaling pathway and reduced the expression of the inflammasome NLRP3. To verify whether modulating autophagy can improve the expression of the inflammasome, mTOR inhibitor rapamycin and AMPK activator GSK621 were employed to induce high levels of autophagy in HSC-T6 cells. Following rapamycin intervention, the LPS+Rapamycin treatment showed a significant increase in the LC3 II/I ratio compared to the model group. This was accompanied by elevated expression of beclin1 and phosphorylation level of ULK1. Concomitantly, a notable decrease in p62 expression was observed. Conversely, the phosphorylation level of mTOR decreased. In comparison to the LPS+Rd group, the LPS+Rapamycin+Rd group demonstrated a significant increase in the LC3 II/I ratio ( p < 0.001). Additionally, increases in the expression of beclin1 and phosphorylation of ULK1 were observed. Concurrently, both p62 expression and the phosphorylation level of mTOR did significantly decrease ( p < 0.05) (Figure 8A). Furthermore, after rapamycin intervention, compared to the model group there was a significant upregulation in the expression of NLRP3, along with its downstream effectors IL-18 and IL-1β. However, the efficacy of Rd was partially attenuated under these conditions ( p < 0.05) (Figure 8B). Insert Figure 9 After the intervention with GSK621, there was a significant increase in the LC3 II/I ratio compared to the model group, along with elevated phosphorylation levels of AMPK and ULK1. Similarly, the LPS+GSK621+Rd group exhibited a comparable increase compared to the treatment group (Figure 9). Discussion TAA, known as a hepatotoxic compound, generates TAA-S-oxide and TAA-S-dioxide, leading to oxidative stress via lipid peroxidation in liver cell membranes through its intrahepatic bioactivation [27]. This oxidative stress disrupts protein synthesis, along with RNA and DNA integrity, and affects glutamyl transpeptidase activity [28, 29], which is why TAA is commonly utilized to induce hepatotoxicity in animal models. Our studies leveraging this model have uncovered that Rd pre-treatment not only mitigates inflammatory processes but also suppresses hepatic autophagy, thereby safeguarding liver tissues. Furthermore, our findings suggest a critical involvement of the AMPK/mTOR/ULK1 signaling pathway in the hepatoprotective influence exerted by Rd. Ginsenoside Rd (C 48 H 82 O 19 ), a prominent saponin derived from the root of Panax ginseng and Panax notoginseng , has diverse pharmacological effects recognized in TCM. Numerous studies have highlighted the significant protective effects of this compound in various systems, including the nervous system [14], cardiovascular systems [13], among others. However, the exploration of Rd's efficacy in mitigating hepatic injury remains relatively uncharted. Our research revealed significant hepatoprotective effects of Rd, which were manifested by the alleviation of morphological abnormalities and a reduction in inflammatory cell infiltration in liver tissue. Additionally, a significant diminution in plasma aspartate AST, ALT, and GST levels was observed, corroborating the hepatoprotective capacity of Rd. These findings underscore the potential of Rd as a therapeutic agent for acute liver injury treatment [24]. Nevertheless, comprehensive studies are warranted to confirm its safety profile and therapeutic efficacy in patients with hepatic injuries. In our study, following TAA-induced acute liver injury, analyses of both mRNA and protein expression confirm the pathogenic mechanism. It was shown that TAA-induced acute liver injury increased pro-inflammatory cytokine mRNAs IL-6, iNOS, TNF-α, and COX-2 mRNA [21], as well as increased inflammation-related protein expression levels of COX-2, iNOS, NLRP3, IL-18, and IL-1β. In the TAA-induced acute liver injury model, endotoxemia upregulates iNOS and elevates NO levels, leading to microthrombosis and hepatocellular necrosis [30]. IL-6 is a key pro-inflammatory cytokine [31], and NLRP3 forms an inflammasome complex that regulates inflammation [32, 33]. TNF-α activates NLRP3 transcription, linked to liver diseases [3, 34, 35], and downstream IL-18 and IL-1β changes [36]. Our research demonstrated that treatment with Rd reduced the expression of these pro-inflammatory cytokine mRNAs, indicating its role in lowering liver tissue inflammation. Furthermore, it also decreased the expression of inflammation-related proteins, suggesting an effect at the protein expression level rather than just gene transcription. These findings indicate that the anti-inflammatory activities of Rd in mitigating liver injury may be attributed to its ability to suppress NLRP3 inflammasome activation. This mechanism could potentially help prevent the exacerbation of liver injury. Adequate regulation of autophagy is acknowledged as a key therapeutic target in treating liver injury [26], and our study extends this understanding by evaluating the potential of Rd to improve liver injury through its autophagy-modulating effects. Studies have revealed the crucial roles of autophagy and inflammasomes in maintaining cellular homeostasis and managing inflammation [37]. Indeed, regulating autophagy can downregulate NLRP3 expression [7, 38] and affect IL-18 and IL-1β levels, mitigating inflammation [39]. Previous results indicated that autophagy levels were elevated in the TAA-induced model [8], warranting further investigation of the Rd mechanism of action. This can be accomplished since sustained TAA exposure can drive liver injury to fibrosis [40]. Liver tissue experiences abnormal autophagy under TAA-induced stress, similar to AMPK/mTOR/ULK1 changes in other stress-related diseases [41, 42]. These have specific roles: AMPK, is an energy sensor that regulates cellular energy metabolism, mTOR controls autophagy through mTORC1 and mTORC2 complexes [41, 42], and ULK1 initiates autophagosome formation by binding to autophagy-associated genes [43, 44]. Our results indicate that Rd regulates autophagy by inhibiting AMPK phosphorylation and restoring mTOR phosphorylation. Autophagosome regulation was evaluated through the autophagic substrate p62. During autophagosome formation, LC3I converts to LC3II, Beclin1 increases, and the autophagic substrate p62 decreases. Notably, in this study’s injured liver tissue, p62 expression slightly increased, likely due to stress responses and oxidative stress. The impact of Rd on autophagy leads to increased p62 accumulation, aligning with the observations from certain TAA-induced models [19, 45]. This indicates that, consistent with previous research findings [26, 46, 47], Rd alleviates inflammation and provides liver protection through autophagy regulation. The effect of Rd on autophagy and pro-inflammatory factors was also investigated from response of HSCs to liver damage. In response to liver damage, HSCs undergo activation and increased autophagy due to cytokine signals [48, 49]. This heightened autophagy leads to the degradation of lipid droplets within HSCs, resulting in autolysosome formation and increased pro-inflammatory cytokines IL-1β and TNF-α [50-52]. LPS-induced HSC-T6 activation was used to investigate the effect of Rd on autophagy and pro-inflammatory factors in this study. After HSC-T6 activation, protein expression of LC3II/I, Beclin1, ATG5, and ATG7 increased in the model group, while p62 decreased. COX-2 and NLRP3 levels also rose. Rd downregulated LC3II/I, Beclin1, ATG5, and ATG7, and upregulated p62, suggesting its autophagy regulation in vitro . Following LPS-induced activation, AMPK and ULK1 phosphorylation increased, and mTOR phosphorylation decreased in the model group. Rd reversed these changes significantly, suggesting Rd regulates HSC-T6 autophagy through the AMPK/mTOR/ULK1 pathway, which corroborates findings from recent studies[7, 53]. Diving into the cellular drama of liver pathology, we turned the spotlight on the NLRP3 inflammasome's role within HSCs. NLRP3 inflammasome activation in HSCs is significant in liver diseases [54]. Indeed, studies have shown that regulating autophagy can inhibit NLRP3 activation and subsequently improve inflammation [55]. This study found that inducing or enhancing autophagy with LPS or rapamycin (mTOR inhibitor) led to increased NLRP3 and downstream IL-18 and IL-1β, mirroring autophagy changes. Thus, Rd regulated autophagy, inhibiting NLRP3 inflammasome activation. Indeed, overactive autophagy can exacerbate inflammation, as seen in atherosclerosis, chronic obstructive pulmonary disease, and tracheal epithelium damage [56-58]. This effect was blocked by rapamycin, revealing Rd's anti-inflammatory mechanism by curbing excessive autophagy. Our results opened avenues for investigating how Rd exerts anti-inflammatory actions via autophagy modulation. Future studies will focus on delineating the molecular crosstalk between autophagy-related pathways and NLRP3 inflammasome activation, aiming to identify potential biomarkers for disease progression and therapeutic response. Moreover, assessing the dose-response of Rd and similar autophagy regulators might reveal optimal therapeutic windows for liver diseases, leading to more efficacious and safer treatments. Conclusion This study demonstrates that Rd exhibits a significant hepatoprotective effect against acute liver injury. This effect was manifested through a reduction in liver index, improved histopathology, and a decrease in serum markers of liver damage. We show that the hepatoprotective effect could be attributed to the downregulation of pro-inflammatory factors, suggesting the ability of Rd to alleviate acute liver injury by suppressing inflammation. Furthermore, this effect is closely associated with the regulation of autophagy. Specifically, Rd regulates autophagy through the AMPK/mTOR/ULK1 signaling pathway, both in TAA-induced acute liver injury in vivo and LPS-induced HSC-T6 cells in vitro . By inhibiting autophagy and attenuating the inflammatory response, Rd effectively mitigates acute liver injury induced by TAA and suppresses inflammation in LPS-induced HSC-T6 cells. These findings highlight the therapeutic potential of Rd in treating acute liver injury by targeting autophagy-mediated inflammation via the AMPK/mTOR/ULK1 signaling pathway. Declarations Data availability The data presented in this study are available on request from the corresponding author. Funding For multiple agency grants This work was supported by the [National Key Research and Development Program of China #1] under Grant [number 2022YFC3501205]; [National Natural Science Foundation of China #2] under Grant [number 82274080 and 32100168]; [The Collaborative Innovation Platform Project of Fuxiaquan National Innovation Demonstration Zone #3] under Grant [number 2021FX02]; [The Natural Science Foundation of Fujian University of Traditional Chinese Medicine #4] under Grant [number X2023025]; [The Basic Discipline Research Enhancement Program of Fujian University of Traditional Chinese Medicine #5] under Grant [number XJC2023008]. Author contribution ZYF, HMQ and SJY designed the research study. XMZ and SYB performed the experimental work and analyzed data. LYX and WH prepared the manuscript. RYL and XZ reviewed and revised the paper. JJL and ZYF supervised the experiments. LYX and HMQ secured the funding support. All the authors approved the final manuscript. Declaration of interest The authors report no declarations of interest. The authors alone are responsible for the content and writing of the paper. References Larrey, D. Epidemiology and individual susceptibility to adverse drug reactions affecting the liver. Semin Liver Dis 2002 , 222, 145-155, https://doi.org/10.1055/s-2002-30105. Liao, Y.J.; Wang, Y.H.; Wu, C.Y.; Hsu, F.Y.; Chien, C.Y.; Lee, Y.C. Ketogenic Diet Enhances the Cholesterol Accumulation in Liver and Augments the Severity of CCl(4) and TAA-Induced Liver Fibrosis in Mice. Int J Mol Sci 2021 , 226, https://doi.org/10.3390/ijms22062934. Xing, Y.; Yao, X.; Li, H.; Xue, G.; Guo, Q.; Yang, G.; An, L.; Zhang, Y.; Meng, G. Cutting Edge: TRAF6 Mediates TLR/IL-1R Signaling-Induced Nontranscriptional Priming of the NLRP3 Inflammasome. J Immunol 2017 , 1995, 1561-1566, https://doi.org/10.4049/jimmunol.1700175. Yang, Z.; Klionsky, D.J. Eaten alive: a history of macroautophagy. Nat Cell Biol 2010 , 129, 814-822, https://doi.org/10.1038/ncb0910-814. Mizushima, N.; Komatsu, M. Autophagy: renovation of cells and tissues. Cell 2011 , 1474, 728-741, https://doi.org/10.1016/j.cell.2011.10.026. Bhatnagar, S.; Mittal, A.; Gupta, S.K.; Kumar, A. TWEAK causes myotube atrophy through coordinated activation of ubiquitin-proteasome system, autophagy, and caspases. J Cell Physiol 2012 , 2273, 1042-1051, https://doi.org/10.1002/jcp.22821. Li, Y.; Li, S.; Wu, H. Ubiquitination-Proteasome System (UPS) and Autophagy Two Main Protein Degradation Machineries in Response to Cell Stress. Cells 2022 , 115, https://doi.org/10.3390/cells11050851. Hernandez-Gea, V.; Ghiassi-Nejad, Z.; Rozenfeld, R.; Gordon, R.; Fiel, M.I.; Yue, Z.; Czaja, M.J.; Friedman, S.L. Autophagy releases lipid that promotes fibrogenesis by activated hepatic stellate cells in mice and in human tissues. Gastroenterology 2012 , 1424, 938-946, https://doi.org/10.1053/j.gastro.2011.12.044. Qian, H.; Chao, X.; Williams, J.; Fulte, S.; Li, T.; Yang, L.; Ding, W.X. Autophagy in liver diseases: A review. Mol Aspects Med 2021 , 82, 100973, https://doi.org/10.1016/j.mam.2021.100973. Cai, X.; Hua, S.; Deng, J.; Du, Z.; Zhang, D.; Liu, Z.; Khan, N.U.; Zhou, M.; Chen, Z. Astaxanthin Activated the Nrf2/HO-1 Pathway to Enhance Autophagy and Inhibit Ferroptosis, Ameliorating Acetaminophen-Induced Liver Injury. ACS Appl Mater Interfaces 2022 , 1438, 42887-42903, https://doi.org/10.1021/acsami.2c10506. Gu, M.; Chen, Y.J.; Feng, Y.R.; Tang, Z.P. LanGui tea, an herbal medicine formula, protects against binge alcohol-induced acute liver injury by activating AMPK-NLRP3 signaling. Chin Med 2024 , 191, 41, https://doi.org/10.1186/s13020-024-00906-0. Zhang, T.; Kang, H.; Peng, Q.; Jiang, Y.; Xie, Y.; Zhang, D.; Song, X.; Li, Y.; Deng, C. Therapeutic mechanism of Cornus Officinalis Fruit Coreon on ALI by AKT/Nrf2 pathway and gut microbiota. Phytomedicine 2024 , 130, 155736, https://doi.org/10.1016/j.phymed.2024.155736. Zhu, D.; Liu, M.; Yang, Y.; Ma, L.; Jiang, Y.; Zhou, L.; Huang, Q.; Pi, R.; Chen, X. Ginsenoside Rd ameliorates experimental autoimmune encephalomyelitis in C57BL/6 mice. J Neurosci Res 2014 , 929, 1217-1226, https://doi.org/10.1002/jnr.23397. Cong, L.; Chen, W. Neuroprotective Effect of Ginsenoside Rd in Spinal Cord Injury Rats. Basic Clin Pharmacol Toxicol 2016 , 1192, 193-201, https://doi.org/10.1111/bcpt.12562. Kim, D.H.; Chung, J.H.; Yoon, J.S.; Ha, Y.M.; Bae, S.; Lee, E.K.; Jung, K.J.; Kim, M.S.; Kim, Y.J.; Kim, M.K.; et al. Ginsenoside Rd inhibits the expressions of iNOS and COX-2 by suppressing NF-kappaB in LPS-stimulated RAW264.7 cells and mouse liver. J Ginseng Res 2013 , 371, 54-63, https://doi.org/10.5142/jgr.2013.37.54. Xu, S.; Mao, Y.; Wu, J.; Feng, J.; Li, J.; Wu, L.; Yu, Q.; Zhou, Y.; Zhang, J.; Chen, J.; et al. TGF-beta/Smad and JAK/STAT pathways are involved in the anti-fibrotic effects of propylene glycol alginate sodium sulphate on hepatic fibrosis. J Cell Mol Med 2020 , 249, 5224-5237, https://doi.org/10.1111/jcmm.15175. Li, Y.; Yu, P.; Fu, W.; Wang, S.; Zhao, W.; Ma, Y.; Wu, Y.; Cui, H.; Yu, X.; Fu, L.; et al. Ginsenoside Rd Inhibited Ferroptosis to Alleviate CCl(4)-Induced Acute Liver Injury in Mice via cGAS/STING Pathway. Am J Chin Med 2023 , 511, 91-105, https://doi.org/10.1142/S0192415X23500064. Cui, L.; Tan, Y.J.; Xu, S.Q.; Qin, B.F.; Xiu, M.X.; Zhang, X.; Shi, L.Q.; Sun, H.M.; Song, J. Ginsenoside Rd, a natural production for attenuating fibrogenesis and inflammation in hepatic fibrosis by regulating the ERRalpha-mediated P2X7r pathway. Food Funct 2023 , 1412, 5606-5619, https://doi.org/10.1039/d3fo01315d. Yang, X.; Gao, M.; Miao, M.; Jiang, C.; Zhang, D.; Yin, Z.; Ni, Y.; Chen, J.; Zhang, J. Combining combretastatin A4 phosphate with ginsenoside Rd synergistically inhibited hepatocellular carcinoma by reducing HIF-1alpha via PI3K/AKT/mTOR signalling pathway. J Pharm Pharmacol 2021 , 732, 263-271, https://doi.org/10.1093/jpp/rgaa006. Lin, X.; Zhang, S.; Huang, R.; Tan, S.; Liang, S.; Wu, X.; Zhuo, L.; Huang, Q. Protective effect of tormentic acid from Potentilla chinensis against lipopolysaccharide/D-galactosamine induced fulminant hepatic failure in mice. Int Immunopharmacol 2014 , 192, 365-372, https://doi.org/10.1016/j.intimp.2014.02.009. Wang, C.; Sun, Y.; Liu, W.; Liu, Y.; Afzal, S.; Grover, J.; Chang, D.; Munch, G.; Li, C.G.; Lin, S.; et al. Protective effect of the curcumin-baicalein combination against macrovascular changes in diabetic angiopathy. Front Endocrinol (Lausanne) 2022 , 13, 953305, https://doi.org/10.3389/fendo.2022.953305. El-Kashef, D.H.; Serrya, M.S. Sitagliptin ameliorates thioacetamide-induced acute liver injury via modulating TLR4/NF-KB signaling pathway in mice. Life Sci 2019 , 228, 266-273, https://doi.org/10.1016/j.lfs.2019.05.019. Jiang, H.; Zhang, X.; Yang, W.; Li, M.; Wang, G.; Luo, Q. Ferrostatin-1 Ameliorates Liver Dysfunction via Reducing Iron in Thioacetamide-induced Acute Liver Injury in Mice. Front Pharmacol 2022 , 13, 869794, https://doi.org/10.3389/fphar.2022.869794. Zhang, M.; Xue, Y.; Zheng, B.; Li, L.; Chu, X.; Zhao, Y.; Wu, Y.; Zhang, J.; Han, X.; Wu, Z.; et al. Liquiritigenin protects against arsenic trioxide-induced liver injury by inhibiting oxidative stress and enhancing mTOR-mediated autophagy. Biomed Pharmacother 2021 , 143, 112167, https://doi.org/10.1016/j.biopha.2021.112167. Yang, X.; Jin, Z.; Lin, D.; Shen, T.; Zhang, J.; Li, D.; Wang, X.; Zhang, C.; Lin, Z.; Li, X.; et al. FGF21 alleviates acute liver injury by inducing the SIRT1-autophagy signalling pathway. J Cell Mol Med 2022 , 263, 868-879, https://doi.org/10.1111/jcmm.17144. Wang, Y.; Sun, Y.; Zuo, L.; Wang, Y.; Huang, Y. ASIC1a promotes high glucose and PDGF-induced hepatic stellate cell activation by inducing autophagy through CaMKKbeta/ERK signaling pathway. Toxicol Lett 2019 , 300, 1-9, https://doi.org/10.1016/j.toxlet.2018.10.003. Ezhilarasan, D. Molecular mechanisms in thioacetamide-induced acute and chronic liver injury models. Environ Toxicol Pharmacol 2023 , 99, 104093, https://doi.org/10.1016/j.etap.2023.104093. Low, T.Y.; Leow, C.K.; Salto-Tellez, M.; Chung, M.C. A proteomic analysis of thioacetamide-induced hepatotoxicity and cirrhosis in rat livers. Proteomics 2004 , 412, 3960-3974, https://doi.org/10.1002/pmic.200400852. Sepehrinezhad, A.; Shahbazi, A.; Sahab Negah, S.; Joghataei, M.T.; Larsen, F.S. Drug-induced-acute liver failure: A critical appraisal of the thioacetamide model for the study of hepatic encephalopathy. Toxicol Rep 2021 , 8, 962-970, https://doi.org/10.1016/j.toxrep.2021.04.011. Fernandes, J.C.; Schemitt, E.G.; Da Silva, J.; Marroni, N.P.; Lima, A.; Ferreira, R.B. Combination of Trans-Resveratrol and epsilon-Viniferin Induces a Hepatoprotective Effect in Rats with Severe Acute Liver Failure via Reduction of Oxidative Stress and MMP-9 Expression. Nutrients 2021 , 1311, https://doi.org/10.3390/nu13113677. Naseem, S.; Hussain, T.; Manzoor, S. Interleukin-6: A promising cytokine to support liver regeneration and adaptive immunity in liver pathologies. Cytokine Growth Factor Rev 2018 , 39, 36-45, https://doi.org/10.1016/j.cytogfr.2018.01.002. Liu-Bryan, R. Intracellular innate immunity in gouty arthritis: role of NALP3 inflammasome. Immunol Cell Biol 2010 , 881, 20-23, https://doi.org/10.1038/icb.2009.93. Wei, H.; Hu, C.; Xie, J.; Yang, C.; Zhao, Y.; Guo, Y.; Mei, Z.; Chen, L.; Lan, Z. Doliroside A attenuates monosodium urate crystals-induced inflammation by targeting NLRP3 inflammasome. Eur J Pharmacol 2014 , 740, 321-328, https://doi.org/10.1016/j.ejphar.2014.07.023. Frissen, M.; Liao, L.; Schneider, K.M.; Djudjaj, S.; Haybaeck, J.; Wree, A.; Rolle-Kampczyk, U.; von Bergen, M.; Latz, E.; Boor, P.; et al. Bidirectional Role of NLRP3 During Acute and Chronic Cholestatic Liver Injury. Hepatology 2021 , 735, 1836-1854, https://doi.org/10.1002/hep.31494. Gaul, S.; Leszczynska, A.; Alegre, F.; Kaufmann, B.; Johnson, C.D.; Adams, L.A.; Wree, A.; Damm, G.; Seehofer, D.; Calvente, C.J.; et al. Hepatocyte pyroptosis and release of inflammasome particles induce stellate cell activation and liver fibrosis. J Hepatol 2021 , 741, 156-167, https://doi.org/10.1016/j.jhep.2020.07.041. Latz, E.; Xiao, T.S.; Stutz, A. Activation and regulation of the inflammasomes. Nat Rev Immunol 2013 , 136, 397-411, https://doi.org/10.1038/nri3452. Seveau, S.; Turner, J.; Gavrilin, M.A.; Torrelles, J.B.; Hall-Stoodley, L.; Yount, J.S.; Amer, A.O. Checks and Balances between Autophagy and Inflammasomes during Infection. J Mol Biol 2018 , 4302, 174-192, https://doi.org/10.1016/j.jmb.2017.11.006. Huang, Z.; Zhou, X.; Zhang, X.; Huang, L.; Sun, Y.; Cheng, Z.; Xu, W.; Li, C.G.; Zheng, Y.; Huang, M. Pien-Tze-Huang, a Chinese patent formula, attenuates NLRP3 inflammasome-related neuroinflammation by enhancing autophagy via the AMPK/mTOR/ULK1 signaling pathway. Biomed Pharmacother 2021 , 141, 111814, https://doi.org/10.1016/j.biopha.2021.111814. Saitoh, T.; Fujita, N.; Jang, M.H.; Uematsu, S.; Yang, B.G.; Satoh, T.; Omori, H.; Noda, T.; Yamamoto, N.; Komatsu, M.; et al. Loss of the autophagy protein Atg16L1 enhances endotoxin-induced IL-1beta production. Nature 2008 , 4567219, 264-268, https://doi.org/10.1038/nature07383. Ke, P.Y. Diverse Functions of Autophagy in Liver Physiology and Liver Diseases. Int J Mol Sci 2019 , 202, https://doi.org/10.3390/ijms20020300. Cai, Z.Y.; Yang, B.; Shi, Y.X.; Zhang, W.L.; Liu, F.; Zhao, W.; Yang, M.W. High glucose downregulates the effects of autophagy on osteoclastogenesis via the AMPK/mTOR/ULK1 pathway. Biochem Biophys Res Commun 2018 , 5032, 428-435, https://doi.org/10.1016/j.bbrc.2018.04.052. Wang, F.; Cao, M.; Fan, M.; Wu, H.; Huang, W.; Zhang, Y.; Hu, Z.; Jin, X. AMPK-mTOR-ULK1 axis activation-dependent autophagy promotes hydroxycamptothecin-induced apoptosis in human bladder cancer cells. J Cell Physiol 2020 , 2355, 4302-4315, https://doi.org/10.1002/jcp.29307. Hardie, D.G. AMPK and autophagy get connected. EMBO J 2011 , 304, 634-635, https://doi.org/10.1038/emboj.2011.12. Moscat, J.; Diaz-Meco, M.T. Feedback on fat: p62-mTORC1-autophagy connections. Cell 2011 , 1474, 724-727, https://doi.org/10.1016/j.cell.2011.10.021. Zhang, X.W.; Zhou, J.C.; Peng, D.; Hua, F.; Li, K.; Yu, J.J.; Lv, X.X.; Cui, B.; Liu, S.S.; Yu, J.M.; et al. Disrupting the TRIB3-SQSTM1 interaction reduces liver fibrosis by restoring autophagy and suppressing exosome-mediated HSC activation. Autophagy 2020 , 165, 782-796, https://doi.org/10.1080/15548627.2019.1635383. Lalazar, G.; Ilyas, G.; Malik, S.A.; Liu, K.; Zhao, E.; Amir, M.; Lin, Y.; Tanaka, K.E.; Czaja, M.J. Autophagy confers resistance to lipopolysaccharide-induced mouse hepatocyte injury. Am J Physiol Gastrointest Liver Physiol 2016 , 3113, G377-386, https://doi.org/10.1152/ajpgi.00124.2016. Wang, Z.; Li, Y.; Yang, X.; Zhang, L.; Shen, H.; Xu, W.; Yuan, C. Protective effects of rapamycin induced autophagy on CLP septic mice. Comp Immunol Microbiol Infect Dis 2019 , 64, 47-52, https://doi.org/10.1016/j.cimid.2019.01.009. Xiu, A.Y.; Ding, Q.; Li, Z.; Zhang, C.Q. Doxazosin Attenuates Liver Fibrosis by Inhibiting Autophagy in Hepatic Stellate Cells via Activation of the PI3K/Akt/mTOR Signaling Pathway. Drug Des Devel Ther 2021 , 15, 3643-3659, https://doi.org/10.2147/DDDT.S317701. Liu, Y.; Bi, Y.M.; Pan, T.; Zeng, T.; Mo, C.; Sun, B.; Gao, L.; Lyu, Z.P. Ethyl Acetate Fraction of Dicliptera chinensis (L.) Juss. Ameliorates Liver Fibrosis by Inducing Autophagy via PI3K/AKT/mTOR/p70S6K Signaling Pathway. Chin J Integr Med 2022 , 281, 60-68, https://doi.org/10.1007/s11655-021-3298-5. Zhang, Z.; Zhao, S.; Yao, Z.; Wang, L.; Shao, J.; Chen, A.; Zhang, F.; Zheng, S. Autophagy regulates turnover of lipid droplets via ROS-dependent Rab25 activation in hepatic stellate cell. Redox Biol 2017 , 11, 322-334, https://doi.org/10.1016/j.redox.2016.12.021. Du, Q.H.; Zhang, C.J.; Li, W.H.; Mu, Y.; Xu, Y.; Lowe, S.; Han, L.; Yu, X.; Wang, S.Y.; Li, Y.; et al. Gan Shen Fu Fang ameliorates liver fibrosis in vitro and in vivo by inhibiting the inflammatory response and extracellular signal-regulated kinase phosphorylation. World J Gastroenterol 2020 , 2621, 2810-2820, https://doi.org/10.3748/wjg.v26.i21.2810. Chen, D.; Chen, J.; Chen, Y.; Chen, F.; Wang, X.; Huang, Y. Interleukin-10 regulates starvation-induced autophagy through the STAT3-mTOR-p70s6k axis in hepatic stellate cells. Exp Biol Med (Maywood) 2022 , 24710, 832-841, https://doi.org/10.1177/15353702221080435. Bai, D.; Du, J.; Bu, X.; Cao, W.; Sun, T.; Zhao, J.; Zhao, Y.; Lu, N. ALDOA maintains NLRP3 inflammasome activation by controlling AMPK activation. Autophagy 2022 , 187, 1673-1693, https://doi.org/10.1080/15548627.2021.1997051. Watanabe, A.; Sohail, M.A.; Gomes, D.A.; Hashmi, A.; Nagata, J.; Sutterwala, F.S.; Mahmood, S.; Jhandier, M.N.; Shi, Y.; Flavell, R.A.; et al. Inflammasome-mediated regulation of hepatic stellate cells. Am J Physiol Gastrointest Liver Physiol 2009 , 2966, G1248-1257, https://doi.org/10.1152/ajpgi.90223.2008. Qin, X.; Zhang, J.; Wang, B.; Xu, G.; Yang, X.; Zou, Z.; Yu, C. Ferritinophagy is involved in the zinc oxide nanoparticles-induced ferroptosis of vascular endothelial cells. Autophagy 2021 , 1712, 4266-4285, https://doi.org/10.1080/15548627.2021.1911016. Martinet, W.; De Meyer, G.R. Autophagy in atherosclerosis: a cell survival and death phenomenon with therapeutic potential. Circ Res 2009 , 1043, 304-317, https://doi.org/10.1161/CIRCRESAHA.108.188318. Mizumura, K.; Choi, A.M.; Ryter, S.W. Emerging role of selective autophagy in human diseases. Front Pharmacol 2014 , 5, 244, https://doi.org/10.3389/fphar.2014.00244. Wu, Y.F.; Li, Z.Y.; Dong, L.L.; Li, W.J.; Wu, Y.P.; Wang, J.; Chen, H.P.; Liu, H.W.; Li, M.; Jin, C.L.; et al. Inactivation of MTOR promotes autophagy-mediated epithelial injury in particulate matter-induced airway inflammation. Autophagy 2020 , 163, 435-450, https://doi.org/10.1080/15548627.2019.1628536. Additional Declarations No competing interests reported. Supplementary Files OriginalimagesofWB.pdf Cite Share Download PDF Status: Published Journal Publication published 28 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 13 Nov, 2024 Reviews received at journal 11 Nov, 2024 Reviews received at journal 07 Nov, 2024 Reviewers agreed at journal 31 Oct, 2024 Reviewers agreed at journal 28 Oct, 2024 Reviewers invited by journal 28 Oct, 2024 Editor assigned by journal 28 Oct, 2024 Editor invited by journal 23 Oct, 2024 Submission checks completed at journal 22 Oct, 2024 First submitted to journal 29 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5176123","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":377501607,"identity":"7c4b77bc-3d2c-4ae9-928e-b2051691e17d","order_by":0,"name":"Xiaomei Zhong","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiaomei","middleName":"","lastName":"Zhong","suffix":""},{"id":377501608,"identity":"22094b88-7a30-4d3c-9895-a257d72b393f","order_by":1,"name":"Yibin Sun","email":"","orcid":"","institution":"Kaifeng Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yibin","middleName":"","lastName":"Sun","suffix":""},{"id":377501609,"identity":"8e21074e-ba9e-45ef-8929-7e76a167eb64","order_by":2,"name":"Yanxiang Lin","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanxiang","middleName":"","lastName":"Lin","suffix":""},{"id":377501610,"identity":"62259dc6-293e-4f1e-bbc1-fc1c22683d3c","order_by":3,"name":"Shan Deng","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shan","middleName":"","lastName":"Deng","suffix":""},{"id":377501611,"identity":"e2c86fc1-4c86-45f8-b4a3-25a5305c468e","order_by":4,"name":"Huan Wang","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Huan","middleName":"","lastName":"Wang","suffix":""},{"id":377501612,"identity":"403c627b-416a-4429-b83e-40c1ba65530f","order_by":5,"name":"Xian Zhou","email":"","orcid":"","institution":"NICM Health Research Institute, Western Sydney University","correspondingAuthor":false,"prefix":"","firstName":"Xian","middleName":"","lastName":"Zhou","suffix":""},{"id":377501613,"identity":"965baad8-3271-466c-aa67-2bba56f874a9","order_by":6,"name":"Jinjian Lu","email":"","orcid":"","institution":"State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jinjian","middleName":"","lastName":"Lu","suffix":""},{"id":377501614,"identity":"14022583-cb39-44e0-aa50-df900c62a80d","order_by":7,"name":"Yanfang Zheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYDAC5gNsIEqOveEAmM/YQFALWwJYizHPgcMkaknsOcBMpBaDY+zPHnzcUZvew3j+4KcbDDayGw4wP3uAXwtDuuHMM8dzexgOM0vnMKQZbzjAZm6AV8v9hmPSvG3HcvczHGZjzmE4nLjhAA+bBH5bGNuk/7YdS+eBaPlPjBZmNmnGtpoEqJYDhLVIHmNjk+xtO2AI9IuxdI5BsvHMw2xmeLXwAUNM4mdbnTyPxMGHn3Mq7GT7jjc/w6tF4QCYAkajBIgFCipmfOqBQL4BTNUxMPA3EFA6CkbBKBgFIxYAAMrVS8z6cz2NAAAAAElFTkSuQmCC","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yanfang","middleName":"","lastName":"Zheng","suffix":""},{"id":377501615,"identity":"81ceb146-c7f2-41b4-aa02-acad81f56203","order_by":8,"name":"Ruoyin Luo","email":"","orcid":"","institution":"Pharmaceutical Sciences,Ulster University","correspondingAuthor":false,"prefix":"","firstName":"Ruoyin","middleName":"","lastName":"Luo","suffix":""},{"id":377501616,"identity":"dcfb4030-049f-4c86-85e9-b1367e3dbcbb","order_by":9,"name":"Mingqing Huang","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Mingqing","middleName":"","lastName":"Huang","suffix":""},{"id":377501617,"identity":"8a0dbf45-ae09-410a-8bb6-53144a14dce8","order_by":10,"name":"Jianyuan Song","email":"","orcid":"","institution":"Fujian Medical University Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jianyuan","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2024-09-29 17:23:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5176123/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5176123/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-87991-9","type":"published","date":"2025-01-28T15:58:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":72158627,"identity":"3474a4f3-3cba-40cc-8fd2-779cc75bb986","added_by":"auto","created_at":"2024-12-23 09:15:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":36576504,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd ameliorated TAA-induced acute liver injury in mice. \u003c/strong\u003eA) Chemical structure of Rd. B, C) Effect of Rd on AST, ALT, LDH and GST levels in serum of liver-injured mice (n = 6). D) Effect of Rd on liver index in mice with acute liver injury (n = 6). E) Effect of Rd on the appearance of liver tissue in mice (n =6). F) Effect of Rd on pathological changes and number of inflammatory cells in mouse liver histological sections (200×, n = 3). Red arrows indicated inflammatory cell infiltration. The blue arrow indicates nuclear condensation. Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001 vs. control group, # \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ##\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ###\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/5b79d476e8cd0ddd41b71cda.png"},{"id":72158618,"identity":"ef68493b-29f3-4409-9845-8e1dc86c6b81","added_by":"auto","created_at":"2024-12-23 09:15:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2978680,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd alleviated hepatic tissue inflammation in mice with acute liver injury. \u003c/strong\u003eA) Effect of Rd on liver tissue COX-2 TNF-α, IL-6, iNOS, mRNA expression effect (n = 3). B) Effect of Rd on liver tissue COX-2, iNOS, NLRP3, ASC, IL-18, IL-1β in liver-injured mice (n = 3). Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs. control group, #\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, ##\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/ddcb2bbeca6e4f9d077c8e05.png"},{"id":72159124,"identity":"d9cec825-320e-4767-8f86-c3f3cebe1069","added_by":"auto","created_at":"2024-12-23 09:23:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":11988128,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd regulates hepatic tissue autophagy levels in mice with acute liver injury. \u003c/strong\u003eA) Effect of Rd on LC3II protein expression in liver tissues of liver-injured mice (400×, n = 3). B) Effects of Rd on liver tissues of mice with acute liver injury LC3, Beclin1, p62 protein expression levels in mice with acute liver injury (n = 3). Values are shown as the mean ± SEM, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001 vs. control group, #\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ##\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ###\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ####\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/83d33939eef1a35c83c91268.png"},{"id":72158619,"identity":"06d77614-332d-4696-8bc6-9b9f036ced72","added_by":"auto","created_at":"2024-12-23 09:15:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":668757,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd regulates hepatic tissue AMPK pathway in mice with acute liver injury. \u003c/strong\u003eEffects of Rd on the liver tissues of mice with acute liver injury on AMPK, mTOR, ULK1 phosphorylation levels in mice with acute liver injury (n = 3). Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, vs. control group, #\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ##\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ###\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/481a2433bdf6f3e10a7e60bb.png"},{"id":72159121,"identity":"9457f80e-f1c3-449c-9a18-61109c531570","added_by":"auto","created_at":"2024-12-23 09:23:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1223898,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd regulates LPS-induced inflammation in HSC-T6 cells. \u003c/strong\u003eA) Effect of incubation with different concentrations of Rd for 24 h on the viability of HSC-T6 cells (n = 4). B) Effect of Rd on LPS-induced inflammation-associated protein expression in HSC-T6 cells (n = 3). Values are shown as the mean ± SEM, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs. control group, #\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ##\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01 vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/c2fcb7ca882418fc3887801b.png"},{"id":72159122,"identity":"76c784fc-b96b-44fd-81b1-ddd2aa8a77be","added_by":"auto","created_at":"2024-12-23 09:23:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1639800,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd regulates LPS-induced autophagy in HSC-T6 cells. \u003c/strong\u003eEffect of Rd on LPS-induced autophagy-related protein expression in HSC-T6 cells (n = 3). Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, vs. control group, #\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ##\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01 vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/1b0d096749a2f6d9a4760915.png"},{"id":72158620,"identity":"98bcd649-1611-4169-9c89-0de96a7d6512","added_by":"auto","created_at":"2024-12-23 09:15:16","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1502337,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRd regulates AMPK pathway in LPS-induced HSC-T6 cells. \u003c/strong\u003eEffect of Rd on AMPK/mTOR/ULK1 pathway in HSC-T6 cells Effect of Rd on AMPK/mTOR/ULK1 pathway in HSC-T6 cells (n = 3). Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, vs. control group, #\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ##\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/a5e92713d74aaea325c72cd8.png"},{"id":72158626,"identity":"8f55d1e4-f4c4-40de-9c24-bec93c03b1fb","added_by":"auto","created_at":"2024-12-23 09:15:16","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2820821,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntervention of Rapamycin on autophagy regulation by Rd. \u003c/strong\u003eA) Effect of Rapamycin intervention on the regulation of autophagy in HSC-T6 cells by Rd (n = 3). B) Effect of Rd on Rapamycin-intervened HSC-T6 cell inflammation-associated protein expression (n = 3). Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. control group, #\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. model group, \u0026amp;\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u0026amp;\u0026amp;\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. treatment group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/118d4937693f3c79ac9f014e.png"},{"id":72158625,"identity":"a6c8bab3-7660-42c5-8231-aaa573644673","added_by":"auto","created_at":"2024-12-23 09:15:16","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1368908,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntervention of GSK621 on autophagy regulation by Rd. \u003c/strong\u003eEffect of GSK621 intervention on the effect of Rd on regulating autophagy in HSC-T6 cells (n = 3). Values are shown as the mean ± SEM; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. control group, #\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. model group, analyzed by one-way ANOVA with Dunnett’s test.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/83e3d05bb66e38c05302c584.png"},{"id":75351365,"identity":"29ddf44c-7ee3-49a1-b1e4-c923c7d4c954","added_by":"auto","created_at":"2025-02-03 16:10:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":57803932,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/0a15fcc4-936e-481a-b454-3947e6a84adc.pdf"},{"id":72158623,"identity":"a6ed8e1f-6acc-4aae-8820-8c9b85c874ac","added_by":"auto","created_at":"2024-12-23 09:15:16","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":725722,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalimagesofWB.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5176123/v1/4f197a350c85307cd231e0c8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Ginsenoside Rd protects against acute liver injury by regulating the autophagy-NLRP3 inflammasome pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe liver is an organ with a unique immune system, comprised of hepatocytes, sinusoidal cells, and perisinusoidal cells. Acute liver injury (ALI), which includes drug-induced, chemical-induced, and immune-mediated liver injury in clinical classifications, can lead to liver dysfunction[1]. Long-term liver injury can lead to hepatic fibrosis, cirrhosis, and even life-threatening conditions such as liver failure and liver cancer. Therefore, preventing and treating liver injury is determinant in halting its progression, thus emphasizing the fundamental significance of developing hepatoprotective therapeutic agents.\u003c/p\u003e\n\u003cp\u003eChemical-induced liver injury is a prevalent form of liver damage, and in studies aiming to induce liver injury models, substances such as TAA, carbon tetrachloride (CCl4), and\u0026nbsp;D-galactosamine are often utilized [2]. TAA is a hepatotoxic compound that undergoes metabolism by CYP450 enzymes, leading to the formation of TAA-sulfur oxide within the body. This metabolic process disrupts hepatic metabolism, impacting proteins and lipids, and triggering oxidative stress [3]. Notably, the activation of autophagy in hepatic stellate cells plays a critical role in TAA-induced liver injury and fibrosis.\u003c/p\u003e\n\u003cp\u003eAbnormal autophagy levels can significantly influence the progression of liver diseases. Autophagy, a self-defense mechanism in the body, degrades damaged cellular organelles and recycles biomolecules to prevent cellular damage and dysfunction[4]. This process is influenced by various factors such as stress, inflammation, and apoptosis, serving as a means of cellular self-protection under oxidative stress conditions [5]. However, excessive autophagy can induce pathological changes in tissues [6]. Indeed, while moderate autophagy eliminates damaged organelles and proteins, excessive autophagy can exacerbate liver diseases [7] and promote hepatic stellate cell activation, thereby worsening liver fibrosis [8]. This indicates that autophagy plays a dual role in liver diseases.\u003c/p\u003e\n\u003cp\u003eRegulating autophagy has been demonstrated to alleviate liver injury, highlighting its potential as a significant therapeutic approach for various liver diseases [9, 10]. This discovery opens opportunities to explore the regulatory effects of drugs on autophagy to identify potential treatments for liver injury. Extensive studies have also validated the efficacy of Traditional Chinese Medicine (TCM) in hepatoprotective approaches [11, 12]. TCM's rich repository of medicinal resources includes ginsenoside Rd (Rd), the structural formula is C\u003csub\u003e48\u003c/sub\u003eH\u003csub\u003e82\u003c/sub\u003eO\u003csub\u003e18\u0026nbsp;\u003c/sub\u003e(Figure 1A),an active component commonly found in \u003cem\u003ePanax\u003c/em\u003e \u003cem\u003eginseng\u003c/em\u003e C.A. Meyer and \u003cem\u003ePanax notoginseng\u003c/em\u003e (Burkill) F.H. Chen ex C.H. Chow, both species belonging to genus Panax in the Araliaceae family, which has shown significant protective effects on the nervous and cardiovascular systems [13, 14].\u003c/p\u003e\n\u003cp\u003eRd impacts several regulatory pathways of significance to autophagy. Studies have suggested that Rd can down-regulate NF-κB, resulting in the inhibition of iNOS and COX-2 levels in RAW 264.7 macrophage cells [15]. It has been found to inhibit the TGF-β/Smad pathway, reduce cellular autophagy, and thus suppress hepatic stellate cells (HSCs) activation [16]. Suppression of ferroptosis, alleviating CCl4-induced liver injury in mice through the cGAS/STING pathway [17], has been observed. Additionally, regulating the ERRα-mediated P2X7r pathway can reduce both fibrogenesis and inflammation in hepatic fibrosis [18]. There is also evidence that Rd, when used in combination with Phosphoarginine, can suppress liver cancer by reducing HIF-1α through the PI3K/AKT/mTOR signaling pathway[19]. However, the potential protective effect of RD in modulation of autophagy on TAA-induced acute liver injury remains to be investigated.\u003c/p\u003e\n\u003cp\u003eHere, for the first time, an investigation on the hepatoprotective effect of Rd against acute liver injury induced by TAA in mice is presented. We assess the underlying mechanisms that are implicated in autophagy and inflammation. The experimental findings provide valuable evidence for prevention and treatment of acute liver injury.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eRegents and chemicals\u003c/p\u003e\n\u003cp\u003eTAA (no. C17J11H115325) and Rd (no. J11HS184464, purity \u0026ge; 95.0%, HPLC) were obtained from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Diammonium glycyrrhizinate was purchased from Zhengda Tianqing Pharmaceutical Group Co., Ltd. (Nanjing, China). Rapamycin (MCE, HY-10219) and GSK621(MCE, HY-100548) were purchased from Med Chem Express Biotech Co. Ltd. (NJ, USA). Aspartate aminotransferase (AST), alanine aminotransferase (ALT), glutathione S-transferase (GSH-ST), and lactate dehydrogenase (LDH) assay kits were obtained from Nanjing Jiancheng Bioengineering Research Institute (Nanjing, China). H\u0026amp;E staining kit was acquired from Beijing Solarbio Science \u0026amp; Technology Co., Ltd. (Beijing, China). The Rabbit mAb of SQSTM1/P62, LC3II/I Beclin1, phospho ULK1, ULK1, phospho mTOR, mTOR, and NLRP3 were obtained from Cell Signaling Technology (MA, USA). Rabbit mAb of COX-2, iNOS, and AMPK, as well as HRP Goat Anti-Mouse IgG (H+L) and HRP Goat Anti-Rabbit IgG (H+L), were purchased from Proteintech Group, Inc. (Wuhan, China). Rabbit mAb of phospho AMPK, IL-18, and IL-1\u0026beta; were purchased from Abcam Ltd. (Cambridge, UK). \u0026beta;-actin Mouse mAb was purchased from TransGen Biotech Co., Ltd. (Beijing, China). Unless otherwise indicated, all other reagents and chemicals were sourced from Beijing Chemical Factory (Beijing, China).\u003c/p\u003e\n\u003cp\u003eAnimals\u003c/p\u003e\n\u003cp\u003eA total of 48 healthy specific pathogen-free (SPF) C57BL/6 mice, obtained from Shanghai Slac Laboratory Animal Co. Ltd. [Shanghai, China, Production License: SCXK (Zhejiang) 2019-2020], with body weight of 20 \u0026plusmn; 2 g, were utilized in the animal experiments. The mice were accommodated at the Experimental Animal Center of Fujian University of Traditional Chinese Medicine [SYXK (Min) 2019-0007), with \u003cem\u003ead libitum\u003c/em\u003e access to food and water, under a 12 h light-dark cycle. All procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health, comply with the ARRIVE guidelines and the study was approved by the Animal Care and Use Committee of the Fujian University of Traditional Chinese Medicine, and all procedures strictly adhered to the regulations regarding animal welfare (Approval Number: FJTCM IACUC2021068).\u003c/p\u003e\n\u003cp\u003eAnimal experimental design\u003c/p\u003e\n\u003cp\u003eForty-eight C57BL/6 mice were randomly assigned into the following groups (n = 8): control group (CON), model group (MOD), Rd low dose (12.5 mg/kg, Rd-12.5), medium dose (25 mg/kg, Rd-25), high dose (50 mg/kg, Rd-50) groups, and diammonium glycyrrhizinate group (DG, 30 mg/kg). DG and Rd were suspended in 0.5% sodium carboxymethylcellulose (CMC-Na) solution. The mice were given gavage 10 mL/kg, once a day for three days continuously. Two hours after the last drug administration, TAA (5 mg/mL/kg) dissolved in physiological saline was injected into the abdominal cavity to induce modeling. After modeling, food was restricted, but water was allowed. The mice were weighed and sacrificed by using 1.5% sodium pentobarbital (0.15 ml/10g) for anesthesia. The livers were isolated and weighed. Liver index (%) = liver weight / body weight \u0026times; 100%.\u003c/p\u003e\n\u003cp\u003eMeasurement of serum transaminase enzymes\u003c/p\u003e\n\u003cp\u003eThe blood was collected and centrifugated at 3500 rpm for 8 min to collect the upper layer of serum and stored in a -80\u0026deg;C freezer. The levels of AST, ALT, LDH, and GST in the serum were measured strictly, according to the instructions provided in the corresponding commercial kits [20].\u003c/p\u003e\n\u003cp\u003ePathological staining of liver tissues\u003c/p\u003e\n\u003cp\u003eThe procedure for pathological staining was conducted in accordance with our previous study [21]. Briefly, liver tissues were collected, fixed, and then washed with PBS buffer. A 0.5 cm \u0026times; 0.5 cm \u0026times; 0.5 cm section of liver tissue was cut and used for pathological staining. The tissues underwent dehydration using increasing ethanol concentrations, followed by rinsing with xylene I (50% ethanol, 50% xylene) and xylene II (100% xylene). Subsequently, the tissues were embedded in paraffin. The paraffin-embedded section was sliced into 4 \u0026mu;m thickness and dried using heat. After cleaning the paraffin section with xylene I and xylene II, it was hydrated with decreasing ethanol concentrations. Following H\u0026amp;E staining, the liver tissue sections were dehydrated, and pathological changes were observed under an optical microscope. Representative areas were then captured by the microscope.\u003c/p\u003e\n\u003cp\u003eCells experimental design\u003c/p\u003e\n\u003cp\u003eA rat hepatic stellate cell line (HSC-T6) was procured from Kunming Cell Bank of Chinese Academy of Sciences in Kunming, China. The HSC-T6 cells were cultured in Dulbecco\u0026apos;s modified Eagle\u0026apos;s medium (DMEM) and maintained at a temperature of 37\u0026deg;C under a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere. HSC-T6 cells were treated with G-Rd at concentrations of 2.5, 5, or 10 \u0026mu;M, either with or without LPS stimulation at 100 ng/mL. In addition, a group of cells treated with G-Rd at 10\u0026mu;M was co-incubated with the mTOR inhibitor RAPA at 2\u0026mu;M, or the AMPK activator GSK621 at 10 \u0026mu;M. The cells were then further incubated for a period of 12 h, after which protein extraction was carried out.\u003c/p\u003e\n\u003cp\u003eCell viability assays\u003c/p\u003e\n\u003cp\u003eBriefly, the MTT proliferation assay was employed to assess the cell viability of HSC-T6 cells and primary mouse hepatocytes. Initially, a 96-well culture plate was prepared, with each well containing 5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells in 1 mL of culture medium. After 24 h, Rd was added to each well (100 \u0026mu;L of drug volume per well). Another 24 h later, 22 \u0026mu;L of 5 mg/mL MTT solution was added to each well, resulting in a final concentration of MTT of 0.5 mg/mL. The plate was then placed in an incubator for 4 h, followed by careful removal of the supernatant. Subsequently, 200 \u0026mu;L of DMSO was added to each well. The plate was placed in a microplate reader, shaken for 5-10 min to facilitate the dissolution of the formazan crystals, and the optical density (OD value) was measured at a wavelength of 490 nm.\u003c/p\u003e\n\u003cp\u003eImmunofluorescence staining assay\u003c/p\u003e\n\u003cp\u003eLiver tissue sections with a thickness of 5 \u0026mu;m were reprocessed with xylene, followed by a gradient of ethanol. Then, the sections were incubated with a normal goat serum-blocking solution by adding it dropwise and incubating at room temperature for 20 min. The LC3Ⅱ primary antibody (dilution ratio of 1:70) was added dropwise and incubated at 4\u0026deg;C overnight. The following day, the sections were taken out, allowed to warm up, washed once with PBS, and air-dried. Fluorescent-labeled secondary antibody (IgG) was added dropwise, incubated at 37\u0026deg;C in the dark for 20 min, washed once with PBS, air-dried, and then mounted with neutral resin. Fluorescence inverted microscope (Leica, DMi8, Germany) was used for image capture and analysis.\u003c/p\u003e\n\u003cp\u003eqPCR analysis of IL-6、TNF-\u0026alpha;、iNOS、COX-2 mRNA expressions\u003c/p\u003e\n\u003cp\u003eThe total RNA was extracted from the powdered frozen liver tissues, and the quantity and purity were assessed using a Thermo Fisher Scientific nanodrop spectrophotometer. The RT Reverse Transcription kit was used to reverse transcribe 200 ng of total RNA into cDNA according to the kit\u0026apos;s instructions. The protocol involved incubating the reaction mixture at 25.0\u0026deg;C for 5 min, 42.0\u0026deg;C for 60 min, 70.0\u0026deg;C for 5 min, followed by cooling to 4.0\u0026deg;C. The resulting cDNA samples were diluted with RNase-free ddH\u003csub\u003e2\u003c/sub\u003eO and mixed with the ChamQ SYBR qPCR Master Mix before undergoing stem-loop RT-PCR using the ABI7900 system from Applied Biosystems, a division of Thermo Fisher Scientific. Each 9 \u0026mu;L reaction mixture contained 4 \u0026mu;L of ChamQ SYBR qPCR Master Mix, 1 \u0026mu;L of each primer, 1 \u0026mu;L of ROX Reference Dye 1, 1 \u0026mu;L of cDNA, and 2 \u0026mu;L of RNase-free dH\u003csub\u003e2\u003c/sub\u003eO. The primer sequences for IL-6, TNF-\u0026alpha;, iNOS, and COX-2 are available in Table 1. The reaction conditions for the targeted genes were set as follows: initial heat activation at 95\u0026deg;C for 30 s, followed by 40 cycles of denaturation at 95\u0026deg;C for 10 s, annealing at 60 \u0026deg;C for 30 s, extension at 95\u0026deg;C for 15 s and final extension at 95\u0026deg;C for 15 s. Data analysis was performed using the comparative CT method (\u003csup\u003e\u0026Delta;\u0026Delta;CT\u0026nbsp;\u003c/sup\u003eMethod) with \u0026beta;-actin mRNA levels serving as the normalization control. The fold change in gene expression between the different treatments was determined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. The primer sequences used in qPCR analysis.\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 235px;\"\u003e\n \u003cp\u003eReverse (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eIL-6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eCTGCAAGAGACTTCCATCCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 235px;\"\u003e\n \u003cp\u003eAGTGGTATAGACAGGTCTGTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGCCGATGGGTTGTACCTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 235px;\"\u003e\n \u003cp\u003eTCTTGACGGCAGAGAGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eiNOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGAAGGGGACGAACTCAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 235px;\"\u003e\n \u003cp\u003eGTGGCTCCCATGTTGCATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eCOX-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGCCTGGTCTGATGATGTATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 235px;\"\u003e\n \u003cp\u003eCCTATGAGTATGAGTCTGCTGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eTGTCCACCTTCCAGCAGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 235px;\"\u003e\n \u003cp\u003eAGCTCAGTAACAGTCCGCCTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eWestern blot analysis\u003c/p\u003e\n\u003cp\u003eThe total protein was extracted from each group\u0026rsquo;s liver tissues with 0.5 mL RIPA assay buffer containing 1% protease/phosphatase inhibitor cocktail. Total protein was mixed with 5\u0026times; protein loading buffer at a concentration 0.5 mg/mL and denatured at 100\u0026deg;C for 10 min. Subsequently, the proteins were separated by SDS-PAGE electrophoresis (PowerPac HC, BioRAD) at 90 V for 90 min using protein gels. The proteins in the gel were then transferred onto a polyvinylidene difluoride membrane and incubated with 5% skim milk dissolved in TBST for 70-90 min at room temperature. The membranes were subsequently incubated overnight at 4\u0026deg;C with the following primary antibodies: anti-COX-2 (1:1000), anti-iNOS (1:1000), anti-NLRP3 (1:1000), anti-IL-18 (1:1000), anti- IL-1\u0026beta; (1:1000), anti-\u0026beta;-actin (1:7500), anti-SQSTM1/p62 (1:1000), anti-p-AMPK (1:750), anti-AMPK (1:750), anti-p-mTOR (1:1000), and anti-mTOR (1:1000), anti-LC3Ⅰ/Ⅱ (1:1000), anti-Beclin1 (1:1000), anti-p-ULK1 (1:1000), and anti-ULK1 (1:1000). After three washes with TBST buffer, they were co-incubated for 1 h with either anti-rabbit or anti-mouse secondary antibodies conjugated with horseradish peroxidase (1:8000). \u0026beta;-actin, purchased from TransGen Biotech, Beijing, China (1:2000), served as the internal control. The immunoreactive bands were visualized. Image Lab 6.0 was utilized for band intensity quantification.\u003c/p\u003e\n\u003cp\u003eStatistical analysis\u003c/p\u003e\n\u003cp\u003eAll data was analyzed using SPSS 26.0 statistical software, and the values were expressed as mean \u0026plusmn; standard error of the mean (SEM). Statistical analysis was conducted using one-way analysis of variance (ANOVA). In cases where the data did not follow a normal distribution, the non-parametric Mann-Whitney U test was utilized. When the data followed a normal distribution and exhibited equal variances, the LSD test was used. In instances of unequal variances, the Games-Howell test was employed for statistical analysis. Statistical significance was considered at values of \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eRd exhibited protection against TAA-induced acute liver injury\u003c/p\u003e\n\u003cp\u003eIn this study, a commonly used animal model of acute liver injury was established through the injection of TAA [22]. This model is characterized by heightened levels of ALT, AST, LDH, and other markers in the serum [23], along with histological changes and pathological alterations in liver tissue.\u003c/p\u003e\n\u003cp\u003eInsert Figure 1\u003c/p\u003e\n\u003cp\u003eTo investigate whether Rd had hepatoprotective effects, the TAA-induced acute liver injury model in mice was pre-treated with Rd. No mortality was observed among the experimental mice in each group. Compared with the control group, the model group showed significant increase in serum levels of AST (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001), ALT (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01), GST (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001), and LDH (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). All mice in the DG (30 mg/kg) and Rd groups showed a noteworthy reduction in the levels of AST, ALT, and GST (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) compared to the model group (Figure 1B). While there was a measurable degree of decline in liver tissue LDH levels, no statistical significance was found for the DG and Rd pre-treated groups (Figure 1C). Moreover, moderate effects are observed for the liver index, with an increase for the acute liver injury model group, and a decrease in the DG and Rd groups. However, as observed in Figure 1D, the high-dose group of Rd exhibited a significant reduction in liver index compared to the model group.\u003c/p\u003e\n\u003cp\u003eMorphologic observation of the liver revealed a smooth surface with normal color in the control group, while the model group exhibited numerous dark red spots on the liver surface. Comparatively, the DG and Rd groups showed varying degrees of improvement, with the medium dose Rd (25 mg/kg) group exhibiting the most prominent effect (Figure 1E). To assess whether Rd leads to pathological changes in liver tissue, pathological staining was performed. Histopathological analysis of the control group using HE staining showed, as expected, well-organized liver cells with normal hepatic cord morphology and intact hepatic lobule structure. In contrast, the model group displayed nuclear pyknosis, abnormal hepatocyte arrangement, tissue infiltration of inflammatory cells, and areas of hemorrhage. Intervention with Rd and DG ameliorated these pathological changes (Figure 1F), resulting in restoration of normal hepatic lobule structure, alleviated infiltration of inflammatory cells and diminished bleeding.\u003c/p\u003e\n\u003cp\u003eRd inhibited inflammatory response in acute liver injury\u003c/p\u003e\n\u003cp\u003eInsert Figure 2\u003c/p\u003e\n\u003cp\u003eDuring the development of acute liver injury, various pathological mechanisms are involved, with inflammation-induced hepatocellular damage being one of the key mechanisms. Herein, after injury, the RT-qPCR results revealed a significant increase (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001) in the mRNA expression of pro-inflammatory cytokines (COX-2, TNF-α, IL-6, and iNOS) in the model group. After low dose of Rd (12.5 mg/kg) and DG treatments, there was no significant effect on the mRNA expression of COX-2 and IL-6. However, the medium and high doses (25, 50 mg/kg) of Rd demonstrated a significant downregulation effect on their expression (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) (Figure 2A).\u003c/p\u003e\n\u003cp\u003eConcomitantly, after injury Western blot analysis revealed a significant upregulation (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05, or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01, or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001) in the protein expression levels of inflammatory markers COX-2, iNOS NLRP3, ASC, IL-18 and IL-1β, in the liver tissue of the model group compared to the control group. However, after intervention with DG and Rd, there was a notable reduction (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) observed in these markers (Figure 2B).\u003c/p\u003e\n\u003cp\u003eRd regulated autophagy in acute liver injury \u003cem\u003evia\u003c/em\u003e inhibiting the AMPK/mTOR/ULK1 axis\u003c/p\u003e\n\u003cp\u003eInsert Figure 3\u003c/p\u003e\n\u003cp\u003eStudies have shown that regulating autophagy can alleviate inflammation and stress levels to improve acute liver injury[24, 25]. To investigate the impact of Rd on autophagy in this ALI model, the expression levels of autophagy-related proteins and upstream signaling pathways were examined. Immunofluorescence analysis revealed a significant elevation (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001) in both the area and intensity of LC3II in the liver tissue of the model group. In the DG group, there was a partial decrease of fluorescence intensity and area (Figure 3A). Notably, Rd demonstrated a significant decrease in both the fluorescence area and intensity of LC3II (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001).\u003c/p\u003e\n\u003cp\u003eWestern blot results showed that significant higher levels of autophagy-associated proteins LC3II/I in the model group compared to the control group (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001), and a noticeable increase in the autophagy substrate p62. Compared with the model group, the levels of Beclin1 and LC3II/I were considerably decreased, and the expression level of p62 was further increased after Rd treatment (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05,\u003cem\u003e\u0026nbsp;p\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01, or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001) (Figure 3B).\u003c/p\u003e\n\u003cp\u003eInsert Figure 4\u003c/p\u003e\n\u003cp\u003eA significant increase in the phosphorylation levels of AMPK and ULK1(\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001) was also observed in hepatic tissue. Concomitantly, treatment with DG and Rd led to a reduction in the phosphorylation levels of AMPK and ULK1, along with decreased phosphorylation levels of mTOR (Figure 4).\u003c/p\u003e\n\u003cp\u003eRd exerted an intervention effect on LPS-induced inflammation and autophagy in HSC-T6 cells\u003c/p\u003e\n\u003cp\u003eInsert Figure 5\u003c/p\u003e\n\u003cp\u003eThe activation of hepatic stellate cells (HSCs) is a critical pathological process during acute liver injury and serves as an important \u003cem\u003ein vitro\u003c/em\u003e research target for liver injury. Therefore, \u003cem\u003ein vitro\u003c/em\u003e experiments using HSC-T6 cells were conducted to examine the impact of Rd on the regulation of autophagy. First, we evaluated the concentration of Rd affecting cell viability. Results from an MTT assay showed that after 24 h of incubation, Rd does not significantly affect cell viability up to a concentration of 160 μM (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). A significant effect was observed at 320 μM (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001). Therefore, the selected concentrations of Rd (2.5-10 μM) in our experiments did not exhibit significant toxicity to HSC-T6 cells (Figure 5A).\u003c/p\u003e\n\u003cp\u003eAfter the activation of HSC-T6 by LPS, the expression levels of NLRP3 and COX-2 were significantly increased compared to the control group (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). However, following intervention with Rd, the expression levels of NLRP3 and COX-2 were significantly decreased compared to the model group (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) (Figure 5B).\u003c/p\u003e\n\u003cp\u003eNumerous studies have demonstrated that the activation of HSC-T6 cells is accompanied by an increase in autophagy levels [26], which can be blocked by autophagy inhibitors.\u003c/p\u003e\n\u003cp\u003eInsert Figure 6\u003c/p\u003e\n\u003cp\u003eThe expression levels of autophagy-related genes showed significant changes, as evidenced by the data presented in Figure 6. Compared with the control group, the expressions of autophagy-related gene 5 (ATG5) and autophagy-related gene 7 (ATG7) were significantly increased (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). Concomitantly, the levels of Beclin1 and LC3II/I were also significantly increased (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01), and the expression of p62 decreased (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). After intervention with Rd, the levels of ATG5, ATG7, LC3II/I and Beclin1 decreased significantly (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01), while the expression of p62 increased (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003eInsert Figure 7\u003c/p\u003e\n\u003cp\u003eTo assess potential regulatory effects of Rd on the AMPK/mTOR/ULK1 pathway in HSC-T6 cells, Western blot experiments were performed. In comparison to the control group, LPS substantially increased the phosphorylation levels of p-AMPK and p-ULK1 proteins (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01), while decreasing the phosphorylation level of p-mTOR (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). Following Rd intervention, as compared to the model group, there was a decrease in the phosphorylation levels of AMPK and ULK1 (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01) and an increase in the phosphorylation level of mTOR (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figure 7).\u003c/p\u003e\n\u003cp\u003eRd co-treated with Rapamycin and GSK621 intervened in autophagy and inflammation in HSC-T6 cells\u003c/p\u003e\n\u003cp\u003eInsert Figure 8\u003c/p\u003e\n\u003cp\u003eThe results from the previous section of \u003cem\u003ein vitro\u003c/em\u003e experiments demonstrated that Rd regulated autophagy through the AMPK/mTOR/ULK1 signaling pathway and reduced the expression of the inflammasome NLRP3. To verify whether modulating autophagy can improve the expression of the inflammasome, mTOR inhibitor rapamycin and AMPK activator GSK621 were employed to induce high levels of autophagy in HSC-T6 cells. Following rapamycin intervention, the LPS+Rapamycin treatment showed a significant increase in the LC3 II/I ratio compared to the model group. This was accompanied by elevated expression of beclin1 and phosphorylation level of ULK1. Concomitantly, a notable decrease in p62 expression was observed. Conversely, the phosphorylation level of mTOR decreased. In comparison to the LPS+Rd group, the LPS+Rapamycin+Rd group demonstrated a significant increase in the LC3 II/I ratio (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001). Additionally, increases in the expression of beclin1 and phosphorylation of ULK1 were observed. Concurrently, both p62 expression and the phosphorylation level of mTOR did significantly decrease (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figure 8A). Furthermore, after rapamycin intervention, compared to the model group there was a significant upregulation in the expression of NLRP3, along with its downstream effectors IL-18 and IL-1β. However, the efficacy of Rd was partially attenuated under these conditions (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) (Figure 8B).\u003c/p\u003e\n\u003cp\u003eInsert Figure 9\u003c/p\u003e\n\u003cp\u003eAfter the intervention with GSK621, there was a significant increase in the LC3 II/I ratio compared to the model group, along with elevated phosphorylation levels of AMPK and ULK1. Similarly, the LPS+GSK621+Rd group exhibited a comparable increase compared to the treatment group (Figure 9).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eTAA, known as a hepatotoxic compound, generates TAA-S-oxide and TAA-S-dioxide, leading to oxidative stress via lipid peroxidation in liver cell membranes through its intrahepatic bioactivation [27]. This oxidative stress disrupts protein synthesis, along with RNA and DNA integrity, and affects glutamyl transpeptidase activity [28, 29], which is why TAA is commonly utilized to induce hepatotoxicity in animal models. Our studies leveraging this model have uncovered that Rd pre-treatment not only mitigates inflammatory processes but also suppresses hepatic autophagy, thereby safeguarding liver tissues. Furthermore, our findings suggest a critical involvement of the AMPK/mTOR/ULK1 signaling pathway in the hepatoprotective influence exerted by Rd.\u003c/p\u003e\n\u003cp\u003eGinsenoside Rd (C\u003csub\u003e48\u003c/sub\u003eH\u003csub\u003e82\u003c/sub\u003eO\u003csub\u003e19\u003c/sub\u003e), a prominent saponin derived from the root of \u003cem\u003ePanax ginseng\u003c/em\u003e and \u003cem\u003ePanax notoginseng\u003c/em\u003e, has diverse pharmacological effects recognized in TCM.\u0026nbsp;Numerous studies have highlighted the significant protective effects of this compound in various systems, including the nervous system [14], cardiovascular systems [13], among others. However, the exploration of Rd's efficacy in mitigating hepatic injury remains relatively uncharted. Our research revealed significant hepatoprotective effects of Rd, which were manifested by the alleviation of morphological abnormalities and a reduction in inflammatory cell infiltration in liver tissue. Additionally, a significant diminution in plasma aspartate AST, ALT, and GST levels was observed, corroborating the hepatoprotective capacity of Rd. These findings underscore the potential of Rd as a therapeutic agent for acute liver injury treatment [24]. Nevertheless, comprehensive studies are warranted to confirm its safety profile and therapeutic efficacy in patients with hepatic injuries.\u003c/p\u003e\n\u003cp\u003eIn our study, following TAA-induced acute liver injury, analyses of both mRNA and protein expression confirm the pathogenic mechanism. It was shown that TAA-induced acute liver injury increased pro-inflammatory cytokine mRNAs IL-6, iNOS, TNF-α, and COX-2 mRNA [21], as well as increased inflammation-related protein expression levels of COX-2, iNOS, NLRP3, IL-18, and IL-1β. In the TAA-induced acute liver injury model, endotoxemia upregulates iNOS and elevates NO levels, leading to microthrombosis and hepatocellular necrosis [30]. IL-6 is a key pro-inflammatory cytokine [31], and NLRP3 forms an inflammasome complex that regulates inflammation [32, 33]. TNF-α activates NLRP3 transcription, linked to liver diseases [3, 34, 35], and downstream IL-18 and IL-1β changes [36]. Our research demonstrated that treatment with Rd reduced the expression of these pro-inflammatory cytokine mRNAs, indicating its role in lowering liver tissue inflammation. Furthermore, it also decreased the expression of inflammation-related proteins, suggesting an effect at the protein expression level rather than just gene transcription. These findings indicate that the anti-inflammatory activities of Rd in mitigating liver injury may be attributed to its ability to suppress NLRP3 inflammasome activation. This mechanism could potentially help prevent the exacerbation of liver injury.\u003c/p\u003e\n\u003cp\u003eAdequate regulation of autophagy is acknowledged as a key therapeutic target in treating liver injury [26], and our study extends this understanding by evaluating the potential of Rd to improve liver injury through its autophagy-modulating effects. Studies have revealed the crucial roles of autophagy and inflammasomes in maintaining cellular homeostasis and managing inflammation [37]. Indeed, regulating autophagy can downregulate NLRP3 expression [7, 38] and affect IL-18 and IL-1β levels, mitigating inflammation [39]. Previous results indicated that autophagy levels were elevated in the TAA-induced model [8], warranting further investigation of the Rd mechanism of action. This can be accomplished since sustained TAA exposure can drive liver injury to fibrosis [40]. Liver tissue experiences abnormal autophagy under TAA-induced stress, similar to AMPK/mTOR/ULK1 changes in other stress-related diseases [41, 42]. These have specific roles: AMPK, is an energy sensor that regulates cellular energy metabolism, mTOR controls autophagy through mTORC1 and mTORC2 complexes [41, 42], and ULK1 initiates autophagosome formation by binding to autophagy-associated genes [43, 44]. Our results indicate that Rd regulates autophagy by inhibiting AMPK phosphorylation and restoring mTOR phosphorylation.\u003c/p\u003e\n\u003cp\u003eAutophagosome regulation was evaluated through the autophagic substrate p62. During autophagosome formation, LC3I converts to LC3II, Beclin1 increases, and the autophagic substrate p62 decreases. Notably, in this study’s injured liver tissue, p62 expression slightly increased, likely due to stress responses and oxidative stress. The impact of Rd on autophagy leads to increased p62 accumulation, aligning with the observations from certain TAA-induced models [19, 45]. This indicates that, consistent with previous research findings [26, 46, 47], Rd alleviates inflammation and provides liver protection through autophagy regulation.\u003c/p\u003e\n\u003cp\u003eThe effect of Rd on autophagy and pro-inflammatory factors was also investigated from response of HSCs to liver damage. In response to liver damage, HSCs undergo activation and increased autophagy due to cytokine signals [48, 49]. This heightened autophagy leads to the degradation of lipid droplets within HSCs, resulting in autolysosome formation and increased pro-inflammatory cytokines IL-1β and TNF-α [50-52]. LPS-induced HSC-T6 activation was used to investigate the effect of Rd on autophagy and pro-inflammatory factors in this study. After HSC-T6 activation, protein expression of LC3II/I, Beclin1, ATG5, and ATG7 increased in the model group, while p62 decreased. COX-2 and NLRP3 levels also rose. Rd downregulated LC3II/I, Beclin1, ATG5, and ATG7, and upregulated p62, suggesting its autophagy regulation \u003cem\u003ein vitro\u003c/em\u003e. Following LPS-induced activation, AMPK and ULK1 phosphorylation increased, and mTOR phosphorylation decreased in the model group. Rd reversed these changes significantly, suggesting Rd regulates HSC-T6 autophagy through the AMPK/mTOR/ULK1 pathway, which corroborates findings from recent studies[7, 53].\u003c/p\u003e\n\u003cp\u003eDiving into the cellular drama of liver pathology, we turned the spotlight on the NLRP3 inflammasome's role within HSCs. NLRP3 inflammasome activation in HSCs is significant in liver diseases [54]. Indeed, studies have shown that regulating autophagy can inhibit NLRP3 activation and subsequently improve inflammation [55]. This study found that inducing or enhancing autophagy with LPS or rapamycin (mTOR inhibitor) led to increased NLRP3 and downstream IL-18 and IL-1β, mirroring autophagy changes. Thus, Rd regulated autophagy, inhibiting NLRP3 inflammasome activation. Indeed, overactive autophagy can exacerbate inflammation, as seen in atherosclerosis, chronic obstructive pulmonary disease, and tracheal epithelium damage [56-58]. This effect was blocked by rapamycin, revealing Rd's anti-inflammatory mechanism by curbing excessive autophagy.\u003c/p\u003e\n\u003cp\u003eOur results opened avenues for investigating how Rd exerts anti-inflammatory actions via autophagy modulation. Future studies will focus on delineating the molecular crosstalk between autophagy-related pathways and NLRP3 inflammasome activation, aiming to identify potential biomarkers for disease progression and therapeutic response. Moreover, assessing the dose-response of Rd and similar autophagy regulators might reveal optimal therapeutic windows for liver diseases, leading to more efficacious and safer treatments.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates that Rd exhibits a significant hepatoprotective effect against acute liver injury. This effect was manifested through a reduction in liver index, improved histopathology, and a decrease in serum markers of liver damage. We show that the hepatoprotective effect could be attributed to the downregulation of pro-inflammatory factors, suggesting the ability of Rd to alleviate acute liver injury by suppressing inflammation. Furthermore, this effect is closely associated with the regulation of autophagy. Specifically, Rd regulates autophagy through the AMPK/mTOR/ULK1 signaling pathway, both in TAA-induced acute liver injury \u003cem\u003ein vivo\u003c/em\u003e and LPS-induced HSC-T6 cells \u003cem\u003ein vitro\u003c/em\u003e. By inhibiting autophagy and attenuating the inflammatory response, Rd effectively mitigates acute liver injury induced by TAA and suppresses inflammation in LPS-induced HSC-T6 cells. These findings highlight the therapeutic potential of Rd in treating acute liver injury by targeting autophagy-mediated inflammation \u003cem\u003evia\u003c/em\u003e the AMPK/mTOR/ULK1 signaling pathway.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe data presented in this study are available on request from the corresponding author.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eFor multiple agency grants This work was supported by the [National Key Research and Development Program of China #1] under Grant [number 2022YFC3501205]; [National Natural Science Foundation of China #2] under Grant [number 82274080 and 32100168]; [The Collaborative Innovation Platform Project of Fuxiaquan National Innovation Demonstration Zone #3] under Grant [number 2021FX02]; [The Natural Science Foundation of Fujian University of Traditional Chinese Medicine #4] under Grant [number X2023025]; [The Basic Discipline Research Enhancement Program of Fujian University of Traditional Chinese Medicine #5] under Grant [number XJC2023008].\u003c/p\u003e\n\u003cp\u003eAuthor contribution\u003c/p\u003e\n\u003cp\u003eZYF, HMQ and SJY designed the research study. XMZ and SYB performed the experimental work and analyzed data. LYX and WH prepared the manuscript. RYL and XZ reviewed and revised the paper. JJL and ZYF supervised the experiments. LYX and HMQ secured the funding support.\u003c/p\u003e\n\u003cp\u003eAll the authors approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDeclaration of interest\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe authors report no declarations of interest. The authors alone are responsible for the content and writing of the paper.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLarrey, D. Epidemiology and individual susceptibility to adverse drug reactions affecting the liver. \u003cem\u003eSemin Liver Dis\u003c/em\u003e \u003cstrong\u003e2002\u003c/strong\u003e, 222, 145-155, https://doi.org/10.1055/s-2002-30105.\u003c/li\u003e\n\u003cli\u003eLiao, Y.J.; Wang, Y.H.; Wu, C.Y.; Hsu, F.Y.; Chien, C.Y.; Lee, Y.C. Ketogenic Diet Enhances the Cholesterol Accumulation in Liver and Augments the Severity of CCl(4) and TAA-Induced Liver Fibrosis in Mice. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 226, https://doi.org/10.3390/ijms22062934.\u003c/li\u003e\n\u003cli\u003eXing, Y.; Yao, X.; Li, H.; Xue, G.; Guo, Q.; Yang, G.; An, L.; Zhang, Y.; Meng, G. Cutting Edge: TRAF6 Mediates TLR/IL-1R Signaling-Induced Nontranscriptional Priming of the NLRP3 Inflammasome. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, 1995, 1561-1566, https://doi.org/10.4049/jimmunol.1700175.\u003c/li\u003e\n\u003cli\u003eYang, Z.; Klionsky, D.J. Eaten alive: a history of macroautophagy. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, 129, 814-822, https://doi.org/10.1038/ncb0910-814.\u003c/li\u003e\n\u003cli\u003eMizushima, N.; Komatsu, M. Autophagy: renovation of cells and tissues. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, 1474, 728-741, https://doi.org/10.1016/j.cell.2011.10.026.\u003c/li\u003e\n\u003cli\u003eBhatnagar, S.; Mittal, A.; Gupta, S.K.; Kumar, A. TWEAK causes myotube atrophy through coordinated activation of ubiquitin-proteasome system, autophagy, and caspases. \u003cem\u003eJ Cell Physiol\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 2273, 1042-1051, https://doi.org/10.1002/jcp.22821.\u003c/li\u003e\n\u003cli\u003eLi, Y.; Li, S.; Wu, H. Ubiquitination-Proteasome System (UPS) and Autophagy Two Main Protein Degradation Machineries in Response to Cell Stress. \u003cem\u003eCells\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 115, https://doi.org/10.3390/cells11050851.\u003c/li\u003e\n\u003cli\u003eHernandez-Gea, V.; Ghiassi-Nejad, Z.; Rozenfeld, R.; Gordon, R.; Fiel, M.I.; Yue, Z.; Czaja, M.J.; Friedman, S.L. Autophagy releases lipid that promotes fibrogenesis by activated hepatic stellate cells in mice and in human tissues. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 1424, 938-946, https://doi.org/10.1053/j.gastro.2011.12.044.\u003c/li\u003e\n\u003cli\u003eQian, H.; Chao, X.; Williams, J.; Fulte, S.; Li, T.; Yang, L.; Ding, W.X. Autophagy in liver diseases: A review. \u003cem\u003eMol Aspects Med\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 82, 100973, https://doi.org/10.1016/j.mam.2021.100973.\u003c/li\u003e\n\u003cli\u003eCai, X.; Hua, S.; Deng, J.; Du, Z.; Zhang, D.; Liu, Z.; Khan, N.U.; Zhou, M.; Chen, Z. Astaxanthin Activated the Nrf2/HO-1 Pathway to Enhance Autophagy and Inhibit Ferroptosis, Ameliorating Acetaminophen-Induced Liver Injury. \u003cem\u003eACS Appl Mater Interfaces\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 1438, 42887-42903, https://doi.org/10.1021/acsami.2c10506.\u003c/li\u003e\n\u003cli\u003eGu, M.; Chen, Y.J.; Feng, Y.R.; Tang, Z.P. LanGui tea, an herbal medicine formula, protects against binge alcohol-induced acute liver injury by activating AMPK-NLRP3 signaling. \u003cem\u003eChin Med\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, 191, 41, https://doi.org/10.1186/s13020-024-00906-0.\u003c/li\u003e\n\u003cli\u003eZhang, T.; Kang, H.; Peng, Q.; Jiang, Y.; Xie, Y.; Zhang, D.; Song, X.; Li, Y.; Deng, C. Therapeutic mechanism of Cornus Officinalis Fruit Coreon on ALI by AKT/Nrf2 pathway and gut microbiota. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, 130, 155736, https://doi.org/10.1016/j.phymed.2024.155736.\u003c/li\u003e\n\u003cli\u003eZhu, D.; Liu, M.; Yang, Y.; Ma, L.; Jiang, Y.; Zhou, L.; Huang, Q.; Pi, R.; Chen, X. Ginsenoside Rd ameliorates experimental autoimmune encephalomyelitis in C57BL/6 mice. \u003cem\u003eJ Neurosci Res\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, 929, 1217-1226, https://doi.org/10.1002/jnr.23397.\u003c/li\u003e\n\u003cli\u003eCong, L.; Chen, W. Neuroprotective Effect of Ginsenoside Rd in Spinal Cord Injury Rats. \u003cem\u003eBasic Clin Pharmacol Toxicol\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, 1192, 193-201, https://doi.org/10.1111/bcpt.12562.\u003c/li\u003e\n\u003cli\u003eKim, D.H.; Chung, J.H.; Yoon, J.S.; Ha, Y.M.; Bae, S.; Lee, E.K.; Jung, K.J.; Kim, M.S.; Kim, Y.J.; Kim, M.K.; et al. Ginsenoside Rd inhibits the expressions of iNOS and COX-2 by suppressing NF-kappaB in LPS-stimulated RAW264.7 cells and mouse liver. \u003cem\u003eJ Ginseng Res\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, 371, 54-63, https://doi.org/10.5142/jgr.2013.37.54.\u003c/li\u003e\n\u003cli\u003eXu, S.; Mao, Y.; Wu, J.; Feng, J.; Li, J.; Wu, L.; Yu, Q.; Zhou, Y.; Zhang, J.; Chen, J.; et al. TGF-beta/Smad and JAK/STAT pathways are involved in the anti-fibrotic effects of propylene glycol alginate sodium sulphate on hepatic fibrosis. \u003cem\u003eJ Cell Mol Med\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 249, 5224-5237, https://doi.org/10.1111/jcmm.15175.\u003c/li\u003e\n\u003cli\u003eLi, Y.; Yu, P.; Fu, W.; Wang, S.; Zhao, W.; Ma, Y.; Wu, Y.; Cui, H.; Yu, X.; Fu, L.; et al. Ginsenoside Rd Inhibited Ferroptosis to Alleviate CCl(4)-Induced Acute Liver Injury in Mice via cGAS/STING Pathway. \u003cem\u003eAm J Chin Med\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, 511, 91-105, https://doi.org/10.1142/S0192415X23500064.\u003c/li\u003e\n\u003cli\u003eCui, L.; Tan, Y.J.; Xu, S.Q.; Qin, B.F.; Xiu, M.X.; Zhang, X.; Shi, L.Q.; Sun, H.M.; Song, J. Ginsenoside Rd, a natural production for attenuating fibrogenesis and inflammation in hepatic fibrosis by regulating the ERRalpha-mediated P2X7r pathway. \u003cem\u003eFood Funct\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, 1412, 5606-5619, https://doi.org/10.1039/d3fo01315d.\u003c/li\u003e\n\u003cli\u003eYang, X.; Gao, M.; Miao, M.; Jiang, C.; Zhang, D.; Yin, Z.; Ni, Y.; Chen, J.; Zhang, J. Combining combretastatin A4 phosphate with ginsenoside Rd synergistically inhibited hepatocellular carcinoma by reducing HIF-1alpha via PI3K/AKT/mTOR signalling pathway. \u003cem\u003eJ Pharm Pharmacol\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 732, 263-271, https://doi.org/10.1093/jpp/rgaa006.\u003c/li\u003e\n\u003cli\u003eLin, X.; Zhang, S.; Huang, R.; Tan, S.; Liang, S.; Wu, X.; Zhuo, L.; Huang, Q. Protective effect of tormentic acid from Potentilla chinensis against lipopolysaccharide/D-galactosamine induced fulminant hepatic failure in mice. \u003cem\u003eInt Immunopharmacol\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, 192, 365-372, https://doi.org/10.1016/j.intimp.2014.02.009.\u003c/li\u003e\n\u003cli\u003eWang, C.; Sun, Y.; Liu, W.; Liu, Y.; Afzal, S.; Grover, J.; Chang, D.; Munch, G.; Li, C.G.; Lin, S.; et al. Protective effect of the curcumin-baicalein combination against macrovascular changes in diabetic angiopathy. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 13, 953305, https://doi.org/10.3389/fendo.2022.953305.\u003c/li\u003e\n\u003cli\u003eEl-Kashef, D.H.; Serrya, M.S. Sitagliptin ameliorates thioacetamide-induced acute liver injury via modulating TLR4/NF-KB signaling pathway in mice. \u003cem\u003eLife Sci\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 228, 266-273, https://doi.org/10.1016/j.lfs.2019.05.019.\u003c/li\u003e\n\u003cli\u003eJiang, H.; Zhang, X.; Yang, W.; Li, M.; Wang, G.; Luo, Q. Ferrostatin-1 Ameliorates Liver Dysfunction via Reducing Iron in Thioacetamide-induced Acute Liver Injury in Mice. \u003cem\u003eFront Pharmacol\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 13, 869794, https://doi.org/10.3389/fphar.2022.869794.\u003c/li\u003e\n\u003cli\u003eZhang, M.; Xue, Y.; Zheng, B.; Li, L.; Chu, X.; Zhao, Y.; Wu, Y.; Zhang, J.; Han, X.; Wu, Z.; et al. Liquiritigenin protects against arsenic trioxide-induced liver injury by inhibiting oxidative stress and enhancing mTOR-mediated autophagy. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 143, 112167, https://doi.org/10.1016/j.biopha.2021.112167.\u003c/li\u003e\n\u003cli\u003eYang, X.; Jin, Z.; Lin, D.; Shen, T.; Zhang, J.; Li, D.; Wang, X.; Zhang, C.; Lin, Z.; Li, X.; et al. FGF21 alleviates acute liver injury by inducing the SIRT1-autophagy signalling pathway. \u003cem\u003eJ Cell Mol Med\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 263, 868-879, https://doi.org/10.1111/jcmm.17144.\u003c/li\u003e\n\u003cli\u003eWang, Y.; Sun, Y.; Zuo, L.; Wang, Y.; Huang, Y. ASIC1a promotes high glucose and PDGF-induced hepatic stellate cell activation by inducing autophagy through CaMKKbeta/ERK signaling pathway. \u003cem\u003eToxicol Lett\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 300, 1-9, https://doi.org/10.1016/j.toxlet.2018.10.003.\u003c/li\u003e\n\u003cli\u003eEzhilarasan, D. Molecular mechanisms in thioacetamide-induced acute and chronic liver injury models. \u003cem\u003eEnviron Toxicol Pharmacol\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, 99, 104093, https://doi.org/10.1016/j.etap.2023.104093.\u003c/li\u003e\n\u003cli\u003eLow, T.Y.; Leow, C.K.; Salto-Tellez, M.; Chung, M.C. A proteomic analysis of thioacetamide-induced hepatotoxicity and cirrhosis in rat livers. \u003cem\u003eProteomics\u003c/em\u003e \u003cstrong\u003e2004\u003c/strong\u003e, 412, 3960-3974, https://doi.org/10.1002/pmic.200400852.\u003c/li\u003e\n\u003cli\u003eSepehrinezhad, A.; Shahbazi, A.; Sahab Negah, S.; Joghataei, M.T.; Larsen, F.S. Drug-induced-acute liver failure: A critical appraisal of the thioacetamide model for the study of hepatic encephalopathy. \u003cem\u003eToxicol Rep\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 8, 962-970, https://doi.org/10.1016/j.toxrep.2021.04.011.\u003c/li\u003e\n\u003cli\u003eFernandes, J.C.; Schemitt, E.G.; Da Silva, J.; Marroni, N.P.; Lima, A.; Ferreira, R.B. Combination of Trans-Resveratrol and epsilon-Viniferin Induces a Hepatoprotective Effect in Rats with Severe Acute Liver Failure via Reduction of Oxidative Stress and MMP-9 Expression. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 1311, https://doi.org/10.3390/nu13113677.\u003c/li\u003e\n\u003cli\u003eNaseem, S.; Hussain, T.; Manzoor, S. Interleukin-6: A promising cytokine to support liver regeneration and adaptive immunity in liver pathologies. \u003cem\u003eCytokine Growth Factor Rev\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 39, 36-45, https://doi.org/10.1016/j.cytogfr.2018.01.002.\u003c/li\u003e\n\u003cli\u003eLiu-Bryan, R. Intracellular innate immunity in gouty arthritis: role of NALP3 inflammasome. \u003cem\u003eImmunol Cell Biol\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, 881, 20-23, https://doi.org/10.1038/icb.2009.93.\u003c/li\u003e\n\u003cli\u003eWei, H.; Hu, C.; Xie, J.; Yang, C.; Zhao, Y.; Guo, Y.; Mei, Z.; Chen, L.; Lan, Z. Doliroside A attenuates monosodium urate crystals-induced inflammation by targeting NLRP3 inflammasome. \u003cem\u003eEur J Pharmacol\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, 740, 321-328, https://doi.org/10.1016/j.ejphar.2014.07.023.\u003c/li\u003e\n\u003cli\u003eFrissen, M.; Liao, L.; Schneider, K.M.; Djudjaj, S.; Haybaeck, J.; Wree, A.; Rolle-Kampczyk, U.; von Bergen, M.; Latz, E.; Boor, P.; et al. Bidirectional Role of NLRP3 During Acute and Chronic Cholestatic Liver Injury. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 735, 1836-1854, https://doi.org/10.1002/hep.31494.\u003c/li\u003e\n\u003cli\u003eGaul, S.; Leszczynska, A.; Alegre, F.; Kaufmann, B.; Johnson, C.D.; Adams, L.A.; Wree, A.; Damm, G.; Seehofer, D.; Calvente, C.J.; et al. Hepatocyte pyroptosis and release of inflammasome particles induce stellate cell activation and liver fibrosis. \u003cem\u003eJ Hepatol\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 741, 156-167, https://doi.org/10.1016/j.jhep.2020.07.041.\u003c/li\u003e\n\u003cli\u003eLatz, E.; Xiao, T.S.; Stutz, A. Activation and regulation of the inflammasomes. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, 136, 397-411, https://doi.org/10.1038/nri3452.\u003c/li\u003e\n\u003cli\u003eSeveau, S.; Turner, J.; Gavrilin, M.A.; Torrelles, J.B.; Hall-Stoodley, L.; Yount, J.S.; Amer, A.O. Checks and Balances between Autophagy and Inflammasomes during Infection. \u003cem\u003eJ Mol Biol\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 4302, 174-192, https://doi.org/10.1016/j.jmb.2017.11.006.\u003c/li\u003e\n\u003cli\u003eHuang, Z.; Zhou, X.; Zhang, X.; Huang, L.; Sun, Y.; Cheng, Z.; Xu, W.; Li, C.G.; Zheng, Y.; Huang, M. Pien-Tze-Huang, a Chinese patent formula, attenuates NLRP3 inflammasome-related neuroinflammation by enhancing autophagy via the AMPK/mTOR/ULK1 signaling pathway. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 141, 111814, https://doi.org/10.1016/j.biopha.2021.111814.\u003c/li\u003e\n\u003cli\u003eSaitoh, T.; Fujita, N.; Jang, M.H.; Uematsu, S.; Yang, B.G.; Satoh, T.; Omori, H.; Noda, T.; Yamamoto, N.; Komatsu, M.; et al. Loss of the autophagy protein Atg16L1 enhances endotoxin-induced IL-1beta production. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 4567219, 264-268, https://doi.org/10.1038/nature07383.\u003c/li\u003e\n\u003cli\u003eKe, P.Y. Diverse Functions of Autophagy in Liver Physiology and Liver Diseases. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 202, https://doi.org/10.3390/ijms20020300.\u003c/li\u003e\n\u003cli\u003eCai, Z.Y.; Yang, B.; Shi, Y.X.; Zhang, W.L.; Liu, F.; Zhao, W.; Yang, M.W. High glucose downregulates the effects of autophagy on osteoclastogenesis via the AMPK/mTOR/ULK1 pathway. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 5032, 428-435, https://doi.org/10.1016/j.bbrc.2018.04.052.\u003c/li\u003e\n\u003cli\u003eWang, F.; Cao, M.; Fan, M.; Wu, H.; Huang, W.; Zhang, Y.; Hu, Z.; Jin, X. AMPK-mTOR-ULK1 axis activation-dependent autophagy promotes hydroxycamptothecin-induced apoptosis in human bladder cancer cells. \u003cem\u003eJ Cell Physiol\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 2355, 4302-4315, https://doi.org/10.1002/jcp.29307.\u003c/li\u003e\n\u003cli\u003eHardie, D.G. AMPK and autophagy get connected. \u003cem\u003eEMBO J\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, 304, 634-635, https://doi.org/10.1038/emboj.2011.12.\u003c/li\u003e\n\u003cli\u003eMoscat, J.; Diaz-Meco, M.T. Feedback on fat: p62-mTORC1-autophagy connections. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, 1474, 724-727, https://doi.org/10.1016/j.cell.2011.10.021.\u003c/li\u003e\n\u003cli\u003eZhang, X.W.; Zhou, J.C.; Peng, D.; Hua, F.; Li, K.; Yu, J.J.; Lv, X.X.; Cui, B.; Liu, S.S.; Yu, J.M.; et al. Disrupting the TRIB3-SQSTM1 interaction reduces liver fibrosis by restoring autophagy and suppressing exosome-mediated HSC activation. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 165, 782-796, https://doi.org/10.1080/15548627.2019.1635383.\u003c/li\u003e\n\u003cli\u003eLalazar, G.; Ilyas, G.; Malik, S.A.; Liu, K.; Zhao, E.; Amir, M.; Lin, Y.; Tanaka, K.E.; Czaja, M.J. Autophagy confers resistance to lipopolysaccharide-induced mouse hepatocyte injury. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, 3113, G377-386, https://doi.org/10.1152/ajpgi.00124.2016.\u003c/li\u003e\n\u003cli\u003eWang, Z.; Li, Y.; Yang, X.; Zhang, L.; Shen, H.; Xu, W.; Yuan, C. Protective effects of rapamycin induced autophagy on CLP septic mice. \u003cem\u003eComp Immunol Microbiol Infect Dis\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 64, 47-52, https://doi.org/10.1016/j.cimid.2019.01.009.\u003c/li\u003e\n\u003cli\u003eXiu, A.Y.; Ding, Q.; Li, Z.; Zhang, C.Q. Doxazosin Attenuates Liver Fibrosis by Inhibiting Autophagy in Hepatic Stellate Cells via Activation of the PI3K/Akt/mTOR Signaling Pathway. \u003cem\u003eDrug Des Devel Ther\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 15, 3643-3659, https://doi.org/10.2147/DDDT.S317701.\u003c/li\u003e\n\u003cli\u003eLiu, Y.; Bi, Y.M.; Pan, T.; Zeng, T.; Mo, C.; Sun, B.; Gao, L.; Lyu, Z.P. Ethyl Acetate Fraction of Dicliptera chinensis (L.) Juss. Ameliorates Liver Fibrosis by Inducing Autophagy via PI3K/AKT/mTOR/p70S6K Signaling Pathway. \u003cem\u003eChin J Integr Med\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 281, 60-68, https://doi.org/10.1007/s11655-021-3298-5.\u003c/li\u003e\n\u003cli\u003eZhang, Z.; Zhao, S.; Yao, Z.; Wang, L.; Shao, J.; Chen, A.; Zhang, F.; Zheng, S. Autophagy regulates turnover of lipid droplets via ROS-dependent Rab25 activation in hepatic stellate cell. \u003cem\u003eRedox Biol\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, 11, 322-334, https://doi.org/10.1016/j.redox.2016.12.021.\u003c/li\u003e\n\u003cli\u003eDu, Q.H.; Zhang, C.J.; Li, W.H.; Mu, Y.; Xu, Y.; Lowe, S.; Han, L.; Yu, X.; Wang, S.Y.; Li, Y.; et al. Gan Shen Fu Fang ameliorates liver fibrosis in vitro and in vivo by inhibiting the inflammatory response and extracellular signal-regulated kinase phosphorylation. \u003cem\u003eWorld J Gastroenterol\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 2621, 2810-2820, https://doi.org/10.3748/wjg.v26.i21.2810.\u003c/li\u003e\n\u003cli\u003eChen, D.; Chen, J.; Chen, Y.; Chen, F.; Wang, X.; Huang, Y. Interleukin-10 regulates starvation-induced autophagy through the STAT3-mTOR-p70s6k axis in hepatic stellate cells. \u003cem\u003eExp Biol Med (Maywood)\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 24710, 832-841, https://doi.org/10.1177/15353702221080435.\u003c/li\u003e\n\u003cli\u003eBai, D.; Du, J.; Bu, X.; Cao, W.; Sun, T.; Zhao, J.; Zhao, Y.; Lu, N. ALDOA maintains NLRP3 inflammasome activation by controlling AMPK activation. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, 187, 1673-1693, https://doi.org/10.1080/15548627.2021.1997051.\u003c/li\u003e\n\u003cli\u003eWatanabe, A.; Sohail, M.A.; Gomes, D.A.; Hashmi, A.; Nagata, J.; Sutterwala, F.S.; Mahmood, S.; Jhandier, M.N.; Shi, Y.; Flavell, R.A.; et al. Inflammasome-mediated regulation of hepatic stellate cells. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 2966, G1248-1257, https://doi.org/10.1152/ajpgi.90223.2008.\u003c/li\u003e\n\u003cli\u003eQin, X.; Zhang, J.; Wang, B.; Xu, G.; Yang, X.; Zou, Z.; Yu, C. Ferritinophagy is involved in the zinc oxide nanoparticles-induced ferroptosis of vascular endothelial cells. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 1712, 4266-4285, https://doi.org/10.1080/15548627.2021.1911016.\u003c/li\u003e\n\u003cli\u003eMartinet, W.; De Meyer, G.R. Autophagy in atherosclerosis: a cell survival and death phenomenon with therapeutic potential. \u003cem\u003eCirc Res\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 1043, 304-317, https://doi.org/10.1161/CIRCRESAHA.108.188318.\u003c/li\u003e\n\u003cli\u003eMizumura, K.; Choi, A.M.; Ryter, S.W. Emerging role of selective autophagy in human diseases. \u003cem\u003eFront Pharmacol\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, 5, 244, https://doi.org/10.3389/fphar.2014.00244.\u003c/li\u003e\n\u003cli\u003eWu, Y.F.; Li, Z.Y.; Dong, L.L.; Li, W.J.; Wu, Y.P.; Wang, J.; Chen, H.P.; Liu, H.W.; Li, M.; Jin, C.L.; et al. Inactivation of MTOR promotes autophagy-mediated epithelial injury in particulate matter-induced airway inflammation. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 163, 435-450, https://doi.org/10.1080/15548627.2019.1628536.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Ginsenoside Rd, Acute liver injury, Autophagy, Inflammation, AMPK/mTOR/ULK1 pathway, thioacetamide, hepatic stellate cell line ","lastPublishedDoi":"10.21203/rs.3.rs-5176123/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5176123/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eContext:\u003c/strong\u003e Ginsenoside Rd (Rd) is a bioactive compound predominantly found in \u003cem\u003ePanax\u003c/em\u003e \u003cem\u003eginseng\u003c/em\u003e C.A. Meyer and \u003cem\u003ePanax notoginseng\u003c/em\u003e (Burkill) F.H. Chen ex C.H. Chow, both species belonging to genus Panax in the Araliaceae family. However, its hepatic protective effect against acute liver injury and related mechanistic action remain unexplored.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e To investigate the protective effect of Rd against thioacetamide (TAA)-induced acute liver injury and assess its underlying regulatory mechanisms related to autophagy and inflammation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and methods:\u003c/strong\u003e Forty-eight C57BL/6 mice were treated with saline (control or model group), Rd (12.5 mg/kg, 25 mg/kg or 50 mg/kg), and diammonium glycyrrhizinate (DG, 30 mg/kg) for three days. Then the mice were stimulated with TAA to establish acute liver injury model, excluding the control group. HSC-T6 cells were treated with Rd at concentrations of 2.5, 5, or 10 μM, for 12 hours with or without LPS stimulation at 100 ng/mL. RT-qPCR, immunofluorescence staining and Western blot were employed to analyze the expressions of genes and proteins associated with inflammation and autophagy. To validate the role of Rd in regulating autophagy and inflammation, the autophagy inducers, rapamycin and GSK621, were utilised in reverse validation experiments in cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Rd exhibited significant hepatic protective effects in mice with acute liver injury. It exhibited strong anti-inflammatory effect by reducing the gene and protein expressions of various pro-inflammatory modulators in liver tissue, and inhibited LPS-induced autophagy and inflammation in HSC-T6 cells.Rd suppressed autophagy in mice \u003cem\u003evia\u003c/em\u003e the AMPK/mTOR/ULK1 pathway. The inhibitory effects of Rd on autophagy and inflammation in HSC-T6 cells were partially blocked by rapamycin and GSK621.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiscussion and Conclusion: \u003c/strong\u003eRd is a promising therapeutic agent to protect liver against TAA-induced acute liver injury.\u003c/p\u003e","manuscriptTitle":"Ginsenoside Rd protects against acute liver injury by regulating the autophagy-NLRP3 inflammasome pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-23 09:15:11","doi":"10.21203/rs.3.rs-5176123/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-13T06:24:02+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-11T14:13:51+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-07T15:27:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"305596204197678844290324104237469296069","date":"2024-10-31T06:34:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"113223284925538396332301595316915775574","date":"2024-10-28T17:35:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-28T16:46:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-28T16:30:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-10-23T07:07:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-22T06:49:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-09-29T17:17:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"04158f21-d4d3-4144-afe6-ebff6f094d93","owner":[],"postedDate":"December 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":40190061,"name":"Biological sciences/Biochemistry"},{"id":40190062,"name":"Biological sciences/Biological techniques"},{"id":40190063,"name":"Biological sciences/Biotechnology"},{"id":40190064,"name":"Biological sciences/Cell biology"},{"id":40190065,"name":"Biological sciences/Molecular biology"},{"id":40190066,"name":"Health sciences/Biomarkers"},{"id":40190067,"name":"Health sciences/Gastroenterology"},{"id":40190068,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2025-02-03T16:03:18+00:00","versionOfRecord":{"articleIdentity":"rs-5176123","link":"https://doi.org/10.1038/s41598-025-87991-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-01-28 15:58:00","publishedOnDateReadable":"January 28th, 2025"},"versionCreatedAt":"2024-12-23 09:15:11","video":"","vorDoi":"10.1038/s41598-025-87991-9","vorDoiUrl":"https://doi.org/10.1038/s41598-025-87991-9","workflowStages":[]},"version":"v1","identity":"rs-5176123","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5176123","identity":"rs-5176123","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.