Low-dose simvastatin protects pancreatic cancer cells by promoting mitochondrial autophagy through TFEB

Low-dose simvastatin protects pancreatic cancer cells by promoting mitochondrial autophagy through TFEB | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Low-dose simvastatin protects pancreatic cancer cells by promoting mitochondrial autophagy through TFEB Zhiliang Wang, Di Wu, Yue Zhang, Weibo Chen, Yang Yang, Yue Yang, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7657011/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Jan, 2026 Read the published version in Cellular Oncology → Version 1 posted 13 You are reading this latest preprint version Abstract Pancreatic cancer is typically accompanied by fibrosis, forming a dense stromal matrix. This dense matrix restricts drug penetration, making it difficult for drugs to effectively reach tumor cells. Additionally, pancreatic cancer has inadequate local blood supply and "vascular irregularity," which makes it challenging for drugs to reach the core of the tumor. Even if some drugs reach the pancreas through systemic circulation, poor vascular permeability prevents them from effectively entering tumor cells, resulting in suboptimal therapeutic effects. Statins were initially used to treat high cholesterol levels and prevent cardiovascular diseases, but recent studies suggest that they may also have potential therapeutic effects on cancer, particularly certain types of cancer such as pancreatic cancer. However, clinical research on the use of statins for pancreatic cancer treatment is still ongoing, and the results are inconsistent. The effects of statins on pancreatic cancer may vary depending on the dose. Due to the aforementioned limitations of fibrosis and lack of blood supply in pancreatic cancer, simvastatin only exerts its effect on pancreatic cancer cells at low doses.The purpose of this study is to explore the effects of low-dose simvastatin on pancreatic cancer cells and the underlying mechanisms. We investigated the effects of different concentrations of simvastatin on pancreatic cancer cells. The vitality of the cells was evaluated by CCK8, EDU staining, and the level of ferroptosis in pancreatic cancer cells was detected by flow cytometry detection of C11, MDA, ROS. We found that small doses of simvastatin can resist the toxicity of Erastin against pancreatic cancer cells. Under the transmission electron microscope, more mitophagosomes were produced in pancreatic cancer cells treated with small dose of simvastatin, and immunofluorescence revealed increased co-localization of lysosomes and mitochondria, indicating that simvastatin promoted the occurrence of mitophagy. At the same time, immunofluorescence confirmed that simvastatin promoted the nuclear translocation of TFEB, and chromatin immunoprecipitation and dual-luciferase gene report confirmed that TFEB is the transcription factor of P62/SQSTM1. This study clarified that a small dose of simvastatin, in the event of mitochondrial stress in pancreatic cancer cells, induces mitophagy to clear damaged mitochondria, protecting pancreatic cancer cells from ferroptosis and apoptosis, by promoting the transcription of P62/SQSTM1 through the nuclear translocation of TFEB. These findings may explain one of the reasons for the suboptimal efficacy of simvastatin in the treatment of pancreatic cancer, while also providing new insights for research on the antitumor effects of statins. TFEB Simvastatin P62 Mitochondrial autophagy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction The incidence and mortality rates of pancreatic cancer have been steadily increasing globally, particularly in developed countries. According to the latest statistics, pancreatic cancer is the fourth leading cause of cancer-related death in the United States, and it is expected to become the second leading cause by 2030[1].The five-year survival rate for pancreatic cancer is very low, generally around 5%[2], primarily because most patients are diagnosed at an advanced stage when the cancer is locally advanced or metastatic. Currently, surgical resection is the only potentially curative treatment, but only a small number of patients are eligible for surgery, as most are diagnosed when surgery is no longer an option.Treatment for pancreatic cancer remains a challenge, with traditional approaches including surgery, chemotherapy, radiation therapy, and targeted therapy[3]. Pancreatic cancer has a unique and complex tumor microenvironment. Surrounding the tumor is a large amount of fibrous tissue, which forms a physical barrier that hinders the effective penetration of drugs. The abundance of collagen fibers and immunosuppressive cells (such as cancer-associated fibroblasts) also limits the therapeutic efficacy of drugs[4].The tumor vasculature in pancreatic cancer is abnormal, leading to very limited blood supply to the tumor tissue. Low blood flow not only restricts the distribution of drugs within the tumor region but also impairs the permeability of therapeutic agents. The blood vessels within the tumor are irregular, often accompanied by high-pressure tumor stroma, further hindering drug penetration and effective delivery[5]. Statins, commonly used to lower cholesterol levels in the blood, have also been found to have potential anti-cancer effects in recent studies[6]. Although the anti-cancer mechanisms of statins are still under investigation, some research suggests that their anti-cancer effects may be related to several mechanisms: Statins inhibit HMG-CoA reductase (3-hydroxy-3-methylglutaryl-coenzyme A reductase), which is the rate-limiting enzyme in the cholesterol biosynthesis pathway[7]. By reducing cholesterol synthesis, statins not only lower cholesterol levels but also interfere with the structure of the cell membrane, affecting the proliferation and growth of tumor cells. Cholesterol is an important component of the cell membrane, and inhibiting its synthesis may lead to changes in the structure and function of the tumor cell membrane, thereby inhibiting tumor cell growth. Statins have also been found to have anti-angiogenic effects, meaning they may limit tumor growth by inhibiting the formation of new blood vessels. Tumors require blood vessels to obtain oxygen and nutrients to support their growth and metastasis. Statins can reduce the expression of angiogenesis factors such as vascular endothelial growth factor (VEGF), slowing the tumor's blood supply and thereby inhibiting its growth[8]. Although statins have shown potential anti-cancer effects in many studies, some research suggests that, in certain cases, statins may promote tumor growth or progression. Recent studies have shown that statins not only have cholesterol-lowering effects but also exhibit potential antioxidant properties in the tumor microenvironment. Antioxidant stress refers to the regulation of intracellular redox balance to reduce damage caused by oxidative stress. Statins inhibit the production of reactive oxygen species (ROS) through multiple mechanisms, thereby reducing oxidative stress. ROS are generated during cellular metabolism, particularly in the mitochondria through oxidative phosphorylation[9]. Studies suggest that low doses of statins can reduce ROS production by affecting cholesterol biosynthesis pathways, thereby lowering cellular oxidative metabolism[10]. Mitochondria are the main source of reactive oxygen species (ROS) in cells. Under normal conditions, mitochondria generate small amounts of ROS during cellular respiration, which play a positive role in cell signaling and adaptation. However, mitochondrial damage often leads to the excessive accumulation of ROS, which increases oxidative stress and further damages the cell's DNA, lipids, and proteins, ultimately inhibiting tumor growth[11]. When using statins, due to the pancreatic cancer barrier or blood supply factors, the difficulty of the drug penetrating the cancer tissue raises the question of whether the small amount of statins that does enter the cancer tissue also exerts an antioxidant stress effect, which requires further investigation. Erastin promotes the accumulation of ROS, leading to mitochondrial membrane damage. This damage induces the formation of pores on the mitochondrial membrane, resulting in mitochondrial dysfunction[12]. Transcription factor EB (TFEB) is an important transcription factor in autophagy, which can directly regulate the expression of autophagy-associated proteins.[13] In this study, We used Erastin to induce mitochondrial damage in pancreatic cancer cells and treated the cells with different concentrations of Simvastatin to observe its effects on pancreatic cancer cells.We found that a small dose of simvastatin could promote the nuclear translocation of TFEB and promote P62 transcription. During mitochondrial stress, it clears damaged mitochondria via autophagy, inhibiting apoptosis and ferroptosis of pancreatic cancer cells. Our study reveals one of the reasons for the suboptimal efficacy of statins, providing new insights for the use of statins in the treatment of pancreatic cancer. 2. Material and methods 2.1 Cell culture The human pancreatic cancer cell lines PANC-1 and SW1990 were obtained from the American Type Culture Collection (ATCC) and were passaged in our laboratory fewer than 6 months after receipt. PANC-1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) supplemented with 10% FBS (Gibco). SW1990 cells were cultured in L15 medium (HyClone) supplemented with 10% FBS. The incubator was set to 37°C with 5% carbon dioxide (CO₂) concentration. 2.2 RNA isolation and quantitative real-time PCR Total RNA was extracted from cultured cells using the RNA Purification Kit (EZBioscience, cat. no. B004D) combined with DNase I treatment. cDNA was synthesized from 1 μg of total RNA using the PrimeScript RT reagent Kit (TaKaRa, cat. no. RR036A). Gene expression levels were measured by quantitative PCR (Thermo Fisher Scientific) using Power SYBR Green PCR Mix . The information of primers was listed below. TFEB: 5'- CCTGGAGATGACCAACAAGCAG -3' (forward), 5'- TAGGCAGCTCCTGCTTCACCAC -3' (reverse); SQSTM1/P62: 5'- TGTGTAGCGTCTGCGAGGGAAA -3' (forward), 5'- AGTGTCCGTGTTTCACCTTCCG-3' (reverse). 2.3 Western blotting Briefly, whole-cell protein lysates were extracted by RIPA lysis buffer containing protease and phosphatase inhibitors (Beyotime, cat. no. P1050) and then separated by SDS-AGE and blotted onto polyvinylidene fluoride membranes (Bio-Rad). After blocking, the membranes were incubated with the corresponding antibodies at 4°C overnight. Next, the membranes were incubated with HRP-conjugated secondary antibodies. Finally, signals of the immunoblots were developed by an ECL system (Millipore, Billerica, USA) and captured by a Tanon 5200 Chemiluminescent Imaging System (Shanghai, China). We obtained antibodies targeting TFEB (Proteintech, 13372-1-AP), SQSTM1/p62 (Affinity, AF5384), LC3B (Affinity, AF4650), PINK1 (Affinity, DF7742), Parkin (Affinity, AF0235), Histone H3 (Affinity, BF9211), β-actin (Santa Cruz, sc-47778). Next, the membranes were probed with secondary antibodies conjugated to HRP Goat Anti-Mouse IgG (H+L) (ABclonal, AS003), and HRP Goat Anti-Rat IgG (H+L) (ABclonal, AS028). Antigen-antibody complexes were visualized using the Omni-ECLTM Enhanced Pico Light Chemiluminescence Kit (epizyme, SQ101L). 2.4 Chemicals BODIPYTM 581/591 C11 was purchased from Invitrogen (InvitrogenTM, D3861). Erastin(S724204) and Simvastatin(S179205) were purchased from Selleck. 2.5 Stable knockdown and overexpression of TFEB by lentiviral vectors We seeded 1 × 10⁶ cells in each well of a 6-well plate with 2 mL of complete medium and transduced them with lentiviral vectors（HANBIO Shanghai, China）at a multiplicity of infection (MOI) of 10:1. The transduction was performed in antibiotic-free medium supplemented with polybrene (8 μg/mL). After recovery in complete medium, puromycin (5 μg/mL) was added to select transduced cells.The sequences were as follows: shTFEB-1: 5′-CGATGTCCTTGGCTACATCAA-3′; shTFEB-2: 5′-GAGACGAAGGTTCAACATCAA-3′. The designed sequences were cloned and inserted into the vector pCMV-c-flag（Beyotime）to generate TFEB expression plasmids. 2.6 CCK-8 cell viability assay and colony-forming unit assay Cell viability was assessed using the Cell Counting Kit-8 according to the manufacturer’s instructions. Briefly, cells were seeded into 96-well plates at a density of 3×10³ cells in 100μL of complete medium and incubated overnight to allow for attachment. After treatment with Erastin(5μM) and various concentrations of simvastatin (1-6μM) for 96 h. Next, the cells were treated with 10μL of CCK-8 reagent for 2 h and incubated for an additional 1 hours at 37°C. The absorbance at 450 nm was measured using a microplate reader. Cell viability was calculated based on the absorbance values and normalized to the control group. For the colony formation assay, cells were seeded in 6-well plates at a density of 2000 cells per well and cultured for 48 h, and treated with Erastin(5μM) and simvastatin(2μM) for 14 days to allow colony formation. The medium was replaced every 3 days. At the end of the incubation period, colonies were washed gently with PBS, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet for 30 minutes at room temperature. The plates were then rinsed with water and air-dried. 2.7 5-Ethynyl-20-deoxyuridine (EdU) incorporation assay Cell proliferation was assessed using the EdU (5-ethynyl-2′-deoxyuridine) assay with a commercial kit (Beyotime, cat. no. C0078S), according to the manufacturer’s instructions. Briefly, cells were seeded in 24-well plates and treated with Erastin(5μM) and simvastatin(2μM) for 48 h, and incubated with 10 μM EdU for 2 hours at 37°C. After incubation, cells were fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.5% Triton X-100 in PBS for 20 minutes, and stained with the Click-iT reaction cocktail for 30 minutes in the dark. Finally, cell nuclei were counterstained with DAPI. Stained cells were visualized and imaged under a fluorescence microscope, and EdU-positive cells were quantified to evaluate proliferative activity. 2.8 BODIPYTM 581/591 C11 staining and Reactive oxygen species assay Lipid peroxidation was evaluated using the fluorescent probe BODIPY™ 581/591 C11 (Thermo Fisher Scientific, Cat. No. D3861) according to the manufacturer’s instructions. Briefly, cells were seeded in 6-well plates and treated as indicated. After treating with Erastin(5μM) and simvastatin(2μM) for 48 h, cells were incubated with 2 μM BODIPY™ 581/591 C11 in serum-free medium for 30 minutes at 37°C in the dark. After incubation, cells were washed twice with PBS, and fluorescence was detected using a fluorescence microscope or flow cytometer. Lipid peroxidation was assessed based on the shift from red fluorescence (non-oxidized) to green fluorescence (oxidized). Cells were plated in 6-well cell culture plate and then incubated with C11-bodipy contained culture medium at a concentration of 2 μM for 30 min. Then, cells were washed with PBS twice and resuspended. Fluorescence intensity was detected by flow cytometry (Beckman) and results were analyzed by FlowJo software. For confocal imaging, cells were plated in round coverslip. Before detection, cells were incubated with 2 μmol/L C11-bodipy for 30 min. Next, cells were washed with PBS twice and images were acquired using confocal microscopy. Intracellular ROS level were detected with Reactive Oxygen Species Assay Kit (Beyotime, cat. no. S0033S). Briefly, cells were stained with 10 μM DCFH-DA for 20 min, and washed twice with PBS. After washing, fluorescence intensity was detected by flow cytometry (Beckman) and results were analyzed by FlowJo software. 2.9 Lipid peroxidation malondialdehyde (MDA) Assay Panc-1 and SW1990 cells were seeded in 10 cm dishes and treated with Erastin(5μM) and simvastatin(2μM) for 48h.The malondialdehyde (MDA) content was determined using a commercial MDA assay kit provided by Beyotime Biotechnology (Beyotime, cat. no. S0131S), following the manufacturer’s instructions. The principle is based on the reaction of MDA with thiobarbituric acid (TBA) under high-temperature and acidic conditions to form a red adduct, which is measured at 532 nm. The MDA concentration in the samples was calculated using a standard curve. Each sample was analyzed in triplicate. 2.10 Enhanced mitochondrial membrane potential assay The mitochondrial membrane potential (ΔΨm) was assessed using the JC-1 dye method with a JC-1 assay kit provided by Beyotime Biotechnology ((Beyotime, cat. no. C2003S)), following the manufacturer's instructions. The procedure was as follows: Panc-1 and SW1990 cells were seeded in 10 cm dishes and treated with Erastin(5μM) and simvastatin(2μM) for 48h.the medium was removed and the cells were gently washed twice with PBS. An appropriate volume of JC-1 working solution was added to each dish, and cells were incubated at 37°C for 20 minutes. After incubation, the dye solution was discarded, and cells were washed twice with JC-1 staining buffer.Fluorescence intensity was then observed under a fluorescence microscope, detecting red fluorescence of JC-1 aggregates (Ex/Em = 525/590 nm) and green fluorescence of JC-1 monomers (Ex/Em = 490/530 nm).Changes in mitochondrial membrane potential were evaluated by the ratio of red to green fluorescence intensity, with a decrease in the red/green ratio indicating a loss of ΔΨm. Each group was analyzed in triplicate. 2.11 Transmission electron microscope (TEM) imaging Cells were resuspended and washed with PBS twice. Then, cells were fixed with 2.5% glutaraldehyde. TEM imaging was conducted by Servicebio (Wuhan, China). 2.12 Cell death Cell apoptosis was assessed using the Annexin V-FITC/PI dual staining method with an apoptosis detection kit provided by BD Biosciences (BD, cat. no. 556547), following the manufacturer’s instructions. Briefly, Panc-1 and SW1990 cells were seeded in 10 cm dishes and treated with Erastin(5μM) and simvastatin(2μM) for 48h，cells were harvested by trypsinization, washed with PBS, and collected by centrifugation. The cell pellet was resuspended in 1× Binding Buffer at a concentration of 1×10⁶ cells/mL. Then, 100 μL of the cell suspension was incubated with 5 μL Annexin V-FITC and 5 μL propidium iodide (PI) in the dark for 15 minutes. After incubation, 400 μL of 1× Binding Buffer was added and mixed gently. Samples were immediately analyzed using a flow cytometer (e.g., BD FACSCalibur) to determine the proportion of apoptotic cells. 2.13 Chromatin immunoprecipitation assay and promoter activity assessment by a dual-luciferase assay ChIP was performed using the Chromatin Immunoprecipitation (ChIP) Kit (BersinBio, cat. no. Bes5001). Briefly, pancreatic cancer cells were seeded in 10 cm dishes, crosslinked with the reagent when they grew to 90% confluence, and lysed with SDS buffer. Then, ultrasound was used to break the DNA into fragments of 200–600 bp, and specific antibodies or anti-human IgG antibody was used to pull down the DNA. After washing with high salt and low salt buffers, DNA was eluted and decrosslinked, and enriched sequences were examined by qPCR, according to the Primers to detect P62/SQSTM1 promoter occupancy were listed as follows, Primer1: 5'- CTCAGAGAGCCAGCCTCCTG-3' (F), 5'- GCCTAGGTGGGGCCATATCTG -3' (R); Primer2: 5'- GCTGGCTGCAAAGTGGAGGC -3 ' (F), 5'- AGGATCCTGTGAGGTATGAG-3' (R). The P62/SQSTM1 promoter region, spanning from -2000 to +200 of the transcription start site, was cloned and inserted into the pGL3-Basic vector (Promega). The coding sequence of human TFEB was cloned and inserted into the pCMV-c-flag vector (Beyotime) to generate TFEB expression plasmids. A dual-luciferase system (Promega, cat. no. E1910) was used to measure firefly and Renilla luciferase activities according to the manufacturer’s protocol. 2.14 Immunofluorescence (IF) staining Panc-1and SW1990 cells were cultivated in confocal dishes after treatment, fixed with 4% paraformaldehyde for 10 min, washed with PBS three times, treated with permeabilization solution (1% Triton X-100 in PBS), washed with PBS again, and blocked with 5% bovine serum albumin (Sigma-Aldrich, Germany) for 1 h. The primary antibody was added to the 24-well plate and mixed overnight at 4 °C. Next, the samples were washed with PBS three times, incubated with Alexa Fluor 488-conjugated Goat anti-rabbit IgG secondary antibody (dilution, 1:200; Sangon Biotech, China) for 60 min, and then stained with DAPI (1:10,000) for 10 min in the dark. A laser scanning confocal microscope (Leica, STELLARIS 8 CRS) was used to observe the samples. To label the mitochondria or lysosome, PANC-1 and SW1990 cells were seeded in confocal dishes. PANC-1 and SW1990 cells were treated with MitoTracker Red (dilution, 200nM; Beyotime, C1035), or LysoTracker Green (dilution, 75nM; Beyotime, C1047S) and DAPI (1:10,000), following the manufacturer’s instructions. The images were captured using a confocal microscope (Leica, STELLARIS 8 CRS). 2.15 Xenograft Tumor Models and immunohistochemical staining (IHC) To investigate the role of the combination of Erastin and Simvastatin. To establish a tumor xenograft model, 3 × 10 6 SW1990 cells were subcutaneously injected into the nude mice. When the tumors reached a volume of 60-100 mm 3 , the mice were randomly divided into three groups (five mice per group) and treated with DMSO (control), Erastin, or a combination of Erastin and Simvastatin. Mice were treated with 80 μl (400 μM) erastin by intratumoral injection and/or 2mg/kg Simvastatin by intraperitoneal injection every 2 days until the endpoint at day 14. Nude mice were euthanized by carbon dioxide and calculated with the following for mula: length × (width2)/2. In paraffin-embedded tissue sections, anti-P62/SQSTM1 antibody was used and stained according to standard IHC procedures. The dilution ratio of the anti-P62/SQSTM1 antibody (Affinity, AF5384) was 1:100. 2.16 Statistical analysis All statistical analyses were performed using GraphPad Prism version 8.0 software (GraphPad Software, USA). All data were reported as the means ± SD of triplicate experiments, and the differences between the two groups were compared using the two-tailed Student’s t- test. Comparisons between multiple groups were performed using one- way ANOVA, and a P-value <0.05 was statistically significant. 3. Result 3.1 Simvastatin can improve Erastin-induced cell toxicity. The mitochondria in cells are constantly challenged by oxidative stress. In order to explore whether simvastatin can protect pancreatic cancer cells, we treated pancreatic cancer cells with Erastin to place the cells in a state of mitochondrial oxidative stress, while using simvastatin in conjunction. We treated PANC-1 and SW1990 cells with 5μM Erastin and different concentrations of simvastatin (the concentration of simvastatin was: 1μM, 2μM, 4μM, 6μM), and after 24 hours of co-incubation, we evaluated the cell vitality by measuring the absorbance by the CCK8 method. We found that simvastatin concentrations of 1μM and 2μM could improve the toxicity of Erastin on pancreatic cancer cells (figure1A and B). We then treated PANC-1 and SW1990 cells with 2μM simvastatin and 5μM Erastin, and measured the cell proliferation ability using the EDU method. We found that 2μM simvastatin significantly resisted Erastin-induced cell proliferation blockage (figure1C). Finally, we carried out colony formation experiments, and found that 2μM simvastatin can improve the colony formation inhibition caused by Erastin (figure1D). 3.2 Simvastatin inhibits ferroptosis of pancreatic cancer cells. Erastin can induce ferroptosis, an iron-dependent form of programmed cell death. Ferroptosis is a cell death mechanism closely associated with lipid peroxidation, characterized by the accumulation of iron within the cell and the formation of lipid peroxides. Therefore, we wanted to explore whether simvastatin can also inhibit the ferroptosis of pancreatic cancer cells. We directly observed the level of lipid peroxidation under a confocal microscope, where red fluorescence turned green when lipid peroxidation occurred. We found that simvastatin reduced the occurrence of lipid peroxidation (figure 2A). We used the BODIPY 581/591 C11 probe to detect lipid peroxidation levels and found that simvastatin (2μM) could resist the increase in lipid peroxidation levels induced by Erastin (5μM) (figure 2B and C). To further detect the level of cell ferroptosis, we used the oxidation-sensitive fluorescent probe DCFH-DA to detect the level of intracellular ROS, and we also detected the level of intracellular MDA. We found that simvastatin could reduce the level of intracellular ROS and MDA (figure 2D and E). Also, erastin targets mitochondria, causing a large accumulation of ROS, which can eventually trigger apoptosis. We used Erastin and simvastatin together, and found that simvastatin can reduce the apoptosis caused by Erastin (figure S1). Erastin increases oxidative stress and generates reactive oxygen species (ROS), leading to the loss of mitochondrial membrane potential. The accumulation of ROS can damage the mitochondrial inner membrane, resulting in the loss of mitochondrial membrane potential, thereby disrupting mitochondrial energy production and compromising cell survival. We used JC-1 staining to detect mitochondrial membrane potential (MMP) and observed MMP under a confocal microscope, where green fluorescence indicates a decrease in MMP, suggesting mitochondrial damage. We found that Erastin significantly damaged the MMP of PANC-1 and SW1990 cells, but simvastatin could reverse such damage (figure 2F). 3.3 Simvastatin promotes mitochondrial autophagy in pancreatic cancer cells. We found that both ferroptosis and apoptosis are closely related to the stability of mitochondrial structure and function. After mitochondrial damage induced by Erastin, simvastatin was able to reverse this effect. Therefore, we hypothesize that statins may have a mechanism that can repair damaged mitochondria. To visually observe the changes in mitochondria, we used transmission electron microscopy to examine pancreatic cancer cells treated with Erastin and simvastatin., we found that under the influence of Erastin, the membrane structure of the mitochondria was damaged, and the cristae disappeared. After using simvastatin to treat PANC-1 and SW1990 cells, we saw more autophagosomes (figure3A). Mitochondrial damage and oxidative stress are the causes of cell death, and cells can maintain normal function by removing damaged mitochondria through autophagy. Autophagy is a cell decomposition metabolic pathway, which leads to the degradation and recycling of proteins and organelles after the fusion of isolation vesicles, autophagosomes and lysosomes that provide hydrolytic enzymes. Mitochondrial autophagy is a special form of autophagy that selectively degrades mitochondria via the PINK1/Parkin pathway[14]. When the mitochondrial membrane is damaged, PINK1 aggregates on the outer mitochondrial membrane (OMM), phosphorylating E3 ubiquitin ligase Parkin and causing it to aggregate on the OMM. Several mitochondrial proteins, including VDAC1, Miro, Mfn-1 and Mfn-2, are ubiquitinated by Parkin, and the subsequent accumulation of P62 on the OMM leads to the binding of ubiquitinated products and LC3, ultimately localizing mitochondria to autophagosomes, which fuse with lysosomes to form auto-lysosomes, and eventually leading to the degradation of mitochondria[15]. Recent studies have found that simvastatin can trigger mitochondrial autophagy[10], so we hypothesized that simvastatin promotes mitochondrial autophagy to remove damaged mitochondria, thus protecting pancreatic cancer cells. We first detected proteins related to mitochondrial autophagy, and found that after Erastin acted on pancreatic cancer cells, the use of simvastatin could increase the expression of proteins related to mitochondrial autophagy (figure3B and C). Meanwhile, immunofluorescence showed that after simvastatin treatment, the colocalization of lysosomes and mitochondria increased, indicating that simvastatin promoted mitochondrial autophagy (figure3D and E). 3.4 Simvastatin induces TFEB nuclear translocation, promoting P62 transcription to regulate mitochondrial autophagy. The transcription factor EB (TFEB) is the main transcription regulator of autophagy and lysosomes, and can regulate their biogenesis and function[16]. Almost all receptors which serve for lysosome biogenesis are controlled by TFEB transcription, with TFEB being its main regulator. Therefore, we wanted to know if simvastatin regulates mitochondrial autophagy through TFEB. Normally, TFEB is phosphorylated and retained in the cytoplasm. But when TFEB is dephosphorylated, it moves from the cytoplasm to the nucleus, where it actively regulates target gene expression to carry out cargo recognition, autophagosome formation, vesicle fusion and substrate degradation. By observing with immunofluorescence, we found that simvastatin promotes the nuclear translocation of TFEB. After simvastatin treatment, the nuclear translocation of TFEB increased in PANC-1 and SW1990 cells (figure4A). At the same time, we extracted the cytosolic protein and nuclear protein of PANC-1 and SW1990. After simvastatin treatment, the TFEB content in the cytoplasm decreased, while the TFEB content in the nucleus increased (figure4B and C). P62/SQSTM1 is a receptor of mitochondrial autophagy, and research suggests that TFEB can regulate P62/SQSTM1, but the specific mechanism is not yet clear. We used immunofluorescence to observe the expression of P62/SQSTM1, and found that simvastatin not only increased TFEB's nuclear translocation, but also increased the expression of P62/SQSTM1 on mitochondria (figure4D and E). We speculated that TFEB might be a transcription factor of P62/SQSTM1. Therefore, we used lentivirus to stably reduce the expression of TFEB, and then checked the mRNA and protein levels of P62/SQSTM1. We found that after knocking down TFEB, both mRNA and protein levels of P62/SQSTM1 were significantly reduced (figure5A-D). Using the JASPAR website, we predicted the binding sites of TFEB in the P62/SQSTM1 promoter (http://jaspar.genereg.net/). We found two potential binding sites (Site1-Site2) (figure5E and F). We therefore designed a CHIP-PCR to confirm TFEB's binding site at the P62/SQSTM1 promoter, and our results showed that the binding site in the promoter area is Site1, not Site2 (figure5G). Lastly, we designed a luciferase reporter gene expression plasmid with Site1 site and transfected it into HEK293T cells. By comparing fluorescence values, we found that overexpressing TFEB increased the activity of the P62/SQSTM1 promoter reporter (figure5H). 3.5 Knocking downTFEB weakens the effect of simvastatin. We used lentivirus to stably knock down TFEB and found that, under the action of Erastin and simvastatin, the expression of SQSTM1/P62 was decreased through immunofluorescence (figure6A and B), and the localization of lysosomes in the mitochondria was reduced (figure6C and D). We measured the mitochondrial membrane potential and found it was also decreased (figure6E). We used the BODIPY 581/591C11 probe to detect lipid peroxidation levels, and found that after TFEB was knocked down, lipid peroxidation levels in PANC-1 and SW1990 cells increased (figure7A and B), and stronger green fluorescence was observed under confocal microscopy (figure7E). In addition, intracellular MDA and ROS levels also increased (figure7C and D). Therefore, knocking down TFEB weakens the inhibitory effect of simvastatin on ferroptosis in pancreatic cancer cells. Finally, we detected the cell proliferation level and apoptosis, and found that knocking down TFEB weakened cell proliferation ability (figure7F), and increased cell apoptosis level (figure7G). 3.6 In vivo, Simvastatin weakens Erastin's toxic effect on pancreatic cancer. We established a human pancreatic cancer xenograft model, and then treated it with a combination of Simvastatin and Erastin. Every two days, we injected 80μl of 400μM Erastin into the tumor tissue, while Simvastatin was injected intraperitoneally into the nude mice at a dose of 2mg/Kg. We observed the growth of the tumor from the first day to the 14th day of treatment, and found that Erastin significantly reduced the volume of the tumor, while the tumor volume did not significantly decrease with the combined treatment of Simvastatin and Erastin(figure8A). We then performed immunohistochemical staining on the tumor tissue, and found that the expression of P62/SQSTM1 in the tumor tissue treated with Simvastatin and Erastin was higher(figure8B).[17] Discussion Pancreatic ductal adenocarcinoma (PDAC) is a relatively uncommon cancer, with approximately 60430 new diagnoses expected in 2021 in the US. The incidence of PDAC is increasing by 0.5% to 1.0% per year, and it is projected to become the second-leading cause of cancer-related mortality by 2030[18]. This depressing reality is mainly due to late-stage diagnosis and the relative lack of effectiveness of existing treatments. Therefore, the development of new strategies and the identification of innovative treatment targets remain a priority for this cancer. Previous studies have suggested that simvastatin can inhibit the growth of pancreatic cancer, but the concentration of simvastatin selected in in vitro experiments is far more than 2µM[19],Bjorkhem‐Bergman's research showed that the mean concentration of statins in human serum was only 1-15 nM, and the pharmacologically active fraction of statins was only 0.01-0.5 nM[20]. Most existing evidence of the pleiotropy of statins is based on in vitro studies with much higher concentrations (1-50 μM). Pancreatic cancer tumors are typically associated with a large amount of fibrotic stroma, primarily composed of fibroblasts, collagen, and glycosaminoglycans (such as hyaluronic acid). These fibrotic components increase the stiffness and density of the tumor stroma, forming a mechanical barrier that significantly reduces the permeability of drugs. Drugs have difficulty penetrating these dense stromal layers, making it challenging for them to effectively reach tumor cells, resulting in poor therapeutic outcomes[21]. Additionally, in the tumor microenvironment of pancreatic cancer, blood vessels are not only sparse but also structurally abnormal, forming irregular and ruptured vessels that impede blood flow. This abnormal vascular network makes it difficult for drugs, especially larger molecules or certain macromolecular drugs (such as antibody drugs and chemotherapy agents), to effectively penetrate into the core of the tumor[22]. Based on these results, we found that small doses of simvastatin could promote mitochondrial autophagy through TFEB, thereby clearing damaged mitochondria, Due to factors such as the surrounding cellular stroma and lack of blood supply in pancreatic cancer, the drug concentration that actually reaches pancreatic cancer tissue is relatively low. Our study found that low doses of simvastatin can protect mitochondrial function and exert antioxidant effects. Therefore, under conventional therapeutic doses, simvastatin is unlikely to exert significant antitumor effects. This may be one of the reasons why statins show limited efficacy in cancer treatment. Therefore, by inhibiting tumor angiogenesis, we can improve the structure of tumor blood vessels, making them more regular and more permeable. This can increase the blood supply of the drug, allowing it to more easily enter the tumor. MMPs are enzymes responsible for the degradation of the tumor stroma, and by using MMP inhibitors, the excessive accumulation of stroma can be reduced, minimizing its physical barrier effect on drug penetration[23]. Alternatively, drugs can be directly injected into the tumor area, avoiding the dilution and distribution limitations caused by systemic circulation. This method can directly increase the drug concentration in the tumor and reduce side effects in normal tissues. These strategies provide new prospects for simvastatin in the treatment of pancreatic cancer. Declarations Acknowledgements Not applicable. Author contributions Xuemin Chen and Yi Qin designed the research. Yang Yang and Di Wu revised the manuscript. Weibo Chen, Yichi Jin, Aining Kang, Yanxun Zou ,Yi Liu and Guangchen Zu contributed to the figure. Xianjun Yu,Yue Yang and Yong An contributed to the acquisition of the financial support for the project leading to this publication. Zhiliang Wang wrote the manuscript and took an active part in the procedures mentioned above. All authors contributed to the article and approved the submitted version. Funding This work was supported by the grants from the National Natural Science Foundation of China (Nos. 81972250 and 81602054), the Young Talent Development Plan of Changzhou Health Commission (Nos. CZQM2021002 and CZQM2020005), Reserve Top Talent of Changzhou “The 14th Five-Year Plan” High-Level Health Talents Training Project (No. 2024BJHB007), the Young Talent Science and Technology Project of Changzhou Health Commission,（No.QN202305）,the Social Development Support Project of Changzhou Science and Technology Bureau (No. CE20225043), and the Major Science and Technology Project of Changzhou Health Commission (Nos. ZD202305 and ZD202210), Undergraduate innovation and entrepreneurship training program of Jiangsu Province(No. 202410285253Y) Conflict of interest The authors have no conflict of interest. Ethics statement All mice experiments were performed following in stitutional guidelines and approved by the Ethics Committee of Fudan University Shanghai cancer center. The animal study was reviewed and approved by the Institutional Animal Care and Use Committee of Fudan University Shanghai cancer center (permit number: No. FUSCCIACUC-S20210465). Consent for publication All authors consent to publication. Data availability statement The data that support the findings of this study are available from the corresponding author upon reasonable request. References R.L. Siegel, K.D. Miller, N.S. Wagle, A. Jemal, Cancer statistics, 2023, CA Cancer J Clin 73(1) (2023) 17-48. E. Sirri, F.A. Castro, J. Kieschke, L. Jansen, K. Emrich, A. Gondos, B. Holleczek, A. Katalinic, I. Urbschat, C. Vohmann, H. Brenner, Recent Trends in Survival of Patients With Pancreatic Cancer in Germany and the United States, Pancreas 45(6) (2016) 908-914. A. McGuigan, P. Kelly, R.C. Turkington, C. Jones, H.G. Coleman, R.S. McCain, Pancreatic cancer: A review of clinical diagnosis, epidemiology, treatment and outcomes, World J Gastroenterol 24(43) (2018) 4846-4861. C. Feig, A. Gopinathan, A. Neesse, D.S. Chan, N. Cook, D.A. Tuveson, The pancreas cancer microenvironment, Clin Cancer Res 18(16) (2012) 4266-4276. A. Neesse, C.A. Bauer, D. Öhlund, M. Lauth, M. Buchholz, P. Michl, D.A. Tuveson, T.M. Gress, Stromal biology and therapy in pancreatic cancer: ready for clinical translation?, Gut 68(1) (2019) 159-171. D.M. Boudreau, O. Yu, J. Johnson, Statin use and cancer risk: a comprehensive review, Expert Opin Drug Saf 9(4) (2010) 603-621. J.W. Clendening, L.Z. Penn, Targeting tumor cell metabolism with statins, Oncogene 31(48) (2012) 4967-4978. I.H. El-Khashab, Antiangiogenic and Proapoptotic Activities of Atorvastatin and Ganoderma lucidum in Tumor Mouse Model via VEGF and Caspase-3 Pathways, Asian Pac J Cancer Prev 22(4) (2021) 1095-1104. A. Wang, Y. Lin, B. Liang, X. Zhao, M. Qiu, H. Huang, C. Li, W. Wang, Y. Kong, Statins attenuate cholesterol-induced ROS via inhibiting NOX2/NOX4 and mitochondrial pathway in collecting ducts of the kidney, BMC Nephrol 23(1) (2022) 184. C.-C. Hsieh, C.-Y. Li, C.-H. Hsu, H.-L. Chen, Y.-H. Chen, Y.-P. Liu, Y.-R. Liu, H.-F. Kuo, P.-L. Liu, Mitochondrial protection by simvastatin against angiotensin II-mediated heart failure, Br J Pharmacol 176(19) (2019) 3791-3804. Y. Yang, S. Karakhanova, W. Hartwig, J.G. D'Haese, P.P. Philippov, J. Werner, A.V. Bazhin, Mitochondria and Mitochondrial ROS in Cancer: Novel Targets for Anticancer Therapy, J Cell Physiol 231(12) (2016) 2570-2581. Y. Sun, R. Deng, C. Zhang, Erastin induces apoptotic and ferroptotic cell death by inducing ROS accumulation by causing mitochondrial dysfunction in gastric cancer cell HGC‑27, Mol Med Rep 22(4) (2020) 2826-2832. W. Liu, C.-C. Li, X. Lu, L.-Y. Bo, F.-G. Jin, Overexpression of transcription factor EB regulates mitochondrial autophagy to protect lipopolysaccharide-induced acute lung injury, Chin Med J (Engl) 132(11) (2019) 1298-1304. F. Ferro, S. Servais, P. Besson, S. Roger, J.-F. Dumas, L. Brisson, Autophagy and mitophagy in cancer metabolic remodelling, Semin Cell Dev Biol 98 (2020) 129-138. S. Geisler, K.M. Holmström, D. Skujat, F.C. Fiesel, O.C. Rothfuss, P.J. Kahle, W. Springer, PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1, Nat Cell Biol 12(2) (2010) 119-131. D. Ivankovic, K.-Y. Chau, A.H.V. Schapira, M.E. Gegg, Mitochondrial and lysosomal biogenesis are activated following PINK1/parkin-mediated mitophagy, J Neurochem 136(2) (2016) 388-402. O. Olajubutu, O.D. Ogundipe, A. Adebayo, S.K. Adesina, Drug Delivery Strategies for the Treatment of Pancreatic Cancer, Pharmaceutics 15(5) (2023). W. Park, A. Chawla, E.M. O'Reilly, Pancreatic Cancer: A Review, JAMA 326(9) (2021) 851-862. C.-Y. Chen, Y.-F. Yang, P.C. Wang, L. Shan, S. Lin, P.-J. Chen, Y.-J. Chen, H.-S. Chiang, J.-T. Lin, C.-F. Hung, Y.-J. Liang, Simvastatin Attenuated Tumor Growth in Different Pancreatic Tumor Animal Models, Pharmaceuticals (Basel) 15(11) (2022). L. Björkhem-Bergman, J.D. Lindh, P. Bergman, What is a relevant statin concentration in cell experiments claiming pleiotropic effects?, Br J Clin Pharmacol 72(1) (2011) 164-165. J. Kota, J. Hancock, J. Kwon, M. Korc, Pancreatic cancer: Stroma and its current and emerging targeted therapies, Cancer Lett 391 (2017) 38-49. Y.-F. Fan, W.-T. Shang, G.-H. Lu, K.-X. Guo, H. Deng, X.-H. Zhu, C.-C. Wang, J. Tian, Decreasing hyaluronic acid combined with drug-loaded nanoprobes improve the delivery and efficacy of chemotherapeutic drugs for pancreatic cancer, Cancer Lett 523 (2021) 1-9. V. Tjomsland, E. Pomianowska, M. Aasrum, D. Sandnes, C.S. Verbeke, I.P. Gladhaug, Profile of MMP and TIMP Expression in Human Pancreatic Stellate Cells: Regulation by IL-1α and TGFβ and Implications for Migration of Pancreatic Cancer Cells, Neoplasia 18(7) (2016) 447-456. Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.docx wb.zip FigS1.tif Cite Share Download PDF Status: Published Journal Publication published 19 Jan, 2026 Read the published version in Cellular Oncology → Version 1 posted Editorial decision: Revision requested 13 Oct, 2025 Reviews received at journal 08 Oct, 2025 Reviews received at journal 07 Oct, 2025 Reviewers agreed at journal 30 Sep, 2025 Reviewers agreed at journal 29 Sep, 2025 Reviewers agreed at journal 29 Sep, 2025 Reviewers agreed at journal 27 Sep, 2025 Reviewers agreed at journal 27 Sep, 2025 Reviewers agreed at journal 27 Sep, 2025 Reviewers invited by journal 27 Sep, 2025 Editor assigned by journal 22 Sep, 2025 Submission checks completed at journal 22 Sep, 2025 First submitted to journal 19 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7657011","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":526215309,"identity":"05608699-c385-4cfb-8d3a-17243cd5948c","order_by":0,"name":"Zhiliang Wang","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Zhiliang","middleName":"","lastName":"Wang","suffix":""},{"id":526215310,"identity":"7dbd3541-897e-40e7-b951-6473657717b4","order_by":1,"name":"Di Wu","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Di","middleName":"","lastName":"Wu","suffix":""},{"id":526215311,"identity":"aaa6a06c-ecb4-479a-9a0d-7ba52de89fc5","order_by":2,"name":"Yue Zhang","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Zhang","suffix":""},{"id":526215312,"identity":"8ff738b5-4883-478b-81ce-12120f041a57","order_by":3,"name":"Weibo Chen","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Weibo","middleName":"","lastName":"Chen","suffix":""},{"id":526215313,"identity":"2a4346c4-9a82-489a-96c6-05e89fadee22","order_by":4,"name":"Yang Yang","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Yang","suffix":""},{"id":526215314,"identity":"23b525e6-671e-430f-b1b4-e3cb4d39ddad","order_by":5,"name":"Yue Yang","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Yang","suffix":""},{"id":526215315,"identity":"70af0f50-09d2-4497-bb78-fcf5a6766d53","order_by":6,"name":"Guangchen Zu","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Guangchen","middleName":"","lastName":"Zu","suffix":""},{"id":526215316,"identity":"d4479e5b-12f2-4a5b-8153-e39afa8efff4","order_by":7,"name":"Yong An","email":"","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"An","suffix":""},{"id":526215317,"identity":"6a76e56e-243c-4bf2-9984-0602798131c9","order_by":8,"name":"Yuchi Jin","email":"","orcid":"","institution":"Suzhou Medical College,Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yuchi","middleName":"","lastName":"Jin","suffix":""},{"id":526215318,"identity":"8b01ca46-184f-406d-b053-3ea4701a62c8","order_by":9,"name":"Aining Kang","email":"","orcid":"","institution":"Suzhou Medical College,Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Aining","middleName":"","lastName":"Kang","suffix":""},{"id":526215319,"identity":"93516b11-74d7-42d8-bbd1-651ee487b60a","order_by":10,"name":"Yanxun Zou","email":"","orcid":"","institution":"Suzhou Medical College,Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yanxun","middleName":"","lastName":"Zou","suffix":""},{"id":526215320,"identity":"3d601d20-ddf6-4249-9d0e-83782534a44d","order_by":11,"name":"Yi Liu","email":"","orcid":"","institution":"Suzhou Medical College,Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Liu","suffix":""},{"id":526215321,"identity":"f8a61e20-2a97-4df8-ab0f-14f78797751d","order_by":12,"name":"Xianjun Yu","email":"","orcid":"","institution":"Fudan University Shanghai Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Xianjun","middleName":"","lastName":"Yu","suffix":""},{"id":526215322,"identity":"cae78291-af3f-47f7-afeb-1ba4f65c8325","order_by":13,"name":"Yi Qin","email":"","orcid":"","institution":"Fudan University Shanghai Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Qin","suffix":""},{"id":526215323,"identity":"b50e21fa-0d58-461b-9f56-fa88acb809a8","order_by":14,"name":"Xiaowu Xu","email":"","orcid":"","institution":"Fudan University Shanghai Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Xiaowu","middleName":"","lastName":"Xu","suffix":""},{"id":526215324,"identity":"f7b00ef6-1a98-4077-b016-c9fa6e2ce333","order_by":15,"name":"Xuemin Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIie3QsQrCMBDG8QsHmQI6Bn2Jg0CnvIlLQMjU7h0KFoS6CJ19Cx9BOahLobNboeCsb2AdHaTp5pD//P2GO4BY7G8jvasRr/0MkltxOsgtzSCtF+dOJcug8aLmx+peMRqGBKCwm0miL40xWcUyYfA9ND4rpwiJoxhGokZyI1FyAEEFPBJt9qLSYUQqMaStJ0KUYUS30pg0t06zRHIht3w+tk5Ju0XdvfpnYafJd27ePBaLxWK/egNglzqmsMQZawAAAABJRU5ErkJggg==","orcid":"","institution":"Third Affiliated Hospital of Soochow University","correspondingAuthor":true,"prefix":"","firstName":"Xuemin","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-09-19 09:38:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7657011/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7657011/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s13402-026-01164-y","type":"published","date":"2026-01-19T15:57:47+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":93109594,"identity":"b0e8124f-85ad-4fa7-aa7c-edbcda6f4020","added_by":"auto","created_at":"2025-10-09 07:25:21","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2015717,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimvastatin can rescue the cell proliferation inhibition caused by Erastin.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B): CCK8 method to detect the effects of different concentrations of Simvastatin (Simvastatin concentrations are 1μM, 2μM, 4μM, 6μM) in combination with Erastin (5μM) on the viability of PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(C): PANC-1 and SW1990 cells were treated with Erastin (concentration of 5μM, pre-treated for 24h) or Erastin + Simvastatin (Erastin concentration of 5μM, Simvastatin concentration of 2μM, pre-treated for 24h), and the cell proliferation level was detected by EDU method.\u003c/p\u003e\n\u003cp\u003e(D): PANC-1 and SW1990 cells were treated with either Erastin (concentration 5μM, pre-treated for 24h) or Erastin+ simvastatin (Erastin concentration 5μM, simvastatin concentration 2μM, pre-treated for 24h), and the ability of the cells to form colonies was detected using the clone formation method.\u003c/p\u003e\n\u003cp\u003eAll quantified data are represented as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/5662a4e5d8caa9a38823f12c.jpg"},{"id":93108796,"identity":"68e85c90-216d-4599-8563-4bce16565a7f","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1928559,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimvastatin reduces Erastin-induced cell ferroptosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePANC-1 and SW1990 cells were treated with Erastin (concentration of 5μM, pre-treated for 24h) or Erastin + Simvastatin (Erastin concentration of 5μM, Simvastatin concentration of 2μM, pre-treated for 24h).\u003c/p\u003e\n\u003cp\u003e(A): Use BODIPYTM 581/591 C11 probe to stain cells, observe the level of lipid peroxidation in PANC-1 and SW1990 cells under a confocal microscope, green fluorescence indicates lipid peroxidation has occurred, and red fluorescence indicates lipid peroxidation has not occurred.\u003c/p\u003e\n\u003cp\u003e(B and C): Use BODIPYTM 581/591 C11 probe to stain cells, and detect the level of C11 in PANC-1 and SW1990 cells through flow cytometry.\u003c/p\u003e\n\u003cp\u003e(D): Flow cytometry detects ROS levels in PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(E): Detect the MDA level in PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(F): The PANC-1 and SW1990 cells were stained with JC-1 probes. Under a confocal microscope, the Mitochondrial membrane potential (MMP) is observed, the green fluorescence indicates a decrease in mitochondrial membrane potential, and the red fluorescence indicates an increase in mitochondrial membrane potential.\u003c/p\u003e\n\u003cp\u003eAll quantified data are presented as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/891db78462eddb8f0c6e1a71.jpg"},{"id":93108797,"identity":"443c7c48-8c61-48a4-a10d-bd4515fdeaec","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2956853,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimvastatin promotes the occurrence of mitochondrial autophagy in PANC-1 and SW1990 cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePANC-1 and SW1990 cells were treated with Erastin (concentration of 5μM, pre-treated for 24h) or Erastin+ Simvastatin (Erastin concentration of 5μM, Simvastatin concentration of 2μM, pre-treated for 24h).\u003c/p\u003e\n\u003cp\u003e(A): Transmission electron microscopy observation of changes in mitochondrial morphology in PANC-1 and SW1990 cells, arrows indicate mitochondria undergoing autophagy.\u003c/p\u003e\n\u003cp\u003e(B and C): Western-Blot method was used to detect the level of mitochondrial autophagy-related proteins in PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(D and E): Immunofluorescence observation of the co-localisation of mitochondria and lysosomes in PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003eAll quantified data are shown as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/594bac80ac82e78dba40b01e.jpg"},{"id":93108799,"identity":"465dcecb-05f5-4852-b5d4-d89f0d7ad1a0","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1800485,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimvastatin promotes nuclear translocation of TFEB.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePANC-1 and SW1990 cells were treated with Erastin (concentration 5μM, pre-treated for 24h) or Erastin + Simvastatin (Erastin concentration 5μM, Simvastatin concentration 2μM, pre-treated for 24h).\u003c/p\u003e\n\u003cp\u003e(A): Observing the localization of TFEB in PANC-1 and SW1990 cells through immunofluorescence.\u003c/p\u003e\n\u003cp\u003e(B and C): Detect the protein levels of TFEB in the nucleus and cytoplasm of PANC-1 and SW1990 cells through Western-Blot.\u003c/p\u003e\n\u003cp\u003e(D and E): After treating PANC-1 and SW1990 cells with Erastin (5μM) and Simvastatin (2μM), the co-localization of P62/SQSTM1 and mitochondria was observed via immunofluorescence.\u003c/p\u003e\n\u003cp\u003eAll quantified data are shown as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/589ca6db74af008434fed30e.jpg"},{"id":93109596,"identity":"084b642f-58cd-4068-afd1-4bbcae40255d","added_by":"auto","created_at":"2025-10-09 07:25:21","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1264412,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTFEB acts as a transcription factor for P62/SQSTM1, promoting the expression of P62/SQSTM1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B): After knocking down TFEB, the protein levels of P62/SQSTM1 in PANC-1 and SW1990 cells were detected by Western-Blot. (C and D): The mRNA levels of P62/SQSTM1 were detected by quantitative RT-PCR.\u003c/p\u003e\n\u003cp\u003eSchematic diagram of TFEB binding site in the promoter region of P62/SQSTM1.\u003c/p\u003e\n\u003cp\u003e(G): Use antibodies of TFEB for chromatin immunoprecipitation experiments, and verify the binding sites through agarose gel electrophoresis.\u003c/p\u003e\n\u003cp\u003e(H): The dual luciferase reporter experiment verifies that TFEB promotes the expression of P62/SQSTM1 by binding to the promoter of P62/SQSTM1.\u003c/p\u003e\n\u003cp\u003eAll quantified data are shown as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/1ff8d565c61e1eb4f38921ee.jpg"},{"id":93108802,"identity":"1daaf217-d751-4963-96c0-cb03d1ad4fe8","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2003586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of TFEB weakens the simvastatin-induced mitochondrial autophagy and promotes cell death.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eErastin + Simvastatin (Erastin concentration at 5μM, Simvastatin concentration at 2μM, pre-treated for 24h) treated different groups of PANC-1 and SW1990 cells (NC, shTFEB-1, shTFEB-2).\u003c/p\u003e\n\u003cp\u003e(A and B): Immunofluorescence observation of PANC-1 and SW1990 cells, co-localization of P62/SQSTM1 and mitochondria. (C and D) Immunofluorescence observation of the co-localization of lysosomes and mitochondria in PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003eStain PANC-1 and SW1990 cells with the JC-1 probe. Observe Mitochondrial membrane potential (MMP) under the confocal microscope, where green fluorescence represents a decrease in mitochondrial membrane potential, and red fluorescence represents an increase in mitochondrial membrane potential.\u003c/p\u003e\n\u003cp\u003eAll quantified data are shown as mean ± SEM; **p \u0026lt; 0.01 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/eafc1e39368ed4d077d7c238.jpg"},{"id":93109597,"identity":"02b899e7-339c-41f9-8b98-b5bbcbb7ab73","added_by":"auto","created_at":"2025-10-09 07:25:21","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1764929,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of TFEB weakens the protective effect of simvastatin on cells from ferroptosis and apoptosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eErastin+Simvastatin (Erastin concentration at 5μM, Simvastatin concentration at 2μM, pre-treatment for 24h) treating different groups of PANC-1 and SW1990 cells (NC, shTFEB-1, shTFEB-2).\u003c/p\u003e\n\u003cp\u003e(A and B): Flow cytometry detects C11 levels in (E) PANC-1 and (F) SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(C and D): Levels of (C) ROS and (D) MDA in PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(E): Use the BODIPYTM 581/591 C11 probe to stain the cells, observe the level of lipid peroxidation in PANC-1 and SW1990 cells under a confocal microscope, green fluorescence indicates lipid peroxidation, and red fluorescence indicates no lipid peroxidation.\u003c/p\u003e\n\u003cp\u003e(F): CCK8 method detects the vitality of PANC-1 and SW1990 cells.\u003c/p\u003e\n\u003cp\u003e(G): Flow cytometer detects the level of cell apoptosis.\u003c/p\u003e\n\u003cp\u003eAll quantified data are shown as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig7.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/dd9a4d96402cb60e4f296ac5.jpg"},{"id":93108803,"identity":"e0325c9c-f937-45ad-a7e9-575d79b5b429","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1229147,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimvastatin weakens Erastin's toxic effects on pancreatic cancer.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A): Photos of tumors taken in each group, and the average volume of tumors in each group.\u003c/p\u003e\n\u003cp\u003e(B): Immunohistochemical staining of P62/SQSTM1 in various groups.\u003c/p\u003e\n\u003cp\u003eAll quantified data are shown as mean ± SEM; **p \u0026lt; 0.01, ***p \u0026lt; 0.001 by one-way ANOVA followed by the Tukey-Kramer test.\u003c/p\u003e","description":"","filename":"Fig8.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/1f17dc6b6323c1ffa259c992.jpg"},{"id":101152178,"identity":"a9168eb3-2894-41aa-aca7-153bf7b0ed72","added_by":"auto","created_at":"2026-01-26 16:10:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16209026,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/9a93ed7b-f3f0-4066-88fb-e7ace09de184.pdf"},{"id":93108794,"identity":"bd1bc2e2-a2da-401b-89ca-a22e24e85f99","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":14231,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/f7e96ee3f37bc68273b77ac0.docx"},{"id":93108804,"identity":"c5046d4c-03de-47a7-8555-fd7bb2e9e86c","added_by":"auto","created_at":"2025-10-09 07:17:21","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18049574,"visible":true,"origin":"","legend":"","description":"","filename":"wb.zip","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/7fce5ed3e45813193a969a31.zip"},{"id":93108805,"identity":"86e7c2f5-ae9f-4bf0-b984-368256252be1","added_by":"auto","created_at":"2025-10-09 07:17:28","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":127096233,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7657011/v1/c77fb3f9514061576904ce35.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Low-dose simvastatin protects pancreatic cancer cells by promoting mitochondrial autophagy through TFEB","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe incidence and mortality rates of pancreatic cancer have been steadily increasing globally, particularly in developed countries. According to the latest statistics, pancreatic cancer is the fourth leading cause of cancer-related death in the United States, and it is expected to become the second leading cause by 2030[1].The five-year survival rate for pancreatic cancer is very low, generally around 5%[2], primarily because most patients are diagnosed at an advanced stage when the cancer is locally advanced or metastatic. Currently, surgical resection is the only potentially curative treatment, but only a small number of patients are eligible for surgery, as most are diagnosed when surgery is no longer an option.Treatment for pancreatic cancer remains a challenge, with traditional approaches including surgery, chemotherapy, radiation therapy, and targeted therapy[3]. Pancreatic cancer has a unique and complex tumor microenvironment. Surrounding the tumor is a large amount of fibrous tissue, which forms a physical barrier that hinders the effective penetration of drugs. The abundance of collagen fibers and immunosuppressive cells (such as cancer-associated fibroblasts) also limits the therapeutic efficacy of drugs[4].The tumor vasculature in pancreatic cancer is abnormal, leading to very limited blood supply to the tumor tissue. Low blood flow not only restricts the distribution of drugs within the tumor region but also impairs the permeability of therapeutic agents. The blood vessels within the tumor are irregular, often accompanied by high-pressure tumor stroma, further hindering drug penetration and effective delivery[5].\u003c/p\u003e\n\u003cp\u003eStatins, commonly used to lower cholesterol levels in the blood, have also been found to have potential anti-cancer effects in recent studies[6]. Although the anti-cancer mechanisms of statins are still under investigation, some research suggests that their anti-cancer effects may be related to several mechanisms: Statins inhibit HMG-CoA reductase (3-hydroxy-3-methylglutaryl-coenzyme A reductase), which is the rate-limiting enzyme in the cholesterol biosynthesis pathway[7]. By reducing cholesterol synthesis, statins not only lower cholesterol levels but also interfere with the structure of the cell membrane, affecting the proliferation and growth of tumor cells. Cholesterol is an important component of the cell membrane, and inhibiting its synthesis may lead to changes in the structure and function of the tumor cell membrane, thereby inhibiting tumor cell growth. Statins have also been found to have anti-angiogenic effects, meaning they may limit tumor growth by inhibiting the formation of new blood vessels. Tumors require blood vessels to obtain oxygen and nutrients to support their growth and metastasis. Statins can reduce the expression of angiogenesis factors such as vascular endothelial growth factor (VEGF), slowing the tumor\u0026apos;s blood supply and thereby inhibiting its growth[8]. Although statins have shown potential anti-cancer effects in many studies, some research suggests that, in certain cases, statins may promote tumor growth or progression. Recent studies have shown that statins not only have cholesterol-lowering effects but also exhibit potential antioxidant properties in the tumor microenvironment. Antioxidant stress refers to the regulation of intracellular redox balance to reduce damage caused by oxidative stress. Statins inhibit the production of reactive oxygen species (ROS) through multiple mechanisms, thereby reducing oxidative stress. ROS are generated during cellular metabolism, particularly in the mitochondria through oxidative phosphorylation[9]. Studies suggest that low doses of statins can reduce ROS production by affecting cholesterol biosynthesis pathways, thereby lowering cellular oxidative metabolism[10]. Mitochondria are the main source of reactive oxygen species (ROS) in cells. Under normal conditions, mitochondria generate small amounts of ROS during cellular respiration, which play a positive role in cell signaling and adaptation. However, mitochondrial damage often leads to the excessive accumulation of ROS, which increases oxidative stress and further damages the cell\u0026apos;s DNA, lipids, and proteins, ultimately inhibiting tumor growth[11]. When using statins, due to the pancreatic cancer barrier or blood supply factors, the difficulty of the drug penetrating the cancer tissue raises the question of whether the small amount of statins that does enter the cancer tissue also exerts an antioxidant stress effect, which requires further investigation.\u003c/p\u003e\n\u003cp\u003eErastin promotes the accumulation of ROS, leading to mitochondrial membrane damage. This damage induces the formation of pores on the mitochondrial membrane, resulting in mitochondrial dysfunction[12]. Transcription factor EB (TFEB) is an important transcription factor in autophagy, which can directly regulate the expression of autophagy-associated proteins.[13] In this study, We used Erastin to induce mitochondrial damage in pancreatic cancer cells and treated the cells with different concentrations of Simvastatin to observe its effects on pancreatic cancer cells.We found that a small dose of simvastatin could promote the nuclear translocation of TFEB and promote P62 transcription. During mitochondrial stress, it clears damaged mitochondria via autophagy, inhibiting apoptosis and ferroptosis of pancreatic cancer cells. Our study reveals one of the reasons for the suboptimal efficacy of statins, providing new insights for the use of statins in the treatment of pancreatic cancer.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human pancreatic cancer cell lines PANC-1 and SW1990 were obtained from the American Type Culture Collection (ATCC) and were passaged in our laboratory fewer than 6 months after receipt. PANC-1 cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) (HyClone) supplemented with 10% FBS (Gibco). SW1990 cells were cultured in L15 medium (HyClone) supplemented with 10% FBS.\u0026nbsp;The incubator was set to 37\u0026deg;C with 5% carbon dioxide (CO₂) concentration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 RNA isolation and quantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cultured cells using the RNA Purification Kit (EZBioscience, cat. no. B004D) combined with DNase I treatment. cDNA was synthesized from 1 \u0026mu;g of total RNA using the PrimeScript RT reagent Kit (TaKaRa, cat. no. RR036A). Gene expression levels were measured by quantitative PCR (Thermo Fisher Scientific) using Power SYBR Green PCR Mix .\u003c/p\u003e\n\u003cp\u003eThe information of primers was listed below.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTFEB: 5\u0026apos;- CCTGGAGATGACCAACAAGCAG -3\u0026apos; (forward), 5\u0026apos;- TAGGCAGCTCCTGCTTCACCAC -3\u0026apos; (reverse);\u003c/p\u003e\n\u003cp\u003eSQSTM1/P62: 5\u0026apos;- TGTGTAGCGTCTGCGAGGGAAA -3\u0026apos; (forward), 5\u0026apos;- AGTGTCCGTGTTTCACCTTCCG-3\u0026apos; (reverse).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Western blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBriefly, whole-cell protein lysates were extracted by RIPA lysis buffer containing protease and phosphatase inhibitors (Beyotime, cat. no. P1050) and then separated by SDS-AGE and blotted onto polyvinylidene fluoride membranes (Bio-Rad). After blocking, the membranes were incubated with the corresponding antibodies at 4\u0026deg;C overnight. Next, the membranes were incubated with HRP-conjugated\u0026nbsp;secondary antibodies. Finally, signals of the immunoblots were developed by an ECL system (Millipore, Billerica, USA) and captured by a Tanon 5200 Chemiluminescent Imaging System (Shanghai, China). We obtained antibodies targeting TFEB (Proteintech, 13372-1-AP), SQSTM1/p62 (Affinity, AF5384), LC3B (Affinity, AF4650), PINK1 (Affinity, DF7742), Parkin (Affinity, AF0235), Histone H3 (Affinity, BF9211), \u0026beta;-actin (Santa Cruz, sc-47778). Next, the membranes were probed with secondary antibodies conjugated to HRP Goat Anti-Mouse IgG (H+L) (ABclonal, AS003), and HRP Goat Anti-Rat IgG (H+L) (ABclonal, AS028). Antigen-antibody complexes were visualized using the Omni-ECLTM Enhanced Pico Light Chemiluminescence Kit (epizyme, SQ101L).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Chemicals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBODIPYTM 581/591 C11 was purchased from Invitrogen (InvitrogenTM, D3861). Erastin(S724204) and Simvastatin(S179205) were purchased from Selleck.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Stable knockdown and overexpression of TFEB by lentiviral vectors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe seeded 1 \u0026times; 10⁶ cells in each well of a 6-well plate with 2 mL of complete medium and transduced them with lentiviral vectors（HANBIO Shanghai, China）at a multiplicity of infection (MOI) of 10:1. The transduction was performed in antibiotic-free medium supplemented with polybrene (8 \u0026mu;g/mL). After recovery in complete medium, puromycin (5 \u0026mu;g/mL) was added to select transduced cells.The sequences were as follows: shTFEB-1: 5\u0026prime;-CGATGTCCTTGGCTACATCAA-3\u0026prime;; shTFEB-2: 5\u0026prime;-GAGACGAAGGTTCAACATCAA-3\u0026prime;. The designed sequences were cloned and inserted into the vector pCMV-c-flag（Beyotime）to generate TFEB expression plasmids.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 CCK-8 cell viability assay and colony-forming unit assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell viability was assessed using the Cell Counting Kit-8 according to the manufacturer\u0026rsquo;s instructions. Briefly, cells were seeded into 96-well plates at a density of 3\u0026times;10\u0026sup3;\u0026nbsp;cells in 100\u0026mu;L of complete medium and incubated overnight to allow for attachment. After treatment with Erastin(5\u0026mu;M) and various concentrations of simvastatin (1-6\u0026mu;M) for 96 h. Next, the cells were treated with 10\u0026mu;L of CCK-8 reagent for 2 h and incubated for an additional 1 hours at 37\u0026deg;C. The absorbance at 450 nm was measured using a microplate reader. Cell viability was calculated based on the absorbance values and normalized to the control group.\u003c/p\u003e\n\u003cp\u003eFor the colony formation assay, cells were seeded in 6-well plates at a density of 2000 cells per well and cultured for 48 h, and treated with Erastin(5\u0026mu;M) and simvastatin(2\u0026mu;M) for \u0026nbsp;14 days to allow colony formation. The medium was replaced every 3 days. At the end of the incubation period, colonies were washed gently with PBS, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet for 30 minutes at room temperature. The plates were then rinsed with water and air-dried.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 5-Ethynyl-20-deoxyuridine (EdU) incorporation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell proliferation was assessed using the EdU (5-ethynyl-2\u0026prime;-deoxyuridine) assay with a commercial kit (Beyotime, cat. no. C0078S), according to the manufacturer\u0026rsquo;s instructions. Briefly, cells were seeded in 24-well plates and treated with Erastin(5\u0026mu;M) and simvastatin(2\u0026mu;M) for 48 h, and incubated with 10 \u0026mu;M EdU for 2 hours at 37\u0026deg;C. After incubation, cells were fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.5% Triton X-100 in PBS for 20 minutes, and stained with the Click-iT reaction cocktail for 30 minutes in the dark. Finally, cell nuclei were counterstained with DAPI. Stained cells were visualized and imaged under a fluorescence microscope, and EdU-positive cells were quantified to evaluate proliferative activity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 BODIPYTM 581/591 C11 staining and Reactive oxygen species assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLipid peroxidation was evaluated using the fluorescent probe BODIPY\u0026trade; 581/591 C11 (Thermo Fisher Scientific, Cat. No. D3861) according to the manufacturer\u0026rsquo;s instructions. Briefly, cells were seeded in 6-well plates and treated as indicated. After treating with Erastin(5\u0026mu;M) and simvastatin(2\u0026mu;M) for 48 h, cells were incubated with 2 \u0026mu;M BODIPY\u0026trade; 581/591 C11 in serum-free medium for 30 minutes at 37\u0026deg;C in the dark. After incubation, cells were washed twice with PBS, and fluorescence was detected using a fluorescence microscope or flow cytometer. Lipid peroxidation was assessed based on the shift from red fluorescence (non-oxidized) to green fluorescence (oxidized).\u003c/p\u003e\n\u003cp\u003eCells were plated in 6-well cell culture plate and then incubated with C11-bodipy contained culture medium at a concentration of 2 \u0026mu;M for 30 min. Then, cells were washed with PBS twice and resuspended. Fluorescence intensity was detected by flow cytometry (Beckman) and results were analyzed by FlowJo software. For confocal imaging, cells were plated in round coverslip. Before detection, cells were incubated with 2 \u0026mu;mol/L C11-bodipy for 30 min. Next, cells were washed with PBS twice and images were acquired using confocal microscopy.\u0026nbsp;Intracellular ROS level were detected with Reactive Oxygen Species Assay Kit (Beyotime, cat. no. S0033S). Briefly, cells were stained with 10 \u0026mu;M DCFH-DA for 20 min, and washed twice with PBS. After washing, fluorescence intensity was detected by flow cytometry (Beckman) and results were analyzed by FlowJo software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Lipid peroxidation malondialdehyde (MDA) Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePanc-1 and SW1990 cells were seeded in 10 cm dishes and treated with Erastin(5\u0026mu;M) and simvastatin(2\u0026mu;M) for 48h.The malondialdehyde (MDA) content was determined using a commercial MDA assay kit provided by Beyotime Biotechnology (Beyotime, cat. no. S0131S), following the manufacturer\u0026rsquo;s instructions. The principle is based on the reaction of MDA with thiobarbituric acid (TBA) under high-temperature and acidic conditions to form a red adduct, which is measured at 532 nm. The MDA concentration in the samples was calculated using a standard curve. Each sample was analyzed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 Enhanced mitochondrial membrane potential assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mitochondrial membrane potential (\u0026Delta;\u0026Psi;m) was assessed using the JC-1 dye method with a JC-1 assay kit provided by Beyotime Biotechnology ((Beyotime, cat. no. C2003S)), following the manufacturer\u0026apos;s instructions. The procedure was as follows: Panc-1 and SW1990 cells were seeded in 10 cm dishes and treated with Erastin(5\u0026mu;M) and simvastatin(2\u0026mu;M) for 48h.the medium was removed and the cells were gently washed twice with PBS. An appropriate volume of JC-1 working solution was added to each dish, and cells were incubated at 37\u0026deg;C for 20 minutes. After incubation, the dye solution was discarded, and cells were washed twice with JC-1 staining buffer.Fluorescence intensity was then observed under a fluorescence microscope, detecting red fluorescence of JC-1 aggregates (Ex/Em = 525/590 nm) and green fluorescence of JC-1 monomers (Ex/Em = 490/530 nm).Changes in mitochondrial membrane potential were evaluated by the ratio of red to green fluorescence intensity, with a decrease in the red/green ratio indicating a loss of\u0026nbsp;\u0026Delta;\u0026Psi;m. Each group was analyzed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11 Transmission electron microscope (TEM) imaging\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were resuspended and washed with PBS twice. Then, cells were fixed with 2.5% glutaraldehyde. TEM imaging was conducted by Servicebio (Wuhan, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12 Cell death\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell apoptosis was assessed using the Annexin V-FITC/PI dual staining method with an apoptosis detection kit provided by BD Biosciences (BD, cat. no. 556547), following the manufacturer\u0026rsquo;s instructions. Briefly, Panc-1 and SW1990 cells were seeded in 10 cm dishes and treated with Erastin(5\u0026mu;M) and simvastatin(2\u0026mu;M) for 48h，cells were harvested by trypsinization, washed with PBS, and collected by centrifugation. The cell pellet was resuspended in 1\u0026times; Binding Buffer at a concentration of 1\u0026times;10⁶ cells/mL. Then, 100 \u0026mu;L of the cell suspension was incubated with 5\u0026nbsp;\u0026mu;L Annexin V-FITC and 5\u0026nbsp;\u0026mu;L propidium iodide (PI) in the dark for 15 minutes. After incubation, 400\u0026nbsp;\u0026mu;L of 1\u0026times;\u0026nbsp;Binding Buffer was added and mixed gently. Samples were immediately analyzed using a flow cytometer (e.g., BD FACSCalibur) to determine the proportion of apoptotic cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13 Chromatin immunoprecipitation assay and promoter activity assessment by a dual-luciferase assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChIP was performed using the Chromatin Immunoprecipitation (ChIP) Kit (BersinBio, cat. no. Bes5001). Briefly, pancreatic cancer cells were seeded in 10 cm dishes, crosslinked with the reagent when they grew to 90% confluence, and lysed with SDS buffer. Then, ultrasound was used to break the DNA into fragments of 200\u0026ndash;600 bp, and specific antibodies or anti-human IgG antibody was used to pull down the DNA. After washing with high salt and low salt buffers, DNA was eluted and decrosslinked, and enriched sequences were examined by qPCR, according to the Primers to detect P62/SQSTM1 promoter occupancy were listed as follows, Primer1: 5\u0026apos;- CTCAGAGAGCCAGCCTCCTG-3\u0026apos; (F), 5\u0026apos;- GCCTAGGTGGGGCCATATCTG -3\u0026apos; (R); Primer2: 5\u0026apos;- GCTGGCTGCAAAGTGGAGGC -3 \u0026apos; (F), 5\u0026apos;- AGGATCCTGTGAGGTATGAG-3\u0026apos; (R). The P62/SQSTM1 promoter region, spanning from -2000 to +200 of the transcription start site, was cloned and inserted into the pGL3-Basic vector (Promega). The coding sequence of human TFEB was cloned and inserted into the pCMV-c-flag vector (Beyotime) to generate TFEB expression plasmids. A dual-luciferase system (Promega, cat. no. E1910) was used to measure firefly and Renilla luciferase activities according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.14 Immunofluorescence (IF) staining\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePanc-1and SW1990 cells were cultivated in confocal dishes after treatment, fixed with 4% paraformaldehyde for 10 min, washed with PBS three times, treated with permeabilization solution (1% Triton X-100 in PBS), washed with PBS again, and blocked with 5% bovine serum albumin (Sigma-Aldrich, Germany) for 1 h. The primary antibody was added to the 24-well plate and mixed overnight at 4 \u0026deg;C. Next, the samples were washed with PBS three times, incubated with Alexa Fluor 488-conjugated Goat anti-rabbit IgG secondary antibody (dilution, 1:200; Sangon Biotech, China) for 60 min, and then stained with DAPI (1:10,000) for 10 min in the dark. A laser scanning confocal microscope (Leica, STELLARIS 8 CRS) was used to observe the samples. To label the mitochondria or lysosome, PANC-1 and SW1990 cells were seeded in confocal dishes. PANC-1 and SW1990 cells were treated with MitoTracker Red (dilution, 200nM; Beyotime, C1035), or LysoTracker Green (dilution, 75nM; Beyotime, C1047S) and DAPI (1:10,000), following the manufacturer\u0026rsquo;s instructions. The images were captured using a confocal microscope (Leica, STELLARIS 8 CRS).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.15 Xenograft Tumor Models and immunohistochemical staining (IHC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the role of the combination of Erastin and Simvastatin. To establish a tumor xenograft model, 3 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e SW1990 cells were subcutaneously injected into the nude mice. When the tumors reached a volume of 60-100 mm\u003csup\u003e3\u003c/sup\u003e, the mice were randomly divided into three groups (five mice per group) and treated with DMSO (control), Erastin, or a combination of Erastin and Simvastatin. Mice were treated with 80 \u0026mu;l (400 \u0026mu;M) erastin by intratumoral injection and/or 2mg/kg Simvastatin by intraperitoneal injection every 2 days until the endpoint at day 14. Nude mice were euthanized by carbon dioxide and calculated with the following for mula: length \u0026times; (width2)/2. In paraffin-embedded tissue sections, anti-P62/SQSTM1 antibody was used and stained according to standard IHC procedures. The dilution ratio of the anti-P62/SQSTM1 antibody (Affinity, AF5384) was 1:100.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.16 Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll statistical analyses were performed using GraphPad Prism version 8.0 software (GraphPad Software, USA). All data were reported as the means \u0026plusmn; SD of triplicate experiments, and the differences between the two groups were compared using the two-tailed Student\u0026rsquo;s t- test. Comparisons between multiple groups were performed using one- way ANOVA, and a P-value \u0026lt;0.05 was statistically significant.\u003c/p\u003e"},{"header":"3. Result","content":"\u003cp\u003e\u003cstrong\u003e3.1 Simvastatin can improve Erastin-induced cell toxicity.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mitochondria in cells are constantly challenged by oxidative stress. In order to explore whether simvastatin can protect pancreatic cancer cells, we treated pancreatic cancer cells with Erastin to place the cells in a state of mitochondrial oxidative stress, while using simvastatin in conjunction. We treated PANC-1 and SW1990 cells with 5\u0026mu;M Erastin and different concentrations of simvastatin (the concentration of simvastatin was: 1\u0026mu;M, 2\u0026mu;M, 4\u0026mu;M, 6\u0026mu;M), and after 24 hours of co-incubation, we evaluated the cell vitality by measuring the absorbance by the CCK8 method. We found that simvastatin concentrations of 1\u0026mu;M and 2\u0026mu;M could improve the toxicity of Erastin on pancreatic cancer cells (figure1A and B). We then treated PANC-1 and SW1990 cells with 2\u0026mu;M simvastatin and 5\u0026mu;M Erastin, and measured the cell proliferation ability using the EDU method. We found that 2\u0026mu;M simvastatin significantly resisted Erastin-induced cell proliferation blockage (figure1C). Finally, we carried out colony formation experiments, and found that 2\u0026mu;M simvastatin can improve the colony formation inhibition caused by Erastin (figure1D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Simvastatin inhibits ferroptosis of pancreatic cancer cells.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eErastin can induce ferroptosis, an iron-dependent form of programmed cell death. Ferroptosis is a cell death mechanism closely associated with lipid peroxidation, characterized by the accumulation of iron within the cell and the formation of lipid peroxides. Therefore, we wanted to explore whether simvastatin can also inhibit the ferroptosis of pancreatic cancer cells. We directly observed the level of lipid peroxidation under a confocal microscope, where red fluorescence turned green when lipid peroxidation occurred. We found that simvastatin reduced the occurrence of lipid peroxidation (figure 2A). We used the BODIPY 581/591 C11 probe to detect lipid peroxidation levels and found that simvastatin (2\u0026mu;M) could resist the increase in lipid peroxidation levels induced by Erastin (5\u0026mu;M) (figure 2B and C). To further detect the level of cell ferroptosis, we used the oxidation-sensitive fluorescent probe DCFH-DA to detect the level of intracellular ROS, and we also detected the level of intracellular MDA. We found that simvastatin could reduce the level of intracellular ROS and MDA (figure 2D and E). Also, erastin targets mitochondria, causing a large accumulation of ROS, which can eventually trigger apoptosis. We used Erastin and simvastatin together, and found that simvastatin can reduce the apoptosis caused by Erastin (figure S1). Erastin increases oxidative stress and generates reactive oxygen species (ROS), leading to the loss of mitochondrial membrane potential. The accumulation of ROS can damage the mitochondrial inner membrane, resulting in the loss of mitochondrial membrane potential, thereby disrupting mitochondrial energy production and compromising cell survival. We used JC-1 staining to detect mitochondrial membrane potential (MMP) and observed MMP under a confocal microscope, where green fluorescence indicates a decrease in MMP, suggesting mitochondrial damage. We found that Erastin significantly damaged the MMP of PANC-1 and SW1990 cells, but simvastatin could reverse such damage (figure 2F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Simvastatin promotes mitochondrial autophagy in pancreatic cancer cells.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe found that both ferroptosis and apoptosis are closely related to the stability of mitochondrial structure and function. After mitochondrial damage induced by Erastin, simvastatin was able to reverse this effect. Therefore, we hypothesize that statins may have a mechanism that can repair damaged mitochondria. To visually observe the changes in mitochondria, we used transmission electron microscopy to examine pancreatic cancer cells treated with Erastin and simvastatin., we found that under the influence of Erastin, the membrane structure of the mitochondria was damaged, and the cristae disappeared. After using simvastatin to treat PANC-1 and SW1990 cells, we saw more autophagosomes (figure3A). Mitochondrial damage and oxidative stress are the causes of cell death, and cells can maintain normal function by removing damaged mitochondria through autophagy. Autophagy is a cell decomposition metabolic pathway, which leads to the degradation and recycling of proteins and organelles after the fusion of isolation vesicles, autophagosomes and lysosomes that provide hydrolytic enzymes. Mitochondrial autophagy is a special form of autophagy that selectively degrades mitochondria via the PINK1/Parkin pathway[14]. When the mitochondrial membrane is damaged, PINK1 aggregates on the outer mitochondrial membrane (OMM), phosphorylating E3 ubiquitin ligase Parkin and causing it to aggregate on the OMM. Several mitochondrial proteins, including VDAC1, Miro, Mfn-1 and Mfn-2, are ubiquitinated by Parkin, and the subsequent accumulation of P62 on the OMM leads to the binding of ubiquitinated products and LC3, ultimately localizing mitochondria to autophagosomes, which fuse with lysosomes to form auto-lysosomes, and eventually leading to the degradation of mitochondria[15]. Recent studies have found that simvastatin can trigger mitochondrial autophagy[10], so we hypothesized that simvastatin promotes mitochondrial autophagy to remove damaged mitochondria, thus protecting pancreatic cancer cells. We first detected proteins related to mitochondrial autophagy, and found that after Erastin acted on pancreatic cancer cells, the use of simvastatin could increase the expression of proteins related to mitochondrial autophagy (figure3B and C). Meanwhile, immunofluorescence showed that after simvastatin treatment, the colocalization of lysosomes and mitochondria increased, indicating that simvastatin promoted mitochondrial autophagy (figure3D and E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Simvastatin induces TFEB nuclear translocation, promoting P62 transcription to regulate mitochondrial autophagy.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe transcription factor EB (TFEB) is the main transcription regulator of autophagy and lysosomes, and can regulate their biogenesis and function[16]. Almost all receptors which serve for lysosome biogenesis are controlled by TFEB transcription, with TFEB being its main regulator. Therefore, we wanted to know if simvastatin regulates mitochondrial autophagy through TFEB. Normally, TFEB is phosphorylated and retained in the cytoplasm. But when TFEB is dephosphorylated, it moves from the cytoplasm to the nucleus, where it actively regulates target gene expression to carry out cargo recognition, autophagosome formation, vesicle fusion and substrate degradation. By observing with immunofluorescence, we found that simvastatin promotes the nuclear translocation of TFEB. After simvastatin treatment, the nuclear translocation of TFEB increased in PANC-1 and SW1990 cells (figure4A). At the same time, we extracted the cytosolic protein and nuclear protein of PANC-1 and SW1990. After simvastatin treatment, the TFEB content in the cytoplasm decreased, while the TFEB content in the nucleus increased (figure4B and C). P62/SQSTM1 is a receptor of mitochondrial autophagy, and research suggests that TFEB can regulate P62/SQSTM1, but the specific mechanism is not yet clear.\u0026nbsp;We used immunofluorescence to observe the expression of P62/SQSTM1, and found that simvastatin not only increased TFEB\u0026apos;s nuclear translocation, but also increased the expression of P62/SQSTM1 on mitochondria (figure4D and E). We speculated that TFEB might be a transcription factor of P62/SQSTM1. Therefore, we used lentivirus to stably reduce the expression of TFEB, and then checked the mRNA and protein levels of P62/SQSTM1. We found that after knocking down TFEB, both mRNA and protein levels of P62/SQSTM1 were significantly reduced (figure5A-D). Using the JASPAR website, we predicted the binding sites of TFEB in the P62/SQSTM1 promoter (http://jaspar.genereg.net/). We found two potential binding sites (Site1-Site2) (figure5E and F). We therefore designed a CHIP-PCR to confirm TFEB\u0026apos;s binding site at the P62/SQSTM1 promoter, and our results showed that the binding site in the promoter area is Site1, not Site2 (figure5G). Lastly, we designed a luciferase reporter gene expression plasmid with Site1 site and transfected it into HEK293T cells. By comparing fluorescence values, we found that overexpressing TFEB increased the activity of the P62/SQSTM1 promoter reporter (figure5H).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 Knocking downTFEB weakens the effect of simvastatin.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe used lentivirus to stably knock down TFEB and found that, under the action of Erastin and simvastatin, the expression of SQSTM1/P62 was decreased through immunofluorescence (figure6A and B), and the localization of lysosomes in the mitochondria was reduced (figure6C and D). We measured the mitochondrial membrane potential and found it was also decreased (figure6E). We used the BODIPY 581/591C11 probe to detect lipid peroxidation levels, and found that after TFEB was knocked down, lipid peroxidation levels in PANC-1 and SW1990 cells increased (figure7A and B), and stronger green fluorescence was observed under confocal microscopy (figure7E). In addition, intracellular MDA and ROS levels also increased (figure7C and D). Therefore, knocking down TFEB weakens the inhibitory effect of simvastatin on ferroptosis in pancreatic cancer cells. Finally, we detected the cell proliferation level and apoptosis, and found that knocking down TFEB weakened cell proliferation ability (figure7F), and increased cell apoptosis level (figure7G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 In vivo, Simvastatin weakens Erastin\u0026apos;s toxic effect on pancreatic cancer.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe established a human pancreatic cancer xenograft model, and then treated it with a combination of Simvastatin and Erastin. Every two days, we injected 80\u0026mu;l of 400\u0026mu;M Erastin into the tumor tissue, while Simvastatin was injected intraperitoneally into the nude mice at a dose of 2mg/Kg. We observed the growth of the tumor from the first day to the 14th day of treatment, and found that Erastin significantly reduced the volume of the tumor, while the tumor volume did not significantly decrease with the combined treatment of Simvastatin and Erastin(figure8A). We then performed immunohistochemical staining on the tumor tissue, and found that the expression of P62/SQSTM1 in the tumor tissue treated with Simvastatin and Erastin was higher(figure8B).[17]\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePancreatic ductal adenocarcinoma (PDAC) is a relatively uncommon cancer, with approximately 60430 new diagnoses expected in 2021 in the US. The incidence of PDAC is increasing by 0.5% to 1.0% per year, and it is projected to become the second-leading cause of cancer-related mortality by 2030[18]. This depressing reality is mainly due to late-stage diagnosis and the relative lack of effectiveness of existing treatments. Therefore, the development of new strategies and the identification of innovative treatment targets remain a priority for this cancer.\u003c/p\u003e\n\u003cp\u003ePrevious studies have suggested that simvastatin can inhibit the growth of pancreatic cancer, but the concentration of simvastatin selected in in vitro experiments is far more than 2\u0026micro;M[19],Bjorkhem‐Bergman\u0026apos;s research showed that the mean concentration of statins in human serum was only 1-15 nM, and the pharmacologically active fraction of statins was only 0.01-0.5 nM[20]. Most existing evidence of the pleiotropy of statins is based on in vitro studies with much higher concentrations (1-50 \u0026mu;M). Pancreatic cancer tumors are typically associated with a large amount of fibrotic stroma, primarily composed of fibroblasts, collagen, and glycosaminoglycans (such as hyaluronic acid). These fibrotic components increase the stiffness and density of the tumor stroma, forming a mechanical barrier that significantly reduces the permeability of drugs. Drugs have difficulty penetrating these dense stromal layers, making it challenging for them to effectively reach tumor cells, resulting in poor therapeutic outcomes[21]. Additionally, in the tumor microenvironment of pancreatic cancer, blood vessels are not only sparse but also structurally abnormal, forming irregular and ruptured vessels that impede blood flow. This abnormal vascular network makes it difficult for drugs, especially larger molecules or certain macromolecular drugs (such as antibody drugs and chemotherapy agents), to effectively penetrate into the core of the tumor[22]. Based on these results, we found that small doses of simvastatin could promote mitochondrial autophagy through TFEB, thereby clearing damaged mitochondria, Due to factors such as the surrounding cellular stroma and lack of blood supply in pancreatic cancer, the drug concentration that actually reaches pancreatic cancer tissue is relatively low. Our study found that low doses of simvastatin can protect mitochondrial function and exert antioxidant effects. Therefore, under conventional therapeutic doses, simvastatin is unlikely to exert significant antitumor effects. This may be one of the reasons why statins show limited efficacy in cancer treatment. Therefore, by inhibiting tumor angiogenesis, we can improve the structure of tumor blood vessels, making them more regular and more permeable. This can increase the blood supply of the drug, allowing it to more easily enter the tumor. MMPs are enzymes responsible for the degradation of the tumor stroma, and by using MMP inhibitors, the excessive accumulation of stroma can be reduced, minimizing its physical barrier effect on drug penetration[23]. Alternatively, drugs can be directly injected into the tumor area, avoiding the dilution and distribution limitations caused by systemic circulation. This method can directly increase the drug concentration in the tumor and reduce side effects in normal tissues. These strategies provide new prospects for simvastatin in the treatment of pancreatic cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXuemin Chen and Yi Qin designed the research. Yang Yang and Di Wu revised the manuscript. Weibo Chen, Yichi Jin, Aining Kang, Yanxun Zou ,Yi Liu and Guangchen Zu contributed to the figure. Xianjun Yu,Yue Yang and Yong An contributed to the acquisition of the financial support for the project leading to this publication. Zhiliang Wang wrote the manuscript and took an active part in the procedures mentioned above. All authors contributed to the article and approved the submitted version.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grants from the National Natural Science Foundation of China (Nos. 81972250 and 81602054), the Young Talent Development Plan of Changzhou Health Commission (Nos. CZQM2021002 and CZQM2020005), Reserve Top Talent of Changzhou\u0026nbsp;\u0026ldquo;The 14th Five-Year Plan\u0026rdquo;\u0026nbsp;High-Level Health Talents Training Project (No. 2024BJHB007), the Young Talent Science and Technology Project of Changzhou Health Commission,（No.QN202305）,the Social Development Support Project of Changzhou Science and Technology Bureau (No. CE20225043), and the Major Science and Technology Project of Changzhou Health Commission (Nos. ZD202305 and ZD202210), Undergraduate innovation and entrepreneurship training program of Jiangsu Province(No. 202410285253Y)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll mice experiments were performed following in stitutional guidelines and approved by the Ethics Committee of Fudan University Shanghai cancer center.\u003c/p\u003e\n\u003cp\u003eThe animal study was reviewed and approved by the Institutional Animal Care and Use Committee of Fudan University Shanghai cancer center (permit number: No. FUSCCIACUC-S20210465).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors consent to publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eR.L. Siegel, K.D. Miller, N.S. Wagle, A. Jemal, Cancer statistics, 2023, CA Cancer J Clin 73(1) (2023) 17-48.\u003c/li\u003e\n\u003cli\u003eE. Sirri, F.A. Castro, J. Kieschke, L. Jansen, K. Emrich, A. Gondos, B. Holleczek, A. Katalinic, I. Urbschat, C. Vohmann, H. Brenner, Recent Trends in Survival of Patients With Pancreatic Cancer in Germany and the United States, Pancreas 45(6) (2016) 908-914.\u003c/li\u003e\n\u003cli\u003eA. McGuigan, P. Kelly, R.C. Turkington, C. Jones, H.G. Coleman, R.S. McCain, Pancreatic cancer: A review of clinical diagnosis, epidemiology, treatment and outcomes, World J Gastroenterol 24(43) (2018) 4846-4861.\u003c/li\u003e\n\u003cli\u003eC. Feig, A. Gopinathan, A. Neesse, D.S. Chan, N. Cook, D.A. Tuveson, The pancreas cancer microenvironment, Clin Cancer Res 18(16) (2012) 4266-4276.\u003c/li\u003e\n\u003cli\u003eA. Neesse, C.A. Bauer, D. \u0026Ouml;hlund, M. Lauth, M. Buchholz, P. Michl, D.A. Tuveson, T.M. Gress, Stromal biology and therapy in pancreatic cancer: ready for clinical translation?, Gut 68(1) (2019) 159-171.\u003c/li\u003e\n\u003cli\u003eD.M. Boudreau, O. Yu, J. Johnson, Statin use and cancer risk: a comprehensive review, Expert Opin Drug Saf 9(4) (2010) 603-621.\u003c/li\u003e\n\u003cli\u003eJ.W. Clendening, L.Z. Penn, Targeting tumor cell metabolism with statins, Oncogene 31(48) (2012) 4967-4978.\u003c/li\u003e\n\u003cli\u003eI.H. El-Khashab, Antiangiogenic and Proapoptotic Activities of Atorvastatin and Ganoderma lucidum in Tumor Mouse Model via VEGF and Caspase-3 Pathways, Asian Pac J Cancer Prev 22(4) (2021) 1095-1104.\u003c/li\u003e\n\u003cli\u003eA. Wang, Y. Lin, B. Liang, X. Zhao, M. Qiu, H. Huang, C. Li, W. Wang, Y. Kong, Statins attenuate cholesterol-induced ROS via inhibiting NOX2/NOX4 and mitochondrial pathway in collecting ducts of the kidney, BMC Nephrol 23(1) (2022) 184.\u003c/li\u003e\n\u003cli\u003eC.-C. Hsieh, C.-Y. Li, C.-H. Hsu, H.-L. Chen, Y.-H. Chen, Y.-P. Liu, Y.-R. Liu, H.-F. Kuo, P.-L. Liu, Mitochondrial protection by simvastatin against angiotensin II-mediated heart failure, Br J Pharmacol 176(19) (2019) 3791-3804.\u003c/li\u003e\n\u003cli\u003eY. Yang, S. Karakhanova, W. Hartwig, J.G. D\u0026apos;Haese, P.P. Philippov, J. Werner, A.V. Bazhin, Mitochondria and Mitochondrial ROS in Cancer: Novel Targets for Anticancer Therapy, J Cell Physiol 231(12) (2016) 2570-2581.\u003c/li\u003e\n\u003cli\u003eY. Sun, R. Deng, C. Zhang, Erastin induces apoptotic and ferroptotic cell death by inducing ROS accumulation by causing mitochondrial dysfunction in gastric cancer cell HGC‑27, Mol Med Rep 22(4) (2020) 2826-2832.\u003c/li\u003e\n\u003cli\u003eW. Liu, C.-C. Li, X. Lu, L.-Y. Bo, F.-G. Jin, Overexpression of transcription factor EB regulates mitochondrial autophagy to protect lipopolysaccharide-induced acute lung injury, Chin Med J (Engl) 132(11) (2019) 1298-1304.\u003c/li\u003e\n\u003cli\u003eF. Ferro, S. Servais, P. Besson, S. Roger, J.-F. Dumas, L. Brisson, Autophagy and mitophagy in cancer metabolic remodelling, Semin Cell Dev Biol 98 (2020) 129-138.\u003c/li\u003e\n\u003cli\u003eS. Geisler, K.M. Holmstr\u0026ouml;m, D. Skujat, F.C. Fiesel, O.C. Rothfuss, P.J. Kahle, W. Springer, PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1, Nat Cell Biol 12(2) (2010) 119-131.\u003c/li\u003e\n\u003cli\u003eD. Ivankovic, K.-Y. Chau, A.H.V. Schapira, M.E. Gegg, Mitochondrial and lysosomal biogenesis are activated following PINK1/parkin-mediated mitophagy, J Neurochem 136(2) (2016) 388-402.\u003c/li\u003e\n\u003cli\u003eO. Olajubutu, O.D. Ogundipe, A. Adebayo, S.K. Adesina, Drug Delivery Strategies for the Treatment of Pancreatic Cancer, Pharmaceutics 15(5) (2023).\u003c/li\u003e\n\u003cli\u003eW. Park, A. Chawla, E.M. O\u0026apos;Reilly, Pancreatic Cancer: A Review, JAMA 326(9) (2021) 851-862.\u003c/li\u003e\n\u003cli\u003eC.-Y. Chen, Y.-F. Yang, P.C. Wang, L. Shan, S. Lin, P.-J. Chen, Y.-J. Chen, H.-S. Chiang, J.-T. Lin, C.-F. Hung, Y.-J. Liang, Simvastatin Attenuated Tumor Growth in Different Pancreatic Tumor Animal Models, Pharmaceuticals (Basel) 15(11) (2022).\u003c/li\u003e\n\u003cli\u003eL. Bj\u0026ouml;rkhem-Bergman, J.D. Lindh, P. Bergman, What is a relevant statin concentration in cell experiments claiming pleiotropic effects?, Br J Clin Pharmacol 72(1) (2011) 164-165.\u003c/li\u003e\n\u003cli\u003eJ. Kota, J. Hancock, J. Kwon, M. Korc, Pancreatic cancer: Stroma and its current and emerging targeted therapies, Cancer Lett 391 (2017) 38-49.\u003c/li\u003e\n\u003cli\u003eY.-F. Fan, W.-T. Shang, G.-H. Lu, K.-X. Guo, H. Deng, X.-H. Zhu, C.-C. Wang, J. Tian, Decreasing hyaluronic acid combined with drug-loaded nanoprobes improve the delivery and efficacy of chemotherapeutic drugs for pancreatic cancer, Cancer Lett 523 (2021) 1-9.\u003c/li\u003e\n\u003cli\u003eV. Tjomsland, E. Pomianowska, M. Aasrum, D. Sandnes, C.S. Verbeke, I.P. Gladhaug, Profile of MMP and TIMP Expression in Human Pancreatic Stellate Cells: Regulation by IL-1\u0026alpha; and TGF\u0026beta; and Implications for Migration of Pancreatic Cancer Cells, Neoplasia 18(7) (2016) 447-456.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cellular-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ceon","sideBox":"Learn more about [Cellular Oncology](http://link.springer.com/journal/13402)","snPcode":"13402","submissionUrl":"https://submission.nature.com/new-submission/13402/3","title":"Cellular Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"TFEB, Simvastatin, P62, Mitochondrial autophagy","lastPublishedDoi":"10.21203/rs.3.rs-7657011/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7657011/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Pancreatic cancer is typically accompanied by fibrosis, forming a dense stromal matrix. This dense matrix restricts drug penetration, making it difficult for drugs to effectively reach tumor cells. Additionally, pancreatic cancer has inadequate local blood supply and \"vascular irregularity,\" which makes it challenging for drugs to reach the core of the tumor. Even if some drugs reach the pancreas through systemic circulation, poor vascular permeability prevents them from effectively entering tumor cells, resulting in suboptimal therapeutic effects.\nStatins were initially used to treat high cholesterol levels and prevent cardiovascular diseases, but recent studies suggest that they may also have potential therapeutic effects on cancer, particularly certain types of cancer such as pancreatic cancer. However, clinical research on the use of statins for pancreatic cancer treatment is still ongoing, and the results are inconsistent. The effects of statins on pancreatic cancer may vary depending on the dose. Due to the aforementioned limitations of fibrosis and lack of blood supply in pancreatic cancer, simvastatin only exerts its effect on pancreatic cancer cells at low doses.The purpose of this study is to explore the effects of low-dose simvastatin on pancreatic cancer cells and the underlying mechanisms. We investigated the effects of different concentrations of simvastatin on pancreatic cancer cells. The vitality of the cells was evaluated by CCK8, EDU staining, and the level of ferroptosis in pancreatic cancer cells was detected by flow cytometry detection of C11, MDA, ROS. We found that small doses of simvastatin can resist the toxicity of Erastin against pancreatic cancer cells. Under the transmission electron microscope, more mitophagosomes were produced in pancreatic cancer cells treated with small dose of simvastatin, and immunofluorescence revealed increased co-localization of lysosomes and mitochondria, indicating that simvastatin promoted the occurrence of mitophagy. At the same time, immunofluorescence confirmed that simvastatin promoted the nuclear translocation of TFEB, and chromatin immunoprecipitation and dual-luciferase gene report confirmed that TFEB is the transcription factor of P62/SQSTM1. This study clarified that a small dose of simvastatin, in the event of mitochondrial stress in pancreatic cancer cells, induces mitophagy to clear damaged mitochondria, protecting pancreatic cancer cells from ferroptosis and apoptosis, by promoting the transcription of P62/SQSTM1 through the nuclear translocation of TFEB. These findings may explain one of the reasons for the suboptimal efficacy of simvastatin in the treatment of pancreatic cancer, while also providing new insights for research on the antitumor effects of statins.","manuscriptTitle":"Low-dose simvastatin protects pancreatic cancer cells by promoting mitochondrial autophagy through TFEB","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-09 07:17:16","doi":"10.21203/rs.3.rs-7657011/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-13T15:16:26+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-08T23:43:23+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-08T00:37:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"243089749776734003429835651661465587854","date":"2025-09-30T20:11:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"325211031614756194478834074595122855297","date":"2025-09-29T22:13:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"300295455602850668367721791472554802914","date":"2025-09-29T08:52:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"63151563799346258106806114175582940081","date":"2025-09-27T14:02:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"340085890035398657425069861938233852539","date":"2025-09-27T13:43:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"210672738967875904554038971757589144151","date":"2025-09-27T05:13:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-27T05:02:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-22T07:27:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-22T07:26:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cellular Oncology","date":"2025-09-19T09:29:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cellular-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ceon","sideBox":"Learn more about [Cellular Oncology](http://link.springer.com/journal/13402)","snPcode":"13402","submissionUrl":"https://submission.nature.com/new-submission/13402/3","title":"Cellular Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8e036bda-6470-4e2f-a1ed-d68b99d55ed6","owner":[],"postedDate":"October 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:07:55+00:00","versionOfRecord":{"articleIdentity":"rs-7657011","link":"https://doi.org/10.1007/s13402-026-01164-y","journal":{"identity":"cellular-oncology","isVorOnly":false,"title":"Cellular Oncology"},"publishedOn":"2026-01-19 15:57:47","publishedOnDateReadable":"January 19th, 2026"},"versionCreatedAt":"2025-10-09 07:17:16","video":"","vorDoi":"10.1007/s13402-026-01164-y","vorDoiUrl":"https://doi.org/10.1007/s13402-026-01164-y","workflowStages":[]},"version":"v1","identity":"rs-7657011","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7657011","identity":"rs-7657011","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}