Improving Motor Function in Amyotrophic Lateral Sclerosis: The impact of Triumeq on a TDP-43 mouse model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Improving Motor Function in Amyotrophic Lateral Sclerosis: The impact of Triumeq on a TDP-43 mouse model Megan Fowler, Jillian M Carr, Julian Gold, Adam Walker, Mary-Louise Rogers This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7351593/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterised by the accumulation of TAR DNA Binding Protein (43kDa; TDP-43) within the cytoplasm of neurons. Endogenous retroviruses (ERVs) have been implicated in ALS pathology and the application of antiretroviral therapy, specifically Triumeq, has been proposed for treatment of ALS. However, evidence to support the actions of Triumeq in ALS is lacking. Methods This study utilised the doxycycline (Dox)-suppressible rNLS8 TDP-43 expression mouse model to investigate the effects of Triumeq on ALS disease pathology and progression. In this model, TDP-43 accumulation in the cytoplasm was induced after removal of Dox. Disease progression was assessed through measures of body weight, neurological score, motor function and inflammatory marker expression. Results Triumeq treatment significantly improved motor function early on in the disease course but did not impact other disease progression markers or disease endpoint. In this TDP-43 ALS mouse model, there was a positive association of TDP-43 mRNA levels with transcription factor ATF4, and inflammatory markers CXCL10 and IRF-1, and Triumeq treatment negated this association. Conclusions Triumeq treatment transiently improved motor function and influenced TDP-43 associated inflammatory gene expression in an ALS mouse model. These findings support the potential use of Triumeq in treating TDP-43-associated ALS and supports further investigation to better understand if the beneficial actions of Triumeq are via impact on ERVs or indirectly through disruption of TDP-43-driven inflammation in ALS. Amyotrophic Lateral Sclerosis Endogenous Retrovirus TDP-43 Inflammation Neurodegeneration Triumeq Antiretroviral Therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Amyotrophic lateral sclerosis (ALS) is a rapidly progressive neurodegenerative disease characterised by degeneration of the upper and lower motor neurons in the motor cortex, brain stem and spinal cord, typically leading to death within 2–5 years of diagnosis (Masrori and Van Damme, 2020 ). Excitingly, Tofersen has been recently approved as a treatment for familial superoxide dismutase 1 ( SOD1 )-linked ALS (Castelli et al., 2024 ) but the only drug therapies for sporadic ALS approved for use by the FDA (USA) and TGA (Australia) are riluzole and edaravone, which only offer a limited extension of lifespan of patients of 2–5 months (Abe et al., 2017 , Ruffo et al., 2025 ). Thus, better understanding of the mechanisms underlying sporadic ALS is needed in addition to developing more effective therapeutics. One proposed driver of ALS pathology are endogenous retroviruses (ERVs), genomic remnants of ancient viral infections that are mostly transcriptionally inactive (Hughes and Coffin, 2004 ). However, some ERVs, such as human endogenous retrovirus type K (HERV-K), retain transcriptional activity which has been associated with ALS (Garcia-Montojo et al., 2018 , Dubowsky et al., 2023 , Pasternack et al., 2024 ), for instance, with increased HERV-K transcripts found in post-mortem brain tissue from ALS patients compared to age matched controls who died from other causes, such as accidental death and Parkinson’s disease (Douville et al., 2011 ). Specifically, the HERV-K envelope (env) protein has been implicated in neurodegenerative processes in ALS (Li et al., 2015 , Steiner et al., 2022 ). One study showed that a mouse model of neuronal HERV-K env overexpression recapitulated many of the facets of ALS pathology including progressive motor dysfunction, muscle atrophy and decrease activity of pyramidal neurons (Li et al., 2015 ). A hallmark of ALS is the expression and mislocalisation of TAR DNA Binding Protein 43 kDa (TDP-43) from the nucleus to the cytoplasm, with 97% of ALS cases showing cytoplasmic localisation and aggregation of TDP-43 in neurons of the brain and spinal cord at post mortem (Cairns et al., 2007 ). Previous research has indicated TDP-43 may influence HERV-K expression, with nuclear TDP-43 binding to the HERV-K promotor and repressing HERV-K transcription (Li et al., 2015 ). Using a Drosophila model expressing TDP-43 within glial cells, results showed the glial TDP-43 aggregation increased the expression of Drosophila ERVs. This increased ERV expression in glial cells resulted in cellular release of neuronal toxic factors that induced DNA damage and neuronal death in surrounding neurons (Chang and Dubnau, 2019 ). Accordingly, antiretroviral therapy (ART), specifically Triumeq, to target ERVs has been explored as a potential treatment for ALS (Gold et al., 2019 , Garcia-Montojo et al., 2021 ). Triumeq is an efficient and well tolerated antiretroviral, used widely for treatment of human immunodeficiency virus (HIV), consisting of two nucleoside reverse transcriptase (RT) inhibitors, abacavir and lamivudine and an integrase inhibitor, dolutegravir (Walmsley et al., 2013 ). A Phase II clinical trial of Triumeq demonstrated safety and tolerability in a small cohort of patients with ALS with patients receiving Triumeq experiencing a slower clinical decline as measured by the ALS Functional Rating Scale – Revised (ALSFRS-R; Gold et al., 2019 ). Based on these promising results, Triumeq progressed to a Phase III clinical trial, known as the Lighthouse Trial (ClinicalTrials.gov Identifier: NCT06658977). During the production of this manuscript, the Lighthouse study was terminated due to interim analysis failing to identify a lack of benefit in survival measures. Notably, participants in the Lighthouse study were not pre-screened, such as selecting individuals based on HERV-K serum levels. As a result, post-hoc analysis may still reveal a benefit in a stratified population that responded to the treatment, similar to the lithium trial post hoc analysis that specifically found patients with the UNC13A genotype responded to lithium (van Eijk et al., 2017 ). Hence, Triumeq has demonstrated some potential in ALS treatment in humans, but it would be beneficial to understand potential mechanisms of Triumeq action in ALS, which may assist in targeting Triumeq to particular ALS patients who may benefit the most. There are a number of mouse models of ALS, including human TDP-43 overexpression and ALS-linked mutant SOD1 transgenic mouse models, that reflect ALS pathology including conserved biomarkers for neurodegeneration such as urinary p75 ECD , which is increased in both humans and mouse models of ALS (Shepheard et al., 2014 , Smith et al., 2015 , Shepheard et al., 2017 ). Since the SOD1 transgenic mouse model reflects familial ALS, but TDP-43 pathology is seen in a larger proportion of ALS cases, the study here utilised the neurofilament heavy chain NEFH -tTA/ tetO -hTDP-43 ΔNLS (hTDP-43 ΔNLS ) ‘rNLS8’ mouse model which features a Doxycycline (Dox)-suppressible human TDP-43 expression system (Walker et al., 2015 ). In this model, the nuclear localisation sequence of hTDP-43 is ablated, resulting in expression and localisation of human TDP-43 to the cytoplasm in neurons and followed by neurodegenerative pathology resembling human ALS (Walker et al., 2015 ). Our aim was to determine if Triumeq affects neurodegeneration and immune dysfunction in this inducible TDP-43 mouse model of ALS. Materials and Methods Animal welfare and monitoring All experiments involving mice were reviewed and approved by the Flinders University Animal Welfare Committee (Ethics #2931) under the National Health and Medical Research Council, Australian code for the care and use of animals for scientific purposes. rNLS8 TDP-43 transgenic mice (hTDP-43 ΔNLS ) were bred at the University of Queensland (UQ Animal Ethics Committee approval 2021-AE000200). Prior to the start of the experiments, mice were fed chow containing 200 mg/kg Dox (Dox Diet, Specialty Feeds, Australia). On day one of the experiments, they were switched to standard chow without Dox. Towards end-stage disease, mice were given easier access to food and water through soaked food. Control mice were either non-transgenic C57BL/6J mice, which were age and gender-matched to the transgenic mice, bred at the Flinders Medical Centre Animal House (Ethics #2931) or single transgenic littermate controls (LMC) negative for the NEFH-tTA transgene, bred alongside the rNLS8 double transgenic mice at the University of Queensland. Mice were monitored daily between 0900 and 1100h and assigned to cohort 1 or cohort 2. Cohort 1 mice were euthanised after 15–19 days after Dox removal and cohort 2 euthanised at approximately 30 days after Dox removal, based on a disease end-point. Disease end-point was defined as ≥ 15% weight loss or two consecutive days of a neurological score of 3 or above as defined by delayed righting reflex and minimal hindfoot grasping (Adapted from Leitner et al .,2009). Mice were weighed and assessed daily. Triumeq administration On day one, mice were switched to standard chow (without Dox) and given either Triumeq (n = 21) or vehicle control (n = 23). The adult dose of Triumeq (ViiV Healthcare) contains 600 mg abacavir, 50 mg dolutegravir, and 300 mg lamivudine. Based on this, an equivalent scaled dose of 12.7 mg crushed Triumeq was mixed into 1.5 g of peanut butter and provided for oral consumption daily. This dosing approach follows the protocol described by Hu et al. ( 2017a ) and aligns with the methodology used in the Lighthouse involving individuals with ALS (Gold et al., 2019 ). Control mice received 1.5 g peanut butter without Triumeq. Treatment continued daily until the timepoints specified in Fig. 3 A. Assessment of motor function Motor function was assessed through grip duration using the wirehang test, as previously described in Crawley ( 1999 ) and Miana-Mena et al. ( 2005 ). Latency to fall was averaged from three measures per mouse with a rest time of one minute in between trials. The cut-off time was set to 180 seconds. Gait was evaluated via stride length using a modified gait analysis test (Wertman et al., 2019 ). Hindlimbs were marked with a food-safe blue food colouring and walked across a 60 cm length of paper toward an enclosed space with access to food. Each mouse completed two trials with a 60-second break between trials. Stride length was measured from the centre of one hindlimb print to the next. Perfusion and tissue collection Mice were anesthetised with isoflurane (Zoetis) and perfused with sodium nitrate and Zamboni’s fixative as previously (Smith et al., 2015 ). Spinal cords and brains were extracted and stored in Zamboni’s fixative overnight at 4°C and cryoprotected using 30% sucrose (w/v) in phosphate-buffered saline (PBS). Spinal cord sections and brain sections were snap-frozen in optimal cutting temperature (OCT) media. The tissue was sectioned with a Cryostat (Leica) into 30 µm sections for spinal cord tissue and 50 µm sections for the brain tissue. Tissue sections were stored in 1X PBS with 0.1% sodium azide and stored at 4°C until use for immunofluorescent analysis. Mouse urine collection and p75 analysis Mice were placed in a plastic cage and light pressure was applied to the caudal area of the back with a thumb and forefinger to stimulate urine release, adapted from Chew and Chua ( 2003 ). Urine was collected immediately and stored in a microcentrifuge tube (Axygen). Samples were centrifuged at 2000 x g for 5 minutes before storage at -80°C until urinary p75 ECD analysis as previous (Shepheard et al., 2014 ). An ELISA was performed for mouse urinary p75 ECD detection, as previously described and validated (Shepheard et al., 2014 ). In brief, 8 µg/mL mouse anti-human p75 MLR1 capture antibody was utilised prior to addition of mouse urine samples diluted to 2.5% v/v and 1.25% v/v in sample buffer (5% v/v 20x PBS, 0.05% v/v Tween-20, 0.01% w/v Thimerosal, 2% w/v bovine serum albumin, pH = 7.3). 1 µg/mL goat anti-mouse p75 antibody (Sigma Aldrich Australia) was used as the detection antibody followed by 1 µg/mL biotinylated bovine anti-goat (Jackson ImmunoResearch Laboratories). 1 µg/mL Streptavidin Horse Radish Peroxidase (HRP; Jackson ImmunoResearch Laboratories) was added and colourmetric detection was completed using the 3,3’,5,5’-Tetramethylbenzidine colour substrate kit (TMB; BioRad Australia) and measured at 450 nm (Perkin Elmer Victor X4 Multilabel Plate Reader). Urinary p75 ECD values were normalised to creatinine as determined by a creatinine kit, as per manufacturer’s instructions (Enzo Life Sciences). RNA extraction and RT-qPCR Total RNA was extracted from mice brain tissue homogenised with Trizol® Reagent (Invitrogen). RNA was treated with DNAse I and 500 ng of purified RNA was reverse transcribed with 30 µM of random hexamers (New England Biolabs; NEB) followed by a mix of 10 U Moloney Murine Leukaemia Virus (M-MuLV) reverse transcriptase (NEB), 200 µM dNTPs (NEB), 10 U RNase inhibitor (NEB) and 1X M-MuLV reaction buffer (NEB). The cDNA was diluted and used for PCR analysis. cDNA samples, iTaq Universal SYBR green (BioRad), and forward and reverse primers, described in Table 1 were cycled using a Rotor-gene Q PCR cycler (Qiagen). Samples were assayed in duplicate and heated to 95°C for 5 mins and then cycled 40 times at 95°C for 15 secs, 59°C for 30 secs and 72°C for 30 secs followed by one cycle of 72°C for 5 mins and a melt profile analysis. A negative control of H 2 O and a no template was concurrently performed. Results were normalised to the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with values calculated according to the double delta Ct method (Rao et al., 2013 ). Immunofluorescence Cryosections as described above in perfusion and tissue collection, were washed in filtered PBS 4 x 15 mins to remove excess OCT. Sections were blocked in 10% (v/v) donkey serum (Sigma Aldrich) overnight at 4°C and incubated with primary antibody solution containing antibody diluent reaction solution (ADRS; Sigma Aldrich) and 1% donkey serum and co-stained with mouse anti-NeuN (1:1000; ProteinTech) and rabbit anti-hTDP-43 (1:2000; ProteinTech #10782-2-AP), overnight at 4°C. Sections were washed 4 x 15 mins with filtered 1x PBS and placed in secondary antibody solution containing donkey anti-mouse Alexa 649 (1:800) and donkey anti-rabbit Alexa 488 (1:800) in ARDS with 1% donkey serum. Sections were washed 4 x 15 mins with filtered 1x PBS before being mounted onto slides with Fluoromount (Thermo Fisher Scientific) and covered with a coverslip. After drying, sections were viewed on a BX50 fluorescence microscope (Olympus) and captured using Zen Blue 3.0 software (Zeiss). Statistical Analysis Results were expressed as the mean ± standard error of measurement (SEM) and statistical analysis was performed using a non-parametric Mann-Whitney U test, one-way or two-way analysis of variance (ANOVA). Statistical analysis was performed using Prism v10 (GraphPad). Differences were considered statistically significant if p < 0.05. Table 1 Primer sequences used for PCR amplification Primer Species Accession Number Sequence Forward (F) and Reverse (R) Amplicon Size (base pair) TARDBP Human NM_007375.4 F: GTACGGGGATGTGATGGATG R: CTGCGCAATCTGATCATCTG 85 GAPDH Mouse NM_008084.3 F: GACGGCCGCATCTTCTTGTGC R: TGCCACTGCAAATGGCAGCC 120 IFN-β Mouse NM_010510.1 F: AGAAAGGACGAACATTCGGAAA R: CCGTCATCTCCATAGGGATCTT 104 MMTV Mouse AF243039.1 F: GATGGTATGAAGCAGGATGG R: AAGGGTAAGTAACACAGGCAGATGTA 248 IL-6 Mouse NM_031168.2 F: GAGGATACCACTCCCAACAGACC R: AAGTGCATCATCGTTGTTCATACA 141 CXCL10 Mouse NM_021274.2 F: GCCGTCATTTTCTGCCTCAT R: GGCCCGTCATCGATATGG 101 TNF Mouse NM_013693.3 F: CATCTTCTCAAAATTCGAGTGACAA R: TGGGAGTAGACAAGGTACAACCC 175 CCL12 Mouse NM_011331.3 F: ATTTCCACACTTCTATGCCTCCT R: ATCCAGTATGGTCCTGAAGATCA 204 ATF4 Mouse NM_001287180.1 F: ATGGCCGGCTATGGATGAT R: CGAAGTCAAACTCTTTCAGATCCATT 113 Ifi27l2a Mouse NM_029803.3 F: CTGTTTGGCTCTGCCATAGGAG R: CCTAGGATGGCATTTGTTGATGTGG 227 IRF-1 Mouse NM_001159393.1 F: CAGAGGAAAGAGAGAAAGTCC R: CACACGGTGACAGTGCTGG 208 NeuN Mouse NM_001039167 F: CACCACTCTCTTGTCCGTTTGC R: GGCTGAGCATATCTGTAAGCTGC 100 Results Removal of Dox induces cytoplasmic TDP-43, increases urinary p75 ECD and inflammatory marker expression in hTDP-43 ΔNLS mice To validate the expression and mislocalisation of human TDP-43 (hTDP-43) in the hTDP-43 ΔNLS mice, immunofluorescence of cortical brain sections from non-transgenic control mice and the hTDP-43 ΔNLS mice was assessed. Brain sections were stained with anti-human TDP-43 (red) and NeuN (green) as a neuronal marker. An example of a brain section from a C57Bl/6J non-transgenic control mouse is shown in Fig. 1 A, where no red fluorescence indicates a lack of hTDP-43. In contrast, the cortical brain sections from the hTDP-43 ΔNLS mice after 15 and 30 days post-Dox removal (Fig. 1 A ) show hTDP-43 expression as well as mislocalisation of hTDP-43 from the nucleus to the cytoplasm with the hTDP-43 shown surrounding the NeuN-labelled neuronal nuclei. p75 ECD was quantitated by ELISA, demonstrating a significant increase in the level of urinary p75 ECD between hTDP-43 ΔNLS mice on Dox (n = 8) and 6 weeks off Dox (n = 27; p = 0.0329), Fig. 1 B. There were no significant differences between the hTDP-43 ΔNLS mice on Dox and 2 weeks off Dox (n = 25; p = 0.983) or 4 weeks off Dox (n = 11; p = 0.0949). However, there was a trend towards an increase in the levels of urinary p75 ECD over time following the removal of Dox. A panel of inflammatory chemokines and cytokines that have been previously shown to be involved in ALS-associated neurodegeneration (Hu et al., 2017b , Tortelli et al., 2020 , Luan et al., 2023 ), along with hTDP-43 and mouse mammary tumour virus (MMTV), were analysed from brain tissue from hTDP-43 ΔNLS mice, off Dox for 4 weeks (n = 6) and LMC (n = 4). As expected, Fig. 2 A shows significantly higher expression of human TARDBP (the gene encoding TDP-43) in the hTDP-43 ΔNLS mice off Dox for 4 weeks compared to the littermate controls (LMC; p = 0.002). MMTV was analysed as a measure of a well described transcriptionally active mouse endogenous retrovirus (Stocking and Kozak, 2008 , Li et al., 2012 ). mRNA levels were not significantly different between hTDP-43 ΔNLS mice and LMC mice, although again, there was a trend towards increased levels in some animals (Fig. 2 B; p = 0.174). There was no significant difference in the expression levels of activating transcription factor 4 (ATF4; Fig. 2 C; p = 0.4762) between hTDP-43 ΔNLS mice and the LMC although a trend towards increased ATF4 was apparent in some hTDP-43 ΔNLS animals. mRNA levels of a panel of inflammatory mediators (Fig. 2 D) were assessed including tumour necrosis factor (TNF), interferon alpha-inducible protein 27 like 2A (Ifi27l2a), C-X-C motif chemokine ligand 10 (CXCL10), C-C motif chemokine ligand 12 (CCL12), interleukin 6 (IL-6) and interferon regulatory factor 1 (IRF-1). mRNA levels of TNF (Fig. 2 D; p = 0.0381), Ifi27l2a (Fig. 2 D; p = 0.0190), CXCL10 ( Figure. 2D ; p = 0.0095) and CCL12 ( Figure. 2D ; p = 0.0476) were significantly higher in the hTDP-43 ΔNLS mice 4 weeks off Dox, compared to the LMC mice. mRNA levels of IL-6 (Fig. 2 D; p = 0.7619) and IRF-1 (Fig. 2 D; p = 0.6095) was not significantly different between hTDP-43 ΔNLS mice and LMC although, similar to ATF4, a trend towards increased levels of IL-6 was apparent in some hTDP-43 ΔNLS animals. Interferon beta (IFN-β) was also analysed but was not reliably detected in these animals (data not shown). These findings show that Dox-removal in this mouse model induces TDP-43 pathology, increasing levels of urinary p75 ECD and induces an inflammatory response. Triumeq treatment transiently improves motor function in hTDP43 ΔNLS mice The therapeutic benefit of Triumeq in the hTDP-43 ΔNLS mouse model of ALS was investigated. Following removal of Dox to induce disease, mice were treated with Triumeq for 15–19 days (n = 21) or 30 days (n = 8) or vehicle treated for 15–19 days (n = 23) or 30 days (n = 8), outlined in the disease timeline in Fig. 3 A. LMC mice were also treated with Triumeq (n = 4) or untreated (n = 4) for 30 days. To assess the effects of Triumeq on motor function, the inverted grid test and stride length measured through gait analysis were performed at multiple time points across the experimental study. The littermate control mice, regardless of Triumeq treatment, consistently stayed on the grid up until the cut-off time of 180 seconds. The Triumeq treated (n = 21) and untreated (n = 23) hTDP-43 ΔNLS mice showed the first reduction in latency to fall on day 15 of the study which was followed by a significant reduction in the latency to fall by day 17 (Fig. 3 B ) . On day 17, there was a significant difference between the Triumeq treated (n = 21) and untreated (n = 23) hTDP-43 ΔNLS mice with the Triumeq treated mice showing a significantly longer latency to fall time compared to the untreated mice ( p < 0.0001). While there was a trend for a longer latency to fall for the Triumeq treated group from day 17 through to day 28, this was not significantly different at any other time point in the study. Stride length was also used as another measure of motor function, completed on day 1, 8, 15, 22 and 27 of the study. There were no significant differences between Triumeq treated (n = 7) and untreated (n = 5) hTDP-43 ΔNLS mice on day 1, day 8 or day 27. However, consistent with the improved motor function as assessed by latency to fall (Fig. 3 B), there was a significantly longer stride length in the Triumeq treated mice on day 15 (Fig. 3 C; p = 0.0375) and day 22 ( p = 0.0445) compared to the untreated mice. Triumeq treatment does not alter disease onset or disease progression as assessed by weight loss and neurological score The data above suggested a benefit to motor function in early disease in hTDP-43 ΔNLS mice treated with Triumeq and next, weight loss, which has been shown previously to change over disease in this mouse model of ALS (Walker et al., 2015 ) was assessed (Fig. 4 A). As expected, there was a significant difference between the littermate control mice and the hTDP-43 ΔNLS mice at the end of the study course ( p < 0.0001) showing induction of the disease in the hTDP-43 ΔNLS mice after Dox removal. Additionally, Triumeq treatment itself did not affect weight, with no significant difference between the LMC mice on Triumeq treatment (n = 4) and the untreated LMC mice (n = 4; p > 0.05). Lastly, there was no significant difference in weight between the Triumeq treated and untreated hTDP-43 ΔNLS mice on any day of the study ( p > 0.05). Further disease progression measures included a neurological score, a 4-point scale assessing motor function of the hindlimbs. Unsurprisingly, the LMC mice, either Triumeq treated or untreated, did not score on the neurological score scale at any point in the study course (Fig. 4 B). The Triumeq-treated and untreated hTDP-43 ΔNLS mice, however, had an increased on neurological score due to progressive loss of hindlimb function and a slow righting reflex. There was no significant difference between the treated and untreated hTDP-43 ΔNLS mice according to neurological score at any point in the disease course. However, end stage disease was met due to reaching ethical weight loss and the neurological score did not reach ethical end point during the course of these experiments. Triumeq does not influence expression of inflammatory markers Figure 2 demonstrates that the hTDP-43 ΔNLS model of ALS is associated with induction of a number of inflammatory markers. Next, the impact of Triumeq on mRNA levels of TDP-43, MMTV, ATF4 and inflammatory chemokine and cytokines were analysed in cortical brain tissue from mice collected at 19 days post-treatment onset, a timepoint that coincided with improved motor function. Expression levels were compared among Triumeq treated hTDP-43 ΔNLS mice (n = 11) and untreated hTDP-43 ΔNLS mice (n = 13). There was a significantly higher mRNA level of TDP-43 in treated mice compared with untreated mice (Fig. 5 A; p = 0.0366). There were no significant differences between treated and untreated mice for expression of MMTV (Fig. 5 B; p = 0.549 ) , ATF4 (Fig. 5 C; p = 0.552) or any of the panel of inflammatory markers analysed (Fig. 5 D). The significant increase in TDP-43 in Triumeq treated mice was unexpected, given that TDP-43 is not driven by its endogenous promoter. However, TDP-43 is expressed via the NEFH promoter, specifically in neurons. Hence, the levels of a neuronal marker, NeuN, was analysed to determine if the higher expression of TDP-43 in the Triumeq treated mice was due to an increased number of TDP-43 expressing neurons as a result of protection of these mice from neurodegeneration. There were no significant differences in the expression of NeuN between the Triumeq treated and untreated mice (Fig. 6 A; p = 0.99). However, analysis of the relationship between TDP-43 and NeuN expression found a significant correlation between TDP-43 and NeuN in untreated mice (Fig. 6B; R 2 = 0.489, p = 0.024), that was not found between in TDP-43 and NeuN after Triumeq treatment (Fig. 6B; R 2 = 0.183, p = 0.217). To assess the relationship between TDP-43 and inflammation at the 19 day disease timepoint, the correlation between TDP-43 mRNA expression and the panel of inflammatory markers for Triumeq treated and untreated mice was analysed, as shown in Table 2 , Fig. 7 . The relationship between TDP-43 and ATF4 was significantly correlated in the untreated hTDP-43 ΔNLS mice (Fig. 7 A; R 2 = 0.462, p = 0.030) but was not significantly correlated in the Triumeq treated hTDP-43 ΔNLS mice (Fig. 7 A; R 2 = 0.018, p = 0.705). Similarly, there was a strong, significant correlation between TDP-43 and IRF-1 (Fig. 7 B; R 2 = 0.619, p = 0.006) and TDP-43 and CXCL10 (Fig. 7 B; R 2 = 0.584, p = 0.010) in the untreated hTDP-43 ΔNLS mice, with no significant correlation in the Triumeq treated hTDP-43 mice. While there was no correlation between TDP-43 and TNF in the untreated mice, there was a moderate, significant correlation between TDP-43 and TNF (Fig. 7 B; R 2 = 0.449 p = 0.033) in the Triumeq treated mice. There was a strong, significant correlation between CXCL10 and IRF-1 in both Triumeq treated (Fig. 7 C; R 2 = 0.633, p = 0.010) and untreated mice (Fig. 7 C; R 2 = 0.849, p < 0.001). Table 2 Correlation analysis between TDP-43, ATF4, MMTV and inflammatory markers. Significant correlations are highlighted in green text Untreated Triumeq treated Figure reference TDP-43 and ATF-4 R 2 = 0.462, p = 0.030 R 2 = 0.018, p = 0.705 Figure 7 A TDP-43 and IRF-1 R 2 = 0.619, p = 0.006 R 2 = 0.193, p = 0.203 Figure 7 B TDP-43 and CXCL10 R 2 = 0.584, p = 0.010 R 2 = 0.057, p = 0.505 Figure 7 B TDP-43 and NeuN R 2 = 0.489, p = 0.024 R 2 = 0.1828, p = 0.217 Figure 6 B TDP-43 and TNF R 2 = 0.004, p = 0.860 R 2 = 0.449, p = 0.033 Figure 7 B TDP-43 and MMTV R 2 = 0.344, p = 0.075 R 2 = 0.01, p = 0.798 Data not shown TDP-43 and CCL12 R 2 = 0.087, p = 0.476 R 2 = 0.357, p = 0.068 Data not shown TDP-43 and Ifi27l2a R 2 = 0.303, p = 0.090 R 2 = 0.278, p = 0.117 Data not shown TDP-43 and IL-6 R 2 = 0.147, p = 0.272 R 2 = 0.100, p = 0.363 Data not shown CXCL10 and IRF-1 R 2 = 0.849, p < 0.001 R 2 = 0.633, p = 0.010 Figure 7 C Discussion Despite substantial global research efforts, sporadic ALS remains an incurable disease. The current treatment landscape of sporadic ALS provides dismal results for motor improvement or increases to survival time for ALS patients, highlighting the need for new treatment options. ERVs and their reactivation have been linked to ALS and, therefore, controlling ERVs could be a therapeutic avenue for reducing neurodegeneration occurring in ALS (Li et al., 2022 ). ART, specifically Triumeq, to target ERVs was being investigated as a treatment for ALS in a Phase III clinical trial after a Phase II trial showed promising outcomes for reducing HERV-K in serum of ALS patients (Gold et al., 2019 ). Although the Phase III trial was discontinued after failing to demonstrate a survival benefit, post-hoc analysis with stratification is yet to be completed to determine if any patients, such as those with higher initial serum HERV-K, responded to the treatment. This post-hoc analysis may reveal responders, such as with the lithium trials for ALS and, more recently, Tofersen (van Eijk et al., 2017 , Miller et al., 2022 ). The central aims of this study were to determine if Triumeq, as potentially beneficial for ALS patients, offers any benefit in a TDP-43 mouse model of ALS, and to investigate whether these effects are associated with changes in inflammatory markers or with altered expression of mouse ERV, MMTV. Following induction of TDP-43 expression and its mislocalisation to the cytoplasm to induce disease, our results demonstrate a significant improvement in motor function at 15–19 days in mice treated with Triumeq. This time point represents early disease and coincides with the onset of weight loss and motor function decline, which are characteristic signs of ALS in this hTDP-43 ΔNLS mouse model. The hTDP-43 ΔNLS mouse model has been previously validated to reflect ALS pathology (Walker et al., 2015 ). In this model, there is a reduction in weight after Dox removal, the presence of hindlimb dysfunction, referred to as the neuroscore in the current study and the motor decline has been well described. Furthermore, this model recapitulates a hallmark of ALS pathology, the TDP-43 inclusions and cytoplasmic mislocalisation. Using this model, Luan et al. ( 2023 ) described inflammatory markers upregulated in the brain and spinal cord of hTDP-43 ΔNLS mice compared to control mice, with CCL12, ATF4, TNF and IL-6 being significantly upregulated at 2 and 4 weeks off Dox. Furthermore, Hunter et al. ( 2021 ) found increased gene expression of CXCL10, analysed through RNAseq, occurred early in the disease process and remained at an increased level through late stage disease. Given that IRF-1 is a known regulator of CXCL10 and their expression levels are correlated, the study herein also measured IRF-1 levels and analysed the correlation with CXCL10. A previous study outlined the antiviral effects of an interferon stimulated gene (ISG), Ifi27l2a, in response to exogenous viral infection in neurons (Cho et al., 2013 ). Hence, in the current study, the expression of ifi27l2a was examined to assess its induction in the TDP-43 mouse model and to determine any expression changes after Triumeq treatment. Hence, previous findings and the results presented herein suggest that neuroinflammation is a key pathological feature of TDP-43-related disease. In this study, the expression and mislocalisation of human TDP-43 in the hTDP-43 ΔNLS mouse model was demonstrated, shown by significantly higher hTDP-43 mRNA levels and protein mislocalisation from the nucleus to the cytoplasm. In a separate cohort, the urinary p75 ECD levels were analysed in hTDP-43 ΔNLS mice on Dox and off Dox for 2, 4 and 6 weeks with an increase in the levels of urinary p75 ECD as the time off Dox increased and a significant increase by 6 weeks off Dox. Previous studies in this mouse model have shown onset of motor symptoms by 2 weeks off Dox following by significant motor decline by 4 weeks Dox (Walker et al., 2015 ). Although there is not a significant increase in p75 ECD between the on Dox group and 2 and 4 weeks off Dox, it is trending towards an increase from 2 weeks off Dox indicating motor neuron death at this point in the disease timeline and coincides with a decline in motor function. In the SOD1 G93A mice, urinary p75 ECD can be detected prior to the onset of motor symptoms (Shepheard et al., 2014 ). However, the SOD1 G93A mouse model is a much more aggressive mouse model with changes in motor neurons occurring from 7 days of age but no overt symptoms present until 100–120 days of age (Smith et al., 2015 ). This means that motor neuron death is occurring early in the SOD1 mouse model, compared to the inducible hTDP-43 ΔNLS mouse model where motor neuron death only occurs after TDP-43 is induced for 6–8 weeks in adulthood (Walker et al., 2015 ). Since urinary p75 ECD in SOD1 G93A mice is associated with significant motor neuron death (Shepheard et al., 2014 , Smith et al., 2015 ), our results in the hTDP-43 ΔNLS mice support a model where loss of lower motor neurons do not occur until about 6 weeks off Dox. Upregulation of inflammatory markers has been well characterised in ALS with increases in chemokines and cytokines such as TNF, CXCL10, interleukins and interferons found to be elevated in ALS patients compared to healthy controls (Tortelli et al., 2020 ). mRNA expression levels of transcription factor, ATF4, and a panel of inflammatory markers were analysed in brain tissue from hTDP-43 ΔNLS mice 30 days after Dox removal. There was a trend towards an increase of ATF4 and MMTV expression in the hTDP-43 ΔNLS mice, but expression was not significantly different to LMC mice, although significant increase in ATF4 levels has been shown in this model previously from as early as 1 week off Dox (Luan et al., 2023 ). A mouse endogenous retrovirus (MERV), MMTV, was chosen as a measure of ERV expression (Subramanian et al., 2011 ) but was not induced in this model. However, this does not exclude other MERVs from being induced or involved, especially considering the number of active ERVs present in the mouse genome (Stocking and Kozak, 2008 ). Significant upregulation of inflammatory markers TNF, CXCL10, and Ifi27l2a and CCL12 was observed. The TDP-43-assocaited increases in these chemokines and cytokines is thought to occur through multiple pathways. For instance, cytoplasmic TDP-43 aggregation is thought to cause activation of microglia to a pro-inflammatory phenotype (Swanson et al., 2025 ) and subsequent release of cytokine and chemokines such as CXCL10 and TNF (Zhao et al., 2015 ). Although IL-6 did not show a significant increase, there was a trend toward higher expression in hTDP-43 ΔNLS mice. There are limited therapeutics available that have shown motor function improvement for ALS (Lu et al., 2024 ). Riluzole, an approved therapeutic for ALS, does not show motor function improvement in human ALS or in mice models of ALS but does have a moderate impact on survival for ALS patients (Lacomblez et al., 1996 , Hogg et al., 2018 , Wright et al., 2021 , Lu et al., 2024 ). Using the SOD1 G93A mouse model, there have been many pre-clinical studies investigating potential treatments that have not translated to human trials (De Cock et al., 2024 ). An example of such trial is the use of a rho kinase inhibitor, Fasudil, which was found to increase both the survival time and motor function in the treated mice (Tönges et al., 2014 ). This improvement in motor function was correlated with a decrease in the release of pro-inflammatory mediators including TNF and CCL2 which lead to a phase II study (Koch et al., 2024 ). In the current study, the influence of Triumeq on weight loss, neuroscore, motor function, and mRNA expression for a panel of inflammatory markers was investigated. No significant effects of Triumeq on weight loss or neuroscore were observed at any timepoint. However, a significant effect of Triumeq on motor function was seen at the 15–19 day timepoint, with significantly higher latency to fall for the Triumeq-treated mice. This also coincided with a significant difference in stride length between the Triumeq treated and untreated mice. The small benefit of delaying motor decline from Triumeq treatment shown here is promising for human ALS patients for two reasons. First, current ALS treatments, Riluzole and Edaravone, which moderately improve survival, have shown no effect in mouse models, including the hTDP-43 ΔNLS model used here (Hogg et al., 2018 , Wright et al., 2021 ). Thus, the modest improvement seen in mice could translate to greater benefits in humans. Second, while survival was unaffected in our study due to the mice reaching ethical end-point according to weight loss, improved motor function could enhance the quality of life for ALS patients. For the mRNA expression analysis, that were no significant differences between the Triumeq treated and untreated mice for any gene except for TDP-43. For TDP-43, Triumeq treated mice had higher expression of hTDP-43 compared to untreated mice with further analysis showing this difference was not due to a difference in a marker of neurons and hence potential neuronal survival. However, this finding raises the possibility that Triumeq may not significantly influence TDP-43 at the mRNA level, though it could potentially play a role in reducing the formation of TDP-43 protein aggregates. In untreated mice, there was a significant correlation between expression of TDP-43 and a neuronal marker, NeuN, which was negated by Triumeq treatment. Our study also assessed the levels of a mouse endogenous retrovirus, MMTV, after Triumeq treatment. There was not a significant difference in the MMTV expression between treatment groups, suggesting that Triumeq does not affect this particular MERV at this disease stage, potentially improving motor function independent of MERV activity. Future studies should expand on this by exploring the expression of additional MERVs. While there were no expression differences between Triumeq treated and untreated mice for ATF4, MMTV or inflammatory markers, the correlation analysis of TDP-43 and the inflammatory markers suggests an influence of Triumeq on inflammatory pathways. A correlation between TDP-43 expression and expression of ATF4, CXCL10, and IRF-1 was observed in the untreated mice, which was not seen in the Triumeq-treated mice. There was, however, a consistent correlation between CXCL10 and IRF-1 regardless of treatment group. While Triumeq did not influence the correlation between CXCL10 and IRF-1, it did disrupt the correlation between TDP-43 and CXCL10 expression. This finding suggests that Triumeq may interrupt TDP-43-dependent CXCL10 expression. CXCL10 is an inflammatory cytokine involved in T-cell recruitment, with T-cell infiltrate found within the brain and spinal cord of ALS patients and other TDP-43 mouse models (Engelhardt et al., 1993 , Garofalo et al., 2020 , Garofalo et al., 2022 ). T-cells have also been shown to have direct cytotoxic contact with motor neurons in ALS, potentially involved in neurodegenerative processes (Coque et al., 2019 ). With CXCL10 found to be significantly upregulated in this model, a measure of cellular infiltrate would allow for determination of whether Triumeq is influencing this mechanism, resulting in the direct impact on motor function in this model. Furthermore, with CXLC10 expression associated with microglia activation in neurodegeneration (Hunter et al., 2021 ) and after viral infection (Chai et al., 2015 ), the trend towards the lower levels of CXCL10 in the Triumeq-treated group could suggest Triumeq is influencing microglia activation, which remains to be investigated. This disrupted association was also found between TDP-43 and ATF4. As previously described, TDP-43 pathology drives inflammation in ALS. TDP-43 pathology is also associated with ATF4, a key player in the unfolded protein response (UPR; Pakos-Zebrucka et al., 2016 ), which has been shown to be dysregulated in ALS (Matus et al., 2013 ). ATF4 upregulation results in autophagy mechanisms which aid in the clearance of TDP-43 aggregates formed in the cytoplasm (Chu et al. , 2023). However, with aberrant formation of TDP-43 aggregates, this clearance system can be overloaded and result in dysfunctional proteostasis and cell death (Mukherjee et al., 2020 ). Furthermore, ATF4 acts as a transcription factor for genes involved in the inflammatory response (Iwasaki et al. , 2013) and binds to the long terminal repeat (LTR) of human immunodeficiency virus 1 (HIV-1), regulating its transcription (Corne et al., 2024 ). While binding sites for ATF4 on the consensus HERV-K LTR have not been established, binding sites for nuclear factor kappa-light-chain-enhancer of activated B cells (NF-ĸB) are present in the HERV-K LTR and regulate transcription (Manghera and Douville, 2013 , Manghera et al., 2016 ). During the unfolded protein response, increases of ATF4, can result in transcription for genes involved in inflammatory response and activate NF-ĸB (Tam et al., 2012 , Schmitz et al., 2018 ), potentially resulting in regulation of HERV-K transcription. The loss of correlation between TDP-43 and ATF4 following Triumeq treatment suggests that Triumeq may disrupt the association between TDP-43 and ATF4, outlined in Fig. 8 , though it does not appear to act by directly influencing ATF4 or TDP-43 mRNA expression levels. This could be occurring through disruption of the association between TDP-43 aggregation and inflammation or by disruption of ATF4-driven transcription of inflammation or ERVs. There are caveats of the current study that should be noted. Firstly, the mouse model uses a TDP-43 expression system with a defective nuclear localisation sequence. Therefore, TDP-43 will localise to the cytoplasm regardless of therapeutic intervention, complicating the assessment of Triumeq’s effects on TDP-43 pathology, as it occurs in human ALS. The study, unfortunately, had lower sample numbers towards the end of the study at day 22–30 due to ethical euthanasia and the numbers were lower than the suggested guidelines for mouse studies in ALS (Ludolph et al., 2010 ). Future studies with greater numbers should also include measures of motor neuron count and muscle fibre analysis to provide further explanation of the motor function increase in the Triumeq treated hTDP-43 ΔNLS mice. Due to the motor function benefit seen herein, future investigations could include combination therapies to increase the therapeutic benefit of Triumeq, including combinations of anti-inflammatories or other current FDA approved therapeutics for ALS such as Riluzole. Future studies should also investigate the individual components of Triumeq to determine which are responsible for the observed motor function benefits in this study. Notably, a previous study in aged mice with elevated MMTV expression reported improved motor function through enhanced grip strength following treatment with Abacavir only, one component of Triumeq (Liu et al., 2023 ). A further caveat of the current study is the lack of direct measurement of Triumeq concentrations within the brain of Triumeq-treated mice. As such, it remains unclear whether the administered dose achieved therapeutic levels sufficient to have antiretroviral effects within the central nervous system (CNS). However, prior studies have shown that the individual components of Triumeq are capable of penetrating the CNS (Capparelli et al., 2005 , Letendre et al., 2008 , Gubernick et al., 2016 ) and comparable dosing regimens have been used in previous murine studies (Hu et al., 2017a , Chen et al., 2021 ). Conclusions In summary, we provide evidence for Triumeq improving motor function in an ALS mouse model. Our study also shows an influence of Triumeq on the association between TDP-43 expression and expression of inflammatory markers that have been previously associated with ALS. While further elucidation of the mechanism of action of Triumeq for ALS needs to be considered, the findings here provide support for further scrutiny on the use of Triumeq treatment for ALS. Abbreviations ALS : Amyotrophic Lateral Sclerosis ERVs : Endogenous retroviruses TDP-43 : TAR DNA Binding Protein (43kDa) ATF4 : Activating Transcription Factor 4 CXCL10 : C-X-C motif chemokine ligand 10 IRF-1 : Interferon regulatory factor 1 HERV-K : Human endogenous retrovirus type K Env: Envelope RT : Reverse transcriptase HIV : Human immunodeficiency virus ART : Antiretroviral therapy ALSFRS-R : Amyotrophic lateral sclerosis functional rating scale – revised p75 ECD : Extracellular domain of p75 Dox: Doxycycline LMC : Littermate control PBS : Phosphate-buffered saline OCT : Optimal cutting temperature GAPDH: Glyceraldehyde-3-phosphate dehydrogenase SEM : Standard error of measurement PCR: Polymerase chain reaction MMTV : Mouse mammary tumour virus TNF : Tumor necrosis factor Ifi27l2a : interferon alpha-inducible protein 27 like 2A CCL12 : C-C motif chemokine ligand 12 IL-6 : Interleukin 6 LTR : Long terminal repeat NF-ĸB : Nuclear factor kappa-light-chain-enhancer of activated B cells CNS : Central nervous system Declarations Availability of data and materials All supporting information and data are available in the article Acknowledgements We would like to thank the Flinders University and University of Queensland Animal House staff and Danielle Renfrey for technical assistance Funding The study was supported by a FightMND Discovery Grant (DIS-202303-00932; MLR and JC), a MND Research Australia Innovator Grant (IG1950; MLR and JC), the Brazil Family Program for Neurology and the Ross Maclean Fellowship for MND Research (AKW). Author information Authors and affiliations Motor Neuron and Neurotrophic Research Laboratory and Virus Research Laboratory, College of Medicine and Public Health, Flinders Health and Medical Research Institute, Flinders University, Bedford Park, Adelaide, South Australia, Australia Megan Fowler, Jillian Carr, Mary-Louise Rogers Clem Jones Centre for Ageing Dementia Research, Queensland Brain Institute, The University of Queensland, St Lucia, Queensland, Australia Adam Walker Sydney Pharmacy School, Faculty of Medicine and Health, The University of Sydney, Camperdown, New South Wales, Australia Adam Walker Faculty of Medicine, Health and Human Sciences, Macquarie University, Sydney, Australia Julian Gold Contributions The study conception and design were contributed to by A/Prof Rogers, Prof Carr and Prof Gold, Material preparation, data collection and analysis were performed by Prof Walker and Dr Fowler. The first draft of the manuscript was written by Dr Fowler and all authors commented and edited subsequent versions. All authors and read and agreed to the published version of the manuscript. Corresponding Authors Correspondence to Megan Fowler or Mary-Louise Rogers Ethics Declarations Ethics Approval All experiments involving mice were approved by the Flinders University Animal Welfare Committee (Ethics #2931) and breeding of mice at the University of Queensland (UQ Animal Ethics Committee approval 2021-AE000200) were conducted under the National Health and Medical Research Council, Australian code for the care and use of animals for scientific purposes. Consent for publication Not applicable Consent to Participate Not applicable Consent for Publication Not Applicable Competing Interests The authors have no relevant financial or non-financial interests to disclose References Abe, K., Aoki, M., Tsuji, S., Itoyama, Y., Sobue, G., Togo, M., Hamada, C., Tanaka, M., Akimoto, M. & Nakamura, K. 2017. Safety and efficacy of edaravone in well defined patients with amyotrophic lateral sclerosis: a randomised, double-blind, placebo-controlled trial. The Lancet Neurology, 16 , 505-512. Cairns, N. J., Neumann, M., Bigio, E. H., Holm, I. E., Troost, D., Hatanpaa, K. J., Foong, C., White Iii, C. L., Schneider, J. A. & Kretzschmar, H. A. 2007. TDP-43 in familial and sporadic frontotemporal lobar degeneration with ubiquitin inclusions. The American journal of pathology, 171 , 227-240. Capparelli, E. V., Letendre, S. L., Ellis, R. J., Patel, P., Holland, D. & Mccutchan, J. A. 2005. Population pharmacokinetics of abacavir in plasma and cerebrospinal fluid. Antimicrobial agents and chemotherapy, 49 , 2504-2506. Castelli, L., Vasta, R., Allen, S. P., Waller, R., Chiò, A., Traynor, B. J. & Kirby, J. 2024. From use of omics to systems biology: Identifying therapeutic targets for amyotrophic lateral sclerosis. International Review of Neurobiology, 176 , 209-268. Chai, Q., She, R., Huang, Y. & Fu, Z. F. 2015. Expression of Neuronal CXCL10 Induced by Rabies Virus Infection Initiates Infiltration of Inflammatory Cells, Production of Chemokines and Cytokines, and Enhancement of Blood-Brain Barrier Permeability. Journal of Virology, 89 , 870-876. Chang, Y.-H. & Dubnau, J. 2019. The Gypsy Endogenous Retrovirus Drives Non-Cell-Autonomous Propagation in a Drosophila TDP-43 Model of Neurodegeneration. Current Biology, 29 , 3135-3152.e4. Chen, L., Al-Harthi, L. & Hu, X.-T. 2021. Triumeq increases excitability of pyramidal neurons in the medial prefrontal cortex by facilitating voltage-gated Ca2+ channel function. Frontiers in Pharmacology, 11 , 617149. Chew, J. L. & Chua, K. Y. 2003. Collection of mouse urine for bioassays. Lab animal, 32 , 48-50. Cho, H., Proll, S. C., Szretter, K. J., Katze, M. G., Gale Jr, M. & Diamond, M. S. 2013. Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses. Nature medicine, 19 , 458-464. Chu, Y. P., Jin, L. W., Wang, L. C., Ho, P. C., Wei, W. Y. & Tsai, K. J. 2023. Transthyretin attenuates TDP-43 proteinopathy by autophagy activation via ATF4 in FTLD-TDP. Brain, 146 , 2089-2106. Coque, E., Salsac, C., Espinosa-Carrasco, G., Varga, B., Degauque, N., Cadoux, M., Crabé, R., Virenque, A., Soulard, C. & Fierle, J. K. 2019. Cytotoxic CD8+ T lymphocytes expressing ALS-causing SOD1 mutant selectively trigger death of spinal motoneurons. Proceedings of the National Academy of Sciences, 116 , 2312-2317. Corne, A., Adolphe, F., Estaquier, J., Gaumer, S. & Corsi, J. M. 2024. ATF4 Signaling in HIV-1 Infection: Viral Subversion of a Stress Response Transcription Factor. Biology (Basel), 13. Crawley, J. N. 1999. Behavioral phenotyping of transgenic and knockout mice: experimental design and evaluation of general health, sensory functions, motor abilities, and specific behavioral tests. Brain research, 835 , 18-26. De Cock, L., Bercier, V. & Van Den Bosch, L. 2024. New developments in pre-clinical models of ALS to guide translation. International Review of Neurobiology, 176 , 477-524. Douville, R., Liu, J., Rothstein, J. & Nath, A. 2011. Identification of active loci of a human endogenous retrovirus in neurons of patients with amyotrophic lateral sclerosis. Annals of neurology, 69 , 141-151. Dubowsky, M., Theunissen, F., Carr, J. M. & Rogers, M.-L. 2023. The Molecular Link Between TDP-43, Endogenous Retroviruses and Inflammatory Neurodegeneration in Amyotrophic Lateral Sclerosis: a Potential Target for Triumeq, an Antiretroviral Therapy. Molecular neurobiology , 1-16. Engelhardt, J. I., Tajti, J. & Appel, S. H. 1993. Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Archives of neurology, 50 , 30-36. Garcia-Montojo, M., Doucet-O’hare, T., Henderson, L. & Nath, A. 2018. Human endogenous retrovirus-K (HML-2): a comprehensive review. Critical Reviews in Microbiology, 44 , 715-738. Garcia-Montojo, M., Fathi, S., Norato, G., Smith, B., Rowe, D., Kiernan, M., Vucic, S., Mathers, S., Van Eijk, R. & Santamaria, U. 2021. Inhibition of HERV-K (HML-2) in amyotrophic lateral sclerosis patients on antiretroviral therapy. Journal of the neurological sciences, 423 , 117358. Garofalo, S., Cocozza, G., Bernardini, G., Savage, J., Raspa, M., Aronica, E., Tremblay, M.-E., Ransohoff, R. M., Santoni, A. & Limatola, C. 2022. Blocking immune cell infiltration of the central nervous system to tame Neuroinflammation in Amyotrophic lateral sclerosis. Brain, Behavior, and Immunity, 105 , 1-14. Garofalo, S., Cocozza, G., Porzia, A., Inghilleri, M., Raspa, M., Scavizzi, F., Aronica, E., Bernardini, G., Peng, L., Ransohoff, R. M., Santoni, A. & Limatola, C. 2020. Natural killer cells modulate motor neuron-immune cell cross talk in models of Amyotrophic Lateral Sclerosis. Nature Communications, 11 , 1773. Gold, J., Rowe, D. B., Kiernan, M. C., Vucic, S., Mathers, S., Van Eijk, R. P., Nath, A., Garcia Montojo, M., Norato, G. & Santamaria, U. A. 2019. Safety and tolerability of Triumeq in amyotrophic lateral sclerosis: the lighthouse trial. Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration, 20 , 595-604. Gubernick, S. I., Félix, N., Lee, D., Xu, J. J. & Hamad, B. 2016. The HIV therapy market. Nature Publishing Group. Hogg, M. C., Halang, L., Woods, I., Coughlan, K. S. & Prehn, J. H. 2018. Riluzole does not improve lifespan or motor function in three ALS mouse models. Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration, 19 , 438-445. Hu, S., Neff, C. P., Kumar, D. M., Habu, Y., Akkina, S. R., Seki, T. & Akkina, R. 2017a. A humanized mouse model for HIV-2 infection and efficacy testing of a single-pill triple-drug combination anti-retroviral therapy. Virology, 501 , 115-118. Hu, Y., Cao, C., Qin, X.-Y., Yu, Y., Yuan, J., Zhao, Y. & Cheng, Y. 2017b. Increased peripheral blood inflammatory cytokine levels in amyotrophic lateral sclerosis: a meta-analysis study. Scientific Reports, 7 , 9094. Hughes, J. F. & Coffin, J. M. 2004. Human endogenous retrovirus K solo-LTR formation and insertional polymorphisms: implications for human and viral evolution. Proceedings of the National Academy of Sciences, 101 , 1668-1672. Hunter, M., Spiller, K. J., Dominique, M. A., Xu, H., Hunter, F. W., Fang, T. C., Canter, R. G., Roberts, C. J., Ransohoff, R. M., Trojanowski, J. Q. & Lee, V. M. Y. 2021. Microglial transcriptome analysis in the rNLS8 mouse model of TDP-43 proteinopathy reveals discrete expression profiles associated with neurodegenerative progression and recovery. Acta Neuropathologica Communications, 9 , 140. Iwasaki, Y., Suganami, T., Hachiya, R., Shirakawa, I., Kim-Saijo, M., Tanaka, M., Hamaguchi, M., Takai-Igarashi, T., Nakai, M., Miyamoto, Y. & Ogawa, Y. 2013. Activating Transcription Factor 4 Links Metabolic Stress to Interleukin-6 Expression in Macrophages. Diabetes, 63 , 152-161. Koch, J. C., Leha, A., Bidner, H., Cordts, I., Dorst, J., Günther, R., Zeller, D., Braun, N., Metelmann, M. & Corcia, P. 2024. Safety, tolerability, and efficacy of fasudil in amyotrophic lateral sclerosis (ROCK-ALS): a phase 2, randomised, double-blind, placebo-controlled trial. The Lancet Neurology, 23 , 1133-1146. Lacomblez, L., Bensimon, G., Leigh, P., Guillet, P., Powe, L., Durrleman, S., Delumeau, J. & Meininger, V. 1996. A confirmatory dose-ranging study of riluzole in ALS. Neurology, 47 , 242S-250S. Leitner, M., Menzies, S. & Lutz, C. 2009. Working with ALS mice: Guidelines for preclinical testing & colony management. The Jackson Laboratory . Letendre, S., Marquie-Beck, J., Capparelli, E., Best, B., Clifford, D., Collier, A. C., Gelman, B. B., Mcarthur, J. C., Mccutchan, J. A. & Morgello, S. 2008. Validation of the CNS penetration-effectiveness rank for quantifying antiretroviral penetration into the central nervous system. Archives of neurology, 65 , 65-70. Li, J., Akagi, K., Hu, Y., Trivett, A. L., Hlynialuk, C. J., Swing, D. A., Volfovsky, N., Morgan, T. C., Golubeva, Y. & Stephens, R. M. 2012. Mouse endogenous retroviruses can trigger premature transcriptional termination at a distance. Genome research, 22 , 870-884. Li, W., Lee, M.-H., Henderson, L., Tyagi, R., Bachani, M., Steiner, J., Campanac, E., Hoffman, D. A., Von Geldern, G. & Johnson, K. 2015. Human endogenous retrovirus-K contributes to motor neuron disease. Science Translational Medicine, 7 , 307ra153-307ra153. Li, W., Pandya, D., Pasternack, N., Garcia-Montojo, M., Henderson, L., Kozak, C. A. & Nath, A. 2022. Retroviral Elements in Pathophysiology and as Therapeutic Targets for Amyotrophic Lateral Sclerosis. Neurotherapeutics, 19 , 1085-1101. Liu, X., Liu, Z., Wu, Z., Ren, J., Fan, Y., Sun, L., Cao, G., Niu, Y., Zhang, B. & Ji, Q. 2023. Resurrection of endogenous retroviruses during aging reinforces senescence. Cell . Lu, L., Deng, Y. & Xu, R. 2024. Current potential therapeutics of amyotrophic lateral sclerosis. Frontiers in Neurology, 15 , 1402962. Luan, W., Wright, A. L., Brown-Wright, H., Le, S., San Gil, R., Madrid San Martin, L., Ling, K., Jafar-Nejad, P., Rigo, F. & Walker, A. K. 2023. Early activation of cellular stress and death pathways caused by cytoplasmic TDP-43 in the rNLS8 mouse model of ALS and FTD. Molecular Psychiatry, 28 , 2445-2461. Ludolph, A. C., Bendotti, C., Blaugrund, E., Chio, A., Greensmith, L., Loeffler, J.-P., Mead, R., Niessen, H. G., Petri, S. & Pradat, P.-F. 2010. Guidelines for preclinical animal research in ALS/MND: A consensus meeting. Amyotrophic Lateral Sclerosis, 11 , 38-45. Manghera, M. & Douville, R. N. 2013. Endogenous retrovirus-K promoter: a landing strip for inflammatory transcription factors? Retrovirology, 10 , 1-11. Manghera, M., Ferguson-Parry, J., Lin, R. & Douville, R. N. 2016. NF-κB and IRF1 induce endogenous retrovirus K expression via interferon-stimulated response elements in its 5′ long terminal repeat. Journal of virology, 90 , 9338-9349. Masrori, P. & Van Damme, P. 2020. Amyotrophic lateral sclerosis: a clinical review. European journal of neurology, 27 , 1918-1929. Matus, S., Lopez, E., Valenzuela, V., Nassif, M. & Hetz, C. 2013. Functional contribution of the transcription factor ATF4 to the pathogenesis of amyotrophic lateral sclerosis. PloS one, 8 , e66672. Miana‐Mena, F. J., Muñoz, M. J., Yagüe, G., Mendez, M., Moreno, M., Ciriza, J., Zaragoza, P. & Osta, R. 2005. Optimal methods to characterize the G93A mouse model of ALS. Amyotrophic Lateral Sclerosis, 6 , 55-62. Miller, T. M., Cudkowicz, M. E., Genge, A., Shaw, P. J., Sobue, G., Bucelli, R. C., Chiò, A., Van Damme, P., Ludolph, A. C. & Glass, J. D. 2022. Trial of antisense oligonucleotide tofersen for SOD1 ALS. New England Journal of Medicine, 387 , 1099-1110. Mukherjee, D., Bercz, L. S., Torok, M. A. & Mace, T. A. 2020. Regulation of cellular immunity by activating transcription factor 4. Immunol Lett, 228 , 24-34. Pakos-Zebrucka, K., Koryga, I., Mnich, K., Ljujic, M., Samali, A. & Gorman, A. M. 2016. The integrated stress response. EMBO Rep, 17 , 1374-1395. Pasternack, N., Doucet-O’hare, T., Johnson, K., Paulsen, O. & Nath, A. 2024. Endogenous retroviruses are dysregulated in ALS. Iscience, 27. Rao, X., Huang, X., Zhou, Z. & Lin, X. 2013. An improvement of the 2ˆ (–delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostatistics, bioinformatics and biomathematics, 3 , 71. Ruffo, P., Traynor, B. J. & Conforti, F. L. 2025. Advancements in genetic research and RNA therapy strategies for amyotrophic lateral sclerosis (ALS): current progress and future prospects. Journal of Neurology, 272 , 233. Schmitz, M. L., Shaban, M. S., Albert, B. V., Gökçen, A. & Kracht, M. 2018. The Crosstalk of Endoplasmic Reticulum (ER) Stress Pathways with NF-κB: Complex Mechanisms Relevant for Cancer, Inflammation and Infection. Biomedicines, 6. Shepheard, S. R., Chataway, T., Schultz, D. W., Rush, R. A. & Rogers, M.-L. 2014. The extracellular domain of neurotrophin receptor p75 as a candidate biomarker for amyotrophic lateral sclerosis. PLoS One, 9 , e87398. Shepheard, S. R., Wuu, J., Cardoso, M., Wiklendt, L., Dinning, P. G., Chataway, T., Schultz, D., Benatar, M. & Rogers, M.-L. 2017. Urinary p75ECD A prognostic, disease progression, and pharmacodynamic biomarker in ALS. Neurology, 88 , 1137-1143. Smith, K. S., Rush, R. A. & Rogers, M. L. 2015. Characterization and changes in neurotrophin receptor p75‐expressing motor neurons in SOD1G93AG1H mice. Journal of Comparative Neurology, 523 , 1664-1682. Steiner, J. P., Bachani, M., Malik, N., Demarino, C., Li, W., Sampson, K., Lee, M. H., Kowalak, J., Bhaskar, M. & Doucet‐O'hare, T. 2022. Human Endogenous Retrovirus K Envelope in Spinal Fluid of Amyotrophic Lateral Sclerosis Is Toxic. Annals of Neurology, 92 , 545-561. Stocking, C. & Kozak, C. A. 2008. Murine endogenous retroviruses. Cell Mol Life Sci, 65 , 3383-98. Subramanian, R. P., Wildschutte, J. H., Russo, C. & Coffin, J. M. 2011. Identification, characterization, and comparative genomic distribution of the HERV-K (HML-2) group of human endogenous retroviruses. Retrovirology, 8 , 90. Swanson, M. E. V., Mrkela, M., Turner, C., Curtis, M. A., Faull, R. L. M., Walker, A. K. & Scotter, E. L. 2025. Neuronal TDP-43 aggregation drives changes in microglial morphology prior to immunophenotype in amyotrophic lateral sclerosis. Acta Neuropathol Commun, 13 , 39. Tam, A. B., Mercado, E. L., Hoffmann, A. & Niwa, M. 2012. ER stress activates NF-κB by integrating functions of basal IKK activity, IRE1 and PERK. PloS one, 7 , e45078. Tönges, L., Günther, R., Suhr, M., Jansen, J., Balck, A., Saal, K. A., Barski, E., Nientied, T., Götz, A. A. & Koch, J. C. 2014. Rho kinase inhibition modulates microglia activation and improves survival in a model of amyotrophic lateral sclerosis. Glia, 62 , 217-232. Tortelli, R., Zecca, C., Piccininni, M., Benmahamed, S., Dell'abate, M. T., Barulli, M. R., Capozzo, R., Battista, P. & Logroscino, G. 2020. Plasma inflammatory cytokines are elevated in ALS. Frontiers in neurology, 11 , 552295. Van Eijk, R. P., Jones, A. R., Sproviero, W., Shatunov, A., Shaw, P. J., Leigh, P. N., Young, C. A., Shaw, C. E., Mora, G. & Mandrioli, J. 2017. Meta-analysis of pharmacogenetic interactions in amyotrophic lateral sclerosis clinical trials. Neurology, 89 , 1915-1922. Walker, A. K., Spiller, K. J., Ge, G., Zheng, A., Xu, Y., Zhou, M., Tripathy, K., Kwong, L. K., Trojanowski, J. Q. & Lee, V. M. Y. 2015. Functional recovery in new mouse models of ALS/FTLD after clearance of pathological cytoplasmic TDP-43. Acta Neuropathologica, 130 , 643-660. Walmsley, S. L., Antela, A., Clumeck, N., Duiculescu, D., Eberhard, A., Gutiérrez, F., Hocqueloux, L., Maggiolo, F., Sandkovsky, U. & Granier, C. 2013. Dolutegravir plus abacavir–lamivudine for the treatment of HIV-1 infection. New England Journal of Medicine, 369 , 1807-1818. Wertman, V., Gromova, A., La Spada, A. R. & Cortes, C. J. 2019. Low-cost gait analysis for behavioral phenotyping of mouse models of neuromuscular disease. JoVE (Journal of Visualized Experiments) , e59878. Wright, A. L., Della Gatta, P. A., Le, S., Berning, B. A., Mehta, P., Jacobs, K. R., Gul, H., San Gil, R., Hedl, T. J. & Riddell, W. R. 2021. Riluzole does not ameliorate disease caused by cytoplasmic TDP‐43 in a mouse model of amyotrophic lateral sclerosis. European Journal of Neuroscience, 54 , 6237-6255. Zhao, W., Beers, D. R., Bell, S., Wang, J., Wen, S., Baloh, R. H. & Appel, S. H. 2015. TDP-43 activates microglia through NF-κB and NLRP3 inflammasome. Experimental Neurology, 273 , 24-35. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7351593","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":506480619,"identity":"f8976673-a252-4650-bfdf-f4925695506a","order_by":0,"name":"Megan Fowler","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABH0lEQVRIie3QMUvEMBTA8VcC7fLAtVKv30B4EDgrFu+r5AjcVFG45UbBocvhfHJfoi7OhUC7dHErOCgUOjkoBSmcoOndaFTcHPJfAi/5kRAAm+3/FgJ4enmJIwQQ25Fz+TPhAEyfWs38PxKGMx9+JYdpet9dAIWkWNHFwj848mTx2kM8ynLW+gYyrqp5sALipFy5ToSPx8tWrhFmPMvdsZHUiQgQ3qd3Cjk7632kOuH6kWqa5WAmj89yg0Ca7HUsEgM575wePjTx3sy3eEWwI8gYbEnCACHXBM23VIl7gkR8olzuLAdStZwhSX6jcB6ZSFk2D7igcD+9aqAX8YRK2Tj94nR0Xaa3tfGbkQDoy3SYMON5nff03Y7NZrPZdn0ChcNcb4dVcVYAAAAASUVORK5CYII=","orcid":"","institution":"Flinders Health and Medical Research Institute, Flinders University","correspondingAuthor":true,"prefix":"","firstName":"Megan","middleName":"","lastName":"Fowler","suffix":""},{"id":506480620,"identity":"b2eeae3d-e2a7-4b90-bd41-3d0190bce245","order_by":1,"name":"Jillian M Carr","email":"","orcid":"","institution":"Flinders Health and Medical Research Institute, Flinders University","correspondingAuthor":false,"prefix":"","firstName":"Jillian","middleName":"M","lastName":"Carr","suffix":""},{"id":506480621,"identity":"10f445b8-3af2-45db-8a13-fcffe4cce483","order_by":2,"name":"Julian Gold","email":"","orcid":"","institution":"Macquarie University","correspondingAuthor":false,"prefix":"","firstName":"Julian","middleName":"","lastName":"Gold","suffix":""},{"id":506480622,"identity":"2b0b6256-eb23-48ff-a66b-77090a2dd537","order_by":3,"name":"Adam Walker","email":"","orcid":"","institution":"The University of Queensland","correspondingAuthor":false,"prefix":"","firstName":"Adam","middleName":"","lastName":"Walker","suffix":""},{"id":506480624,"identity":"dbf344e8-4711-41f7-89fb-9deea602dca2","order_by":4,"name":"Mary-Louise Rogers","email":"","orcid":"","institution":"Flinders Health and Medical Research Institute, Flinders University","correspondingAuthor":false,"prefix":"","firstName":"Mary-Louise","middleName":"","lastName":"Rogers","suffix":""}],"badges":[],"createdAt":"2025-08-12 05:38:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7351593/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7351593/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90525948,"identity":"3f5c372e-55c5-4329-84d1-f2e6dfe73b7b","added_by":"auto","created_at":"2025-09-03 16:56:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":276272,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Representative micrograph (20x) of cortical neurons from\u0026nbsp; \u003cstrong\u003ei. \u003c/strong\u003enon-transgenic control mice, \u003cstrong\u003eii.\u003c/strong\u003e hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice off Dox for 15 days and \u003cstrong\u003eiii.\u003c/strong\u003e hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice off Dox for 30 days labelled with hTDP-43 (red) and NeuN (green) (Scale bar 200 µM) with insets showing labelled neurons (Scale bar 100 µM). Arrow showing the individual neuron in the following insets\u003cstrong\u003e \u003c/strong\u003elabelled with hTDP-43 and NeuN (Scale bar 50 µM).\u003cstrong\u003e \u003c/strong\u003e\u0026nbsp;\u003cstrong\u003eB \u003c/strong\u003eUrinary p75\u003csup\u003eECD\u003c/sup\u003e\u0026nbsp;levels were quantified in samples from hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice on Dox (n = 8) and compared to p75\u003csup\u003eECD\u003c/sup\u003e\u0026nbsp;levels from hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice off Dox at the time points 2 weeks (n = 25), 4 weeks (n = 11) and 6 weeks (n = 27). Levels of p75\u003csup\u003eECD\u003c/sup\u003e\u0026nbsp;were standardised to urinary creatinine to account for dilution. Individual points represent the mean ± SEM from 3 biological replicates, 2 technical replicates. One-way ANOVA with Sidak’s multiple comparisons test * p \u0026lt; 0.05 \u003cstrong\u003eC \u003c/strong\u003eSchematic showing the Dox-suppressible TDP-43 expression system in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice under the control of the \u003cem\u003eNEFH \u003c/em\u003epromotor compared to the monogenic littermate controls, lacking the \u003cem\u003eNEFH\u003c/em\u003e-tTA transgene\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/ec319746ca374def7e3014d0.png"},{"id":90525949,"identity":"2ad19b43-dc77-42a1-ab32-36a38f44c0d0","added_by":"auto","created_at":"2025-09-03 16:56:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":454057,"visible":true,"origin":"","legend":"\u003cp\u003emRNA was quantified from brain tissue from littermate controls (LMC; n = 4) and hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (hTDP-43; n = 6) from day 30 post removal of Dox by RT-qPCR using primers for \u003cstrong\u003eA\u003c/strong\u003e TDP-43, \u003cstrong\u003eB\u003c/strong\u003e MMTV, \u003cstrong\u003eC\u003c/strong\u003e ATF4 and \u003cstrong\u003eD \u003c/strong\u003ea panel of inflammatory markers. Expression for all mRNA candidates were normalised to GAPDH. Results represent the mean ± SEM from duplicate values. Mann-Whitney U test * = p \u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.005\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/6a9966631e35ad9f0e26a3ce.png"},{"id":90525950,"identity":"21409b72-96f6-4a22-9c23-b13e8caf60b6","added_by":"auto","created_at":"2025-09-03 16:56:28","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":695896,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eSchematic showing Triumeq treatment timeline and progression over the study course. Mice were administered Triumeq or vehicle beginning immediately after Dox removal and treated for 15 or 30 days\u003cstrong\u003e B\u003c/strong\u003e Mean latency to fall for a cohort of treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n = 21), untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n = 23), treated LMC cohort (n = 4) and an untreated LMC cohort (n = 4) across the course of the experimental study. \u003cstrong\u003eC\u003c/strong\u003e Gait analysis of treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n =7) and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n = 5) was measured and assessed by mean stride length across the course of the treatment study. Results represent the mean ± SEM, Two-way ANOVA with Tukey’s multiple comparisons test. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/9cadc2218457f9596d362e2f.png"},{"id":90525952,"identity":"3846a47f-76ad-4661-9012-a10049327d59","added_by":"auto","created_at":"2025-09-03 16:56:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":199446,"visible":true,"origin":"","legend":"\u003cp\u003eA cohort of hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice was treated with antiretroviral therapy, Triumeq, (n = 21) and compared to an untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e cohort (n = 23), treated LMC cohort (n = 4) and an untreated LMC cohort (n = 4) and compared \u003cstrong\u003eA\u003c/strong\u003e percentage weight change and\u003cstrong\u003e B\u003c/strong\u003e neurological score where 0 = normal hindlimb movement and normal gait, 1 = partial hindlimb splay and slightly abnormal gait, 2 = hindlimb dragging while moving forward, 3 = minimal hindlimb movement and slow and abnormal gait and 4 = rigid paralysis in hindlimbs and no forward motion, deemed the ethical end-point. Results represent the mean ± SEM, Two-way ANOVA with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/123da58cbbf2812017324d4f.png"},{"id":90526163,"identity":"1f89e796-bc26-4607-ba16-0192d92876a1","added_by":"auto","created_at":"2025-09-03 17:04:28","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":424129,"visible":true,"origin":"","legend":"\u003cp\u003emRNA was quantified from brain tissue from treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n = 10) and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n = 11) from day 19 post treatment onset by RT-qPCR using primers for \u003cstrong\u003eA\u003c/strong\u003e TDP-43, \u003cstrong\u003eB\u003c/strong\u003e MMTV, \u003cstrong\u003eC \u003c/strong\u003eATF4, \u003cstrong\u003eD \u003c/strong\u003ea panel of inflammatory markers\u003cstrong\u003e.\u003c/strong\u003e\u0026nbsp; Expression for all mRNA candidates were normalised to GAPDH. Results represent the mean ± SEM from duplicate values. Mann-Whitney U test * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/1d1598e8ed76a7ac949f4e20.png"},{"id":90525954,"identity":"809a0e44-6da1-49c5-9f36-bd81ce1ba9d8","added_by":"auto","created_at":"2025-09-03 16:56:28","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":261908,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003emRNA was quantified from brain tissue from treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice\u0026nbsp; (orange; n = 10) and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (blue; n = 11) from day 10 post-treatment onset by RT-qPCR using primers for NeuN. \u003cstrong\u003eB\u003c/strong\u003e mRNA expression levels of NeuN were correlated against TDP-43 expression levels for treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (orange circle) and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (blue square)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/692a4381bb90a2e05346a44a.png"},{"id":90525956,"identity":"c3664186-40e5-4a08-90b3-05cd687facf1","added_by":"auto","created_at":"2025-09-03 16:56:28","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":441627,"visible":true,"origin":"","legend":"\u003cp\u003eThe relationship between the mRNA expression of \u003cstrong\u003eA. \u003c/strong\u003eATF4 and TDP-43 \u003cstrong\u003eB. \u003c/strong\u003einflammatory markers and TDP-43 and \u003cstrong\u003eC. \u003c/strong\u003eCXCL10 and IRF-1 in untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (blue square; n = 10) and Triumeq treated (orange circle; n = 10) hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice at day 19.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/0f90d10463ff87003fb43ae3.png"},{"id":90526834,"identity":"fae1f035-c98c-4519-bab8-5a242cf26f58","added_by":"auto","created_at":"2025-09-03 17:12:28","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":165560,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic showing the influence of Triumeq on the association between TDP-43 and inflammation and TDP-43 and ATF4 where \u003cstrong\u003e1.\u003c/strong\u003e TDP-43 drives inflammation and \u003cstrong\u003e2.\u003c/strong\u003e is associated with increased ATF4 where ATF4 acts to clear TDP-43 aggregates. \u003cstrong\u003e3.\u003c/strong\u003eTriumeq disrupted this association between TDP-43 and ATF4 at the mRNA level. \u003cstrong\u003e4.\u003c/strong\u003eATF4 is a transcription factor for genes involved in the inflammatory response and activates NF-ĸB which can bind to the HERV-K LTR to cause transcription of HERV-K. \u003cstrong\u003e5.\u003c/strong\u003e Triumeq could also influence inflammation in an ATF4 independent manner\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/dca9db5dda337b216d8917c1.png"},{"id":93253443,"identity":"031bee4c-5229-4f53-a712-8873e54c3551","added_by":"auto","created_at":"2025-10-10 16:08:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4130093,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7351593/v1/bc6639c7-4377-4057-bc0a-e62e68464ff9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eImproving Motor Function in Amyotrophic Lateral Sclerosis: The impact of Triumeq on a TDP-43 mouse model\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAmyotrophic lateral sclerosis (ALS) is a rapidly progressive neurodegenerative disease characterised by degeneration of the upper and lower motor neurons in the motor cortex, brain stem and spinal cord, typically leading to death within 2\u0026ndash;5 years of diagnosis (Masrori and Van Damme, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Excitingly, Tofersen has been recently approved as a treatment for familial superoxide dismutase 1 (\u003cem\u003eSOD1\u003c/em\u003e)-linked ALS (Castelli et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) but the only drug therapies for sporadic ALS approved for use by the FDA (USA) and TGA (Australia) are riluzole and edaravone, which only offer a limited extension of lifespan of patients of 2\u0026ndash;5 months (Abe et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Ruffo et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Thus, better understanding of the mechanisms underlying sporadic ALS is needed in addition to developing more effective therapeutics. One proposed driver of ALS pathology are endogenous retroviruses (ERVs), genomic remnants of ancient viral infections that are mostly transcriptionally inactive (Hughes and Coffin, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). However, some ERVs, such as human endogenous retrovirus type K (HERV-K), retain transcriptional activity which has been associated with ALS (Garcia-Montojo et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Dubowsky et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Pasternack et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), for instance, with increased HERV-K transcripts found in post-mortem brain tissue from ALS patients compared to age matched controls who died from other causes, such as accidental death and Parkinson\u0026rsquo;s disease (Douville et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSpecifically, the HERV-K envelope (env) protein has been implicated in neurodegenerative processes in ALS (Li et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Steiner et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). One study showed that a mouse model of neuronal HERV-K \u003cem\u003eenv\u003c/em\u003e overexpression recapitulated many of the facets of ALS pathology including progressive motor dysfunction, muscle atrophy and decrease activity of pyramidal neurons (Li et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). A hallmark of ALS is the expression and mislocalisation of TAR DNA Binding Protein 43 kDa (TDP-43) from the nucleus to the cytoplasm, with 97% of ALS cases showing cytoplasmic localisation and aggregation of TDP-43 in neurons of the brain and spinal cord at post mortem (Cairns et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Previous research has indicated TDP-43 may influence HERV-K expression, with nuclear TDP-43 binding to the HERV-K promotor and repressing HERV-K transcription (Li et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Using a Drosophila model expressing TDP-43 within glial cells, results showed the glial TDP-43 aggregation increased the expression of Drosophila ERVs. This increased ERV expression in glial cells resulted in cellular release of neuronal toxic factors that induced DNA damage and neuronal death in surrounding neurons (Chang and Dubnau, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAccordingly, antiretroviral therapy (ART), specifically Triumeq, to target ERVs has been explored as a potential treatment for ALS (Gold et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Garcia-Montojo et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Triumeq is an efficient and well tolerated antiretroviral, used widely for treatment of human immunodeficiency virus (HIV), consisting of two nucleoside reverse transcriptase (RT) inhibitors, abacavir and lamivudine and an integrase inhibitor, dolutegravir (Walmsley et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). A Phase II clinical trial of Triumeq demonstrated safety and tolerability in a small cohort of patients with ALS with patients receiving Triumeq experiencing a slower clinical decline as measured by the ALS Functional Rating Scale \u0026ndash; Revised (ALSFRS-R; Gold et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Based on these promising results, Triumeq progressed to a Phase III clinical trial, known as the Lighthouse Trial (ClinicalTrials.gov Identifier: NCT06658977). During the production of this manuscript, the Lighthouse study was terminated due to interim analysis failing to identify a lack of benefit in survival measures. Notably, participants in the Lighthouse study were not pre-screened, such as selecting individuals based on HERV-K serum levels. As a result, post-hoc analysis may still reveal a benefit in a stratified population that responded to the treatment, similar to the lithium trial post hoc analysis that specifically found patients with the UNC13A genotype responded to lithium (van Eijk et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eHence, Triumeq has demonstrated some potential in ALS treatment in humans, but it would be beneficial to understand potential mechanisms of Triumeq action in ALS, which may assist in targeting Triumeq to particular ALS patients who may benefit the most. There are a number of mouse models of ALS, including human TDP-43 overexpression and ALS-linked mutant \u003cem\u003eSOD1\u003c/em\u003e transgenic mouse models, that reflect ALS pathology including conserved biomarkers for neurodegeneration such as urinary p75\u003csup\u003eECD\u003c/sup\u003e, which is increased in both humans and mouse models of ALS (Shepheard et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Smith et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Shepheard et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Since the \u003cem\u003eSOD1\u003c/em\u003e transgenic mouse model reflects familial ALS, but TDP-43 pathology is seen in a larger proportion of ALS cases, the study here utilised the neurofilament heavy chain \u003cem\u003eNEFH\u003c/em\u003e-tTA/\u003cem\u003etetO\u003c/em\u003e-hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e (hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e) \u0026lsquo;rNLS8\u0026rsquo; mouse model which features a Doxycycline (Dox)-suppressible human TDP-43 expression system (Walker et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In this model, the nuclear localisation sequence of hTDP-43 is ablated, resulting in expression and localisation of human TDP-43 to the cytoplasm in neurons and followed by neurodegenerative pathology resembling human ALS (Walker et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Our aim was to determine if Triumeq affects neurodegeneration and immune dysfunction in this inducible TDP-43 mouse model of ALS.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eAnimal welfare and monitoring\u003c/h2\u003e\u003cp\u003e All experiments involving mice were reviewed and approved by the Flinders University Animal Welfare Committee (Ethics #2931) under the National Health and Medical Research Council, Australian code for the care and use of animals for scientific purposes. rNLS8 TDP-43 transgenic mice (hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e) were bred at the University of Queensland (UQ Animal Ethics Committee approval 2021-AE000200). Prior to the start of the experiments, mice were fed chow containing 200 mg/kg Dox (Dox Diet, Specialty Feeds, Australia). On day one of the experiments, they were switched to standard chow without Dox. Towards end-stage disease, mice were given easier access to food and water through soaked food. Control mice were either non-transgenic C57BL/6J mice, which were age and gender-matched to the transgenic mice, bred at the Flinders Medical Centre Animal House (Ethics #2931) or single transgenic littermate controls (LMC) negative for the NEFH-tTA transgene, bred alongside the rNLS8 double transgenic mice at the University of Queensland. Mice were monitored daily between 0900 and 1100h and assigned to cohort 1 or cohort 2. Cohort 1 mice were euthanised after 15\u0026ndash;19 days after Dox removal and cohort 2 euthanised at approximately 30 days after Dox removal, based on a disease end-point. Disease end-point was defined as \u0026ge;\u0026thinsp;15% weight loss or two consecutive days of a neurological score of 3 or above as defined by delayed righting reflex and minimal hindfoot grasping (Adapted from Leitner \u003cem\u003eet al\u003c/em\u003e.,2009). Mice were weighed and assessed daily.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTriumeq administration\u003c/h3\u003e\n\u003cp\u003eOn day one, mice were switched to standard chow (without Dox) and given either Triumeq (n\u0026thinsp;=\u0026thinsp;21) or vehicle control (n\u0026thinsp;=\u0026thinsp;23). The adult dose of Triumeq (ViiV Healthcare) contains 600 mg abacavir, 50 mg dolutegravir, and 300 mg lamivudine. Based on this, an equivalent scaled dose of 12.7 mg crushed Triumeq was mixed into 1.5 g of peanut butter and provided for oral consumption daily. This dosing approach follows the protocol described by Hu et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017a\u003c/span\u003e) and aligns with the methodology used in the Lighthouse involving individuals with ALS (Gold et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Control mice received 1.5 g peanut butter without Triumeq.\u0026nbsp;Treatment continued daily until the timepoints specified in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA.\u003c/p\u003e\n\u003ch3\u003eAssessment of motor function\u003c/h3\u003e\n\u003cp\u003eMotor function was assessed through grip duration using the wirehang test, as previously described in Crawley (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1999\u003c/span\u003e) and Miana-Mena et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Latency to fall was averaged from three measures per mouse with a rest time of one minute in between trials. The cut-off time was set to 180 seconds. Gait was evaluated via stride length using a modified gait analysis test (Wertman et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Hindlimbs were marked with a food-safe blue food colouring and walked across a 60 cm length of paper toward an enclosed space with access to food. Each mouse completed two trials with a 60-second break between trials. Stride length was measured from the centre of one hindlimb print to the next.\u003c/p\u003e\n\u003ch3\u003ePerfusion and tissue collection\u003c/h3\u003e\n\u003cp\u003eMice were anesthetised with isoflurane (Zoetis) and perfused with sodium nitrate and Zamboni\u0026rsquo;s fixative as previously (Smith et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Spinal cords and brains were extracted and stored in Zamboni\u0026rsquo;s fixative overnight at 4\u0026deg;C and cryoprotected using 30% sucrose (w/v) in phosphate-buffered saline (PBS). Spinal cord sections and brain sections were snap-frozen in optimal cutting temperature (OCT) media. The tissue was sectioned with a Cryostat (Leica) into 30 \u0026micro;m sections for spinal cord tissue and 50 \u0026micro;m sections for the brain tissue. Tissue sections were stored in 1X PBS with 0.1% sodium azide and stored at 4\u0026deg;C until use for immunofluorescent analysis.\u003c/p\u003e\n\u003ch3\u003eMouse urine collection and p75 analysis\u003c/h3\u003e\n\u003cp\u003eMice were placed in a plastic cage and light pressure was applied to the caudal area of the back with a thumb and forefinger to stimulate urine release, adapted from Chew and Chua (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Urine was collected immediately and stored in a microcentrifuge tube (Axygen). Samples were centrifuged at 2000 x g for 5 minutes before storage at -80\u0026deg;C until urinary p75\u003csup\u003eECD\u003c/sup\u003e analysis as previous (Shepheard et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). An ELISA was performed for mouse urinary p75\u003csup\u003eECD\u003c/sup\u003e detection, as previously described and validated (Shepheard et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In brief, 8 \u0026micro;g/mL mouse anti-human p75 MLR1 capture antibody was utilised prior to addition of mouse urine samples diluted to 2.5% v/v and 1.25% v/v in sample buffer (5% v/v 20x PBS, 0.05% v/v Tween-20, 0.01% w/v Thimerosal, 2% w/v bovine serum albumin, pH\u0026thinsp;=\u0026thinsp;7.3). 1 \u0026micro;g/mL goat anti-mouse p75 antibody (Sigma Aldrich Australia) was used as the detection antibody followed by 1 \u0026micro;g/mL biotinylated bovine anti-goat (Jackson ImmunoResearch Laboratories). 1 \u0026micro;g/mL Streptavidin Horse Radish Peroxidase (HRP; Jackson ImmunoResearch Laboratories) was added and colourmetric detection was completed using the 3,3\u0026rsquo;,5,5\u0026rsquo;-Tetramethylbenzidine colour substrate kit (TMB; BioRad Australia) and measured at 450 nm (Perkin Elmer Victor X4 Multilabel Plate Reader). Urinary p75\u003csup\u003eECD\u003c/sup\u003e values were normalised to creatinine as determined by a creatinine kit, as per manufacturer\u0026rsquo;s instructions (Enzo Life Sciences).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eRNA extraction and RT-qPCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from mice brain tissue homogenised with Trizol\u0026reg; Reagent (Invitrogen). RNA was treated with DNAse I and 500 ng of purified RNA was reverse transcribed with 30 \u0026micro;M of random hexamers (New England Biolabs; NEB) followed by a mix of 10 U Moloney Murine Leukaemia Virus (M-MuLV) reverse transcriptase (NEB), 200 \u0026micro;M dNTPs (NEB), 10 U RNase inhibitor (NEB) and 1X M-MuLV reaction buffer (NEB). The cDNA was diluted and used for PCR analysis. cDNA samples, iTaq Universal SYBR green (BioRad), and forward and reverse primers, described in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e were cycled using a Rotor-gene Q PCR cycler (Qiagen). Samples were assayed in duplicate and heated to 95\u0026deg;C for 5 mins and then cycled 40 times at 95\u0026deg;C for 15 secs, 59\u0026deg;C for 30 secs and 72\u0026deg;C for 30 secs followed by one cycle of 72\u0026deg;C for 5 mins and a melt profile analysis. A negative control of H\u003csub\u003e2\u003c/sub\u003eO and a no template was concurrently performed. Results were normalised to the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with values calculated according to the double delta Ct method (Rao et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003eCryosections as described above in perfusion and tissue collection, were washed in filtered PBS 4 x 15 mins to remove excess OCT. Sections were blocked in 10% (v/v) donkey serum (Sigma Aldrich) overnight at 4\u0026deg;C and incubated with primary antibody solution containing antibody diluent reaction solution (ADRS; Sigma Aldrich) and 1% donkey serum and co-stained with mouse anti-NeuN (1:1000; ProteinTech) and rabbit anti-hTDP-43 (1:2000; ProteinTech #10782-2-AP), overnight at 4\u0026deg;C. Sections were washed 4 x 15 mins with filtered 1x PBS and placed in secondary antibody solution containing donkey anti-mouse Alexa 649 (1:800) and donkey anti-rabbit Alexa 488 (1:800) in ARDS with 1% donkey serum. Sections were washed 4 x 15 mins with filtered 1x PBS before being mounted onto slides with Fluoromount (Thermo Fisher Scientific) and covered with a coverslip. After drying, sections were viewed on a BX50 fluorescence microscope (Olympus) and captured using Zen Blue 3.0 software (Zeiss).\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eResults were expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of measurement (SEM) and statistical analysis was performed using a non-parametric Mann-Whitney U test, one-way or two-way analysis of variance (ANOVA). Statistical analysis was performed using Prism v10 (GraphPad). Differences were considered statistically significant if \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for PCR amplification\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSpecies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAccession Number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003cp\u003eForward (F) and Reverse (R)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAmplicon Size (base pair)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTARDBP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHuman\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_007375.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: GTACGGGGATGTGATGGATG\u003c/p\u003e\u003cp\u003eR: CTGCGCAATCTGATCATCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e85\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_008084.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: GACGGCCGCATCTTCTTGTGC\u003c/p\u003e\u003cp\u003eR: TGCCACTGCAAATGGCAGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIFN-β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_010510.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: AGAAAGGACGAACATTCGGAAA\u003c/p\u003e\u003cp\u003eR: CCGTCATCTCCATAGGGATCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e104\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMMTV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAF243039.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: GATGGTATGAAGCAGGATGG\u003c/p\u003e\u003cp\u003eR: AAGGGTAAGTAACACAGGCAGATGTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e248\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_031168.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: GAGGATACCACTCCCAACAGACC\u003c/p\u003e\u003cp\u003eR: AAGTGCATCATCGTTGTTCATACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e141\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCXCL10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_021274.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: GCCGTCATTTTCTGCCTCAT\u003c/p\u003e\u003cp\u003eR: GGCCCGTCATCGATATGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e101\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_013693.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: CATCTTCTCAAAATTCGAGTGACAA\u003c/p\u003e\u003cp\u003eR: TGGGAGTAGACAAGGTACAACCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e175\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCCL12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_011331.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: ATTTCCACACTTCTATGCCTCCT\u003c/p\u003e\u003cp\u003eR: ATCCAGTATGGTCCTGAAGATCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e204\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eATF4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_001287180.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: ATGGCCGGCTATGGATGAT\u003c/p\u003e\u003cp\u003eR: CGAAGTCAAACTCTTTCAGATCCATT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e113\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIfi27l2a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_029803.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: CTGTTTGGCTCTGCCATAGGAG\u003c/p\u003e\u003cp\u003eR: CCTAGGATGGCATTTGTTGATGTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e227\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIRF-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_001159393.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: CAGAGGAAAGAGAGAAAGTCC\u003c/p\u003e\u003cp\u003eR: CACACGGTGACAGTGCTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e208\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNeuN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNM_001039167\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF: CACCACTCTCTTGTCCGTTTGC\u003c/p\u003e\u003cp\u003eR: GGCTGAGCATATCTGTAAGCTGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eRemoval of Dox induces cytoplasmic TDP-43, increases urinary p75\u003c/b\u003e\u003csup\u003e\u003cb\u003eECD\u003c/b\u003e\u003c/sup\u003e \u003cb\u003eand inflammatory marker expression in hTDP-43\u003c/b\u003e\u003csup\u003e\u003cb\u003eΔNLS\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo validate the expression and mislocalisation of human TDP-43 (hTDP-43) in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice, immunofluorescence of cortical brain sections from non-transgenic control mice and the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice was assessed. Brain sections were stained with anti-human TDP-43 (red) and NeuN (green) as a neuronal marker. An example of a brain section from a C57Bl/6J non-transgenic control mouse is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, where no red fluorescence indicates a lack of hTDP-43. In contrast, the cortical brain sections from the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice after 15 and 30 days post-Dox removal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e show hTDP-43 expression as well as mislocalisation of hTDP-43 from the nucleus to the cytoplasm with the hTDP-43 shown surrounding the NeuN-labelled neuronal nuclei.\u003c/p\u003e\u003cp\u003ep75\u003csup\u003eECD\u003c/sup\u003e was quantitated by ELISA, demonstrating a significant increase in the level of urinary p75\u003csup\u003eECD\u003c/sup\u003e between hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice on Dox (n\u0026thinsp;=\u0026thinsp;8) and 6 weeks off Dox (n\u0026thinsp;=\u0026thinsp;27; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0329), Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB. There were no significant differences between the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice on Dox and 2 weeks off Dox (n\u0026thinsp;=\u0026thinsp;25; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.983) or 4 weeks off Dox (n\u0026thinsp;=\u0026thinsp;11; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0949). However, there was a trend towards an increase in the levels of urinary p75\u003csup\u003eECD\u003c/sup\u003e over time following the removal of Dox.\u003c/p\u003e\u003cp\u003eA panel of inflammatory chemokines and cytokines that have been previously shown to be involved in ALS-associated neurodegeneration (Hu et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017b\u003c/span\u003e, Tortelli et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Luan et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), along with hTDP-43 and mouse mammary tumour virus (MMTV), were analysed from brain tissue from hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice, off Dox for 4 weeks (n\u0026thinsp;=\u0026thinsp;6) and LMC (n\u0026thinsp;=\u0026thinsp;4). As expected, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA shows significantly higher expression of human \u003cem\u003eTARDBP\u003c/em\u003e (the gene encoding TDP-43) in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice off Dox for 4 weeks compared to the littermate controls (LMC; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002). MMTV was analysed as a measure of a well described transcriptionally active mouse endogenous retrovirus (Stocking and Kozak, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e, Li et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). mRNA levels were not significantly different between hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice and LMC mice, although again, there was a trend towards increased levels in some animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.174).\u003c/p\u003e\u003cp\u003eThere was no significant difference in the expression levels of activating transcription factor 4 (ATF4; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.4762) between hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice and the LMC although a trend towards increased ATF4 was apparent in some hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e animals. mRNA levels of a panel of inflammatory mediators (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD) were assessed including tumour necrosis factor (TNF), interferon alpha-inducible protein 27 like 2A (Ifi27l2a), C-X-C motif chemokine ligand 10 (CXCL10), C-C motif chemokine ligand 12 (CCL12), interleukin 6 (IL-6) and interferon regulatory factor 1 (IRF-1). mRNA levels of TNF (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0381), Ifi27l2a (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0190), CXCL10 (\u003cb\u003eFigure. 2D\u003c/b\u003e; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0095) and CCL12 (\u003cb\u003eFigure. 2D\u003c/b\u003e; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0476) were significantly higher in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice 4 weeks off Dox, compared to the LMC mice. mRNA levels of IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.7619) and IRF-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.6095) was not significantly different between hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice and LMC although, similar to ATF4, a trend towards increased levels of IL-6 was apparent in some hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e animals. Interferon beta (IFN-β) was also analysed but was not reliably detected in these animals (data not shown). These findings show that Dox-removal in this mouse model induces TDP-43 pathology, increasing levels of urinary p75\u003csup\u003eECD\u003c/sup\u003e and induces an inflammatory response.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eTriumeq treatment transiently improves motor function in hTDP43\u003csup\u003eΔNLS\u003c/sup\u003e mice\u003c/h2\u003e\u003cp\u003eThe therapeutic benefit of Triumeq in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mouse model of ALS was investigated. Following removal of Dox to induce disease, mice were treated with Triumeq for 15\u0026ndash;19 days (n\u0026thinsp;=\u0026thinsp;21) or 30 days (n\u0026thinsp;=\u0026thinsp;8) or vehicle treated for 15\u0026ndash;19 days (n\u0026thinsp;=\u0026thinsp;23) or 30 days (n\u0026thinsp;=\u0026thinsp;8), outlined in the disease timeline in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. LMC mice were also treated with Triumeq (n\u0026thinsp;=\u0026thinsp;4) or untreated (n\u0026thinsp;=\u0026thinsp;4) for 30 days.\u003c/p\u003e\u003cp\u003eTo assess the effects of Triumeq on motor function, the inverted grid test and stride length measured through gait analysis were performed at multiple time points across the experimental study. The littermate control mice, regardless of Triumeq treatment, consistently stayed on the grid up until the cut-off time of 180 seconds. The Triumeq treated (n\u0026thinsp;=\u0026thinsp;21) and untreated (n\u0026thinsp;=\u0026thinsp;23) hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice showed the first reduction in latency to fall on day 15 of the study which was followed by a significant reduction in the latency to fall by day 17 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. On day 17, there was a significant difference between the Triumeq treated (n\u0026thinsp;=\u0026thinsp;21) and untreated (n\u0026thinsp;=\u0026thinsp;23) hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice with the Triumeq treated mice showing a significantly longer latency to fall time compared to the untreated mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). While there was a trend for a longer latency to fall for the Triumeq treated group from day 17 through to day 28, this was not significantly different at any other time point in the study. Stride length was also used as another measure of motor function, completed on day 1, 8, 15, 22 and 27 of the study. There were no significant differences between Triumeq treated (n\u0026thinsp;=\u0026thinsp;7) and untreated (n\u0026thinsp;=\u0026thinsp;5) hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice on day 1, day 8 or day 27. However, consistent with the improved motor function as assessed by latency to fall (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), there was a significantly longer stride length in the Triumeq treated mice on day 15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0375) and day 22 (\u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0445) compared to the untreated mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTriumeq treatment does not alter disease onset or disease progression as assessed by weight loss and neurological score\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe data above suggested a benefit to motor function in early disease in hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice treated with Triumeq and next, weight loss, which has been shown previously to change over disease in this mouse model of ALS (Walker et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) was assessed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003eAs expected, there was a significant difference between the littermate control mice and the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice at the end of the study course (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) showing induction of the disease in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice after Dox removal. Additionally, Triumeq treatment itself did not affect weight, with no significant difference between the LMC mice on Triumeq treatment (n\u0026thinsp;=\u0026thinsp;4) and the untreated LMC mice (n\u0026thinsp;=\u0026thinsp;4; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Lastly, there was no significant difference in weight between the Triumeq treated and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice on any day of the study (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003eFurther disease progression measures included a neurological score, a 4-point scale assessing motor function of the hindlimbs. Unsurprisingly, the LMC mice, either Triumeq treated or untreated, did not score on the neurological score scale at any point in the study course (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The Triumeq-treated and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice, however, had an increased on neurological score due to progressive loss of hindlimb function and a slow righting reflex. There was no significant difference between the treated and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice according to neurological score at any point in the disease course. However, end stage disease was met due to reaching ethical weight loss and the neurological score did not reach ethical end point during the course of these experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eTriumeq does not influence expression of inflammatory markers\u003c/h2\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e demonstrates that the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e model of ALS is associated with induction of a number of inflammatory markers. Next, the impact of Triumeq on mRNA levels of TDP-43, MMTV, ATF4 and inflammatory chemokine and cytokines were analysed in cortical brain tissue from mice collected at 19 days post-treatment onset, a timepoint that coincided with improved motor function. Expression levels were compared among Triumeq treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n\u0026thinsp;=\u0026thinsp;11) and untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (n\u0026thinsp;=\u0026thinsp;13). There was a significantly higher mRNA level of TDP-43 in treated mice compared with untreated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0366). There were no significant differences between treated and untreated mice for expression of MMTV (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB; \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.549\u003cem\u003e)\u003c/em\u003e, ATF4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC; p\u0026thinsp;=\u0026thinsp;0.552) or any of the panel of inflammatory markers analysed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eThe significant increase in TDP-43 in Triumeq treated mice was unexpected, given that TDP-43 is not driven by its endogenous promoter. However, TDP-43 is expressed via the \u003cem\u003eNEFH\u003c/em\u003e promoter, specifically in neurons. Hence, the levels of a neuronal marker, NeuN, was analysed to determine if the higher expression of TDP-43 in the Triumeq treated mice was due to an increased number of TDP-43 expressing neurons as a result of protection of these mice from neurodegeneration. There were no significant differences in the expression of NeuN between the Triumeq treated and untreated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.99). However, analysis of the relationship between TDP-43 and NeuN expression found a significant correlation between TDP-43 and NeuN in untreated mice (Fig.\u0026nbsp;6B; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.489, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.024), that was not found between in TDP-43 and NeuN after Triumeq treatment (Fig.\u0026nbsp;6B; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.183, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.217).\u003c/p\u003e\u003cp\u003eTo assess the relationship between TDP-43 and inflammation at the 19 day disease timepoint, the correlation between TDP-43 mRNA expression and the panel of inflammatory markers for Triumeq treated and untreated mice was analysed, as shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. The relationship between TDP-43 and ATF4 was significantly correlated in the untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.462, p\u0026thinsp;=\u0026thinsp;0.030) but was not significantly correlated in the Triumeq treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.018, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.705). Similarly, there was a strong, significant correlation between TDP-43 and IRF-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.619, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.006) and TDP-43 and CXCL10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.584, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.010) in the untreated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice, with no significant correlation in the Triumeq treated hTDP-43 mice. While there was no correlation between TDP-43 and TNF in the untreated mice, there was a moderate, significant correlation between TDP-43 and TNF (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.449 \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.033) in the Triumeq treated mice. There was a strong, significant correlation between CXCL10 and IRF-1 in both Triumeq treated (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.633, p\u0026thinsp;=\u0026thinsp;0.010) and untreated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC; R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.849, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eCorrelation analysis between TDP-43, ATF4, MMTV and inflammatory markers.\u003c/b\u003e Significant correlations are highlighted in green text\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUntreated\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTriumeq treated\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure reference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and ATF-4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.462, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.030\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.018, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.705\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and IRF-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.619, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.006\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.193, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.203\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and CXCL10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.584, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.057, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.505\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and NeuN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.489, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.024\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.1828, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.217\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and TNF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.004, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.860\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.449, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.033\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and MMTV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.344, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.075\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.01, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.798\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003eData not shown\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and CCL12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.087, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.476\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.357, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.068\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003eData not shown\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and Ifi27l2a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.303, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.090\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.278, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.117\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003eData not shown\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTDP-43 and IL-6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.147, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.272\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.100, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.363\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003eData not shown\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCXCL10 and IRF-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.849, \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.633, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDespite substantial global research efforts, sporadic ALS remains an incurable disease. The current treatment landscape of sporadic ALS provides dismal results for motor improvement or increases to survival time for ALS patients, highlighting the need for new treatment options. ERVs and their reactivation have been linked to ALS and, therefore, controlling ERVs could be a therapeutic avenue for reducing neurodegeneration occurring in ALS (Li et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). ART, specifically Triumeq, to target ERVs was being investigated as a treatment for ALS in a Phase III clinical trial after a Phase II trial showed promising outcomes for reducing HERV-K in serum of ALS patients (Gold et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Although the Phase III trial was discontinued after failing to demonstrate a survival benefit, post-hoc analysis with stratification is yet to be completed to determine if any patients, such as those with higher initial serum HERV-K, responded to the treatment. This post-hoc analysis may reveal responders, such as with the lithium trials for ALS and, more recently, Tofersen (van Eijk et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Miller et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe central aims of this study were to determine if Triumeq, as potentially beneficial for ALS patients, offers any benefit in a TDP-43 mouse model of ALS, and to investigate whether these effects are associated with changes in inflammatory markers or with altered expression of mouse ERV, MMTV. Following induction of TDP-43 expression and its mislocalisation to the cytoplasm to induce disease, our results demonstrate a significant improvement in motor function at 15\u0026ndash;19 days in mice treated with Triumeq.\u0026nbsp;This time point represents early disease and coincides with the onset of weight loss and motor function decline, which are characteristic signs of ALS in this hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mouse model.\u003c/p\u003e\u003cp\u003eThe hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mouse model has been previously validated to reflect ALS pathology (Walker et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In this model, there is a reduction in weight after Dox removal, the presence of hindlimb dysfunction, referred to as the neuroscore in the current study and the motor decline has been well described. Furthermore, this model recapitulates a hallmark of ALS pathology, the TDP-43 inclusions and cytoplasmic mislocalisation. Using this model, Luan et al. (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) described inflammatory markers upregulated in the brain and spinal cord of hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice compared to control mice, with CCL12, ATF4, TNF and IL-6 being significantly upregulated at 2 and 4 weeks off Dox. Furthermore, Hunter et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) found increased gene expression of CXCL10, analysed through RNAseq, occurred early in the disease process and remained at an increased level through late stage disease. Given that IRF-1 is a known regulator of CXCL10 and their expression levels are correlated, the study herein also measured IRF-1 levels and analysed the correlation with CXCL10. A previous study outlined the antiviral effects of an interferon stimulated gene (ISG), Ifi27l2a, in response to exogenous viral infection in neurons (Cho et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Hence, in the current study, the expression of ifi27l2a was examined to assess its induction in the TDP-43 mouse model and to determine any expression changes after Triumeq treatment. Hence, previous findings and the results presented herein suggest that neuroinflammation is a key pathological feature of TDP-43-related disease.\u003c/p\u003e\u003cp\u003eIn this study, the expression and mislocalisation of human TDP-43 in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mouse model was demonstrated, shown by significantly higher hTDP-43 mRNA levels and protein mislocalisation from the nucleus to the cytoplasm. In a separate cohort, the urinary p75\u003csup\u003eECD\u003c/sup\u003e levels were analysed in hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice on Dox and off Dox for 2, 4 and 6 weeks with an increase in the levels of urinary p75\u003csup\u003eECD\u003c/sup\u003e as the time off Dox increased and a significant increase by 6 weeks off Dox. Previous studies in this mouse model have shown onset of motor symptoms by 2 weeks off Dox following by significant motor decline by 4 weeks Dox (Walker et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although there is not a significant increase in p75\u003csup\u003eECD\u003c/sup\u003e between the on Dox group and 2 and 4 weeks off Dox, it is trending towards an increase from 2 weeks off Dox indicating motor neuron death at this point in the disease timeline and coincides with a decline in motor function. In the SOD1\u003csup\u003eG93A\u003c/sup\u003e mice, urinary p75\u003csup\u003eECD\u003c/sup\u003e can be detected prior to the onset of motor symptoms (Shepheard et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, the SOD1 \u003csup\u003eG93A\u003c/sup\u003e mouse model is a much more aggressive mouse model with changes in motor neurons occurring from 7 days of age but no overt symptoms present until 100\u0026ndash;120 days of age (Smith et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This means that motor neuron death is occurring early in the SOD1 mouse model, compared to the inducible hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mouse model where motor neuron death only occurs after TDP-43 is induced for 6\u0026ndash;8 weeks in adulthood (Walker et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Since urinary p75\u003csup\u003eECD\u003c/sup\u003e in SOD1\u003csup\u003eG93A\u003c/sup\u003e mice is associated with significant motor neuron death (Shepheard et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Smith et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), our results in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice support a model where loss of lower motor neurons do not occur until about 6 weeks off Dox.\u003c/p\u003e\u003cp\u003eUpregulation of inflammatory markers has been well characterised in ALS with increases in chemokines and cytokines such as TNF, CXCL10, interleukins and interferons found to be elevated in ALS patients compared to healthy controls (Tortelli et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). mRNA expression levels of transcription factor, ATF4, and a panel of inflammatory markers were analysed in brain tissue from hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice 30 days after Dox removal. There was a trend towards an increase of ATF4 and MMTV expression in the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice, but expression was not significantly different to LMC mice, although significant increase in ATF4 levels has been shown in this model previously from as early as 1 week off Dox (Luan et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). A mouse endogenous retrovirus (MERV), MMTV, was chosen as a measure of ERV expression (Subramanian et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) but was not induced in this model. However, this does not exclude other MERVs from being induced or involved, especially considering the number of active ERVs present in the mouse genome (Stocking and Kozak, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Significant upregulation of inflammatory markers TNF, CXCL10, and Ifi27l2a and CCL12 was observed. The TDP-43-assocaited increases in these chemokines and cytokines is thought to occur through multiple pathways. For instance, cytoplasmic TDP-43 aggregation is thought to cause activation of microglia to a pro-inflammatory phenotype (Swanson et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) and subsequent release of cytokine and chemokines such as CXCL10 and TNF (Zhao et al., \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although IL-6 did not show a significant increase, there was a trend toward higher expression in hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice.\u003c/p\u003e\u003cp\u003eThere are limited therapeutics available that have shown motor function improvement for ALS (Lu et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Riluzole, an approved therapeutic for ALS, does not show motor function improvement in human ALS or in mice models of ALS but does have a moderate impact on survival for ALS patients (Lacomblez et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1996\u003c/span\u003e, Hogg et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Wright et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Lu et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Using the SOD1\u003csup\u003eG93A\u003c/sup\u003e mouse model, there have been many pre-clinical studies investigating potential treatments that have not translated to human trials (De Cock et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). An example of such trial is the use of a rho kinase inhibitor, Fasudil, which was found to increase both the survival time and motor function in the treated mice (T\u0026ouml;nges et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This improvement in motor function was correlated with a decrease in the release of pro-inflammatory mediators including TNF and CCL2 which lead to a phase II study (Koch et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In the current study, the influence of Triumeq on weight loss, neuroscore, motor function, and mRNA expression for a panel of inflammatory markers was investigated. No significant effects of Triumeq on weight loss or neuroscore were observed at any timepoint. However, a significant effect of Triumeq on motor function was seen at the 15\u0026ndash;19 day timepoint, with significantly higher latency to fall for the Triumeq-treated mice. This also coincided with a significant difference in stride length between the Triumeq treated and untreated mice. The small benefit of delaying motor decline from Triumeq treatment shown here is promising for human ALS patients for two reasons. First, current ALS treatments, Riluzole and Edaravone, which moderately improve survival, have shown no effect in mouse models, including the hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e model used here (Hogg et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Wright et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Thus, the modest improvement seen in mice could translate to greater benefits in humans. Second, while survival was unaffected in our study due to the mice reaching ethical end-point according to weight loss, improved motor function could enhance the quality of life for ALS patients.\u003c/p\u003e\u003cp\u003eFor the mRNA expression analysis, that were no significant differences between the Triumeq treated and untreated mice for any gene except for TDP-43. For TDP-43, Triumeq treated mice had higher expression of hTDP-43 compared to untreated mice with further analysis showing this difference was not due to a difference in a marker of neurons and hence potential neuronal survival. However, this finding raises the possibility that Triumeq may not significantly influence TDP-43 at the mRNA level, though it could potentially play a role in reducing the formation of TDP-43 protein aggregates. In untreated mice, there was a significant correlation between expression of TDP-43 and a neuronal marker, NeuN, which was negated by Triumeq treatment. Our study also assessed the levels of a mouse endogenous retrovirus, MMTV, after Triumeq treatment. There was not a significant difference in the MMTV expression between treatment groups, suggesting that Triumeq does not affect this particular MERV at this disease stage, potentially improving motor function independent of MERV activity. Future studies should expand on this by exploring the expression of additional MERVs.\u003c/p\u003e\u003cp\u003eWhile there were no expression differences between Triumeq treated and untreated mice for ATF4, MMTV or inflammatory markers, the correlation analysis of TDP-43 and the inflammatory markers suggests an influence of Triumeq on inflammatory pathways. A correlation between TDP-43 expression and expression of ATF4, CXCL10, and IRF-1 was observed in the untreated mice, which was not seen in the Triumeq-treated mice. There was, however, a consistent correlation between CXCL10 and IRF-1 regardless of treatment group. While Triumeq did not influence the correlation between CXCL10 and IRF-1, it did disrupt the correlation between TDP-43 and CXCL10 expression. This finding suggests that Triumeq may interrupt TDP-43-dependent CXCL10 expression. CXCL10 is an inflammatory cytokine involved in T-cell recruitment, with T-cell infiltrate found within the brain and spinal cord of ALS patients and other TDP-43 mouse models (Engelhardt et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1993\u003c/span\u003e, Garofalo et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Garofalo et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). T-cells have also been shown to have direct cytotoxic contact with motor neurons in ALS, potentially involved in neurodegenerative processes (Coque et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). With CXCL10 found to be significantly upregulated in this model, a measure of cellular infiltrate would allow for determination of whether Triumeq is influencing this mechanism, resulting in the direct impact on motor function in this model. Furthermore, with CXLC10 expression associated with microglia activation in neurodegeneration (Hunter et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and after viral infection (Chai et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), the trend towards the lower levels of CXCL10 in the Triumeq-treated group could suggest Triumeq is influencing microglia activation, which remains to be investigated. This disrupted association was also found between TDP-43 and ATF4. As previously described, TDP-43 pathology drives inflammation in ALS. TDP-43 pathology is also associated with ATF4, a key player in the unfolded protein response (UPR; Pakos-Zebrucka et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), which has been shown to be dysregulated in ALS (Matus et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). ATF4 upregulation results in autophagy mechanisms which aid in the clearance of TDP-43 aggregates formed in the cytoplasm (Chu \u003cem\u003eet al.\u003c/em\u003e, 2023). However, with aberrant formation of TDP-43 aggregates, this clearance system can be overloaded and result in dysfunctional proteostasis and cell death (Mukherjee et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Furthermore, ATF4 acts as a transcription factor for genes involved in the inflammatory response (Iwasaki \u003cem\u003eet al.\u003c/em\u003e, 2013) and binds to the long terminal repeat (LTR) of human immunodeficiency virus 1 (HIV-1), regulating its transcription (Corne et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). While binding sites for ATF4 on the consensus HERV-K LTR have not been established, binding sites for nuclear factor kappa-light-chain-enhancer of activated B cells (NF-ĸB) are present in the HERV-K LTR and regulate transcription (Manghera and Douville, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Manghera et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). During the unfolded protein response, increases of ATF4, can result in transcription for genes involved in inflammatory response and activate NF-ĸB (Tam et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, Schmitz et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), potentially resulting in regulation of HERV-K transcription. The loss of correlation between TDP-43 and ATF4 following Triumeq treatment suggests that Triumeq may disrupt the association between TDP-43 and ATF4, outlined in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, though it does not appear to act by directly influencing ATF4 or TDP-43 mRNA expression levels. This could be occurring through disruption of the association between TDP-43 aggregation and inflammation or by disruption of ATF4-driven transcription of inflammation or ERVs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThere are caveats of the current study that should be noted. Firstly, the mouse model uses a TDP-43 expression system with a defective nuclear localisation sequence. Therefore, TDP-43 will localise to the cytoplasm regardless of therapeutic intervention, complicating the assessment of Triumeq\u0026rsquo;s effects on TDP-43 pathology, as it occurs in human ALS. The study, unfortunately, had lower sample numbers towards the end of the study at day 22\u0026ndash;30 due to ethical euthanasia and the numbers were lower than the suggested guidelines for mouse studies in ALS (Ludolph et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Future studies with greater numbers should also include measures of motor neuron count and muscle fibre analysis to provide further explanation of the motor function increase in the Triumeq treated hTDP-43\u003csup\u003eΔNLS\u003c/sup\u003e mice. Due to the motor function benefit seen herein, future investigations could include combination therapies to increase the therapeutic benefit of Triumeq, including combinations of anti-inflammatories or other current FDA approved therapeutics for ALS such as Riluzole. Future studies should also investigate the individual components of Triumeq to determine which are responsible for the observed motor function benefits in this study. Notably, a previous study in aged mice with elevated MMTV expression reported improved motor function through enhanced grip strength following treatment with Abacavir only, one component of Triumeq (Liu et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). A further caveat of the current study is the lack of direct measurement of Triumeq concentrations within the brain of Triumeq-treated mice. As such, it remains unclear whether the administered dose achieved therapeutic levels sufficient to have antiretroviral effects within the central nervous system (CNS). However, prior studies have shown that the individual components of Triumeq are capable of penetrating the CNS (Capparelli et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, Letendre et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2008\u003c/span\u003e, Gubernick et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and comparable dosing regimens have been used in previous murine studies (Hu et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017a\u003c/span\u003e, Chen et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, we provide evidence for Triumeq improving motor function in an ALS mouse model. Our study also shows an influence of Triumeq on the association between TDP-43 expression and expression of inflammatory markers that have been previously associated with ALS. While further elucidation of the mechanism of action of Triumeq for ALS needs to be considered, the findings here provide support for further scrutiny on the use of Triumeq treatment for ALS.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003eALS\u003c/em\u003e: Amyotrophic Lateral Sclerosis\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eERVs\u003c/em\u003e: Endogenous retroviruses\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTDP-43\u003c/em\u003e: TAR DNA Binding Protein (43kDa)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eATF4\u003c/em\u003e: Activating Transcription Factor 4\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCXCL10\u003c/em\u003e: C-X-C motif chemokine ligand 10\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIRF-1\u003c/em\u003e: Interferon regulatory factor 1\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHERV-K\u003c/em\u003e: Human endogenous retrovirus type K\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEnv:\u003c/em\u003e Envelope\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRT\u003c/em\u003e: Reverse transcriptase\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHIV\u003c/em\u003e: Human immunodeficiency virus\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eART\u003c/em\u003e: Antiretroviral therapy\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eALSFRS-R\u003c/em\u003e: Amyotrophic lateral sclerosis functional rating scale \u0026ndash; revised\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ep75\u003csup\u003eECD\u003c/sup\u003e\u003c/em\u003e: Extracellular domain of p75\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDox:\u003c/em\u003e Doxycycline\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLMC\u003c/em\u003e: Littermate control\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePBS\u003c/em\u003e: Phosphate-buffered saline\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eOCT\u003c/em\u003e: Optimal cutting temperature\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGAPDH:\u003c/em\u003e Glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSEM\u003c/em\u003e: Standard error of measurement\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePCR:\u003c/em\u003e Polymerase chain reaction\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMMTV\u003c/em\u003e: Mouse mammary tumour virus\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTNF\u003c/em\u003e: Tumor necrosis factor\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIfi27l2a\u003c/em\u003e: interferon alpha-inducible protein 27 like 2A\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCCL12\u003c/em\u003e: C-C motif chemokine ligand 12\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e: Interleukin 6\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLTR\u003c/em\u003e: Long terminal repeat\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNF-ĸB\u003c/em\u003e: Nuclear factor kappa-light-chain-enhancer of activated B cells\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCNS\u003c/em\u003e: Central nervous system\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll supporting information and data are available in the article\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the Flinders University and University of Queensland Animal House staff and Danielle Renfrey for technical assistance\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supported by a FightMND Discovery Grant (DIS-202303-00932; MLR and JC), a MND Research Australia Innovator Grant (IG1950; MLR and JC), the Brazil Family Program for Neurology and the Ross Maclean Fellowship for MND Research (AKW). \u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors and affiliations\u003c/p\u003e\n\u003cp\u003eMotor Neuron and Neurotrophic Research Laboratory and Virus Research Laboratory, College of Medicine and Public Health, Flinders Health and Medical Research Institute, Flinders University, Bedford Park, Adelaide, South Australia, Australia\u003cbr\u003e Megan Fowler, Jillian Carr, Mary-Louise Rogers\u003c/p\u003e\n\u003cp\u003eClem Jones Centre for Ageing Dementia Research, Queensland Brain Institute, The University of Queensland, St Lucia, Queensland, Australia\u003cbr\u003e Adam Walker\u003c/p\u003e\n\u003cp\u003eSydney Pharmacy School, Faculty of Medicine and Health, The University of Sydney, Camperdown, New South Wales, Australia \u003cbr\u003e Adam Walker\u003c/p\u003e\n\u003cp\u003eFaculty of Medicine, Health and Human Sciences, Macquarie University, Sydney, Australia\u003cbr\u003e Julian Gold\u003c/p\u003e\n\u003cp\u003eContributions\u003c/p\u003e\n\u003cp\u003eThe study conception and design were contributed to by A/Prof Rogers, Prof Carr and Prof Gold, Material preparation, data collection and analysis were performed by Prof Walker and Dr Fowler. The first draft of the manuscript was written by Dr Fowler and all authors commented and edited subsequent versions. All authors and read and agreed to the published version of the manuscript. \u003c/p\u003e\n\u003cp\u003eCorresponding Authors\u003c/p\u003e\n\u003cp\u003eCorrespondence to Megan Fowler or Mary-Louise Rogers\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthics Approval\u003c/p\u003e\n\u003cp\u003eAll experiments involving mice were approved by the Flinders University Animal Welfare Committee (Ethics #2931) and breeding of mice at the University of Queensland (UQ Animal Ethics Committee approval 2021-AE000200) were conducted under the National Health and Medical Research Council, Australian code for the care and use of animals for scientific purposes. \u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable \u003c/p\u003e\n\u003cp\u003eConsent to Participate \u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003eConsent for Publication\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003eCompeting Interests\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbe, K., Aoki, M., Tsuji, S., Itoyama, Y., Sobue, G., Togo, M., Hamada, C., Tanaka, M., Akimoto, M. \u0026amp; Nakamura, K. 2017. Safety and efficacy of edaravone in well defined patients with amyotrophic lateral sclerosis: a randomised, double-blind, placebo-controlled trial. \u003cem\u003eThe Lancet Neurology,\u003c/em\u003e 16\u003cstrong\u003e,\u003c/strong\u003e 505-512.\u003c/li\u003e\n\u003cli\u003eCairns, N. J., Neumann, M., Bigio, E. H., Holm, I. E., Troost, D., Hatanpaa, K. J., Foong, C., White Iii, C. L., Schneider, J. A. \u0026amp; Kretzschmar, H. A. 2007. TDP-43 in familial and sporadic frontotemporal lobar degeneration with ubiquitin inclusions. \u003cem\u003eThe American journal of pathology,\u003c/em\u003e 171\u003cstrong\u003e,\u003c/strong\u003e 227-240.\u003c/li\u003e\n\u003cli\u003eCapparelli, E. V., Letendre, S. L., Ellis, R. J., Patel, P., Holland, D. \u0026amp; Mccutchan, J. A. 2005. Population pharmacokinetics of abacavir in plasma and cerebrospinal fluid. \u003cem\u003eAntimicrobial agents and chemotherapy,\u003c/em\u003e 49\u003cstrong\u003e,\u003c/strong\u003e 2504-2506.\u003c/li\u003e\n\u003cli\u003eCastelli, L., Vasta, R., Allen, S. P., Waller, R., Chi\u0026ograve;, A., Traynor, B. J. \u0026amp; Kirby, J. 2024. From use of omics to systems biology: Identifying therapeutic targets for amyotrophic lateral sclerosis. \u003cem\u003eInternational Review of Neurobiology,\u003c/em\u003e 176\u003cstrong\u003e,\u003c/strong\u003e 209-268.\u003c/li\u003e\n\u003cli\u003eChai, Q., She, R., Huang, Y. \u0026amp; Fu, Z. F. 2015. Expression of Neuronal CXCL10 Induced by Rabies Virus Infection Initiates Infiltration of Inflammatory Cells, Production of Chemokines and Cytokines, and Enhancement of Blood-Brain Barrier Permeability. \u003cem\u003eJournal of Virology,\u003c/em\u003e 89\u003cstrong\u003e,\u003c/strong\u003e 870-876.\u003c/li\u003e\n\u003cli\u003eChang, Y.-H. \u0026amp; Dubnau, J. 2019. The Gypsy Endogenous Retrovirus Drives Non-Cell-Autonomous Propagation in a Drosophila TDP-43 Model of Neurodegeneration. \u003cem\u003eCurrent Biology,\u003c/em\u003e 29\u003cstrong\u003e,\u003c/strong\u003e 3135-3152.e4.\u003c/li\u003e\n\u003cli\u003eChen, L., Al-Harthi, L. \u0026amp; Hu, X.-T. 2021. Triumeq increases excitability of pyramidal neurons in the medial prefrontal cortex by facilitating voltage-gated Ca2+ channel function. \u003cem\u003eFrontiers in Pharmacology,\u003c/em\u003e 11\u003cstrong\u003e,\u003c/strong\u003e 617149.\u003c/li\u003e\n\u003cli\u003eChew, J. L. \u0026amp; Chua, K. Y. 2003. Collection of mouse urine for bioassays. \u003cem\u003eLab animal,\u003c/em\u003e 32\u003cstrong\u003e,\u003c/strong\u003e 48-50.\u003c/li\u003e\n\u003cli\u003eCho, H., Proll, S. C., Szretter, K. J., Katze, M. G., Gale Jr, M. \u0026amp; Diamond, M. S. 2013. Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses. \u003cem\u003eNature medicine,\u003c/em\u003e 19\u003cstrong\u003e,\u003c/strong\u003e 458-464.\u003c/li\u003e\n\u003cli\u003eChu, Y. P., Jin, L. W., Wang, L. C., Ho, P. C., Wei, W. Y. \u0026amp; Tsai, K. J. 2023. Transthyretin attenuates TDP-43 proteinopathy by autophagy activation via ATF4 in FTLD-TDP. \u003cem\u003eBrain,\u003c/em\u003e 146\u003cstrong\u003e,\u003c/strong\u003e 2089-2106.\u003c/li\u003e\n\u003cli\u003eCoque, E., Salsac, C., Espinosa-Carrasco, G., Varga, B., Degauque, N., Cadoux, M., Crab\u0026eacute;, R., Virenque, A., Soulard, C. \u0026amp; Fierle, J. K. 2019. Cytotoxic CD8+ T lymphocytes expressing ALS-causing SOD1 mutant selectively trigger death of spinal motoneurons. \u003cem\u003eProceedings of the National Academy of Sciences,\u003c/em\u003e 116\u003cstrong\u003e,\u003c/strong\u003e 2312-2317.\u003c/li\u003e\n\u003cli\u003eCorne, A., Adolphe, F., Estaquier, J., Gaumer, S. \u0026amp; Corsi, J. M. 2024. ATF4 Signaling in HIV-1 Infection: Viral Subversion of a Stress Response Transcription Factor. \u003cem\u003eBiology (Basel),\u003c/em\u003e 13.\u003c/li\u003e\n\u003cli\u003eCrawley, J. N. 1999. Behavioral phenotyping of transgenic and knockout mice: experimental design and evaluation of general health, sensory functions, motor abilities, and specific behavioral tests. \u003cem\u003eBrain research,\u003c/em\u003e 835\u003cstrong\u003e,\u003c/strong\u003e 18-26.\u003c/li\u003e\n\u003cli\u003eDe Cock, L., Bercier, V. \u0026amp; Van Den Bosch, L. 2024. New developments in pre-clinical models of ALS to guide translation. \u003cem\u003eInternational Review of Neurobiology,\u003c/em\u003e 176\u003cstrong\u003e,\u003c/strong\u003e 477-524.\u003c/li\u003e\n\u003cli\u003eDouville, R., Liu, J., Rothstein, J. \u0026amp; Nath, A. 2011. Identification of active loci of a human endogenous retrovirus in neurons of patients with amyotrophic lateral sclerosis. \u003cem\u003eAnnals of neurology,\u003c/em\u003e 69\u003cstrong\u003e,\u003c/strong\u003e 141-151.\u003c/li\u003e\n\u003cli\u003eDubowsky, M., Theunissen, F., Carr, J. M. \u0026amp; Rogers, M.-L. 2023. The Molecular Link Between TDP-43, Endogenous Retroviruses and Inflammatory Neurodegeneration in Amyotrophic Lateral Sclerosis: a Potential Target for Triumeq, an Antiretroviral Therapy. \u003cem\u003eMolecular neurobiology\u003c/em\u003e\u003cstrong\u003e,\u003c/strong\u003e 1-16.\u003c/li\u003e\n\u003cli\u003eEngelhardt, J. I., Tajti, J. \u0026amp; Appel, S. H. 1993. Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. \u003cem\u003eArchives of neurology,\u003c/em\u003e 50\u003cstrong\u003e,\u003c/strong\u003e 30-36.\u003c/li\u003e\n\u003cli\u003eGarcia-Montojo, M., Doucet-O\u0026rsquo;hare, T., Henderson, L. \u0026amp; Nath, A. 2018. Human endogenous retrovirus-K (HML-2): a comprehensive review. \u003cem\u003eCritical Reviews in Microbiology,\u003c/em\u003e 44\u003cstrong\u003e,\u003c/strong\u003e 715-738.\u003c/li\u003e\n\u003cli\u003eGarcia-Montojo, M., Fathi, S., Norato, G., Smith, B., Rowe, D., Kiernan, M., Vucic, S., Mathers, S., Van Eijk, R. \u0026amp; Santamaria, U. 2021. Inhibition of HERV-K (HML-2) in amyotrophic lateral sclerosis patients on antiretroviral therapy. \u003cem\u003eJournal of the neurological sciences,\u003c/em\u003e 423\u003cstrong\u003e,\u003c/strong\u003e 117358.\u003c/li\u003e\n\u003cli\u003eGarofalo, S., Cocozza, G., Bernardini, G., Savage, J., Raspa, M., Aronica, E., Tremblay, M.-E., Ransohoff, R. M., Santoni, A. \u0026amp; Limatola, C. 2022. Blocking immune cell infiltration of the central nervous system to tame Neuroinflammation in Amyotrophic lateral sclerosis. \u003cem\u003eBrain, Behavior, and Immunity,\u003c/em\u003e 105\u003cstrong\u003e,\u003c/strong\u003e 1-14.\u003c/li\u003e\n\u003cli\u003eGarofalo, S., Cocozza, G., Porzia, A., Inghilleri, M., Raspa, M., Scavizzi, F., Aronica, E., Bernardini, G., Peng, L., Ransohoff, R. M., Santoni, A. \u0026amp; Limatola, C. 2020. Natural killer cells modulate motor neuron-immune cell cross talk in models of Amyotrophic Lateral Sclerosis. \u003cem\u003eNature Communications,\u003c/em\u003e 11\u003cstrong\u003e,\u003c/strong\u003e 1773.\u003c/li\u003e\n\u003cli\u003eGold, J., Rowe, D. B., Kiernan, M. C., Vucic, S., Mathers, S., Van Eijk, R. P., Nath, A., Garcia Montojo, M., Norato, G. \u0026amp; Santamaria, U. A. 2019. Safety and tolerability of Triumeq in amyotrophic lateral sclerosis: the lighthouse trial. \u003cem\u003eAmyotrophic Lateral Sclerosis and Frontotemporal Degeneration,\u003c/em\u003e 20\u003cstrong\u003e,\u003c/strong\u003e 595-604.\u003c/li\u003e\n\u003cli\u003eGubernick, S. I., F\u0026eacute;lix, N., Lee, D., Xu, J. J. \u0026amp; Hamad, B. 2016. The HIV therapy market. Nature Publishing Group.\u003c/li\u003e\n\u003cli\u003eHogg, M. C., Halang, L., Woods, I., Coughlan, K. S. \u0026amp; Prehn, J. H. 2018. Riluzole does not improve lifespan or motor function in three ALS mouse models. \u003cem\u003eAmyotrophic Lateral Sclerosis and Frontotemporal Degeneration,\u003c/em\u003e 19\u003cstrong\u003e,\u003c/strong\u003e 438-445.\u003c/li\u003e\n\u003cli\u003eHu, S., Neff, C. P., Kumar, D. M., Habu, Y., Akkina, S. R., Seki, T. \u0026amp; Akkina, R. 2017a. A humanized mouse model for HIV-2 infection and efficacy testing of a single-pill triple-drug combination anti-retroviral therapy. \u003cem\u003eVirology,\u003c/em\u003e 501\u003cstrong\u003e,\u003c/strong\u003e 115-118.\u003c/li\u003e\n\u003cli\u003eHu, Y., Cao, C., Qin, X.-Y., Yu, Y., Yuan, J., Zhao, Y. \u0026amp; Cheng, Y. 2017b. Increased peripheral blood inflammatory cytokine levels in amyotrophic lateral sclerosis: a meta-analysis study. \u003cem\u003eScientific Reports,\u003c/em\u003e 7\u003cstrong\u003e,\u003c/strong\u003e 9094.\u003c/li\u003e\n\u003cli\u003eHughes, J. F. \u0026amp; Coffin, J. M. 2004. Human endogenous retrovirus K solo-LTR formation and insertional polymorphisms: implications for human and viral evolution. \u003cem\u003eProceedings of the National Academy of Sciences,\u003c/em\u003e 101\u003cstrong\u003e,\u003c/strong\u003e 1668-1672.\u003c/li\u003e\n\u003cli\u003eHunter, M., Spiller, K. J., Dominique, M. A., Xu, H., Hunter, F. W., Fang, T. C., Canter, R. G., Roberts, C. J., Ransohoff, R. M., Trojanowski, J. Q. \u0026amp; Lee, V. M. Y. 2021. Microglial transcriptome analysis in the rNLS8 mouse model of TDP-43 proteinopathy reveals discrete expression profiles associated with neurodegenerative progression and recovery. \u003cem\u003eActa Neuropathologica Communications,\u003c/em\u003e 9\u003cstrong\u003e,\u003c/strong\u003e 140.\u003c/li\u003e\n\u003cli\u003eIwasaki, Y., Suganami, T., Hachiya, R., Shirakawa, I., Kim-Saijo, M., Tanaka, M., Hamaguchi, M., Takai-Igarashi, T., Nakai, M., Miyamoto, Y. \u0026amp; Ogawa, Y. 2013. Activating Transcription Factor 4 Links Metabolic Stress to Interleukin-6 Expression in Macrophages. \u003cem\u003eDiabetes,\u003c/em\u003e 63\u003cstrong\u003e,\u003c/strong\u003e 152-161.\u003c/li\u003e\n\u003cli\u003eKoch, J. C., Leha, A., Bidner, H., Cordts, I., Dorst, J., G\u0026uuml;nther, R., Zeller, D., Braun, N., Metelmann, M. \u0026amp; Corcia, P. 2024. Safety, tolerability, and efficacy of fasudil in amyotrophic lateral sclerosis (ROCK-ALS): a phase 2, randomised, double-blind, placebo-controlled trial. \u003cem\u003eThe Lancet Neurology,\u003c/em\u003e 23\u003cstrong\u003e,\u003c/strong\u003e 1133-1146.\u003c/li\u003e\n\u003cli\u003eLacomblez, L., Bensimon, G., Leigh, P., Guillet, P., Powe, L., Durrleman, S., Delumeau, J. \u0026amp; Meininger, V. 1996. A confirmatory dose-ranging study of riluzole in ALS. \u003cem\u003eNeurology,\u003c/em\u003e 47\u003cstrong\u003e,\u003c/strong\u003e 242S-250S.\u003c/li\u003e\n\u003cli\u003eLeitner, M., Menzies, S. \u0026amp; Lutz, C. 2009. Working with ALS mice: Guidelines for preclinical testing \u0026amp; colony management. \u003cem\u003eThe Jackson Laboratory\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eLetendre, S., Marquie-Beck, J., Capparelli, E., Best, B., Clifford, D., Collier, A. C., Gelman, B. B., Mcarthur, J. C., Mccutchan, J. A. \u0026amp; Morgello, S. 2008. Validation of the CNS penetration-effectiveness rank for quantifying antiretroviral penetration into the central nervous system. \u003cem\u003eArchives of neurology,\u003c/em\u003e 65\u003cstrong\u003e,\u003c/strong\u003e 65-70.\u003c/li\u003e\n\u003cli\u003eLi, J., Akagi, K., Hu, Y., Trivett, A. L., Hlynialuk, C. J., Swing, D. A., Volfovsky, N., Morgan, T. C., Golubeva, Y. \u0026amp; Stephens, R. M. 2012. Mouse endogenous retroviruses can trigger premature transcriptional termination at a distance. \u003cem\u003eGenome research,\u003c/em\u003e 22\u003cstrong\u003e,\u003c/strong\u003e 870-884.\u003c/li\u003e\n\u003cli\u003eLi, W., Lee, M.-H., Henderson, L., Tyagi, R., Bachani, M., Steiner, J., Campanac, E., Hoffman, D. A., Von Geldern, G. \u0026amp; Johnson, K. 2015. Human endogenous retrovirus-K contributes to motor neuron disease. \u003cem\u003eScience Translational Medicine,\u003c/em\u003e 7\u003cstrong\u003e,\u003c/strong\u003e 307ra153-307ra153.\u003c/li\u003e\n\u003cli\u003eLi, W., Pandya, D., Pasternack, N., Garcia-Montojo, M., Henderson, L., Kozak, C. A. \u0026amp; Nath, A. 2022. Retroviral Elements in Pathophysiology and as Therapeutic Targets for Amyotrophic Lateral Sclerosis. \u003cem\u003eNeurotherapeutics,\u003c/em\u003e 19\u003cstrong\u003e,\u003c/strong\u003e 1085-1101.\u003c/li\u003e\n\u003cli\u003eLiu, X., Liu, Z., Wu, Z., Ren, J., Fan, Y., Sun, L., Cao, G., Niu, Y., Zhang, B. \u0026amp; Ji, Q. 2023. Resurrection of endogenous retroviruses during aging reinforces senescence. \u003cem\u003eCell\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eLu, L., Deng, Y. \u0026amp; Xu, R. 2024. Current potential therapeutics of amyotrophic lateral sclerosis. \u003cem\u003eFrontiers in Neurology,\u003c/em\u003e 15\u003cstrong\u003e,\u003c/strong\u003e 1402962.\u003c/li\u003e\n\u003cli\u003eLuan, W., Wright, A. L., Brown-Wright, H., Le, S., San Gil, R., Madrid San Martin, L., Ling, K., Jafar-Nejad, P., Rigo, F. \u0026amp; Walker, A. K. 2023. Early activation of cellular stress and death pathways caused by cytoplasmic TDP-43 in the rNLS8 mouse model of ALS and FTD. \u003cem\u003eMolecular Psychiatry,\u003c/em\u003e 28\u003cstrong\u003e,\u003c/strong\u003e 2445-2461.\u003c/li\u003e\n\u003cli\u003eLudolph, A. C., Bendotti, C., Blaugrund, E., Chio, A., Greensmith, L., Loeffler, J.-P., Mead, R., Niessen, H. G., Petri, S. \u0026amp; Pradat, P.-F. 2010. Guidelines for preclinical animal research in ALS/MND: A consensus meeting. \u003cem\u003eAmyotrophic Lateral Sclerosis,\u003c/em\u003e 11\u003cstrong\u003e,\u003c/strong\u003e 38-45.\u003c/li\u003e\n\u003cli\u003eManghera, M. \u0026amp; Douville, R. N. 2013. Endogenous retrovirus-K promoter: a landing strip for inflammatory transcription factors? \u003cem\u003eRetrovirology,\u003c/em\u003e 10\u003cstrong\u003e,\u003c/strong\u003e 1-11.\u003c/li\u003e\n\u003cli\u003eManghera, M., Ferguson-Parry, J., Lin, R. \u0026amp; Douville, R. N. 2016. NF-\u0026kappa;B and IRF1 induce endogenous retrovirus K expression via interferon-stimulated response elements in its 5\u0026prime; long terminal repeat. \u003cem\u003eJournal of virology,\u003c/em\u003e 90\u003cstrong\u003e,\u003c/strong\u003e 9338-9349.\u003c/li\u003e\n\u003cli\u003eMasrori, P. \u0026amp; Van Damme, P. 2020. Amyotrophic lateral sclerosis: a clinical review. \u003cem\u003eEuropean journal of neurology,\u003c/em\u003e 27\u003cstrong\u003e,\u003c/strong\u003e 1918-1929.\u003c/li\u003e\n\u003cli\u003eMatus, S., Lopez, E., Valenzuela, V., Nassif, M. \u0026amp; Hetz, C. 2013. Functional contribution of the transcription factor ATF4 to the pathogenesis of amyotrophic lateral sclerosis. \u003cem\u003ePloS one,\u003c/em\u003e 8\u003cstrong\u003e,\u003c/strong\u003e e66672.\u003c/li\u003e\n\u003cli\u003eMiana‐Mena, F. J., Mu\u0026ntilde;oz, M. J., Yag\u0026uuml;e, G., Mendez, M., Moreno, M., Ciriza, J., Zaragoza, P. \u0026amp; Osta, R. 2005. Optimal methods to characterize the G93A mouse model of ALS. \u003cem\u003eAmyotrophic Lateral Sclerosis,\u003c/em\u003e 6\u003cstrong\u003e,\u003c/strong\u003e 55-62.\u003c/li\u003e\n\u003cli\u003eMiller, T. M., Cudkowicz, M. E., Genge, A., Shaw, P. J., Sobue, G., Bucelli, R. C., Chi\u0026ograve;, A., Van Damme, P., Ludolph, A. C. \u0026amp; Glass, J. D. 2022. Trial of antisense oligonucleotide tofersen for SOD1 ALS. \u003cem\u003eNew England Journal of Medicine,\u003c/em\u003e 387\u003cstrong\u003e,\u003c/strong\u003e 1099-1110.\u003c/li\u003e\n\u003cli\u003eMukherjee, D., Bercz, L. S., Torok, M. A. \u0026amp; Mace, T. A. 2020. Regulation of cellular immunity by activating transcription factor 4. \u003cem\u003eImmunol Lett,\u003c/em\u003e 228\u003cstrong\u003e,\u003c/strong\u003e 24-34.\u003c/li\u003e\n\u003cli\u003ePakos-Zebrucka, K., Koryga, I., Mnich, K., Ljujic, M., Samali, A. \u0026amp; Gorman, A. M. 2016. The integrated stress response. \u003cem\u003eEMBO Rep,\u003c/em\u003e 17\u003cstrong\u003e,\u003c/strong\u003e 1374-1395.\u003c/li\u003e\n\u003cli\u003ePasternack, N., Doucet-O\u0026rsquo;hare, T., Johnson, K., Paulsen, O. \u0026amp; Nath, A. 2024. Endogenous retroviruses are dysregulated in ALS. \u003cem\u003eIscience,\u003c/em\u003e 27.\u003c/li\u003e\n\u003cli\u003eRao, X., Huang, X., Zhou, Z. \u0026amp; Lin, X. 2013. An improvement of the 2\u0026circ; (\u0026ndash;delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. \u003cem\u003eBiostatistics, bioinformatics and biomathematics,\u003c/em\u003e 3\u003cstrong\u003e,\u003c/strong\u003e 71.\u003c/li\u003e\n\u003cli\u003eRuffo, P., Traynor, B. J. \u0026amp; Conforti, F. L. 2025. Advancements in genetic research and RNA therapy strategies for amyotrophic lateral sclerosis (ALS): current progress and future prospects. \u003cem\u003eJournal of Neurology,\u003c/em\u003e 272\u003cstrong\u003e,\u003c/strong\u003e 233.\u003c/li\u003e\n\u003cli\u003eSchmitz, M. L., Shaban, M. S., Albert, B. V., G\u0026ouml;k\u0026ccedil;en, A. \u0026amp; Kracht, M. 2018. The Crosstalk of Endoplasmic Reticulum (ER) Stress Pathways with NF-\u0026kappa;B: Complex Mechanisms Relevant for Cancer, Inflammation and Infection. \u003cem\u003eBiomedicines,\u003c/em\u003e 6.\u003c/li\u003e\n\u003cli\u003eShepheard, S. R., Chataway, T., Schultz, D. W., Rush, R. A. \u0026amp; Rogers, M.-L. 2014. The extracellular domain of neurotrophin receptor p75 as a candidate biomarker for amyotrophic lateral sclerosis. \u003cem\u003ePLoS One,\u003c/em\u003e 9\u003cstrong\u003e,\u003c/strong\u003e e87398.\u003c/li\u003e\n\u003cli\u003eShepheard, S. R., Wuu, J., Cardoso, M., Wiklendt, L., Dinning, P. G., Chataway, T., Schultz, D., Benatar, M. \u0026amp; Rogers, M.-L. 2017. Urinary p75ECD A prognostic, disease progression, and pharmacodynamic biomarker in ALS. \u003cem\u003eNeurology,\u003c/em\u003e 88\u003cstrong\u003e,\u003c/strong\u003e 1137-1143.\u003c/li\u003e\n\u003cli\u003eSmith, K. S., Rush, R. A. \u0026amp; Rogers, M. L. 2015. Characterization and changes in neurotrophin receptor p75‐expressing motor neurons in SOD1G93AG1H mice. \u003cem\u003eJournal of Comparative Neurology,\u003c/em\u003e 523\u003cstrong\u003e,\u003c/strong\u003e 1664-1682.\u003c/li\u003e\n\u003cli\u003eSteiner, J. P., Bachani, M., Malik, N., Demarino, C., Li, W., Sampson, K., Lee, M. H., Kowalak, J., Bhaskar, M. \u0026amp; Doucet‐O\u0026apos;hare, T. 2022. Human Endogenous Retrovirus K Envelope in Spinal Fluid of Amyotrophic Lateral Sclerosis Is Toxic. \u003cem\u003eAnnals of Neurology,\u003c/em\u003e 92\u003cstrong\u003e,\u003c/strong\u003e 545-561.\u003c/li\u003e\n\u003cli\u003eStocking, C. \u0026amp; Kozak, C. A. 2008. Murine endogenous retroviruses. \u003cem\u003eCell Mol Life Sci,\u003c/em\u003e 65\u003cstrong\u003e,\u003c/strong\u003e 3383-98.\u003c/li\u003e\n\u003cli\u003eSubramanian, R. P., Wildschutte, J. H., Russo, C. \u0026amp; Coffin, J. M. 2011. Identification, characterization, and comparative genomic distribution of the HERV-K (HML-2) group of human endogenous retroviruses. \u003cem\u003eRetrovirology,\u003c/em\u003e 8\u003cstrong\u003e,\u003c/strong\u003e 90.\u003c/li\u003e\n\u003cli\u003eSwanson, M. E. V., Mrkela, M., Turner, C., Curtis, M. A., Faull, R. L. M., Walker, A. K. \u0026amp; Scotter, E. L. 2025. Neuronal TDP-43 aggregation drives changes in microglial morphology prior to immunophenotype in amyotrophic lateral sclerosis. \u003cem\u003eActa Neuropathol Commun,\u003c/em\u003e 13\u003cstrong\u003e,\u003c/strong\u003e 39.\u003c/li\u003e\n\u003cli\u003eTam, A. B., Mercado, E. L., Hoffmann, A. \u0026amp; Niwa, M. 2012. ER stress activates NF-\u0026kappa;B by integrating functions of basal IKK activity, IRE1 and PERK. \u003cem\u003ePloS one,\u003c/em\u003e 7\u003cstrong\u003e,\u003c/strong\u003e e45078.\u003c/li\u003e\n\u003cli\u003eT\u0026ouml;nges, L., G\u0026uuml;nther, R., Suhr, M., Jansen, J., Balck, A., Saal, K. A., Barski, E., Nientied, T., G\u0026ouml;tz, A. A. \u0026amp; Koch, J. C. 2014. Rho kinase inhibition modulates microglia activation and improves survival in a model of amyotrophic lateral sclerosis. \u003cem\u003eGlia,\u003c/em\u003e 62\u003cstrong\u003e,\u003c/strong\u003e 217-232.\u003c/li\u003e\n\u003cli\u003eTortelli, R., Zecca, C., Piccininni, M., Benmahamed, S., Dell\u0026apos;abate, M. T., Barulli, M. R., Capozzo, R., Battista, P. \u0026amp; Logroscino, G. 2020. Plasma inflammatory cytokines are elevated in ALS. \u003cem\u003eFrontiers in neurology,\u003c/em\u003e 11\u003cstrong\u003e,\u003c/strong\u003e 552295.\u003c/li\u003e\n\u003cli\u003eVan Eijk, R. P., Jones, A. R., Sproviero, W., Shatunov, A., Shaw, P. J., Leigh, P. N., Young, C. A., Shaw, C. E., Mora, G. \u0026amp; Mandrioli, J. 2017. Meta-analysis of pharmacogenetic interactions in amyotrophic lateral sclerosis clinical trials. \u003cem\u003eNeurology,\u003c/em\u003e 89\u003cstrong\u003e,\u003c/strong\u003e 1915-1922.\u003c/li\u003e\n\u003cli\u003eWalker, A. K., Spiller, K. J., Ge, G., Zheng, A., Xu, Y., Zhou, M., Tripathy, K., Kwong, L. K., Trojanowski, J. Q. \u0026amp; Lee, V. M. Y. 2015. Functional recovery in new mouse models of ALS/FTLD after clearance of pathological cytoplasmic TDP-43. \u003cem\u003eActa Neuropathologica,\u003c/em\u003e 130\u003cstrong\u003e,\u003c/strong\u003e 643-660.\u003c/li\u003e\n\u003cli\u003eWalmsley, S. L., Antela, A., Clumeck, N., Duiculescu, D., Eberhard, A., Guti\u0026eacute;rrez, F., Hocqueloux, L., Maggiolo, F., Sandkovsky, U. \u0026amp; Granier, C. 2013. Dolutegravir plus abacavir\u0026ndash;lamivudine for the treatment of HIV-1 infection. \u003cem\u003eNew England Journal of Medicine,\u003c/em\u003e 369\u003cstrong\u003e,\u003c/strong\u003e 1807-1818.\u003c/li\u003e\n\u003cli\u003eWertman, V., Gromova, A., La Spada, A. R. \u0026amp; Cortes, C. J. 2019. Low-cost gait analysis for behavioral phenotyping of mouse models of neuromuscular disease. \u003cem\u003eJoVE (Journal of Visualized Experiments)\u003c/em\u003e\u003cstrong\u003e,\u003c/strong\u003e e59878.\u003c/li\u003e\n\u003cli\u003eWright, A. L., Della Gatta, P. A., Le, S., Berning, B. A., Mehta, P., Jacobs, K. R., Gul, H., San Gil, R., Hedl, T. J. \u0026amp; Riddell, W. R. 2021. Riluzole does not ameliorate disease caused by cytoplasmic TDP‐43 in a mouse model of amyotrophic lateral sclerosis. \u003cem\u003eEuropean Journal of Neuroscience,\u003c/em\u003e 54\u003cstrong\u003e,\u003c/strong\u003e 6237-6255.\u003c/li\u003e\n\u003cli\u003eZhao, W., Beers, D. R., Bell, S., Wang, J., Wen, S., Baloh, R. H. \u0026amp; Appel, S. H. 2015. TDP-43 activates microglia through NF-\u0026kappa;B and NLRP3 inflammasome. \u003cem\u003eExperimental Neurology,\u003c/em\u003e 273\u003cstrong\u003e,\u003c/strong\u003e 24-35.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Amyotrophic Lateral Sclerosis, Endogenous Retrovirus, TDP-43, Inflammation, Neurodegeneration, Triumeq, Antiretroviral Therapy","lastPublishedDoi":"10.21203/rs.3.rs-7351593/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7351593/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eAmyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterised by the accumulation of TAR DNA Binding Protein (43kDa; TDP-43) within the cytoplasm of neurons. Endogenous retroviruses (ERVs) have been implicated in ALS pathology and the application of antiretroviral therapy, specifically Triumeq, has been proposed for treatment of ALS. However, evidence to support the actions of Triumeq in ALS is lacking.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThis study utilised the doxycycline (Dox)-suppressible rNLS8 TDP-43 expression mouse model to investigate the effects of Triumeq on ALS disease pathology and progression. In this model, TDP-43 accumulation in the cytoplasm was induced after removal of Dox. Disease progression was assessed through measures of body weight, neurological score, motor function and inflammatory marker expression.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eTriumeq treatment significantly improved motor function early on in the disease course but did not impact other disease progression markers or disease endpoint. In this TDP-43 ALS mouse model, there was a positive association of TDP-43 mRNA levels with transcription factor ATF4, and inflammatory markers CXCL10 and IRF-1, and Triumeq treatment negated this association.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eTriumeq treatment transiently improved motor function and influenced TDP-43 associated inflammatory gene expression in an ALS mouse model. These findings support the potential use of Triumeq in treating TDP-43-associated ALS and supports further investigation to better understand if the beneficial actions of Triumeq are via impact on ERVs or indirectly through disruption of TDP-43-driven inflammation in ALS.\u003c/p\u003e","manuscriptTitle":"Improving Motor Function in Amyotrophic Lateral Sclerosis: The impact of Triumeq on a TDP-43 mouse model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 16:56:24","doi":"10.21203/rs.3.rs-7351593/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"580bffc2-a681-4123-83a9-14b32da882a1","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-02T15:23:59+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-03 16:56:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7351593","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7351593","identity":"rs-7351593","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.