Arbutin attenuates CFA-induced Arthritis by modulating expression levels of 5- LOX, NF-κB, IL-17, PGE-2 and TNF-α

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Arbutin, a naturally soluble glycosylated phenol has anti-oxidant, antimicrobial, anti-tumor and anti-inflammatory properties. The current exploration appraises the treatment of arthritis by use of Arbutin (25, 50 and 100 mg/kg) orally in CFA-induced rat Arthritis model. Body weight changes, paw size, and joint diameter were recorded till the 28th day in the arthritic-induced rats. Hematological, biochemical, oxidative and inflammatory biomarkers were measured through the blood samples of anesthetized rats. Arbutin markedly decreased paw volume, PGE-2, anti-CCP and 5-LOX levels, however, maintained metabolic and hematological balance and prevented weight loss. Radiology and histology changes improved significantly in the ankle joints of rats. Moreover, Arbutin increased gene pointers such as IL-10 and IL-4 while significantly reducing the levels of CRP and WBCs, whereas, Hb, Platelets and RBCs count markedly raised in post-treatments. Antioxidant levels of SOD, CAT and GSH were improved and MDA level was reduced in treated groups. Rt-PCR investigation showed a significant reduction of the interleukin-1β, TNF-α, interleukin-6, Cycloxygenase-2, NF-κB and IL-17 and increased expression of gene pointers like IL-4, and IL-10 in treated groups. Assessment of molecular docking revealed a strong binding interaction of Arbutin against 5-LOX, IL-17, TNF-alpha and interleukin-6, Cycloxygenase-2, nuclear factor-κB, IL-4 and iNOS providing a strong association between experimental and theoretical results. As a result, Arbutin has significantly reduced CFA-induced arthritis by modulation of anti-inflammatory cytokines i.e., IL-10 and IL-4, the pro-inflammatory cytokines panel like NF-κB, TNF-alpha, IL-1β, IL-6, PGE-2, 5-LOX and COX-2 and oxidative biomarkers.
Full text 200,987 characters · extracted from preprint-html · click to expand
Arbutin attenuates CFA-induced Arthritis by modulating expression levels of 5- LOX, NF-κB, IL-17, PGE-2 and TNF-α | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Arbutin attenuates CFA-induced Arthritis by modulating expression levels of 5- LOX, NF-κB, IL-17, PGE-2 and TNF-α Abdul Malik, Nabeela Tabassum Sial, Urooj Iqbal, Muhammad Fayyaz Ur Rehman This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3664612/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Arbutin, a naturally soluble glycosylated phenol has anti-oxidant, antimicrobial, anti-tumor and anti-inflammatory properties. The current exploration appraises the treatment of arthritis by use of Arbutin (25, 50 and 100 mg/kg) orally in CFA-induced rat Arthritis model. Body weight changes, paw size, and joint diameter were recorded till the 28th day in the arthritic-induced rats. Hematological, biochemical, oxidative and inflammatory biomarkers were measured through the blood samples of anesthetized rats. Arbutin markedly decreased paw volume, PGE-2, anti-CCP and 5-LOX levels, however, maintained metabolic and hematological balance and prevented weight loss. Radiology and histology changes improved significantly in the ankle joints of rats. Moreover, Arbutin increased gene pointers such as IL-10 and IL-4 while significantly reducing the levels of CRP and WBCs, whereas, Hb, Platelets and RBCs count markedly raised in post-treatments. Antioxidant levels of SOD, CAT and GSH were improved and MDA level was reduced in treated groups. Rt-PCR investigation showed a significant reduction of the interleukin-1β, TNF-α, interleukin-6, Cycloxygenase-2, NF-κB and IL-17 and increased expression of gene pointers like IL-4, and IL-10 in treated groups. Assessment of molecular docking revealed a strong binding interaction of Arbutin against 5-LOX, IL-17, TNF-alpha and interleukin-6, Cycloxygenase-2, nuclear factor-κB, IL-4 and iNOS providing a strong association between experimental and theoretical results. As a result, Arbutin has significantly reduced CFA-induced arthritis by modulation of anti-inflammatory cytokines i.e., IL-10 and IL-4, the pro-inflammatory cytokines panel like NF-κB, TNF-alpha, IL-1β, IL-6, PGE-2, 5-LOX and COX-2 and oxidative biomarkers. Arbutin inflammation CFA Arthritis COX-2 Molecular docking Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Arthritis or Rheumatoid Arthritis (RA), a common disorder of systemic autoimmunity, characterized by the chronic inflammatory process that causes harm to extra-articular organs such as the kidney, heart, digestive system, eyes, skin, joints and central nervous system (Radu and Bungau, 2021 ). In the development of polyarthritis, cytokines are key signaling molecules. Many inflammatory cytokines, such as IL-2, interleukin-6, IL-12 and IL-23, IL-1β are thought to start and continue the inflammatory response in the synovium (Mohammad Saleem et al., 2021 ). Changes in pro- (TNF-α, IL-6, IL-1β) and anti-inflammatory (IL-10 and IL-4) cytokine balances govern the pathogenesis and progression of RA. Additionally, the increase in nuclear factor-kappa B (NF-κB), which is a transcription factor that influences cellular proliferation and inflammation, has a significant influence on the inflammatory immune response associated with Arthritis (Ammara Saleem et al., 2020 ). Arthritis is known to cause progressive synovial inflammation that eventually affects several joints. First, the genetic predisposition to produce autoimmune T and B cells; second, a tissue injury or infection that causes autoreactive lymphocytes to become activated, which in turn causes tissue or organ destruction by stimulating antigen-presenting cells (Gul et al., 2023 ). Numerous T cells, B cells, neutrophils, macrophages, osteoclasts, fibroblasts, and dendritic cell subtypes interact in a complicated way to perpetuate inflammation in the joints. The main inflammatory cells in the afflicted joints are T cells, monocytes, and B cells (Yen-Ju Lin et al., 2020 ). Many environmental aspects are associated with a greater risk of RA, including obesity, smoking, drinking, genetic factors, and insufficient vitamin D. Some widely used treatments for arthritis include biologics, disease modifying anti-rheumatic drugs (DMARDs), NSAIDs, and corticosteroids. Apart from their well-reported side consequences (GI irritation, nephrotoxicity, hematological abnormalities, high risk of cardiovascular problems, and serious infections), and prohibitively high cost, over 30% of the patients did not react to traditional therapy (Nawaz et al., 2023 ). Although NSAIDs, corticosteroids, and DMARDs do not lessen the responses mediated by T cells and B cells. Instead, these aim to reduce joint inflammation and pain (Akhter et al., 2022 ). Therefore, new herbal compounds that are the most efficient and cost-effective against these adverse reactions must be focused. There is more research on phytoconstituents from plants that prevent the production of cytokines for arthritis treatment (Arya et al., 2011 ). Arbutin, a naturally occurring hydroquinone glycoside, is present in the Vaccinium, Asteraceae, and Ericaceae family of plants. It demonstrates a wide range of pharmacological actions, such as neuroprotective, free radical scavenging, antimicrobial, antihyperglycemic, antioxidant, hepatoprotective, antitumor, and alpha-amylase inhibitory properties (Ahmadian et al., 2019 ). Both osteoclasts and osteoblasts have been shown to utilize Arbutin in maintaining bone homeostasis. Arbutin suppresses the generation of superoxide and downregulates the osteoclastogenesis regulator NFATc1 to prevent osteoclast differentiation (Zhang et al., 2021 ). Numerous plant species, including wheat, pears, and bearberry plants in the genus Arctostaphylos, have abundant amounts of glycosylated hydroquinone in their leaves. Arbutin exhibits outstanding safety and has no negative effects on health, including toxicity or irritation. The use of Arbutin as a drug has not been approved yet and some clinical trials (NCT03868748 and NCT00717652) are already in process to determine its toxicity in humans and other animals. Since 1988, Japan has been using it as a skin-lightening agent in cosmetics due to its safety and other countries are now adopting this use as well. Arbutin is a multifunctional compound that exhibits anti-oxidant and depigmenting properties (Lee and Kim, 2012 ). According to the literature review, there hasn't been a scientific assessment of the anti-arthritic effect of Arbutin through the CFA model of polyarthritis. The current study focuses on the molecular mechanism underlying Arbutin for anti-arthritic action in an arthritis model induced by CFA. Materials and Methods Drugs and chemicals Arbutin, purchased from Macklin (China), and we have conducted the characterization of our compound via UV-visible spectrophotometry, GC-MS, FTIR and HPLC for purity of the compound (Figure S1 - S4 ). Complete Freund’s adjuvant (CFA) was obtained through Sigma-Aldrich, USA. DPPH and Piroxicam were obtained from Sigma Aldrich, USA, while, ethanol & chloroform used were of analytical grade. Experimental Animals Sprague Dawley (SD) rats of either sex, weighing 145–230 g have been utilized in the study. Animals were kept in the standard housing circumstances with air-conditioned circumstances at an animal house in the Department of Pharmacology, University of Sargodha. To maintain a room temperature of 25 ± 5°C and also at a twelve-hour light/dark cycle, animals were adequately provided with the pellet diet and free access to water. The animals were acclimatized to their new environment and it was made sure on the guidelines of the National Research Council. Animals were provided with a standard diet and water ad-libitum . Studies performed after acceptance from the Biosafety and Ethical Review Committee (BERC) of the University of Sargodha with Certificate Number. SU/ORIC/803–23. CFAinduction of inflammation Animals were randomly distributed into groups, (n = 6). Group-i: Arthritic Control, Group: ii: Vehicle control Distilled water 10 ml/kg, Group-iii: Piroxicam 10 mg/kg, Group-iv: Arbutin 25 mg/kg, Group-v: Arbutin 50 mg/kg, Group-vi: Arbutin100 mg/kg, All doses were selected from a pilot study. All groups received an injection of 0.1 ml CFA except vehicle control, into the left hind paw of rats on day zero. Treatment continued for 28 days and all animals were killed on the 28th day. To assess Arthritis in each group, several factors were recorded (Akhter et al., 2022 ). Determination of arthritis through physical features Rats in all groups were checked for weight changes, weekly according to the schedule during the treatment (Neng-Yu Lin et al., 2013 ). Paw edema of the rat injected with CFA was observed (Qasim et al., 2021 ). The animals were inspected macroscopically to check for the emergence of any signs of Arthritis. After receiving the CFA injection, rats experienced paw inflammation and arthritis within 4–5 days. The nose, ears, tail, and paws of all rats were assessed and scoring was done, to calculate the arthritic index (Gohil et al., 2018 ). Measurement of paw swelling and weight changes Using a Plethysmometer (Panlab® Spain), physical parameters like paw volume were measured once a week for a total of 28 days. Percentage suppression in the paw (hind footpad) volume was determined by the use of the following equation (Ren et al., 2017 ). Inhibition [%] = Vc − Vt/Vc × 100 The volume of the paws of the control and treated animals is denoted by Vc and Vt, respectively. Throughout the study, changes in body weight in arthritic animals relative to treated animals were also noted to confirm the drug’s therapeutic effects. Assessment of arthritis through blood and serum On the 28th day, the experimental animals (rats) were kept in a transparent acrylic jar and subjected to a brief inhalation of mild ether anesthesia. Through cardiac puncture, blood was drawn into EDTA tubes, and conventional laboratory techniques were used for the hematological parameters such as hemoglobin, RBC, WBC, platelets, ESR, and PCV were measured. Aspartate aminotransferase (AST), alkaline phosphatase (ALP), ALT, and other serum markers were also measured for activity. Assay for mRNA expression of cytokines, IL-1β, TNF-alpha, interleukin-6, COX 2, nuclear factor-κB, IL-4, IL-10 and IL- 17 A specialized kit, the Hi Pure Total RNA Kit (Cat# IVD4121, Magen Biotechnology, Co., Guangzhou, China), was used for the total RNA extraction carried out in blood and tissue samples, and cDNA were prepared using the standard kit protocol. SYBR Select Master Mix (Cat No. 4472903, ZOKEYO, China) was used to express the targeted genes in real-time by using duplicates of the appropriate primers (10µM each) and cDNA as the template. PCR Reactions were conducted on an Rt- PCR System (Sansure Biotech Inc, China). The relevant Ct’s of samples were compared with controls and control samples containing housekeeping genes (GAPDH). Table 1 Forward–reverse primers sequences and base pairs employed in Rt-PCR Marker Sequence (5'->3') Reverse/Forward Product length (bp) Gene Accession Number TNF-α ATGGGCTCCCTCTCATCAGT Forward 106 NM_013693.3 GCTTGGTGGTTTGCTACGAC Reverse IL-6 CCCACCAGGAACGAAAGTCA Forward 81 XM_032905335.1 ACTGGCTGGAAGTCTCTTGC Reverse GAPDH GACTCCACTCACGGCAAATTC Forward 171 NM_001411843.1 TCTCCATGGTGGTGAAGACA Reverse IL-4 ACCCTGTTCTGCTTTCTC Forward 168 NM_201270.1 GTTCTCCGTGGTGTTCCT Reverse IL-10 AGTGGAGCAGGTGAAGAATG Forward 109 NM_012854.2 GAGTGTCACGTAGGCTTCTATG Reverse Cox-2 GATTGACAGCCCACCAACTT Forward 199 NM_017232.4 GATTGACAGCCCACCAACTT Reverse IL-1b CACCTCTCAAGCAGAGCACAG Forward 79 NM_031512.2 GGGTTCCATGGTGAAGTCAAC Reverse NF-κB CGTGAGGCTGTTTGGTTTGA Forward 89 XM_039079521.1 TCTGCCCTCCTGACTCTACT Reverse IL-17 ACTTTCCGGGTGGAGAAGAT Forward 99 XM_032899488.1 CTTAGGGGCTAGCCTCAGGT Reverse Estimation of serum prostaglandin E2 , Anti-Cyclic Citrullinated Peptides (Anti-CCP), and 5-Lipoxgenase (5-LOX) After the experimental animals were fully immunized up to day 28, their hearts were punctured to obtain blood samples. After that, the blood samples were given an hour to clot. Centrifugation at 3000 rpm for 5 minutes was used to extract serum, which was then stored at -20°C. The protocol provided by CSB-E07967r kit (CUSABIO, China the manufacturer of the ELISA kit, was used to measure the prostaglandin E2, Anti-CCP (Anti cyclic citrullinated peptide antibody) Rat ELISA Kit, CUSABIO, catalog No. CSB-E13830r. A microplate spectrophotometer set at a wavelength of 450 nm was used for sample analysis (Akhter et al., 2022 ). The result of the PGE-2 level was expressed as pg per ml. The result of Anti-CCP activity was expressed as U per mL. 5-Lipoxygenase Rat arachidonate 5-Lipoxygense (Alox 5 ELISA Kit) with CUSABIO, Catalogue# CSB-E16982r), according to manufacturer protocol used. In-Vitro assay of antioxidant Free radical scavenging assay of DPPH The assay was conducted to evaluate the antioxidant potential of Arbutin (Shahid Chatha et al., 2014 ). This method includes 1 ml of 0.004% DPPH in the methanol mixed with three mL of Arbutin, and the mixture solution was then left for thirty minutes in the dark. The absorbance at a wavelength of 517 nm was recorded. A reaction mixture with minimum absorbance suggests an increased level of radical scavenging activity. Analysis was also done on the antioxidant activity of ascorbic acid and BHT as a standard. The control group utilized a solution devoid of plant extract (Naseem et al., 2020 ). Three duplicates of each test were run. This is how the percentage inhibition of samples containing DPPH radicals was determined. In-Vivo Antioxidant Assays The serum levels of Glutathione (GSH) and Catalase (CAT) were evaluated using the ELISA protocol. The Catalase and GSH kits (Cat. BC1175 for Rat) were obtained from Solarbio in Beijing, China. The results were expressed in nanograms per milliliter. Further, Rats kit from Solarbio in Beijing, China was used to measure superoxide dismutase (SOD) using kit SOD (Cat. BC0175). The results were given as ng per mL. ELISA determined the amount of malondialdehyde (MDA) in serum. The MDA level was measured using the kit MDA Cat. BC0025 for rat, from Solarbio in Beijing, China, and was reported as nmol per ml. The antioxidant enzymes in the serum, including CAT, SOD, MDA and GSH were assessed in compliance with the manufacturer's instructions using mouse ELISA kits for these substrates. Histological assessment of ankle joints A solution (decalcifying) containing potassium sodium tartrate, sodium tartrate, ethylene diamine tetra acetic acid, and hydrochloric acid was used to fix rat ankle joints in formalin. After cutting the tissues into sections of 5µm thick, embedded in the paraffin and staining done with eosin and hematoxylin (E and H). Further, histopathologist has examined the formation of pannus, the erosion of bone, and the inflammatory cells infiltration. Radiographic analysis On the 28th day, radiographs of the rat hind paws were obtained. Radiographic films were thoroughly examined to look for bone erosions, narrowing between joint spaces, and swelling of joint tissues (Khan et al., 2023 ). Docking study at molecular level Molecular docking of Arbutin was employed for evaluating pro and anti-inflammatory proteins i.e., IL-4 (PDB: 2B8U), IL-10 (PDB: 1Y6K), IL-17(PDB:4HSA), and TNF-alpha (PDB:2AZ5), inducible NOS (PDB:2NSI), cycloxygenase-2 (PDB:5KIR), PGE-2 (PDB:7D7M), 5-LOX (PDB:3V98), NF-κB (PDB:1SVC) targets involved in inflammation. All proteins were downloaded and repaired for molecular docking using software version 20.7.4 (Krieger and Vriend, 2014 ). The three-dimensional structures of the ligand were acquired from PubChem (accessed August 25, 2021 via https://pubchem.ncbi.nlm.nih.gov/ ). The ligands were downloaded. The ligand 2D and 3D structures were optimized using Avogadro’s software. In YASARA, a modified Auto Dock-Lamarckian Genetic Algorithm is utilized for molecular docking and the computation of dissociation constants and binding energies. The docking scores were determined by the protocol before utilizing the equation. ΔG = ΔG (vander waals) + ΔG (H − bonding) + ΔG (electrostatic) + ΔG (torsional free energy) + ΔG (desolavation energy) Ligplot and Pymole sources were used for the collection of data on ligand–protein interactions. The precise ligand was chosen from a database of ligand–protein complexes and interactions—including H-bonds—was recorded. Statistical Assessment Data was shown as mean ± SEM. In order to conduct the statistical analysis, GraphPad Prism version 8.0 was utilized for the Bonferroni posttest and 2-way and 1-way (ANOVA) analysis of variance. Results In-Vitro (DDPH) analysis Arbutin was investigated using DPPH revealing the antioxidant activity of Arbutin. The percentage inhibition of samples containing DPPH radicals was found to be 67.69% (percentage of antioxidant). Effect of Arbutin on Arthritic index (AI), Body weight, and paw volume The findings presented in Fig. 1 indicate that Arbutin administered to rats in 25, 50 and 100 mg/kg doses demonstrated a marked decrease in rats arthritic index, measuring 1.63 ± 0.21, 1.59 ± 0.10, and 1.44 ± 0.13, respectively, compared to the arthritic control group, which had an arthritic index of 3.29 ± 0.10). On day 28 of treatment, there was a noticeable decrease in paw volume (52.04, 78.04, and 84.7%) in 25, 50 and 100 mg/kg doses, respectively. Moreover, joint swelling, arthralgia, redness and immobility, the main markers of chronic inflammation were markedly decreased in rats treated with Arbutin and piroxicam. During the treatment period, arthritic rats exhibited a marked reduction in body weight from 183.167 ± 3.43 to 167.60 ± 4.021g. On day 28, however, rats given Arbutin (25, 50, and 100 mg/kg) has shown a significant gain in weight. On day 7, a significant change in weight gain was observed with the dose increased from 50 mg/kg as shown in Fig. 1 . Biochemical and hematological parameters In rats with arthritis that received CFA injection, hematologic changes were noted. Among these were the documented significant decrease in hemoglobin, RBC counts, the rise in platelet values, WBCs, Platelets, ESR, AST, ALT, ALP, Urea, creatinine CRP and RF. Table 2 indicates that oral Arbutin administration markedly reduced the LFTs, WBCs, CRP, ESR, platelets, urea and creatinine in comparison to the solvent treated rats while significantly increasing RBCs and hemoglobin. At dosages of 25, 50, and 100 mg/kg, the results demonstrated shielding effects against the indicators i.e. hepatotoxicity and nephrotoxicity. Additionally, in rats given CFA injections, Arbutin markedly reduced the RF values. Table 2: Effects of orally administered Arbutin on biochemistry and hematology in CFA-induced Arthritic rats Biochemical & hematological parameters Arthritic control Vehicle Control Piroxicam 10 mg/kg Arbutin 25 mg/kg Arbutin 50 mg/kg Arbutin 100 mg/kg Hb (g/dL) 8.11 ± 0.72 14.65 ± 0.87 *** 15.65 ± 1.00 *** 12.40 ± 0.89 * 12.97 ± 1.11 ** 14.65 ± 0.90 *** RBCs (×10 6 /µL) 5.38 ± 0.41 8.433±0.26 *** 7.750 ± 0.18 *** 7.067 ± 0.08 ** 7.033 ± 0.26 ** 9.383 ± 0.42 *** WBCs (×10 3 /µL) 18.64 ± 0.22 11.13 ± 0.82 *** 14.59 ± 0.23 *** 16.07 ± 0.38 * 16.04 ± 0.88 * 10.76 ± 0.52 *** Platelets (×10 3 /µL) 177.5 ± 13.76 465.3 ± 47.44 *** 518.5 ± 44.70 *** 379.3 ± 31.94 * 421.7 ± 25.85 ** 425.8 ± 74.33 *** ESR (mm/1 st hr) 12.70 ± 0.34 7.450 ± 0.25 *** 10.72 ± 0.28 *** 10.95 ± 0.31 ** 10.94 ± 0.36 ** 9.00 ± 0.17 *** AST 81.11 ± 0.54 46.24 ± 0.18 *** 64.81 ± 1.45 *** 77.96 ± 0.59 * 47.86± 0.60 *** 56.37 ± 0.38 *** (U/L) ALT(U/L) 74.56 ± 0.44 42.63 ± 0.50 *** 42.10 ± 0.84 *** 71.81 ± 0.37 ** 71.70 ± 0.55 ** 58.68 ± 0.48 *** ALP(U/L) 340 ± 0.57 177.7 ± 5.30 *** 141.7 ± 7.45 *** 319.8 ± 2.023 ** 320.7 ± 1.22 ** 246.2 ± 0.60 *** Urea (mg/dL) 50.87 ± 0.51 20.21 ± 0.32 *** 34.85 ± 0.41 *** 47.70 ± 0.56 ** 47.90± 0.76 ** 27.48 ± 0.55 *** Creatinine (mg/dL) 2.335 ± 0.04 1.517 ± 0.07 *** 1.220±0.09 *** 2.010 ± 0.68 ** 2.008 ± 0.07 ** 0.9200 ± 0.02 *** CRP (mg/L) 9.167 ± 0.22 3.972 ± 0.12 *** 3.983 ± 0.26 *** 8.273 ± 0.21 * 8.293 ± 0.12 * 4.867 ± 0.18 *** RF (IU/mL) 9.650 ± 0.21 6.083 ± 0.04 *** 8.578 ± 0.16 *** 9.125 ± 0.06 * 8.970 ± 0.08 ** 7.148 ± 0.57 *** Values represented as means ± SEM (n=6). *= p < 0.05, **= p<0.01 and ***=p < 0.001, ns : non-significant compared with the arthritic control. Hb: Hemoglobin, RBCs: Red blood cells, WBCs: White blood cells, ESR: Erythrocyte sedimentation rate, ALT: Alanine aminotransferase, AST: Aspartate aminotransferase, ALP: Alkaline phosphatase, RF: Rheumatoid factor, CRP: C-reactive protein Effect of Arbutin on mRNA inhibition of TNF-alpha, interleukin-1β, cycloxygenase-2, interleukin-6, NF-κB, IL-17 and increase in the expressions of cytokines (IL-4 and IL-10) Blood was drawn on the 28th day, and Rt-qPCR was used to assess various inflammatory cytokines. Rats which were treated with Arbutin, orally at 25, 50 and 100 mg/kg (3.437 ± 0.0192, 3.41 ± 0.0073, and 2.186 ± 0.00182) showed a marked decrease in TNF-α, while arthritic control rats (6.05 ± 0.1803) showed increased manifestation of TNF-α. Rats treated with Arbutin and piroxicam showed a significant (p < 0.001) decrease in IL-1β (4.132 ± 0.1123, 3.998 ± 0.0716 and 3.427 ± 0.061, 3.567 ± 0.1145) when compared to adjuvant control arthritic rats. Rats treated with Arbutin showed significant inhibition of IL-6 (4.24 ± 0.1211, 3.070 ± 0.0678, and 2.782 ± 0.0535, respectively) compared to solvent treated rats (6.650 ± 0.014). Cycloxygenase-2 expression with Arbutin at 25 mg/kg p.o (3.123 ± 0.0463), 50 mg/kg (3.090 ± 0.0474), and 100 mg/kg (2.424 ± 0.030) were significantly reduced (p < 0.001) compared to the expression level of COX-2 in diseased control rats (6.1 ± 0.0966). Additionally, rats treated with Arbutin and piroxicam showed a significant decrease in NF-κB (3.417 ± 0.1014, 2.950 ± 0.0428, 1.963 ± 0.068, 2.733 ± 0.0918) when compared to rats with arthritis (5.933 ± 0.066). Rats that were given Arbutin (100 mg/kg) and piroxicam had higher levels of interleukins i.e., IL-4 and IL-10 than rats with arthritis, as demonstrated by the following data in Fig. 2 (a, b, c, d, e, f, g & h). Impact of Arbutin on PGE2, 5-LOX and Anti-CCP When compared to diseased animals (189.8 ± 3.348), the Arbutin-treated animals (p < 0.001) revealed a remarkable reduction in PGE2 levels (77.80 ± 3.9, 75.84 ± 2.166, and 43.82 ± 0.956). Unlike other doses, the maximum effect was obtained at 100 mg/kg of Arbutin (Fig. 3 a). Arbutin at the median dosage was superior to piroxicam 10 mg/kg (76.75 ± 0.248). Subsequent oral Arbutin treatment at 25 mg/kg, 50 mg/kg and 100 mg/kg significantly (p < 0.001) suppressed the expression of 5-LOX (9.870 ± 0.11), 9.810 ± 0.18), and (3.445 ± 0.18) in comparison to the arthritic control (11.14 ± 0.36), while piroxicam (10.11 ± 0.30) demonstrated a marked (p < 0.001) reduction in the 5-LOX protein levels, as depicted in Fig. 3 b. Furthermore, compared to the piroxicam (395.7 ± 2.49) group, the CFA-treated arthritic control group had higher serum levels of Anti-CCP (410 ± 3.89). Conversely, a highly marked (p < 0.001) decrease in anti-CCP concentration was noted in the 25, 50, and 100 mg/kg, treated groups (395.2 ± 1.35), (289.7 ± 3.21), and (110.1 ± 2.19) opposed to the diseased control rats as shown in the Fig. 3 c. Arbutin impact on SOD, CAT, GSH and MDA In the diseased group, the CFA-induced oxidative stress as shown in Table 3 , decreases serum concentrations of Catalase, SOD and GSH. Following oral doses (25, 50 and 100 mg/kg) of Arbutin, a noteworthy increase in catalase levels of 49.06 ± 0.69, 117.2 ± 2.34, and 116.1 ± 5.26 ng/mL respectively, in comparison to the diseased control group (37.24 ± 0.69 ng/ml). A comparable reduction in MDA and rise in catalase, GSH, and SOD were observed in all treatment groups. Table 3 Impact of Arbutin on anti-oxidant enzyme activities Treatment groups SOD (ng/ml protein) CAT (ng/ml protein) GSH (ng/ml protein) MDA (nmol/ml protein) Arthritic rats 1.067 ± 0.07 37.24 ± 0.69 1.31 ± 0.157 9.038 ± 0.12 Vehicle control rats 3.93 ± 0.11 *** 97.95 ± 0.73 *** 3.58 ± 0.098 *** 5.68 ± 0.14 *** Piroxicam 10 mg/kg 4.20 ± 0.10 *** 101 ± 0.34 *** 4.33 ± 0.12 *** 7.13 ± 0.11 *** Arbutin 25 mg/kg 2.02 ± 0.06 ** 49.06 ± 0.69 ** 2.13 ± 0.14 ** 8.35 ± 0.18 ** Arbutin 50 mg/kg 3.24 ± 0.05 *** 117.2 ± 2.34 *** 4.58 ± 0.12 *** 3.17 ± 0.05 *** Arbutin 100 mg/kg 4.25 ± 0.07 116.1 ± 5.26 *** 5.09 ± 0.26 *** 1.5 ± 0.06 *** Values expressed as mean ± SEM following one-way (ANOVA) with Dennett’s test (*** =p < 0.001, **=p < 0.01) Impact of Arbutin on histological changes The histology of normal control rats showed no signs of inflammation with normal synovial tissue space, joint space and intact articular cartilage. Rats with arthritis in control groups exhibited observable synovial lining, distinct synoviocyte proliferation, and invasion of inflammatory cells in granulous and pannus formation in ankle joints. Comparably, arthritic control groups also showed swelling, extensive bone erosions and joint deformity along with collagen fiber deposition (Fig. 4 ). Nonetheless, piroxicam (10 mg/kg) demonstrated a slight increase in inflammatory cell incursion, cartilage degradation, thickening of the synovial intergalactic space, and a reduction in the formation of pannus. Additionally, Arbutin (100 mg/kg) administered demonstrated significant fortification against the growth of vascular lesions, restricted joint space, cartilage degradation, and a low number of inflammatory cells without the development of pannus, all of which closely resemble the architecture of normal joints. Conversely, a moderate amount of cartilage damage with minimal cell invasion and pannus formation was observed with the 50 mg/kg, p.o dose of Arbutin. In contrast, rats given 25 mg/kg of Arbutin showed minimal cartilage loss, a small amount of inflammatory cell infiltration, and no pannus formation. Effect of Arbutin on radio-graphical changes When analyzing arthritis, radiography is helpful in determining the severity of the disease course. It has been discovered that a decrease in joint spaces causes cartilage to be lost, which sets off a variety of irrational mechanisms. X-rays revealed there were normal cartilage architecture and morphology in normal rats, with no swelling around the joints. On the other hand, x-ray analysis of control rats with arthritis revealed that the rats had severe tissue swelling, phalangeal bone erosion, and narrow joint space. In contrast, rats given 100 mg/kg of Arbutin showed inhibition of bone damage, connective tissue inflammation, joint distortion, and narrow joint spaces. Similar protection against swelling, joint deformity and bone erosion was demonstrated in rats given 50 mg/kg of Arbutin. Rats treated with piroxicam also showed similar mild alterations in their soft tissues surrounding their joints, along with a noticeable decrease in joint space as illustrated in Fig. 5 . Analysis of in-silico studies Arbutin was tested against eight protein targets, which included TNFα, iNOS, COX-2, 5-lipoxygenase, NF-κB, IL-4, and IL-10. To find ligand-protein interactions, virtual screening of Arbutin was carried out. Binding energies and dissociation constants were then computed to ascertain the ligand-protein affinity. Table 4 , lists the ligands' dissociation constants and binding energies for each target. Table 4. Targets chosen for their optimal position against Arbutin in terms of dissociation constants, binding energy and active sites Targets Binding Energy kcal/mol Dissociation constant µM Active site IL-17 -7.52 4.88 ARG 20, THR 21, VAL 22, MET 23, VAL 24, ASN 25, LEU 26, LEU 99, GLU 102, ASN 108, SER 109, PHE 110, ARG 111, LEU 112 iNOS -8.13 1.11 LEU 108, THR 109, CYS 110, CYS 115, LEU 116, GLY 117, SER 118, ILE 119, PRO 122, SER 124, LEU 125, ARG 199, ALA 459, ASP 460, TRP 461, ILE 462, MET 480, LEU 481, ASN 482 TNF-α -6.8 10.3 PRO 20, GLN 21, ALA, 22, GLU 23, GLY 24, GLN 25, LEU 26, LYS 65, PRO 139, ASP 140, TYR 141, LEU 142, ASP 143, PHE 144 COX2 -8.60 633 nM ASN 34, CYS 36, HIS 39, PRO 40, CYS 41, ARG 44, GLY 45, VAL 46, CYS 47, TYR 130, GLY 135, PRO 153, PRO 154, VAL 155, PRO 156, GLN 461 5-LOX -7.87 1.7 ALA 398, HIS 399, ARG 401, PHE 402, GLN 611, ASN 613, GLU 614, LEU 615, MET 619, TYR 620, PRO 621, GLU 622, HIS 624, PRO 668, ASN 669, SER 670, ALA, 672 NF-κB -7.38 3.91 PHE 56, ARG 57, PHE 58, ARG 59, PRO 65, SER 66, HIS 67, GLY 68, GLY 69, VAL 115, GLY 116, LYS 117, ASN 139, GLY 141, ILE 142, LEU 143, IL-4 -7.4 3.74 LEU 27, THR 28, VAL 29, THR 30, VAL 51, LEU 52, GLN 54, PHE 55, HIS 58, HIS 59, GLN 106 IL-10 -7.39 3.84 SER 10, VAL 11, TRP 12, PHE 13, THR 91, VAL 92, THR, 93, ASN 94, THR 95, ARG 96, PHE 97, SER 98, GLU 101 Arbutin, post-molecular docking 3D and 2D poses against protein targets, such as IL-17, iNOS, TNF-α, COX-2, 5-lipoxygenase, NF-κB, IL-4, and IL-10 are shown in the figure below. Arbutin revealed the best binding energies (kcal/mol) of -7.52, -8.13, -6.8, -8.60, -7.87, -7.38, 7.4, -7.39 and the dissociation constants of 4.88, 1.11, 10.3, 633, 1.7, 3.91, 3.74, 3.84 against IL-17, INOS, TNFα, COX-2, 5-LOX, NF-κB, IL-4, IL-10 in an appropriate way. The allosteric binding sites of IL-17 for Arbutin were ARG 20 , THR 21 , VAL 22 , MET 23 , VAL 24 , ASN 25 , LEU 26 , LEU 99 , GLU 102 , ASN 108 , SER 109 , PHE 110 , ARG 111 , LEU 112 . Likewise for iNOS, the binding sites were LEU 108 , THR 109 , CYS 110 , CYS 115 , LEU 116 , GLY 117, SER 118 , ILE 119 , PRO 122 , SER 124, LEU 125 , ARG 199 , ALA 459 , ASP 460 , TRP 461 , ILE 462 , MET 480 , LEU 481 , ASN 482 , while the binding pockets for TNFα were PRO 20 , GLN 21 , ALA 22 , GLU 23 , GLY 24, GLN 25, LEU 26, LYS 65 , PRO 139 , ASP 140 , TYR 141 , LEU 142 , ASP 143 , PHE 144 . The binding sites of COX-2 was ASN 34 , CYS 36 , HIS 39 , PRO 40 , CYS 41 , ARG 44, GLY 45 , VAL 46 , CYS 47 , TYR 130 , GLY 135 , PRO 153 , PRO 154 , VAL 155 , PRO 156 , GLN 461 . The binding sites of 5-LOX was ALA, 398 , HIS 399 , ARG 401 , PHE 402, GLN 611 , ASN 613 , GLU 614, LEU 615, MET 619, TYR 620, PRO 621 , GLU 622 , HIS 624 , PRO 668 , ASN 669 , SER 670 , ALA 672 . The active site residues of NF-κB were PHE 56 , ARG 57 , PHE 58 , ARG 59 , PRO 65 , SER 66 , HIS 67 , GLY 68 , GLY 69 , VAL 115 , GLY 116 , LYS 117 , ASN 139 , GLY 141 , ILE 142 , LEU 143 . While the allosteric binding sites of IL-4 were LEU 27 , THR 28 , VAL 29 , THR 30 , VAL 51 , LEU 52 , GLN 54 , PHE 55 , HIS 58 , HIS 59 , and GLN 106 . The Arbutin ligand interactions with the active site residues of IL-10 include SER, 10, VAL 11, TRP 12 , PHE 13 , THR, 91 , VAL 92, , THR, 93 , ASN 94 , THR 95 , ARG 96 , PHE 97 , SER 98 , GLU 101 . Discussions Arthritis is more prevalent autoimmune disease that affects the cartilage, bones, and synovial membranes (McInnes and Schett, 2007 ). The exact pathology of rheumatism is unknown, however, important validations have shown that its extensive destruction of bone and cartilage is caused by synovial neovascularization, proteinase-mediated suspension of cartilage articular matrix, elevated proinflammatory cytokine expression and osteoclast-mediated bone disintegration (Liu et al., 2013 ). The pathological similarity of the CFA-induced arthritis model to human arthritis makes it a highly recommended model for preclinical drug testing (Neng-Yu Lin et al., 2013 ). Inflammatory reactions start a few days after CFA injection inoculation, and secondary lesions appear two weeks after primary lesions (Alamgeer et al., 2017). CFA, which activates cell-arbitrated immunity and speeds up the production of antibodies, is made up of temperature-killed M. tuberculosis added in liquefied paraffin (Kim et al., 2016 ). There are three stages to mycobacterium-induced edema: starts with the induction phase without any sign of synovitis, early synovitis, and late synovitis. This showed the accumulation of protein debris and extracellular fluid at the site of inflammation (Jitta et al., 2019 ). The goal of the current study was to assess the effectiveness of Arbutin in CFA induced model of arthritis. The administration of Arbutin, (25, 50 and 100 mg/kg, oral) has significantly decreased arthritic index and paw volume in treated rats as compared to the arthritic control group. Our compound Arbutin has an inhibitory effect on TNF-α, IL-1β, IL-6, PGE2, IL-8 and COX-2, which are the markers of inflammation (Qasim et al., 2023 ) as shown in Fig. 1 a, 1 c. Further, weight loss in treated groups was prevented through the reduction in IL-1β and expression level of TNF-α (Fu et al., 2019 ) as shown in Fig. 1 b. Furthermore, the standard drug piroxicam also has reduced arthritic index and paw volume and there was increased in weight of CFA induced rats. Rheumatoid cachexia developed as a result of lysosomal protease-induced muscle proteolysis, which is triggered by decreased absorption of prostaglandin-E2, 14C-glucose, and 14C-leucine in the intestines of rats (Alamgeer et al., 2017). Intestinal absorption in rats was also resolved and reduced the expression of pro-inflammatory cytokines (Ahsan et al., 2021 ). Hematological and biochemical tests in CFA-induced arthritis were conducted which show anemia in rats indicated by a decrease in the level of hemoglobin (Hb) and red blood cell (RBCs) count. Anemia may be caused by the destruction of premature reticuloendothelial cells, a decrease in erythropoietin, or a decrease in iron loading in the RES and synovial joints (Alamgeer et al., 2017). The significant increase in Hb and RBCs by Arbutin, most likely as a result of NF-κB reduced expression. Thus, it prevented the inflammatory cascade and restored the normalcy of inflammatory cell invasion in the synovial fluid (Iqubal et al., 2019 ). Furthermore, the production of cytokines like TNF-α and IL-6 leads to an increase in platelet and white blood cells (WBCs) counts in arthritic rats (Fig. 2 h, 2 e). Additionally, due to the greater secretion of IL-6 and TNF-alpha, which initiates the acute phase reaction in RA, arthritic rats showed increased levels of platelets and WBCs. Despite inhibiting the production of IL-6 and TNF-α, Arbutin has reduced the number of platelets and WBCs in rats; however, this may be because of its immunomodulatory action. Arbutin has normalized inflammatory cell invasion in synovial fluid and inhibited the inflammation cascade. It also increased hemoglobin and RBCs, possibly as a result of decreased NF-κB expression (Isaacs and Iqbal, 2019 ). The two major markers for the early detection of systemic polyarthritis are elevated serum ferritin and C-reactive protein (CRP). An effective method for assessing the active inflammatory process is the CRP, which is a significant predictor of systemic inflammation (Razi et al., 2012 ). When compared to arthritic control rats, Arbutin treatment prevented the acute phase reactions. Increased levels in ESR and CRP in arthritic control rats indicated infection in the blood, whereas rats given piroxicam and Arbutin, the levels decreased which is in line with previous study (Prakash Babu et al., 2014 ). A possible parameter implicated in the pathobiology of RA could be abnormal changes in the values of RF and also in CRP in serum. Initiation of immune cascade progresses arthritis by the production of factor that is RF which is directed against the Fc portion of autoantibodies. There was a noteworthy reduction in Rheumatoid factor (RF) levels among treatment groups with Arbutin. Immunoglobulin molecules like rheumatoid factor (RF) have the ability to trigger an immune response because the body perceives them as "non-self" (Yildirim et al., 2004 ). Furthermore, increased bone erosion and lysosomal enzyme integrity may be the cause of the diseased control group's elevated serum ALP concentration (Chakraborty et al., 2010 ). Rats in the disease control group showed remarkable increased levels of the RF and CRP, indicating that these had been exposed to an inflammatory stimulus following CFA vaccination. Conversely, the groups treated with piroxicam and Arbutin (100 mg/kg) showed a marked reduction (p < 0.001) in the values of RF and C-reactive proteins as given in Table 2 . Nonetheless, the ALP was markedly decreased when Arbutin at varying doses was given to the treatment groups. This also prevented the abnormal increase in SGPT and SGOT, which may have been brought on by a decrease in bone loss and an improvement in lysosome stability as given in Table 2 . Renal safety of Arbutin was assessed through urea and creatinine levels in treated groups of rats (Silpavathi et al., 2023 ). The development of arthritis is significantly influenced by proliferating macrophages, T lymphocytes, and synovial cells (Weyand et al., 2001 ). Macrophages and stimulated T cells release proinflammatory cytokines, which contribute to the development of arthritis (Vandooren et al., 2009 ). Immunity (T-cell mediated) triggers the release of pro-inflammatory cytokines and triggers antibody synthesis resulting in the degeneration of joints. Excessive expression of these cytokines results in apoptosis, bone loss, tissue eradication, irreversible tissue proliferation (Yang et al., 2013 ). Accordingly, possible counteragents for the cytokines have the power to shield cells from inflammatory processes (Shin et al., 2016 ). In the present study, Rt-qPCR was used to study the impact of Arbutin on the expression of pro-inflammatory cytokines panels (TNF-alpha, IL-6, IL-17 & IL-1β), inflammatory like NF-κB & COX-2, and anti-inflammatory gene pointers (IL-4 and IL-10). Osteoclast induction, bone erosion, and matrix metalloproteinase (MMP) production have all been related to IL-1β (Barksby et al., 2007 ). Moreover, the article refers to endogenous MMP inhibitors as tissue inhibitors of MMPs (TIMPs). Soluble IL-6R is characterized by the induction of TIMP formation in cultured chondrocytes and synovial fibroblasts by IL-6. Extracellular matrix turnover is aided by the protective catabolic response that tissues produce (Silacci et al., 1998 ). Multiple studies have reported that infiltrating cells, monocytes, and macrophages secrete pro-inflammatory cytokines. Three main cytokines involved in initiation, progression and development of arthritis are TNF-α, IL-1β, and also IL-6 (Yap et al., 2018 ). As a result, pro-inflammatory cytokines have appeared as fascinating targets of arthritis. In our research, the administration of Arbutin to CFA-induced arthritis rats effectively decreased the TNF-α, IL-17, NF-κB, IL-6, COX-2 and also IL-1β levels which ultimately decreased proinflammatory cytokines as shown in Fig. 2 . The present study found that rats given Arbutin and piroxicam showed a significant reduction in COX-2 levels, whereas animals with arthritis as control showed higher levels. As a result of the reduction in COX-2 production, this implies that piroxicam and Arbutin have partially prevented the harmful effects of CFA by blocking prostaglandin synthesis. Anti-arthritic actions of Arbutin may possibly be mediated through the inhibition of arachidonic acid metabolism in line with the already reported study (Uttra et al., 2018 ). Inflammation leads to increased release of TNF-α by phagocytes leading to leucocyte adhesion and penetration in the vascular endothelium. Additionally, TNF-α inhibits the synthesis of bone collagen mainly by causing increased bone deterioration and hyperplasia of the fibroblast (Singh et al., 2021 ). In our present study, Arbutin possesses anti-inflammatory potential in many mediators of inflammation (TNF, COX-2, IL-1 β and IL-17) and can used to treat arthritis. The main factors in the development of arthritic decay demonstrated that TNF-α buildup magnifies the appearance of PGE-2, IL-1 β, and also IL-6 leads to hyperplasia of the synovial joint, increased enzyme devastation accretion, collagenase activation, and osteoclast disease (Alunno et al., 2017 ). In the current investigation, diseased control rats showed elevated expression of PGE-2 and COX-2; conversely, rats receiving Arbutin treatment (25, 50 and 100 mg/kg) have shown a significant decrease in PGE-2 and COX-2. Interleukin-10 alters arthritis synovitis by deactivating macrophages and suppressing the cellular defense mechanism (Bozkurt et al., 2006 ). As RA advances, IL-10 suppresses the immune response mediated by the Th1 and inhibits the functioning of antigen-presenting cells too, that provide protection to the integrity of the joints (Uttra et al., 2018 ). IL-17 has a crucial role in arthritis, affecting osteoclast genesis, granulopoiesis, and release of pro-inflammatory cytokines such as IL-1β, TNFα, IL-8, and IL-6 (Schinocca et al., 2021 ). In arthritic control rats, Arbutin decreased the raised IL-17, IL-1β, and IL-6 levels, suggesting its anti-inflammatory and anti-arthritic efficacy. IL-6 increases bone resorption and the production of autoantibodies. These mediators cause inflammatory tissues in the synovial membrane to release collagenase (Mima and Nishimoto, 2009 ). It was reported that PGE-2 levels in CFA-induced rats were closely linked to cartilage erosion, blood vessel dilatation, joint swelling, redness and pain. Prostaglandin E synthase (PGES) produces PGE2 from COX-II. When arthritis is active, pro-inflammatory cytokines up-regulate COX-II, which results in an indirect increase in PGE-2 (Uttra et al., 2019 ). Angiogenesis, vasodilation, fluid extravasation and vascularization in the synovial membrane mediated by the production of PGE-2, are upregulated at the injection site due to increase in COX-2 levels (Shabbir et al., 2016 ). Increased PGE-2 expression results from an excess of pro-inflammatory cytokines. Increased PGE-2 levels spur vasodilation, bone destruction and also migration of leukocytes to the site of inflammation by speeding up osteoclast differentiation and producing degrading enzymes as shown in Fig. 3 a. Lipoxygenases are crucial in the production of leukotrienes (B4, C4, D4, and E4), which are important in inflammatory disorders (Gheorghe et al., 2009 ). The CFA-induced rise in PGE-2 and 5-LOX levels in arthritic rats was significantly reduced by administering Arbutin. Hence, the outcomes of the present investigation demonstrated that Arbutin caused a remarkable decrease in PGE-2 levels in rats with arthritis induced by CFA. In the current investigation, increased levels of anti-CCP were detected early on the 7th day using the CFA model followed by arthritis. The levels of Anti-CCP reduced significantly in Arbutin (25, 50 and 100 mg/kg) treated rodent groups. A decrease in Anti-CCP concentration explained the inhibition of TNF-α (El-Ashmawy et al., 2019 ) as shown in Fig. 3 . ROS leads to alterations in cell organelles including DNA damage, protein oxidation, inactivation of enzymes, and peroxidation of lipids (Sghaier et al., 2011 ). Consequently, the injured joints are destroyed because superoxide anions produced during phagocytosis cause the second messenger system-dependent, NF-κB-dependent expression of the pro-inflammatory cytokines (Prakash Babu et al., 2014 ). These are shielded against tissue damage by reactive species by endogenous antioxidant enzymes such as catalase. The enzyme catalase contributes to the reduction of hydrogen peroxide (H 2 O 2 ) in synovial tissue spaces. SOD catalyzes the conversion of superoxide to hydrogen peroxide and oxygen free radicals, which are then further catalyzed into molecules of oxygen and water by catalase enzymes. In comparison to healthy rats, the arthritic control rats showed decreased levels of anti-oxidant parameters (SOD, CAT and GSH) and raised levels of pro-oxidant marker (MDA). Arbutin has shown a potential role in mitigating the deterioration caused by free radicals. Oxidative enzymes like GSH, CAT and also SOD were overexpressed, MDA production decreased and lipid peroxidation was less prominent in rats with arthritis treated with Arbutin, indicating antioxidant activity which is given in Table 3 . In vitro free radical scavenging assay through DPPH radical, is used for assessing the antioxidant potential of Arbutin which has shown strong antioxidant properties (Baliyan et al., 2022 ) . In the current study, histopathological assessment showed that animal groups that received treatment with Arbutin inhibited the leukocyte migration, thereby protecting joints from joint deformity, cartilage destruction and formation of pannus as depicted in Fig. 4 . Furthermore, radiological analysis demonstrated that, in comparison to arthritic control rats, Arbutin demonstrated a significant protective effect against the growth of secondary lesions and cartilage damage as illustrated in Fig. 5 . As mediators in the pathophysiology of RA, free radicals and reactive oxygen species (ROS) have been supposed to cause tissue damage. Rheumatism causes various cells such as neutrophils, macrophages and dendritic cells to infiltrate the diseased articulations, and then produce ROS, which breaks through the antioxidant defense system and release more of them at the site of inflammation (Nich and Goodman, 2014 ). We also analyzed appropriate poses for protein–ligand interactions, the dependable method of molecular docking, which is one of the most important docking subtypes in the pharmaceutical industry is protein-ligand docking (Azam and Abbasi, 2013 ). Strong interactions were indicated by the highest negative bond energy values in the docking (Herawati et al., 2021 ). In this way, the most suitable binding site for the ligand can be predicted along with the molecular interactions that are explained. Furthermore, interactions between the ligand atoms and amino acids could be identified according to their distance from one another. The objective of the current investigation was to study how Arbutin interacted with IL-17, iNOS, TNF-α, COX-2, NFκB, 5-LOX, IL-4, and IL-10. Together with pharmacological evidence supporting its anti-arthritic efficacy, Arbutin demonstrated strong binding interactions with each of these chosen targets. The in silico and in vivo analysis of the present study yielded very consistent results. Conclusions The present findings of the study suggested that treatment of Arbutin led to significant reductions in paw volume, body weight recovery, normalization of altered biochemical and hematological parameters, and inhibition of the level of mRNA expression of the aforementioned cytokines in arthritic rats. Thus, the anti-arthritic effect of Arbutin showed its ability to raise levels of IL-4 and interleukin-10, and by decreasing IL-17 as well as antioxidant enzyme activity of SOD, GSH and CAT by decreasing levels of NF-κB, COX-2, 5-LOX, TNF-α, IL-1β, and also IL-6. Because of the numerous anti-arthritic qualities that Arbutin possesses, it is therefore, reasonable to conclude, based on these observations, that it is a potent anti-arthritic agent. Computational docking analysis has also supported our current findings. To gain a better understanding of the mechanism underlying Arbutin having anti-arthritic properties and perhaps help develop more potent treatment approaches for rheumatoid arthritis, more thorough mechanistic research should be carried out in the future. Declarations Funding The authors declare that they did not receive any funds, grants or other resources in the preparation of this manuscript. Author’s Declaration The study was supervised and designed by AM. Data collection, material preparation and experiments were performed by NTS. UI facilitated for performing rt-PCR, ELISA and compilation of results. While, In-Silico studies were interpreted by FM. Data analysis was done by NTS and AM. Manuscript drafted by NTS and AM. The final manuscript was read and approved by all authors. Acknowledgment The authors express their gratitude to the University of Sargodha, Sargodha, Pakistan's College of Pharmacy (Post Graduate Pharmacology Lab.) for the technical facilities provided. Data availability The data in this study mentioned above is transparent. The authors declare, that there are no known competing financial interests or personal connections that could have appeared to influence the work reported in this paper. References Ahmadian, S. R., Ghasemi-Kasman, M., Pouramir, M., & Sadeghi, F. (2019). Arbutin attenuates cognitive impairment and inflammatory response in pentylenetetrazol-induced kindling model of epilepsy. Neuropharmacology , 146, 117-127. Ahsan, H., Irfan, H. M., Alamgeer, Shahzad, M., Asim, M. H., Akram, M., et al. (2021). Anti-rheumatic activity of pseudoephedrine (a substituted phenethylamine) in complete Freund’s adjuvant-induced arthritic rats by down regulating IL-1β, IL-6 and TNF-α as well as upregulating IL-4 and IL-10. Inflammopharmacology , 29, 673-682. Akhter, S., Irfan, H. M., Alamgeer, Jahan, S., Shahzad, M., & Latif, M. B. (2022). Nerolidol: a potential approach in rheumatoid arthritis through reduction of TNF-α, IL-1β, IL-6, NF-kB, COX-2 and antioxidant effect in CFA-induced arthritic model. Inflammopharmacology , 30(2), 537-548. Alamgeer, Niazi, S. G., Uttra, A. M., Qaiser, M. N., & Ahsan, H. (2017). Appraisal of anti-arthritic and nephroprotective potential of Cuscuta reflexa. Pharmaceutical biology , 55(1), 792-798. Alunno, A., Carubbi, F., Giacomelli, R., & Gerli, R. (2017). Cytokines in the pathogenesis of rheumatoid arthritis: new players and therapeutic targets. BMC rheumatology , 1(1), 1-13. Arya, V., Gupta, V. K., & Kaur, R. (2011). A review on plants having anti-arthritic potential. Int J Pharm Sci Rev Res , 7(2), 131-136. Azam, S. S., & Abbasi, S. W. (2013). Molecular docking studies for the identification of novel melatoninergic inhibitors for acetylserotonin-O-methyltransferase using different docking routines. Theoretical Biology and Medical Modelling , 10(1), 1-16. Baliyan, S., Mukherjee, R., Priyadarshini, A., Vibhuti, A., Gupta, A., Pandey, R. P., et al. (2022). Determination of antioxidants by DPPH radical scavenging activity and quantitative phytochemical analysis of Ficus religiosa. 27(4), 1326. Barksby, H., Lea, S., Preshaw, P., & Taylor, J. (2007). The expanding family of interleukin-1 cytokines and their role in destructive inflammatory disorders. Clinical & Experimental Immunology , 149(2), 217-225. Bozkurt, F. Y., Ay, Z. Y., Berker, E., Tepe, E., & Akkuş, S. (2006). Anti-inflammatory cytokines in gingival crevicular fluid in patients with periodontitis and rheumatoid arthritis: a preliminary report. Cytokine , 35(3-4), 180-185. Chakraborty, M., Bhattacharya, S., Bhattacharjee, P., Das, R., & Mishra, R. (2010). Prevention of the progression of adjuvant induced arthritis by oral supplementation of Indian fresh water mussel (Lamellidens marginalis) aqueous extract in experimental rats. Journal of ethnopharmacology , 132(1), 316-320. El-Ashmawy, N. E., Khedr, E. G., Shamloula, M. M., Kamel, M. M. J. E. B., & Medicine (2019). Evaluation of the antirheumatic effects of isoflavone-free soy protein isolate and etanercept in rats with adjuvant-induced arthritis. 244(7), 545-553. Fu, Q., Wang, L., Li, L., Li, Y., Liu, R., & Zheng, Y. J. C. r. (2019). Risk factors for progression and prognosis of rheumatoid arthritis–associated interstitial lung disease: single center study with a large sample of Chinese population. 38, 1109-1116. Gheorghe, K. R., Korotkova, M., Catrina, A. I., Backman, L., Af Klint, E., Claesson, H.-E., et al. (2009). Expression of 5-lipoxygenase and 15-lipoxygenase in rheumatoid arthritis synovium and effects of intraarticular glucocorticoids. 11, 1-11. Gohil, P., Patel, V., Deshpande, S., Chorawala, M., & Shah, G. (2018). Anti-arthritic activity of cell wall content of Lactobacillus plantarum in freund’s adjuvant-induced arthritic rats: involvement of cellular inflammatory mediators and other biomarkers. Inflammopharmacology , 26, 171-181. Gul, B., Anwar, R., Saleem, M., Noor, A., & Ullah, M. I. (2023). C assia absus-mediated upregulation of IL-4, IL-10 and downregulation of IL-1β, IL-6, TNF-α, NF-κB, IFN-γ in CFA-induced arthritis model. Inflammopharmacology , 31(3), 1241-1256. Herawati, H., Oktanella, Y., & Anisa, A. (2021). Molecular docking analysis of curcuminoids from curcuma longa extract on inos as an immunomodulator candidate in broilers. Adv Anim Vet Sci , 9(4), 519-524. Iqubal, A., Sharma, S., Ansari, M. A., Najmi, A. K., Syed, M. A., Ali, J., et al. (2019). Nerolidol attenuates cyclophosphamide-induced cardiac inflammation, apoptosis and fibrosis in Swiss Albino mice. European Journal of Pharmacology , 863, 172666. Isaacs, J. D., & Iqbal, K. J. C. T. (2019). Potential pharmacologic targets for the prevention of rheumatoid arthritis. 41(7), 1312-1322. Jitta, S. R., Daram, P., Gourishetti, K., Misra, C. S., Polu, P. R., Shah, A., et al. (2019). Terminalia tomentosa Bark Ameliorates Inflammation and Arthritis in Carrageenan Induced Inflammatory Model and Freund’s Adjuvant-Induced Arthritis Model in Rats. Journal of Toxicology , 2019, 7898914. doi:10.1155/2019/7898914. Khan, Y. H., Qasim, S., Uttra, A. M., Alotaibi, N. H., Alanazi, A. S., Alzarea, A. I., et al. (2023). Enalapril attenuated CFA provoked arthritic manifestation by modulating proinflammatory and anti-inflammatory cytokine network. Life Sciences , 324, 121742. Kim, W., Park, S., Choi, C., Kim, Y. R., Park, I., Seo, C., et al. (2016). Evaluation of anti-inflammatory potential of the new ganghwaljetongyeum on adjuvant-induced inflammatory arthritis in rats. Evidence-Based Complementary and Alternative Medicine , 2016. Krieger, E., & Vriend, G. (2014). YASARA View—molecular graphics for all devices—from smartphones to workstations. Bioinformatics , 30(20), 2981-2982. Lee, H.-J., & Kim, K.-W. (2012). Anti-inflammatory effects of arbutin in lipopolysaccharide-stimulated BV2 microglial cells. Inflammation Research , 61, 817-825. Lin, N.-Y., Beyer, C., Gießl, A., Kireva, T., Scholtysek, C., Uderhardt, S., et al. (2013). Autophagy regulates TNFα-mediated joint destruction in experimental arthritis. Annals of the rheumatic diseases , 72(5), 761-768. Lin, Y.-J., Anzaghe, M., & Schülke, S. (2020). Update on the pathomechanism, diagnosis, and treatment options for rheumatoid arthritis. Cells , 9(4), 880. Liu, X., Zou, Q., Zeng, B., Fang, Y., & Wei, H. (2013). Analysis of fecal Lactobacillus community structure in patients with early rheumatoid arthritis. Current microbiology , 67, 170-176. McInnes, I. B., & Schett, G. (2007). Cytokines in the pathogenesis of rheumatoid arthritis. Nature Reviews Immunology , 7(6), 429-442. Mima, T., & Nishimoto, N. J. C. o. i. r. (2009). Clinical value of blocking IL-6 receptor. 21(3), 224-230. Naseem, Z., Zahid, M., Hanif, M. A., & Shahid, M. (2020). Environmentally friendly extraction of bioactive compounds from Mentha arvensis using deep eutectic solvent as green extraction media. Polish Journal of Environmental Studies , 29(5), 3749-3757. Nawaz, S., Irfan, H. M., Akram, M., & Jahan, S. (2023). Linalool: Monoterpene alcohol effectiveness in chronic synovitis through lowering Interleukin-17, spleen and thymus indices. International Immunopharmacology , 121, 110517. Nich, C., & Goodman, S. B. (2014). Role of macrophages in the biological reaction to wear debris from joint replacements. Journal of long-term effects of medical implants , 24(4). Prakash Babu, N., Saravanan, S., Pandikumar, P., Bala Krishna, K., Karunai Raj, M., & Ignacimuthu, S. (2014). Anti-inflammatory and anti-arthritic effects of 3-hydroxy, 2-methoxy sodium butanoate from the leaves of Clerodendrum phlomidis Lf. Inflammation research , 63, 127-138. Qasim, S., Alamgeer, Kalsoom, S., Shahzad, M., Bukhari, I. A., Vohra, F., et al. (2021). Rosuvastatin attenuates rheumatoid arthritis-associated manifestations via modulation of the pro-and anti-inflammatory cytokine network: a combination of in vitro and in vivo studies. ACS omega , 6(3), 2074-2084. Qasim, S., Khan, Y. H., Uttra, A. M., Alotaibi, N. H., Alanazi, A. S., Alzarea, A. I., et al. (2023). Appraisal of anti-inflammatory and immunomodulatory potential of ramipril against Freund’s adjuvant-provoked arthritic rat model. 1-11. Radu, A.-F., & Bungau, S. G. (2021). Management of rheumatoid arthritis: an overview. Cells , 10(11), 2857. Razi, E., Ehteram, H., Akbari, H., Chavoshi, V., & Razi, A. (2012). Evaluation of high-sensitivity C-reactive protein in acute asthma. Tanaffos , 11(1), 32. Ren, X., Zhang, M., Chen, L., Zhang, W., Huang, Y., Luo, H., et al. (2017). The anti-inflammatory effects of Yunnan Baiyao are involved in regulation of the phospholipase A2/arachidonic acid metabolites pathways in acute inflammation rat model. Molecular Medicine Reports , 16(4), 4045-4053. Saleem, A., Saleem, M., Akhtar, M. F., Shahzad, M., & Jahan, S. (2020). Polystichum braunii extracts inhibit Complete Freund’s adjuvant-induced arthritis via upregulation of I-κB, IL-4, and IL-10, downregulation of COX-2, PGE2, IL-1β, IL-6, NF-κB, and TNF-α, and subsiding oxidative stress. Inflammopharmacology , 28, 1633-1648. Saleem, M., Iftikhar, A., Asif, M., Hussain, K., Alamgeer, Shah, P. A., et al. (2021). Asphodelus tenuifolius extracts arrested inflammation and arthritis through modulation of TNF-α, NF-κB, ILs, and COX-2 activities in in vivo models. Inflammopharmacology , 29, 483-497. Schinocca, C., Rizzo, C., Fasano, S., Grasso, G., La Barbera, L., Ciccia, F., et al. (2021). Role of the IL-23/IL-17 pathway in rheumatic diseases: an overview. 12, 637829. Sghaier, M. B., Skandrani, I., Nasr, N., Franca, M.-G. D., Chekir-Ghedira, L., & Ghedira, K. (2011). Flavonoids and sesquiterpenes from Tecurium ramosissimum promote antiproliferation of human cancer cells and enhance antioxidant activity: A structure–activity relationship study. Environmental toxicology and pharmacology , 32(3), 336-348. Shabbir, A., Shahzad, M., Ali, A., & Zia-ur-Rehman, M. (2016). Discovery of new benzothiazine derivative as modulator of pro-and anti-inflammatory cytokines in rheumatoid arthritis. Inflammation , 39, 1918-1929. Shahid Chatha, S., Hussain, A., Asad, R., Majeed, M., & Aslam, N. (2014). Bioactive components and antioxidant properties of Terminalia arjuna L. Extracts. J Food Process Technol , 5(298), 2. Shin, T.-H., Kim, H.-S., Kang, T.-W., Lee, B.-C., Lee, H.-Y., Kim, Y.-J., et al. (2016). Human umbilical cord blood-stem cells direct macrophage polarization and block inflammasome activation to alleviate rheumatoid arthritis. Cell death & disease , 7(12), e2524-e2524. Silacci, P., Dayer, J.-M., Desgeorges, A., Peter, R., Manueddu, C., & Guerne, P.-A. (1998). Interleukin (IL)-6 and its soluble receptor induce TIMP-1 expression in synoviocytes and chondrocytes, and block IL-1-induced collagenolytic activity. Journal of Biological Chemistry , 273(22), 13625-13629. Silpavathi, L., Das, M. K., & Das, D. (2023). Anti-arthritic potentials of aqueous and methanolic leaf extracts of Ardisia solanacea on complete Freund’s adjuvant induced rheumatoid arthritis in rats. Advances in Traditional Medicine , 23(1), 111-119. Singh, S., Karwasra, R., Nayak, D., Khurana, A. K., & Manchanda, R. K. (2021). Amelioration of experimental rheumatoid arthritis by selected ultra-diluted preparations by down regulating increased expression of TNF-α & IL-6. Uttra, A. M., Shahzad, M., Shabbir, A., & Jahan, S. (2018). Ephedra gerardiana aqueous ethanolic extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley rats by downregulating PGE2, COX2, IL-1β, IL-6, TNF-α, NF-kB and upregulating IL-4 and IL-10. Journal of ethnopharmacology , 224, 482-496. Uttra, A. M., Shahzad, M., Shabbir, A., Jahan, S., Bukhari, I. A., & Assiri, A. M. (2019). Ribes orientale: A novel therapeutic approach targeting rheumatoid arthritis with reference to pro-inflammatory cytokines, inflammatory enzymes and anti-inflammatory cytokines. Journal of ethnopharmacology , 237, 92-107. Vandooren, B., Noordenbos, T., Ambarus, C., Krausz, S., Cantaert, T., Yeremenko, N., et al. (2009). Absence of a classically activated macrophage cytokine signature in peripheral spondylarthritis, including psoriatic arthritis. Arthritis & Rheumatism: Official Journal of the American College of Rheumatology , 60(4), 966-975. Weyand, C. M., Bryl, E., & Goronzy, J. J. (2001). The role of T cells in rheumatoid arthritis. Autoimmunity , 183-195. Yang, X., Yang, J., & Zou, H. (2013). Baicalin inhibits IL-17-mediated joint inflammation in murine adjuvant-induced arthritis. Clinical and Developmental Immunology , 2013. Yap, H.-Y., Tee, S. Z.-Y., Wong, M. M.-T., Chow, S.-K., Peh, S.-C., & Teow, S.-Y. (2018). Pathogenic role of immune cells in rheumatoid arthritis: implications in clinical treatment and biomarker development. Cells , 7(10), 161. Yildirim, K., Karatay, S., Melikoglu, M. A., Gureser, G., Ugur, M., & Senel, K. (2004). Associations between acute phase reactant levels and disease activity score (DAS28) in patients with rheumatoid arthritis. Annals of clinical & laboratory science , 34(4), 423-426. Zhang, Y., Li, M., Liu, Z., & Fu, Q. (2021). Arbutin ameliorates glucocorticoid-induced osteoporosis through activating autophagy in osteoblasts. Experimental Biology and Medicine , 246(14), 1650-1659. Supplementary Files GraphicalabstractofArbutin.jpeg SupplementaryMaterial.docx Cite Share Download PDF Status: Under Review Version 1 posted Editor invited by journal 09 Mar, 2024 Reviewers agreed at journal 18 Jan, 2024 Reviewers invited by journal 11 Dec, 2023 Editor assigned by journal 09 Dec, 2023 First submitted to journal 09 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3664612","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":258711552,"identity":"b420b15c-7e22-42dd-8c66-c3a514dc8c2b","order_by":0,"name":"Abdul Malik","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJ0lEQVRIie2QPUsDMRjHIwe5JXprpEf7FU4OjkKhn8AP0VC46alLwaVihcBNp7PQL6FLJsGDw9zkHmkHodDBqVpwEcTEQ6ecL5tIfkMCf54fzwtCDsdfhKII3SMUYoLrIPB5YfLwS2WAEPlUdnM5MDn5VkEfSqT2I/M3KsGMC8qgT3aIZE93V/0DpMjmQR11CfLLmwtbk4U8pEwMCd7OyhashuOt2anogdSDkTRVtjYKEq14BAf+SQsKj/HwVsSAtUJJYlM6tTI1Cn+BYsoyCqsYXpuVqFZKM5jUXUqWU/CWo6xZ2VvIcZeJSh9Zpj0oKnZOZOKNzqhO7Lu05/xSPYpJu5On8RyKCbuu+HIDz8ftwC+ldX0bmL6/Py03eOvfVDscDse/5w0T42LTiPOMBAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-9315-0301","institution":"University of Sargodha","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Abdul","middleName":"","lastName":"Malik","suffix":""},{"id":258711553,"identity":"5c0c6bee-428b-4393-8b96-b2fe08ba289f","order_by":1,"name":"Nabeela Tabassum Sial","email":"","orcid":"","institution":"Lahore College for Women University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nabeela","middleName":"Tabassum","lastName":"Sial","suffix":""},{"id":258711554,"identity":"08ddea8d-66de-428a-830e-e99590d2b8cc","order_by":2,"name":"Urooj Iqbal","email":"","orcid":"","institution":"University of Sargodha","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Urooj","middleName":"","lastName":"Iqbal","suffix":""},{"id":258711555,"identity":"c4e12ff6-1ce8-4b7e-9d5f-21d04a202e4b","order_by":3,"name":"Muhammad Fayyaz Ur Rehman","email":"","orcid":"","institution":"University of Sargodha","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Fayyaz Ur","lastName":"Rehman","suffix":""}],"badges":[],"createdAt":"2023-11-25 17:56:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3664612/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3664612/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":48158614,"identity":"698b3136-ebb7-43c0-b969-58c0cec3bb5b","added_by":"auto","created_at":"2023-12-13 20:38:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":146249,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of Arbutin on (a) Arthritic index (b) Body Weight changes (c) Paw volume/edema. Data presented in the form of Mean± SEM (n=6), while ns=non-significant, ***=p\u0026lt;0.001, **=p\u0026lt;0.01, *=p\u0026lt;0.05 in contrast to the arthritic control group by 2-way ANOVA following Dunnet’s formula.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/eed9e9a70c6bb0edef405cfd.png"},{"id":48157407,"identity":"a812cf06-c8c6-4abe-87d1-fce0a258f817","added_by":"auto","created_at":"2023-12-13 20:22:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":743758,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Arbutin on messenger RNA values of a (IL-4), b (IL-10), c (COX-2), d (IL-1β), e (IL-6), f (IL-17), g (NF-kB), h (TNF-α), in CFA-mediated inflammation. Values representing mean± SEM (n=6). Whereas ns depicts non-significant, ***=p\u0026lt;0.001, **=p\u0026lt;0.01 and *=p\u0026lt;0.05, in contrast to arthritic control group\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/2643e9c98f2903f822186e70.png"},{"id":48157404,"identity":"39ad1b24-e495-4671-be79-8d17d68da9f0","added_by":"auto","created_at":"2023-12-13 20:22:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":262815,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of Arbutin on a. (PGE-2), b (5-LOX) and c. (Anti-CCP) in CFA-induced arthritis in the rats. *** =p\u0026lt;0.001, **=p\u0026lt;0.01, \u0026amp; *=p\u0026lt;0.05 as compared to the solvent-treated group followed by One-Way ANOVA.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/af5f0dfba94387ea287fc7a2.png"},{"id":48157409,"identity":"97aae564-37d7-44ab-8223-63b9a33a642c","added_by":"auto","created_at":"2023-12-13 20:22:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1123715,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of different doses of Arbutin on histopathological changes. A Arthritic control, B vehicle control (receiving solvent), C Piroxicam 10 mg/kg, D Arbutin 25 mg/kg, E Arbutin 50 mg/kg, F Arbutin 100 mg/kg.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/2894ec9c32f43e01253ce051.png"},{"id":48157410,"identity":"147e5e0c-00ed-47a3-9722-eaefbec61dd7","added_by":"auto","created_at":"2023-12-13 20:22:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":547373,"visible":true,"origin":"","legend":"\u003cp\u003eRadiographic analysis of treated rats compared to arthritic control rats. Where A representing Arthritic rats ankle joints with narrowing in joint space and bone erosion, B represents the ankle joint of vehicle control rat showing normal morphology and architecture of cartilage bone, C represents the ankle joint of Piroxicam treated rat, while D, E and F represent ankle joints of rats treated with various doses of arbutin (25, 50 and 100 mg/kg) representing inhibition in the spatial constriction and inflammation of tissues.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/31ba0691135ba2b8ed5288d2.png"},{"id":48157411,"identity":"ecb75a52-8f10-4106-9370-c90e2fa72fd2","added_by":"auto","created_at":"2023-12-13 20:22:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":403849,"visible":true,"origin":"","legend":"\u003cp\u003e2D and 3D images of Arbutin from post-molecular docking in protein pockets.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/6cd55efdac1d848e7db49766.png"},{"id":48158997,"identity":"fe2946e2-49e9-4873-86e2-f2889d5acea9","added_by":"auto","created_at":"2023-12-13 20:46:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3846493,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/9064efd0-5285-43a8-9b16-27ab6683e176.pdf"},{"id":48158125,"identity":"126cb7d5-17e4-474b-8ce7-64f194394004","added_by":"auto","created_at":"2023-12-13 20:30:56","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":148022,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalabstractofArbutin.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/9ac8adf01e65ef33ec1ee1c4.jpeg"},{"id":48157408,"identity":"dd1ca07f-0f75-43da-823f-36a8343ee1aa","added_by":"auto","created_at":"2023-12-13 20:22:56","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1580809,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-3664612/v1/60c5f86cebc150b49f8b7590.docx"}],"financialInterests":"","formattedTitle":"Arbutin attenuates CFA-induced Arthritis by modulating expression levels of 5- LOX, NF-κB, IL-17, PGE-2 and TNF-α","fulltext":[{"header":"Introduction","content":"\u003cp\u003eArthritis or Rheumatoid Arthritis (RA), a common disorder of systemic autoimmunity, characterized by the chronic inflammatory process that causes harm to extra-articular organs such as the kidney, heart, digestive system, eyes, skin, joints and central nervous system (Radu and Bungau, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In the development of polyarthritis, cytokines are key signaling molecules. Many inflammatory cytokines, such as IL-2, interleukin-6, IL-12 and IL-23, IL-1β are thought to start and continue the inflammatory response in the synovium (Mohammad Saleem et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Changes in pro- (TNF-α, IL-6, IL-1β) and anti-inflammatory (IL-10 and IL-4) cytokine balances govern the pathogenesis and progression of RA. Additionally, the increase in nuclear factor-kappa B (NF-κB), which is a transcription factor that influences cellular proliferation and inflammation, has a significant influence on the inflammatory immune response associated with Arthritis (Ammara Saleem et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eArthritis is known to cause progressive synovial inflammation that eventually affects several joints. First, the genetic predisposition to produce autoimmune T and B cells; second, a tissue injury or infection that causes autoreactive lymphocytes to become activated, which in turn causes tissue or organ destruction by stimulating antigen-presenting cells (Gul et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Numerous T cells, B cells, neutrophils, macrophages, osteoclasts, fibroblasts, and dendritic cell subtypes interact in a complicated way to perpetuate inflammation in the joints. The main inflammatory cells in the afflicted joints are T cells, monocytes, and B cells (Yen-Ju Lin et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Many environmental aspects are associated with a greater risk of RA, including obesity, smoking, drinking, genetic factors, and insufficient vitamin D. Some widely used treatments for arthritis include biologics, disease modifying anti-rheumatic drugs (DMARDs), NSAIDs, and corticosteroids. Apart from their well-reported side consequences (GI irritation, nephrotoxicity, hematological abnormalities, high risk of cardiovascular problems, and serious infections), and prohibitively high cost, over 30% of the patients did not react to traditional therapy (Nawaz et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAlthough NSAIDs, corticosteroids, and DMARDs do not lessen the responses mediated by T cells and B cells. Instead, these aim to reduce joint inflammation and pain (Akhter et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, new herbal compounds that are the most efficient and cost-effective against these adverse reactions must be focused. There is more research on phytoconstituents from plants that prevent the production of cytokines for arthritis treatment (Arya et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eArbutin, a naturally occurring hydroquinone glycoside, is present in the Vaccinium, Asteraceae, and Ericaceae family of plants. It demonstrates a wide range of pharmacological actions, such as neuroprotective, free radical scavenging, antimicrobial, antihyperglycemic, antioxidant, hepatoprotective, antitumor, and alpha-amylase inhibitory properties (Ahmadian et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Both osteoclasts and osteoblasts have been shown to utilize Arbutin in maintaining bone homeostasis. Arbutin suppresses the generation of superoxide and downregulates the osteoclastogenesis regulator NFATc1 to prevent osteoclast differentiation (Zhang et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Numerous plant species, including wheat, pears, and bearberry plants in the genus Arctostaphylos, have abundant amounts of glycosylated hydroquinone in their leaves.\u003c/p\u003e \u003cp\u003eArbutin exhibits outstanding safety and has no negative effects on health, including toxicity or irritation. The use of Arbutin as a drug has not been approved yet and some clinical trials (NCT03868748 and NCT00717652) are already in process to determine its toxicity in humans and other animals. Since 1988, Japan has been using it as a skin-lightening agent in cosmetics due to its safety and other countries are now adopting this use as well. Arbutin is a multifunctional compound that exhibits anti-oxidant and depigmenting properties (Lee and Kim, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). According to the literature review, there hasn't been a scientific assessment of the anti-arthritic effect of Arbutin through the CFA model of polyarthritis. The current study focuses on the molecular mechanism underlying Arbutin for anti-arthritic action in an arthritis model induced by CFA.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDrugs and chemicals\u003c/h2\u003e \u003cp\u003eArbutin, purchased from Macklin (China), and we have conducted the characterization of our compound via UV-visible spectrophotometry, GC-MS, FTIR and HPLC for purity of the compound (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-\u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). Complete Freund\u0026rsquo;s adjuvant (CFA) was obtained through Sigma-Aldrich, USA. DPPH and Piroxicam were obtained from Sigma Aldrich, USA, while, ethanol \u0026amp; chloroform used were of analytical grade.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExperimental Animals\u003c/h2\u003e \u003cp\u003eSprague Dawley (SD) rats of either sex, weighing 145\u0026ndash;230 g have been utilized in the study. Animals were kept in the standard housing circumstances with air-conditioned circumstances at an animal house in the Department of Pharmacology, University of Sargodha. To maintain a room temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;5\u0026deg;C and also at a twelve-hour light/dark cycle, animals were adequately provided with the pellet diet and free access to water. The animals were acclimatized to their new environment and it was made sure on the guidelines of the National Research Council. Animals were provided with a standard diet and water \u003cem\u003ead-libitum\u003c/em\u003e. Studies performed after acceptance from the Biosafety and Ethical Review Committee (BERC) of the University of Sargodha with Certificate Number. SU/ORIC/803\u0026ndash;23.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCFAinduction of inflammation\u003c/h2\u003e \u003cp\u003eAnimals were randomly distributed into groups, (n\u0026thinsp;=\u0026thinsp;6). Group-i: Arthritic Control, Group: ii: Vehicle control Distilled water 10 ml/kg, Group-iii: Piroxicam 10 mg/kg, Group-iv: Arbutin 25 mg/kg, Group-v: Arbutin 50 mg/kg, Group-vi: Arbutin100 mg/kg,\u003c/p\u003e \u003cp\u003eAll doses were selected from a pilot study. All groups received an injection of 0.1 ml CFA except vehicle control, into the left hind paw of rats on day zero. Treatment continued for 28 days and all animals were killed on the 28th day. To assess Arthritis in each group, several factors were recorded (Akhter et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of arthritis through physical features\u003c/h2\u003e \u003cp\u003eRats in all groups were checked for weight changes, weekly according to the schedule during the treatment (Neng-Yu Lin et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Paw edema of the rat injected with CFA was observed (Qasim et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The animals were inspected macroscopically to check for the emergence of any signs of Arthritis. After receiving the CFA injection, rats experienced paw inflammation and arthritis within 4\u0026ndash;5 days. The nose, ears, tail, and paws of all rats were assessed and scoring was done, to calculate the arthritic index (Gohil et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of paw swelling and weight changes\u003c/h2\u003e \u003cp\u003eUsing a Plethysmometer (Panlab\u0026reg; Spain), physical parameters like paw volume were measured once a week for a total of 28 days. Percentage suppression in the paw (hind footpad) volume was determined by the use of the following equation (Ren et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eInhibition [%]\u0026thinsp;=\u0026thinsp;Vc\u0026thinsp;\u0026minus;\u0026thinsp;Vt/Vc \u0026times; 100\u003c/p\u003e \u003cp\u003eThe volume of the paws of the control and treated animals is denoted by Vc and Vt, respectively. Throughout the study, changes in body weight in arthritic animals relative to treated animals were also noted to confirm the drug\u0026rsquo;s therapeutic effects.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of arthritis through blood and serum\u003c/h2\u003e \u003cp\u003eOn the 28th day, the experimental animals (rats) were kept in a transparent acrylic jar and subjected to a brief inhalation of mild ether anesthesia. Through cardiac puncture, blood was drawn into EDTA tubes, and conventional laboratory techniques were used for the hematological parameters such as hemoglobin, RBC, WBC, platelets, ESR, and PCV were measured. Aspartate aminotransferase (AST), alkaline phosphatase (ALP), ALT, and other serum markers were also measured for activity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAssay for mRNA expression of cytokines, IL-1β, TNF-alpha, interleukin-6, COX 2, nuclear factor-κB, IL-4, IL-10 and IL- 17\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA specialized kit, the Hi Pure Total RNA Kit (Cat# IVD4121, Magen Biotechnology, Co., Guangzhou, China), was used for the total RNA extraction carried out in blood and tissue samples, and cDNA were prepared using the standard kit protocol. SYBR Select Master Mix (Cat No. 4472903, ZOKEYO, China) was used to express the targeted genes in real-time by using duplicates of the appropriate primers (10\u0026micro;M each) and cDNA as the template. PCR Reactions were conducted on an Rt- PCR System (Sansure Biotech Inc, China). The relevant Ct\u0026rsquo;s of samples were compared with controls and control samples containing housekeeping genes (GAPDH).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eForward\u0026ndash;reverse primers sequences and base pairs employed in Rt-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5'-\u0026gt;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse/Forward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct length (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGene Accession Number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGGCTCCCTCTCATCAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNM_013693.3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTGGTGGTTTGCTACGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCACCAGGAACGAAAGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eXM_032905335.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGGCTGGAAGTCTCTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACTCCACTCACGGCAAATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNM_001411843.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTCCATGGTGGTGAAGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCTGTTCTGCTTTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e168\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNM_201270.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCTCCGTGGTGTTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTGGAGCAGGTGAAGAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e109\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNM_012854.2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGTGTCACGTAGGCTTCTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCox-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATTGACAGCCCACCAACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e199\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNM_017232.4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATTGACAGCCCACCAACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCTCTCAAGCAGAGCACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNM_031512.2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGTTCCATGGTGAAGTCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNF-κB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTGAGGCTGTTTGGTTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eXM_039079521.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGCCCTCCTGACTCTACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTTTCCGGGTGGAGAAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eXM_032899488.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTAGGGGCTAGCCTCAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEstimation of serum prostaglandin E2\u003c/b\u003e, \u003cb\u003eAnti-Cyclic Citrullinated Peptides (Anti-CCP), and 5-Lipoxgenase (5-LOX)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAfter the experimental animals were fully immunized up to day 28, their hearts were punctured to obtain blood samples. After that, the blood samples were given an hour to clot. Centrifugation at 3000 rpm for 5 minutes was used to extract serum, which was then stored at -20\u0026deg;C. The protocol provided by CSB-E07967r kit (CUSABIO, China the manufacturer of the ELISA kit, was used to measure the prostaglandin E2, Anti-CCP (Anti cyclic citrullinated peptide antibody) Rat ELISA Kit, CUSABIO, catalog No. CSB-E13830r. A microplate spectrophotometer set at a wavelength of 450 nm was used for sample analysis (Akhter et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The result of the PGE-2 level was expressed as pg per ml. The result of Anti-CCP activity was expressed as U per mL. 5-Lipoxygenase Rat arachidonate 5-Lipoxygense (Alox 5 ELISA Kit) with CUSABIO, Catalogue# CSB-E16982r), according to manufacturer protocol used.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn-Vitro\u003c/b\u003e \u003cb\u003eassay of antioxidant\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eFree radical scavenging assay of DPPH\u003c/h2\u003e \u003cp\u003eThe assay was conducted to evaluate the antioxidant potential of Arbutin (Shahid Chatha et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This method includes 1 ml of 0.004% DPPH in the methanol mixed with three mL of Arbutin, and the mixture solution was then left for thirty minutes in the dark. The absorbance at a wavelength of 517 nm was recorded. A reaction mixture with minimum absorbance suggests an increased level of radical scavenging activity. Analysis was also done on the antioxidant activity of ascorbic acid and BHT as a standard. The control group utilized a solution devoid of plant extract (Naseem et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Three duplicates of each test were run. This is how the percentage inhibition of samples containing DPPH radicals was determined.\u003c/p\u003e\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAgcAAABKCAYAAAAv+PegAAAUI0lEQVR4Ae2Z23EbyRJE6YuM0e+6IQvWBn2uFYq1Q3bIk43QjaPQuUqWeoABCEIDMjsC2zP1zMoqoFvcp//+++97P+WgM9AZ6Ax0BjoDnQFn4MmH7h2KzkBnoDPQGegMdAaYgV4O+peT/uWoM9AZ6Ax0BjoDz2agl4MOxLOB6L8a+q+GzkBnoDPQGejloJeDXg46A52BzkBnoDPwbAZ6OehAPBuI/ouh/2LoDHQGOgOdgafvXWWgDJSBMlAGykAZCAZ6OQgy+lgGykAZKANloAx8/97LQaegDJSBMlAGykAZeMZALwfP6OhLGSgDZaAMlIEy8KLLwYcPH74/PT1tfpLeL1++bNp9+/bth+kem8+fP/8WxzwfP358pvv06ZOq/+/IEjM+exZ5qffUIi52LGri/evXr5suYDkXc4/NZoILFeB1ydGKQ2yQWxu1nqvDuLfYwcasrNYe3ld+18rgYe8MXZvjln7M599///3sO2Cv3e1r5qW/W7OQdnue4euSWKf6vcoHVn9TVvpLZOe+9/fs/71n+xKetmzp3ZGWZ8w186Hv3nr4Hp37bWBWt37LyAN/W98V5H5nV/Wc05+r48Wdk7AE5xAD3MNSIPNHhnfs8gdpj80qNjmIgy7xmNtdfJlT3WqnBmKCa88y/qxrj++fsJmcMdD2jRrm8PI+ZTPGa9XhvK2+dPfm3S/fCstr1f+SuODMHxqe50xbU/bX72j6XosDDMzU3lin+n0Kw2puT9lv6ax99VshV/fo/71ne4uPvfJ7/R7sxYOds8RswOely9nN78a5GOZMO3uJjhmCK+YsvxP6bX1XsNXeeFnTOX3i2Xp+lcuByVZfrEmCQ2Sh+O6xgTQPMPOxGy+JSj3Pkont3kUucO1d1+Qg9j1+aGYN88vCu18A8GRvqCvfM5ZDnrJbPzsbE7N5ruVd/0t3uPgTPbsUJ/M7+8b7aqaRTbm8X5p3ZT9namWjzLxb/dZutV/jk3H88SbO5E67e/b/3rNtjdfsL+X+mpx7fDx04fKSxW8bc8s8Xvp9J+f0sZfEOxXT+U+s+mYNzKEzek6fsU49v+rlwINa0ABZFcsgJXl7bPB5a5eDe/7QOBQ5VMrgdutykL3UPnf0q76kzbXPfkEd/lUeddjeY/2Jnl1al5yw5wI737W5/BFM+eo7mfpLnol/bo6It6ffp/KufpRP2U8dOMEAVr4Tq3XP/tvHe832qt49MjjZ0989sW5tc+3lgHrw5TeHWZjfpXM4mSV/U7Glh8Txg361Vt874szvbcry2ZgrmbqtfT3xW9YLOUlPkYUuC5nFOvA5THtsiLs6HCT9VPPMmV8yYpFXHfET0zm9fvDB8l08kwdsGAiHgh0bP8ZJG+lP2+TWmA7yjKV/7tgkD8aQW/RiQTZtMxbP2E5M2iRuseWO/tSiLvNju8qzh3f8rCt7TO7Es9LBgTbkwgYsKZcv4vGsPXvGxAcsYp56/LHXf9abOacuecRuxS2xp5948cmFXWJPXODLmsmF3lhbeuKnTcZHx/u5fmMHtpkDubyyX7rwkTMwrOITE4x7+g9GarUefLN/xE+c6OQcHXmsRzzIscklF+hmTN7BQKyV3vjqsM2l3Dipy2f0WSe6xMxzxs64PLvEgz0co7PerCFzOXvJbebimTjJtTJxmD9384ppfj+wNeeWznkyBnmRgZ/41DTXSo6dsbS3Bt7P6fU5t//qxDnLDb2gkuw0pTiJRT6LpUiakg3eY2Mjt/YtPGCwOea0qcQS66xLm6nPePjjN2U/BD8PHptq3b5jM5u6skGWwwceMWkPDgeNXb043Kkf28mV/GQcbM0rN1mvMfWdMdVfuxMv6xCDPTSu+cHm4lmeqcEeTb6xM55x5BEdn8RAfPTI5YY94/BsPjETW7uMmXpji5v3mcec6LBLW2Qu5NahjF3sxM2PHKQtdRsDPfbUYRx5IZextGdXj33i4Vl+Mh+x00duJjZi65/2xkKmXtmePeNiTxywzoUd9doL+ypOMTlPyrHLeMaZs5HYjUE+F8/GIab50PNMXJY9YTdm6o2d+GYec2KDTlvl7OqIlytxJQbwiR97dNQhHt7NlTJrwFd/du2JwUpeeccPG/HxLkfaJ1ZkxDIe7+SZNshZ0/an+P+8+O5OHGtRljv6xIducobMuvboM/6p519TdsrqhE5Qkj1NaUQSybMNdJ/k7LHBNxtm3q3hVM/ukOVwEytxzjjn9Ma0Ft8zx+QqBxtcq6anjZhWtZgX+xymiTt9xZOyreeMCfdgEU/2flX3VsxL5NTBJxc4Ehe6VX7rREcM/OZCDne50g85fvKs3apnzNHEZV5iyBeyrZmzDm3N5776jqzqwh5bcs0FxsyP3pqnnPdZE/ZwRt60PzeD6vHJ70fiA+/ETJ6JIfNiP/uDfsbJPFvPk0tiIJv9AM+cG3KKE59VfuSz9vTDJ2sDpzORfvZr4iI+H3Hgz3vyYx/QYZe2yYs5jOm+qkvb9Oc5a5s63q2N2MZVlvUSRz1+YE7+sybzZEzxyRf21pO7emKQM9+NkbjMBbbEpxxb4mccdaf2FW+zZvzFxPM5/al8qfv9VzK1O54FtSpaQnLoVsXONHtssuHpb84VHu3Q4Z/NpaHkdc045/TGhA+W75ljxmQwc7BXTU0buRaje3KBffI9cevDvhUvbXgmnnzOGshtzdiu6jYe2LDf+iQX+rjTmy0/bdhX+VeYjSX2Fff6sbPw0d6cK7/sAfzjx248uZy9SX0+myt3Yhon5atnuCPXXGDPmVcv5qwVO+xd9hKcs46sH/uVXv4zprHZ9/Y78ZOHTy70yJwL87JvLepOu3ye8ff2nxhiFQvc5YI3PizyaK/Nym/OiVjxmX1Alz1NfT6bzx0sW33Sxl3ufHdXnvjQWZO12q/UJU+px2byv6ojfcRBXha6jP9DGP+RX3HnvuIEruaMEM445o0UJx/BN/NQA/JcOS/n9Ol36nn7G3LKK3ST7FD9KAAyk5BVsenD8x4b4l7bBAcyhyLJBcNs5jm9MeGD5XvmmE1jkPm45qAjTxu5zpjYwIV555dj4jYX+6wxdT4T19grn8yN3rrZb7XIP78giSXxmT85Qj+/TPgjAz+2xOc51+Rn1ortqmfEJef0n++zN6lf1ZHYzJGyrec5E9qBfcUL2Get2NmDiXu+z3xbemvM/oGNd3OJlV1+0j7xk4dPrkt40g+f1fxSV+bD/lT/jccup8Sw7ok1eZucEUM/eHARV0zpj36+z56mflXHKoeyrd0erfjDR72Y2ZOHfF/Vm3riTdxZkxizbvsgPuwzvz7u6JNv5eQl7lzEWsWz7ml/7p16yZVLXqwBHTbmPafPWKeef6/ulPVCN8nGRHDZFF1Xxapz32NDbMnQj90mJHGp51l82XRikdc145zTGxM+MkdinHwweHxcOej6TRsw5lDmjwNxsM9hmrjN5U6s5EG5e8ZSps/kCP3Eo89LdvJt9ZN6kw/7IH/kRW9fkPuMDj6pQ7/Zj6w/41gP+syffMuP/KLD1lrSlnjaq5+1YSOeGSt1YnPHNutSTqyceeRiyJqQYzdzG4fYGYd3bbGZdaaeXpBLjrBPjszhjm9iy7zkzN7aU/k0xqkdrIk9beUGGxe2iWfWmvjABn6WftY9sc44+GiT+cltzcQ2Pvbospa0RY+t+lVtxBXfjAWWxEE8F7b6KUse0PnOLoZZn+8ZC/vMi2/WzDP5XZNHakJPbJbvmQMf9OgytjHZxSZ2dfgmvpRvxdJmtSc/qSevucGeNWN3Tp+xtp5/sbhlcUIOcECtPuhy2YS0tUHa7bGB+IzBs8vBUC956tmRqWfHZ8omjr/++uuZz9T/+++/v+nJ5QCZLwcwsTo0GRf/lQ3y5D15TvmqLnznyiGaOnCvlsOIHsy5iLf6cqTN3ufJ38yV/CSW6Ze8gy37nVinH3asKU8f9BnPXlpjYky77JXY2f2IOf3RgcWV8YyhLnfx6+u7ueaeM0WcxCon6ZM40hbsqcNn6nPmMybPe/pNfO0mbuSzH8nLfE6sM1bOvHXon34zX+rwyzV19mfK02f2zjnBZmI0TnIOBuY3ZWJe+Zt75p38aMdOXj65yEluP9aa/ScmWLBJfLynHe/E11Z78iGzbuR8XDOGGCY23qfMGOyTi8yhb9rzDC7y712zF5nDGFm/tahjP6dP29XzL+ZW2sreBQMM3mq4Li3eL82lfrV/fQb40Zo/2K+f9T4ZmF8+88eXAyYPz/ugaRYYuNVvyqVsejm41O8W9nmhyFlkBk9dpm6R+zVi9HLwGqw+WEwP9Zf8kHrTvcUl48Hoexi4/mvrYQC/AOjqsvCCcHW9kIFb/KZcmPKH+Z+8HKzw+teKle7osl4Ojt6hO+K79nbLD8G1vufK81+F3X/9SbZclIvOwOPOwLnfvKPoezk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDZaAMlIEycBQGejk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDZaAMlIEycBQGejk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDZaAMlIEycBQGejk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDZaAMlIEycBQGejk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDZaAMlIEycBQGejk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDZaAMlIEycBQGejk4SieKowyUgTJQBsrAQRjo5eAgjSiMMlAGykAZKANHYaCXg6N0ojjKQBkoA2WgDByEgV4ODtKIwigDR2Dg6enp+5cvX5ZQvn79+h39t2/flvpbCz99+vT948ePtw77avHA+88///zgCJ5WHzicC7vPnz9P8VXv8AWOvYvcW/1exfjw4cPd+r/KX9n9GOjl4H5cN1MZODQDHBIcFqsD2YsB+ntcDjjgtrAckUQOzTzgwY8slzXlYUyNfNI3fS55pm/E2ns5ONXvU3nJkTWcsq3ucRno5eBxe1fkZeCmDHCYeYCtLgBeEFa6mwL5GQwsq4vKa+R6SUxwzsMd2bwckAPZlN/qckD8S/5ycK7fpzgB873m4BSO6l6PgV4OXo/bRi4DD8MABz8HCz/4W4dVLwe/t1NOpmbrcgDHR7gc7On3rCnf+cvBI1zcEnOfL2Ogl4PL+Kp1GXiTDHCYcWCwVgcYcg9Cdy4R84BAxgcbYuZSx77S8a9vbbikYEP8lOefs/2zuD4ZEx8OYS87q5zY6zsP7Mw5dVkTMTKvOmTTT7zEzgWGlCUudFkzfKA31pae+GkzMfJ+rt/EoIaZA7m8sne9TQZ6OXibfW1VZWA3A/zA50HmoeLhYSAvBdp6QHjwzANHOf4cMMabfuj4GNd8+CP34PTANg46D04xE1u7jJl64hM7LzYzjzmxxS5txccO5rRVJ3bi5kfs2rFnbjmmDhZx5AUMxkI+9bxjo45n+flh/PM/xDYmIrmZ2Iijf9obC5l6Zd3fDgO9HLydXraSMnAVAxxu84DjEPKQMeg8uJDjhy0L+9Uhgs08XD2QPASJMQ8a4k0/4k9cYiCG8ZAllsSOTdpanzt+6OdHfe7YTNzoV1xYc+LClhjgnYva0aU9sqx/1qken3nYGx+fmY88GRfbzIv9rBP9jGOO7o/PQC8Hj9/DVlAGXsQAP/IcDqtPBs4DVrkHHu8eusbxcOLQmYe8sbTBZx4+Kz8PP/JxMOHHbrw9l4Npay3uxDSOsq19hRtbsOfhqr+Ys1Zr0IYakYET+4yT9WO/0uPLZx72xt/b78xLHj650E9Z6vv82Az0cvDY/Sv6MvAiBjikVoeIB2geYsry4ORwmAc/gDygsCU+77lmLPSZC1v8ZmwOJOym/3wHVx5uqQcT+ZCtljlWuinbOiDBnvn1A/uslXcP2Yl7vu+5HJDbGienvKOfS37SPvGDQ4z6XsKTPt0fh4Hn39jHwV2kZaAM3IABDqY87DMkBxF61zxAPIA8ZDl0fMbH2NrlQY9tHlLY5sGEP/rMnwelWMyHznz4pi3v2lvrrM18+mas1PGca9ahDnkersjFkDUh592D1zqMA86Mw3vyNutMPXwSW47MJQfmcJ+cZF5yZn/s6VYsY3Z/XAZ+ffMft4YiLwNl4EIG/HHn8OCTP/yE8qCY+jzg0OXhwEGVfhlz5vOAm3IPScvBTgzEzpW50o5DTR92D0llHpbpjy5ryXjGyNw+y4fvsx5zuueBi49ydmtPWeLIusCeOnymftadcbM34JhcoCe+dhM3cny63i4DvRy83d62sjJQBu7AAIeoB/sd0t01hRcKLwkm57LgJUtZ97fFQC8Hb6ufraYMlIE/wID/kv8Dqe+ekgvDvCzcHUQTvjoDvRy8OsVNUAbKwHtggL8evPVDk78Y5P9+eQ99fa819nLwXjvfustAGSgDZaAMbDDQy8EGMRWXgTJQBspAGXivDPRy8F4737rLQBkoA2WgDGww0MvBBjEVl4EyUAbKQBl4rwz0cvBeO9+6y0AZKANloAxsMNDLwQYxFZeBMlAGykAZeK8M9HLwXjvfustAGSgDZaAMbDDQy8EGMRWXgTJQBspAGXivDPRy8F4737rLQBkoA2WgDGww8D9osuF5bvfAGAAAAABJRU5ErkJggg==\"\u003e\u003cbr\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn-Vivo\u003c/b\u003e \u003cb\u003eAntioxidant Assays\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe serum levels of Glutathione (GSH) and Catalase (CAT) were evaluated using the ELISA protocol. The Catalase and GSH kits (Cat. BC1175 for Rat) were obtained from Solarbio in Beijing, China. The results were expressed in nanograms per milliliter. Further, Rats kit from Solarbio in Beijing, China was used to measure superoxide dismutase (SOD) using kit SOD (Cat. BC0175). The results were given as ng per mL. ELISA determined the amount of malondialdehyde (MDA) in serum. The MDA level was measured using the kit MDA Cat. BC0025 for rat, from Solarbio in Beijing, China, and was reported as nmol per ml. The antioxidant enzymes in the serum, including CAT, SOD, MDA and GSH were assessed in compliance with the manufacturer's instructions using mouse ELISA kits for these substrates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eHistological assessment of ankle joints\u003c/h2\u003e \u003cp\u003eA solution (decalcifying) containing potassium sodium tartrate, sodium tartrate, ethylene diamine tetra acetic acid, and hydrochloric acid was used to fix rat ankle joints in formalin. After cutting the tissues into sections of 5\u0026micro;m thick, embedded in the paraffin and staining done with eosin and hematoxylin (E and H). Further, histopathologist has examined the formation of pannus, the erosion of bone, and the inflammatory cells infiltration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRadiographic analysis\u003c/h2\u003e \u003cp\u003eOn the 28th day, radiographs of the rat hind paws were obtained. Radiographic films were thoroughly examined to look for bone erosions, narrowing between joint spaces, and swelling of joint tissues (Khan et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDocking study at molecular level\u003c/h2\u003e \u003cp\u003eMolecular docking of Arbutin was employed for evaluating pro and anti-inflammatory proteins i.e., IL-4 (PDB: 2B8U), IL-10 (PDB: 1Y6K), IL-17(PDB:4HSA), and TNF-alpha (PDB:2AZ5), inducible NOS (PDB:2NSI), cycloxygenase-2 (PDB:5KIR), PGE-2 (PDB:7D7M), 5-LOX (PDB:3V98), NF-κB (PDB:1SVC) targets involved in inflammation. All proteins were downloaded and repaired for molecular docking using software version 20.7.4 (Krieger and Vriend, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The three-dimensional structures of the ligand were acquired from PubChem (accessed August 25, 2021 via \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The ligands were downloaded. The ligand \u003cem\u003e2D\u003c/em\u003e and \u003cem\u003e3D\u003c/em\u003e structures were optimized using Avogadro\u0026rsquo;s software. In YASARA, a modified Auto Dock-Lamarckian Genetic Algorithm is utilized for molecular docking and the computation of dissociation constants and binding energies. The docking scores were determined by the protocol before utilizing the equation.\u003c/p\u003e \u003cp\u003eΔG\u0026thinsp;=\u0026thinsp;ΔG (vander waals) + ΔG (H\u0026thinsp;\u0026minus;\u0026thinsp;bonding) + ΔG (electrostatic) + ΔG (torsional free energy) + ΔG (desolavation energy)\u003c/p\u003e \u003cp\u003eLigplot and Pymole sources were used for the collection of data on ligand\u0026ndash;protein interactions. The precise ligand was chosen from a database of ligand\u0026ndash;protein complexes and interactions\u0026mdash;including H-bonds\u0026mdash;was recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Assessment\u003c/h2\u003e \u003cp\u003eData was shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. In order to conduct the statistical analysis, GraphPad Prism version 8.0 was utilized for the Bonferroni posttest and 2-way and 1-way (ANOVA) analysis of variance.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIn-Vitro\u003c/b\u003e \u003cb\u003e(DDPH)\u003c/b\u003e \u003cb\u003eanalysis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eArbutin was investigated using DPPH revealing the antioxidant activity of Arbutin. The percentage inhibition of samples containing DPPH radicals was found to be 67.69% (percentage of antioxidant).\u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEffect of Arbutin on Arthritic index (AI), Body weight, and paw volume\u003c/h2\u003e \u003cp\u003eThe findings presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e indicate that Arbutin administered to rats in 25, 50 and 100 mg/kg doses demonstrated a marked decrease in rats arthritic index, measuring 1.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21, 1.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10, and 1.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13, respectively, compared to the arthritic control group, which had an arthritic index of 3.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10). On day 28 of treatment, there was a noticeable decrease in paw volume (52.04, 78.04, and 84.7%) in 25, 50 and 100 mg/kg doses, respectively. Moreover, joint swelling, arthralgia, redness and immobility, the main markers of chronic inflammation were markedly decreased in rats treated with Arbutin and piroxicam. During the treatment period, arthritic rats exhibited a marked reduction in body weight from 183.167\u0026thinsp;\u0026plusmn;\u0026thinsp;3.43 to 167.60\u0026thinsp;\u0026plusmn;\u0026thinsp;4.021g. On day 28, however, rats given Arbutin (25, 50, and 100 mg/kg) has shown a significant gain in weight. On day 7, a significant change in weight gain was observed with the dose increased from 50 mg/kg as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eBiochemical and hematological parameters\u003c/h2\u003e \u003cp\u003eIn rats with arthritis that received CFA injection, hematologic changes were noted. Among these were the documented significant decrease in hemoglobin, RBC counts, the rise in platelet values, WBCs, Platelets, ESR, AST, ALT, ALP, Urea, creatinine CRP and RF. Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e indicates that oral Arbutin administration markedly reduced the LFTs, WBCs, CRP, ESR, platelets, urea and creatinine in comparison to the solvent treated rats while significantly increasing RBCs and hemoglobin. At dosages of 25, 50, and 100 mg/kg, the results demonstrated shielding effects against the indicators i.e. hepatotoxicity and nephrotoxicity. Additionally, in rats given CFA injections, Arbutin markedly reduced the RF values.\u003c/p\u003e \u003ch4\u003eTable 2: Effects of orally administered Arbutin on biochemistry and hematology in CFA-induced Arthritic rats\u003c/h4\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBiochemical \u0026amp; hematological parameters\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eArthritic\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003econtrol\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVehicle Control\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003ePiroxicam 10 mg/kg\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eArbutin 25 mg/kg\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eArbutin 50 mg/kg\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eArbutin 100 mg/kg\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHb\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e(g/dL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e8.11 \u0026plusmn; 0.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e14.65 \u0026plusmn; 0.87\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e15.65 \u0026plusmn; 1.00\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e12.40 \u0026plusmn; 0.89\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e12.97 \u0026plusmn; 1.11\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e14.65 \u0026plusmn; 0.90\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRBCs (\u0026times;10\u003csup\u003e6\u003c/sup\u003e/\u0026micro;L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e5.38 \u0026plusmn; 0.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e8.433\u0026plusmn;0.26\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e7.750 \u0026plusmn; 0.18\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e7.067 \u0026plusmn; 0.08\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e7.033 \u0026plusmn; 0.26\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e9.383 \u0026plusmn; 0.42\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWBCs (\u0026times;10\u003csup\u003e3\u003c/sup\u003e/\u0026micro;L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e18.64 \u0026plusmn; 0.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e11.13 \u0026plusmn; 0.82\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e14.59 \u0026plusmn; 0.23\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e16.07 \u0026plusmn; 0.38\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e16.04 \u0026plusmn; 0.88\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e10.76 \u0026plusmn; 0.52\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; Platelets (\u0026times;10\u003csup\u003e3\u003c/sup\u003e/\u0026micro;L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e177.5 \u0026plusmn; 13.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e465.3 \u0026plusmn; 47.44\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e518.5 \u0026plusmn; 44.70\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e379.3 \u0026plusmn; 31.94\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e421.7 \u0026plusmn; 25.85\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e425.8 \u0026plusmn; 74.33\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eESR\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(mm/1\u003csup\u003est\u003c/sup\u003ehr)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e12.70 \u0026nbsp;\u0026plusmn; \u0026nbsp;0.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e7.450 \u0026nbsp;\u0026plusmn; \u0026nbsp;0.25\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e10.72 \u0026plusmn; 0.28\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e10.95 \u0026plusmn; 0.31\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e10.94 \u0026plusmn; 0.36\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e9.00 \u0026plusmn; 0.17\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAST\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e81.11 \u0026plusmn; 0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e46.24 \u0026plusmn; 0.18\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e64.81 \u0026plusmn; 1.45\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e77.96 \u0026plusmn; 0.59\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e47.86\u0026plusmn; 0.60\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e56.37 \u0026plusmn; 0.38\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e(U/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eALT(U/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e74.56 \u0026plusmn; 0.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e42.63 \u0026plusmn; 0.50\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e42.10 \u0026plusmn; 0.84\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e71.81 \u0026plusmn; 0.37\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e71.70 \u0026plusmn; 0.55\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e58.68 \u0026plusmn; 0.48\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eALP(U/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e340 \u0026plusmn; 0.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e177.7 \u0026plusmn; 5.30\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e141.7 \u0026plusmn; 7.45\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e319.8 \u0026plusmn; 2.023\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e320.7 \u0026plusmn; 1.22\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e246.2 \u0026plusmn; 0.60\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eUrea (mg/dL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e50.87 \u0026plusmn; 0.51\u003c/p\u003e\n \u003cp\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e20.21 \u0026plusmn; 0.32\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e34.85 \u0026plusmn; 0.41\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e47.70 \u0026plusmn; 0.56\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e47.90\u0026plusmn; 0.76\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e27.48 \u0026plusmn; 0.55\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eCreatinine (mg/dL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e2.335 \u0026plusmn; 0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e1.517 \u0026plusmn; 0.07\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e1.220\u0026plusmn;0.09\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e2.010 \u0026plusmn; 0.68\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e2.008 \u0026plusmn; 0.07\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e0.9200 \u0026plusmn; 0.02\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCRP (mg/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e9.167 \u0026plusmn; 0.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e3.972 \u0026plusmn; 0.12\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e3.983 \u0026plusmn; 0.26\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e8.273 \u0026plusmn; 0.21\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e8.293 \u0026plusmn; 0.12\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e4.867 \u0026plusmn; 0.18\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.75%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRF (IU/mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\" valign=\"top\"\u003e\n \u003cp\u003e9.650 \u0026plusmn; 0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e6.083 \u0026plusmn; 0.04\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e8.578 \u0026plusmn; 0.16\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.458333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e9.125 \u0026plusmn; 0.06\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\" valign=\"top\"\u003e\n \u003cp\u003e8.970 \u0026plusmn; 0.08\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" valign=\"top\"\u003e\n \u003cp\u003e7.148 \u0026plusmn; 0.57\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eValues represented as means \u0026plusmn; SEM (n=6). *= p \u0026lt; 0.05, **= p\u0026lt;0.01 and ***=p \u0026lt; 0.001, ns : non-significant compared with the arthritic control. Hb: Hemoglobin, RBCs: Red blood cells, WBCs: White blood cells, ESR: Erythrocyte sedimentation rate, ALT: Alanine aminotransferase, AST: Aspartate aminotransferase, ALP: Alkaline phosphatase, RF: Rheumatoid factor, CRP: C-reactive protein\u003c/p\u003e\u003cp\u003e \u003cb\u003eEffect of Arbutin on mRNA inhibition of TNF-alpha, interleukin-1β, cycloxygenase-2, interleukin-6, NF-κB, IL-17 and increase in the expressions of cytokines (IL-4 and IL-10)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBlood was drawn on the 28th day, and Rt-qPCR was used to assess various inflammatory cytokines. Rats which were treated with Arbutin, orally at 25, 50 and 100 mg/kg (3.437\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0192, 3.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0073, and 2.186\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00182) showed a marked decrease in TNF-α, while arthritic control rats (6.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1803) showed increased manifestation of TNF-α. Rats treated with Arbutin and piroxicam showed a significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) decrease in IL-1β (4.132\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1123, 3.998\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0716 and 3.427\u0026thinsp;\u0026plusmn;\u0026thinsp;0.061, 3.567\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1145) when compared to adjuvant control arthritic rats. Rats treated with Arbutin showed significant inhibition of IL-6 (4.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1211, 3.070\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0678, and 2.782\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0535, respectively) compared to solvent treated rats (6.650\u0026thinsp;\u0026plusmn;\u0026thinsp;0.014). Cycloxygenase-2 expression with Arbutin at 25 mg/kg p.o (3.123\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0463), 50 mg/kg (3.090\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0474), and 100 mg/kg (2.424\u0026thinsp;\u0026plusmn;\u0026thinsp;0.030) were significantly reduced (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) compared to the expression level of COX-2 in diseased control rats (6.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0966). Additionally, rats treated with Arbutin and piroxicam showed a significant decrease in NF-κB (3.417\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1014, 2.950\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0428, 1.963\u0026thinsp;\u0026plusmn;\u0026thinsp;0.068, 2.733\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0918) when compared to rats with arthritis (5.933\u0026thinsp;\u0026plusmn;\u0026thinsp;0.066). Rats that were given Arbutin (100 mg/kg) and piroxicam had higher levels of interleukins i.e., IL-4 and IL-10 than rats with arthritis, as demonstrated by the following data in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e (a, b, c, d, e, f, g \u0026amp; h).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eImpact of Arbutin on PGE2, 5-LOX and Anti-CCP\u003c/h2\u003e \u003cp\u003eWhen compared to diseased animals (189.8\u0026thinsp;\u0026plusmn;\u0026thinsp;3.348), the Arbutin-treated animals (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) revealed a remarkable reduction in PGE2 levels (77.80\u0026thinsp;\u0026plusmn;\u0026thinsp;3.9, 75.84\u0026thinsp;\u0026plusmn;\u0026thinsp;2.166, and 43.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.956). Unlike other doses, the maximum effect was obtained at 100 mg/kg of Arbutin (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Arbutin at the median dosage was superior to piroxicam 10 mg/kg (76.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.248). Subsequent oral Arbutin treatment at 25 mg/kg, 50 mg/kg and 100 mg/kg significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) suppressed the expression of 5-LOX (9.870\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11), 9.810\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18), and (3.445\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18) in comparison to the arthritic control (11.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36), while piroxicam (10.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30) demonstrated a marked (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) reduction in the 5-LOX protein levels, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb. Furthermore, compared to the piroxicam (395.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.49) group, the CFA-treated arthritic control group had higher serum levels of Anti-CCP (410\u0026thinsp;\u0026plusmn;\u0026thinsp;3.89). Conversely, a highly marked (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) decrease in anti-CCP concentration was noted in the 25, 50, and 100 mg/kg, treated groups (395.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.35), (289.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3.21), and (110.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.19) opposed to the diseased control rats as shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eArbutin impact on SOD, CAT, GSH and MDA\u003c/h2\u003e \u003cp\u003eIn the diseased group, the CFA-induced oxidative stress as shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e3\u003c/span\u003e, decreases serum concentrations of Catalase, SOD and GSH. Following oral doses (25, 50 and 100 mg/kg) of Arbutin, a noteworthy increase in catalase levels of 49.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69, 117.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.34, and 116.1\u0026thinsp;\u0026plusmn;\u0026thinsp;5.26 ng/mL respectively, in comparison to the diseased control group (37.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69 ng/ml). A comparable reduction in MDA and rise in catalase, GSH, and SOD were observed in all treatment groups.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eImpact of Arbutin on anti-oxidant enzyme activities\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSOD (ng/ml protein)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAT (ng/ml protein)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGSH (ng/ml protein)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMDA (nmol/ml protein)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eArthritic rats\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.067\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e37.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e9.038\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eVehicle control rats\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e97.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.73\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.098\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e5.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePiroxicam 10 mg/kg\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e4.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e101\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e7.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eArbutin 25 mg/kg\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e49.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e8.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eArbutin 50 mg/kg\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e117.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.34\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eArbutin 100 mg/kg\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e4.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e116.1\u0026thinsp;\u0026plusmn;\u0026thinsp;5.26\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e5.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eValues expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM following one-way (ANOVA) with Dennett\u0026rsquo;s test (*** =p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, **=p\u0026thinsp;\u0026lt;\u0026thinsp;0.01)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImpact of Arbutin on histological changes\u003c/h2\u003e \u003cp\u003eThe histology of normal control rats showed no signs of inflammation with normal synovial tissue space, joint space and intact articular cartilage. Rats with arthritis in control groups exhibited observable synovial lining, distinct synoviocyte proliferation, and invasion of inflammatory cells in granulous and pannus formation in ankle joints. Comparably, arthritic control groups also showed swelling, extensive bone erosions and joint deformity along with collagen fiber deposition (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Nonetheless, piroxicam (10 mg/kg) demonstrated a slight increase in inflammatory cell incursion, cartilage degradation, thickening of the synovial intergalactic space, and a reduction in the formation of pannus. Additionally, Arbutin (100 mg/kg) administered demonstrated significant fortification against the growth of vascular lesions, restricted joint space, cartilage degradation, and a low number of inflammatory cells without the development of pannus, all of which closely resemble the architecture of normal joints. Conversely, a moderate amount of cartilage damage with minimal cell invasion and pannus formation was observed with the 50 mg/kg, p.o dose of Arbutin. In contrast, rats given 25 mg/kg of Arbutin showed minimal cartilage loss, a small amount of inflammatory cell infiltration, and no pannus formation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEffect of Arbutin on radio-graphical changes\u003c/h2\u003e \u003cp\u003eWhen analyzing arthritis, radiography is helpful in determining the severity of the disease course. It has been discovered that a decrease in joint spaces causes cartilage to be lost, which sets off a variety of irrational mechanisms. X-rays revealed there were normal cartilage architecture and morphology in normal rats, with no swelling around the joints. On the other hand, x-ray analysis of control rats with arthritis revealed that the rats had severe tissue swelling, phalangeal bone erosion, and narrow joint space. In contrast, rats given 100 mg/kg of Arbutin showed inhibition of bone damage, connective tissue inflammation, joint distortion, and narrow joint spaces. Similar protection against swelling, joint deformity and bone erosion was demonstrated in rats given 50 mg/kg of Arbutin. Rats treated with piroxicam also showed similar mild alterations in their soft tissues surrounding their joints, along with a noticeable decrease in joint space as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of\u003c/b\u003e \u003cb\u003ein-silico\u003c/b\u003e \u003cb\u003estudies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eArbutin was tested against eight protein targets, which included TNFα, iNOS, COX-2, 5-lipoxygenase, NF-κB, IL-4, and IL-10. To find ligand-protein interactions, virtual screening of Arbutin was carried out. Binding energies and dissociation constants were then computed to ascertain the ligand-protein affinity. Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e4\u003c/span\u003e, lists the ligands' dissociation constants and binding energies for each target.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eTable 4.\u003c/strong\u003e Targets chosen for their optimal position against Arbutin in terms of dissociation constants, binding energy and active sites\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"619\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eTargets\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003eBinding Energy kcal/mol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003eDissociation constant\u003c/p\u003e\n \u003cp\u003e\u0026micro;M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eActive site\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eIL-17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-7.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e4.88\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eARG 20, THR 21, VAL 22, MET 23, VAL 24, ASN 25, LEU 26, LEU 99, GLU 102, ASN 108, SER 109, PHE 110, ARG 111, LEU 112\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eiNOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-8.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e1.11\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eLEU 108, THR 109, CYS 110, CYS 115, LEU 116, GLY 117, SER 118, ILE 119, PRO 122, SER 124, LEU 125, ARG 199, ALA 459, ASP 460, TRP 461, ILE 462, MET 480, LEU 481, ASN 482\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eTNF-\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-6.8\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e10.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003ePRO 20, GLN 21, ALA, 22, GLU 23, GLY 24, GLN 25, LEU 26, LYS 65, PRO 139, ASP 140, TYR 141, LEU 142, ASP 143, PHE 144\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eCOX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-8.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e633 nM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eASN 34, CYS 36, HIS 39, PRO 40, CYS 41, ARG 44, GLY 45, VAL 46, CYS 47, TYR 130, GLY 135, PRO 153, PRO 154, VAL 155, PRO 156, GLN 461\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003e5-LOX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-7.87\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e1.7\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eALA 398, HIS 399, ARG 401, PHE 402, GLN 611, ASN 613, GLU 614, LEU 615, MET 619, TYR 620, PRO 621, GLU 622, HIS 624, PRO 668, ASN 669, SER 670, ALA, 672\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eNF-\u0026kappa;B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-7.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e3.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003ePHE 56, ARG 57, PHE 58, ARG 59, PRO 65, SER 66, HIS 67, GLY 68, GLY 69, VAL 115, GLY 116, LYS 117, ASN 139, GLY 141, ILE 142, LEU 143,\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eIL-4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-7.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e3.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eLEU 27, THR 28, VAL 29, THR 30, VAL 51, LEU 52, GLN 54, PHE 55, HIS 58, HIS 59, GLN 106\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.831987075928918%\" valign=\"top\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.893376413570275%\" valign=\"top\"\u003e\n \u003cp\u003e-7.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.508885298869144%\" valign=\"top\"\u003e\n \u003cp\u003e3.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.76575121163167%\" valign=\"top\"\u003e\n \u003cp\u003eSER 10, VAL 11, TRP 12, PHE 13, THR 91, VAL 92, THR, 93, ASN 94, THR 95, ARG 96, PHE 97, SER 98, GLU 101\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n \u003cp\u003eArbutin, post-molecular docking 3D and 2D poses against protein targets, such as IL-17, iNOS, TNF-α, COX-2, 5-lipoxygenase, NF-κB, IL-4, and IL-10 are shown in the figure below.\u003c/p\u003e \u003cp\u003eArbutin revealed the best binding energies (kcal/mol) of -7.52, -8.13, -6.8, -8.60, -7.87, -7.38, 7.4, -7.39 and the dissociation constants of 4.88, 1.11, 10.3, 633, 1.7, 3.91, 3.74, 3.84 against IL-17, INOS, TNFα, COX-2, 5-LOX, NF-κB, IL-4, IL-10 in an appropriate way.\u003c/p\u003e \u003cp\u003eThe allosteric binding sites of IL-17 for Arbutin were ARG \u003csup\u003e20\u003c/sup\u003e, THR \u003csup\u003e21\u003c/sup\u003e, VAL \u003csup\u003e22\u003c/sup\u003e, MET \u003csup\u003e23\u003c/sup\u003e, VAL \u003csup\u003e24\u003c/sup\u003e, ASN \u003csup\u003e25\u003c/sup\u003e, LEU \u003csup\u003e26\u003c/sup\u003e, LEU \u003csup\u003e99\u003c/sup\u003e, GLU \u003csup\u003e102\u003c/sup\u003e, ASN \u003csup\u003e108\u003c/sup\u003e, SER \u003csup\u003e109\u003c/sup\u003e, PHE \u003csup\u003e110\u003c/sup\u003e, ARG \u003csup\u003e111\u003c/sup\u003e, LEU \u003csup\u003e112\u003c/sup\u003e. Likewise for iNOS, the binding sites were LEU \u003csup\u003e108\u003c/sup\u003e, THR \u003csup\u003e109\u003c/sup\u003e, CYS \u003csup\u003e110\u003c/sup\u003e, CYS \u003csup\u003e115\u003c/sup\u003e, LEU \u003csup\u003e116\u003c/sup\u003e, GLY 117, SER \u003csup\u003e118\u003c/sup\u003e, ILE \u003csup\u003e119\u003c/sup\u003e, PRO \u003csup\u003e122\u003c/sup\u003e, SER 124, LEU \u003csup\u003e125\u003c/sup\u003e, ARG \u003csup\u003e199\u003c/sup\u003e, ALA \u003csup\u003e459\u003c/sup\u003e, ASP \u003csup\u003e460\u003c/sup\u003e, TRP \u003csup\u003e461\u003c/sup\u003e, ILE \u003csup\u003e462\u003c/sup\u003e, MET \u003csup\u003e480\u003c/sup\u003e, LEU \u003csup\u003e481\u003c/sup\u003e, ASN \u003csup\u003e482\u003c/sup\u003e, while the binding pockets for TNFα were PRO \u003csup\u003e20\u003c/sup\u003e, GLN\u003csup\u003e21\u003c/sup\u003e, ALA\u003csup\u003e22\u003c/sup\u003e, GLU \u003csup\u003e23\u003c/sup\u003e, GLY 24, GLN 25, LEU 26, LYS \u003csup\u003e65\u003c/sup\u003e, PRO \u003csup\u003e139\u003c/sup\u003e, ASP \u003csup\u003e140\u003c/sup\u003e, TYR \u003csup\u003e141\u003c/sup\u003e, LEU \u003csup\u003e142\u003c/sup\u003e, ASP \u003csup\u003e143\u003c/sup\u003e, PHE \u003csup\u003e144\u003c/sup\u003e. The binding sites of COX-2 was ASN \u003csup\u003e34\u003c/sup\u003e, CYS \u003csup\u003e36\u003c/sup\u003e, HIS \u003csup\u003e39\u003c/sup\u003e, PRO \u003csup\u003e40\u003c/sup\u003e, CYS \u003csup\u003e41\u003c/sup\u003e, ARG 44, GLY \u003csup\u003e45\u003c/sup\u003e, VAL \u003csup\u003e46\u003c/sup\u003e, CYS \u003csup\u003e47\u003c/sup\u003e, TYR \u003csup\u003e130\u003c/sup\u003e, GLY \u003csup\u003e135\u003c/sup\u003e, PRO \u003csup\u003e153\u003c/sup\u003e, PRO \u003csup\u003e154\u003c/sup\u003e, VAL \u003csup\u003e155\u003c/sup\u003e, PRO \u003csup\u003e156\u003c/sup\u003e, GLN \u003csup\u003e461\u003c/sup\u003e. The binding sites of 5-LOX was ALA, \u003csup\u003e398\u003c/sup\u003e, HIS \u003csup\u003e399\u003c/sup\u003e, ARG \u003csup\u003e401\u003c/sup\u003e, PHE 402, GLN \u003csup\u003e611\u003c/sup\u003e, ASN \u003csup\u003e613\u003c/sup\u003e, GLU 614, LEU 615, MET 619, TYR 620, PRO \u003csup\u003e621\u003c/sup\u003e, GLU \u003csup\u003e622\u003c/sup\u003e, HIS \u003csup\u003e624\u003c/sup\u003e, PRO \u003csup\u003e668\u003c/sup\u003e, ASN \u003csup\u003e669\u003c/sup\u003e, SER \u003csup\u003e670\u003c/sup\u003e, ALA\u003csup\u003e672\u003c/sup\u003e. The active site residues of NF-κB were PHE \u003csup\u003e56\u003c/sup\u003e, ARG \u003csup\u003e57\u003c/sup\u003e, PHE \u003csup\u003e58\u003c/sup\u003e, ARG \u003csup\u003e59\u003c/sup\u003e, PRO \u003csup\u003e65\u003c/sup\u003e, SER \u003csup\u003e66\u003c/sup\u003e, HIS \u003csup\u003e67\u003c/sup\u003e, GLY \u003csup\u003e68\u003c/sup\u003e, GLY \u003csup\u003e69\u003c/sup\u003e, VAL \u003csup\u003e115\u003c/sup\u003e, GLY \u003csup\u003e116\u003c/sup\u003e, LYS \u003csup\u003e117\u003c/sup\u003e, ASN \u003csup\u003e139\u003c/sup\u003e, GLY \u003csup\u003e141\u003c/sup\u003e, ILE \u003csup\u003e142\u003c/sup\u003e, LEU \u003csup\u003e143\u003c/sup\u003e. While the allosteric binding sites of IL-4 were LEU \u003csup\u003e27\u003c/sup\u003e, THR \u003csup\u003e28\u003c/sup\u003e, VAL \u003csup\u003e29\u003c/sup\u003e, THR \u003csup\u003e30\u003c/sup\u003e, VAL\u003csup\u003e51\u003c/sup\u003e, LEU\u003csup\u003e52\u003c/sup\u003e, GLN \u003csup\u003e54\u003c/sup\u003e, PHE \u003csup\u003e55\u003c/sup\u003e, HIS \u003csup\u003e58\u003c/sup\u003e, HIS \u003csup\u003e59\u003c/sup\u003e, and GLN \u003csup\u003e106\u003c/sup\u003e. The Arbutin ligand interactions with the active site residues of IL-10 include SER, 10, VAL 11, TRP \u003csup\u003e12\u003c/sup\u003e, PHE \u003csup\u003e13\u003c/sup\u003e, THR, \u003csup\u003e91\u003c/sup\u003e, VAL \u003csup\u003e92,\u003c/sup\u003e, THR, \u003csup\u003e93\u003c/sup\u003e, ASN \u003csup\u003e94\u003c/sup\u003e, THR\u003csup\u003e95\u003c/sup\u003e, ARG \u003csup\u003e96\u003c/sup\u003e, PHE \u003csup\u003e97\u003c/sup\u003e, SER\u003csup\u003e98\u003c/sup\u003e, GLU \u003csup\u003e101\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussions","content":"\u003cp\u003eArthritis is more prevalent autoimmune disease that affects the cartilage, bones, and synovial membranes (McInnes and Schett, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The exact pathology of rheumatism is unknown, however, important validations have shown that its extensive destruction of bone and cartilage is caused by synovial neovascularization, proteinase-mediated suspension of cartilage articular matrix, elevated proinflammatory cytokine expression and osteoclast-mediated bone disintegration (Liu et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The pathological similarity of the CFA-induced arthritis model to human arthritis makes it a highly recommended model for preclinical drug testing (Neng-Yu Lin et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Inflammatory reactions start a few days after CFA injection inoculation, and secondary lesions appear two weeks after primary lesions (Alamgeer et al., 2017). CFA, which activates cell-arbitrated immunity and speeds up the production of antibodies, is made up of temperature-killed \u003cem\u003eM. tuberculosis\u003c/em\u003e added in liquefied paraffin (Kim et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). There are three stages to mycobacterium-induced edema: starts with the induction phase without any sign of synovitis, early synovitis, and late synovitis. This showed the accumulation of protein debris and extracellular fluid at the site of inflammation (Jitta et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The goal of the current study was to assess the effectiveness of Arbutin in CFA induced model of arthritis.\u003c/p\u003e \u003cp\u003eThe administration of Arbutin, (25, 50 and 100 mg/kg, oral) has significantly decreased arthritic index and paw volume in treated rats as compared to the arthritic control group. Our compound Arbutin has an inhibitory effect on TNF-α, IL-1β, IL-6, PGE2, IL-8 and COX-2, which are the markers of inflammation (Qasim et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec. Further, weight loss in treated groups was prevented through the reduction in IL-1β and expression level of TNF-α (Fu et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb. Furthermore, the standard drug piroxicam also has reduced arthritic index and paw volume and there was increased in weight of CFA induced rats. Rheumatoid cachexia developed as a result of lysosomal protease-induced muscle proteolysis, which is triggered by decreased absorption of prostaglandin-E2, 14C-glucose, and 14C-leucine in the intestines of rats (Alamgeer et al., 2017). Intestinal absorption in rats was also resolved and reduced the expression of pro-inflammatory cytokines (Ahsan et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHematological and biochemical tests in CFA-induced arthritis were conducted which show anemia in rats indicated by a decrease in the level of hemoglobin (Hb) and red blood cell (RBCs) count. Anemia may be caused by the destruction of premature reticuloendothelial cells, a decrease in erythropoietin, or a decrease in iron loading in the RES and synovial joints (Alamgeer et al., 2017). The significant increase in Hb and RBCs by Arbutin, most likely as a result of NF-κB reduced expression. Thus, it prevented the inflammatory cascade and restored the normalcy of inflammatory cell invasion in the synovial fluid (Iqubal et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Furthermore, the production of cytokines like TNF-α and IL-6 leads to an increase in platelet and white blood cells (WBCs) counts in arthritic rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). Additionally, due to the greater secretion of IL-6 and TNF-alpha, which initiates the acute phase reaction in RA, arthritic rats showed increased levels of platelets and WBCs. Despite inhibiting the production of IL-6 and TNF-α, Arbutin has reduced the number of platelets and WBCs in rats; however, this may be because of its immunomodulatory action. Arbutin has normalized inflammatory cell invasion in synovial fluid and inhibited the inflammation cascade. It also increased hemoglobin and RBCs, possibly as a result of decreased NF-κB expression (Isaacs and Iqbal, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe two major markers for the early detection of systemic polyarthritis are elevated serum ferritin and C-reactive protein (CRP). An effective method for assessing the active inflammatory process is the CRP, which is a significant predictor of systemic inflammation (Razi et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). When compared to arthritic control rats, Arbutin treatment prevented the acute phase reactions. Increased levels in ESR and CRP in arthritic control rats indicated infection in the blood, whereas rats given piroxicam and Arbutin, the levels decreased which is in line with previous study (Prakash Babu et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). A possible parameter implicated in the pathobiology of RA could be abnormal changes in the values of RF and also in CRP in serum. Initiation of immune cascade progresses arthritis by the production of factor that is RF which is directed against the Fc portion of autoantibodies. There was a noteworthy reduction in Rheumatoid factor (RF) levels among treatment groups with Arbutin. Immunoglobulin molecules like rheumatoid factor (RF) have the ability to trigger an immune response because the body perceives them as \"non-self\" (Yildirim et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Furthermore, increased bone erosion and lysosomal enzyme integrity may be the cause of the diseased control group's elevated serum ALP concentration (Chakraborty et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Rats in the disease control group showed remarkable increased levels of the RF and CRP, indicating that these had been exposed to an inflammatory stimulus following CFA vaccination. Conversely, the groups treated with piroxicam and Arbutin (100 mg/kg) showed a marked reduction (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the values of RF and C-reactive proteins as given in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Nonetheless, the ALP was markedly decreased when Arbutin at varying doses was given to the treatment groups. This also prevented the abnormal increase in SGPT and SGOT, which may have been brought on by a decrease in bone loss and an improvement in lysosome stability as given in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Renal safety of Arbutin was assessed through urea and creatinine levels in treated groups of rats (Silpavathi et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe development of arthritis is significantly influenced by proliferating macrophages, T lymphocytes, and synovial cells (Weyand et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Macrophages and stimulated T cells release proinflammatory cytokines, which contribute to the development of arthritis (Vandooren et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Immunity (T-cell mediated) triggers the release of pro-inflammatory cytokines and triggers antibody synthesis resulting in the degeneration of joints. Excessive expression of these cytokines results in apoptosis, bone loss, tissue eradication, irreversible tissue proliferation (Yang et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Accordingly, possible counteragents for the cytokines have the power to shield cells from inflammatory processes (Shin et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In the present study, Rt-qPCR was used to study the impact of Arbutin on the expression of pro-inflammatory cytokines panels (TNF-alpha, IL-6, IL-17 \u0026amp; IL-1β), inflammatory like NF-κB \u0026amp; COX-2, and anti-inflammatory gene pointers (IL-4 and IL-10). Osteoclast induction, bone erosion, and matrix metalloproteinase (MMP) production have all been related to IL-1β (Barksby et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Moreover, the article refers to endogenous MMP inhibitors as tissue inhibitors of MMPs (TIMPs). Soluble IL-6R is characterized by the induction of TIMP formation in cultured chondrocytes and synovial fibroblasts by IL-6. Extracellular matrix turnover is aided by the protective catabolic response that tissues produce (Silacci et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e1998\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMultiple studies have reported that infiltrating cells, monocytes, and macrophages secrete pro-inflammatory cytokines. Three main cytokines involved in initiation, progression and development of arthritis are TNF-α, IL-1β, and also IL-6 (Yap et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). As a result, pro-inflammatory cytokines have appeared as fascinating targets of arthritis. In our research, the administration of Arbutin to CFA-induced arthritis rats effectively decreased the TNF-α, IL-17, NF-κB, IL-6, COX-2 and also IL-1β levels which ultimately decreased proinflammatory cytokines as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The present study found that rats given Arbutin and piroxicam showed a significant reduction in COX-2 levels, whereas animals with arthritis as control showed higher levels. As a result of the reduction in COX-2 production, this implies that piroxicam and Arbutin have partially prevented the harmful effects of CFA by blocking prostaglandin synthesis. Anti-arthritic actions of Arbutin may possibly be mediated through the inhibition of arachidonic acid metabolism in line with the already reported study (Uttra et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Inflammation leads to increased release of TNF-α by phagocytes leading to leucocyte adhesion and penetration in the vascular endothelium. Additionally, TNF-α inhibits the synthesis of bone collagen mainly by causing increased bone deterioration and hyperplasia of the fibroblast (Singh et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In our present study, Arbutin possesses anti-inflammatory potential in many mediators of inflammation (TNF, COX-2, IL-1 β and IL-17) and can used to treat arthritis. The main factors in the development of arthritic decay demonstrated that TNF-α buildup magnifies the appearance of PGE-2, IL-1 β, and also IL-6 leads to hyperplasia of the synovial joint, increased enzyme devastation accretion, collagenase activation, and osteoclast disease (Alunno et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the current investigation, diseased control rats showed elevated expression of PGE-2 and COX-2; conversely, rats receiving Arbutin treatment (25, 50 and 100 mg/kg) have shown a significant decrease in PGE-2 and COX-2. Interleukin-10 alters arthritis synovitis by deactivating macrophages and suppressing the cellular defense mechanism (Bozkurt et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). As RA advances, IL-10 suppresses the immune response mediated by the Th1 and inhibits the functioning of antigen-presenting cells too, that provide protection to the integrity of the joints (Uttra et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). IL-17 has a crucial role in arthritis, affecting osteoclast genesis, granulopoiesis, and release of pro-inflammatory cytokines such as IL-1β, TNFα, IL-8, and IL-6 (Schinocca et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In arthritic control rats, Arbutin decreased the raised IL-17, IL-1β, and IL-6 levels, suggesting its anti-inflammatory and anti-arthritic efficacy. IL-6 increases bone resorption and the production of autoantibodies. These mediators cause inflammatory tissues in the synovial membrane to release collagenase (Mima and Nishimoto, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIt was reported that PGE-2 levels in CFA-induced rats were closely linked to cartilage erosion, blood vessel dilatation, joint swelling, redness and pain. Prostaglandin E synthase (PGES) produces PGE2 from COX-II. When arthritis is active, pro-inflammatory cytokines up-regulate COX-II, which results in an indirect increase in PGE-2 (Uttra et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Angiogenesis, vasodilation, fluid extravasation and vascularization in the synovial membrane mediated by the production of PGE-2, are upregulated at the injection site due to increase in COX-2 levels (Shabbir et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Increased PGE-2 expression results from an excess of pro-inflammatory cytokines. Increased PGE-2 levels spur vasodilation, bone destruction and also migration of leukocytes to the site of inflammation by speeding up osteoclast differentiation and producing degrading enzymes as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea.\u003c/p\u003e \u003cp\u003eLipoxygenases are crucial in the production of leukotrienes (B4, C4, D4, and E4), which are important in inflammatory disorders (Gheorghe et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The CFA-induced rise in PGE-2 and 5-LOX levels in arthritic rats was significantly reduced by administering Arbutin. Hence, the outcomes of the present investigation demonstrated that Arbutin caused a remarkable decrease in PGE-2 levels in rats with arthritis induced by CFA. In the current investigation, increased levels of anti-CCP were detected early on the 7th day using the CFA model followed by arthritis. The levels of Anti-CCP reduced significantly in Arbutin (25, 50 and 100 mg/kg) treated rodent groups. A decrease in Anti-CCP concentration explained the inhibition of TNF-α (El-Ashmawy et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. ROS leads to alterations in cell organelles including DNA damage, protein oxidation, inactivation of enzymes, and peroxidation of lipids (Sghaier et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Consequently, the injured joints are destroyed because superoxide anions produced during phagocytosis cause the second messenger system-dependent, NF-κB-dependent expression of the pro-inflammatory cytokines (Prakash Babu et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). These are shielded against tissue damage by reactive species by endogenous antioxidant enzymes such as catalase. The enzyme catalase contributes to the reduction of hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) in synovial tissue spaces. SOD catalyzes the conversion of superoxide to hydrogen peroxide and oxygen free radicals, which are then further catalyzed into molecules of oxygen and water by catalase enzymes. In comparison to healthy rats, the arthritic control rats showed decreased levels of anti-oxidant parameters (SOD, CAT and GSH) and raised levels of pro-oxidant marker (MDA). Arbutin has shown a potential role in mitigating the deterioration caused by free radicals. Oxidative enzymes like GSH, CAT and also SOD were overexpressed, MDA production decreased and lipid peroxidation was less prominent in rats with arthritis treated with Arbutin, indicating antioxidant activity which is given in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e3\u003c/span\u003e. \u003cem\u003eIn vitro\u003c/em\u003e free radical scavenging assay through DPPH radical, is used for assessing the antioxidant potential of Arbutin which has shown strong antioxidant properties (Baliyan et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) .\u003c/p\u003e \u003cp\u003eIn the current study, histopathological assessment showed that animal groups that received treatment with Arbutin inhibited the leukocyte migration, thereby protecting joints from joint deformity, cartilage destruction and formation of pannus as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Furthermore, radiological analysis demonstrated that, in comparison to arthritic control rats, Arbutin demonstrated a significant protective effect against the growth of secondary lesions and cartilage damage as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. As mediators in the pathophysiology of RA, free radicals and reactive oxygen species (ROS) have been supposed to cause tissue damage. Rheumatism causes various cells such as neutrophils, macrophages and dendritic cells to infiltrate the diseased articulations, and then produce ROS, which breaks through the antioxidant defense system and release more of them at the site of inflammation (Nich and Goodman, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe also analyzed appropriate poses for protein\u0026ndash;ligand interactions, the dependable method of molecular docking, which is one of the most important docking subtypes in the pharmaceutical industry is protein-ligand docking (Azam and Abbasi, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Strong interactions were indicated by the highest negative bond energy values in the docking (Herawati et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this way, the most suitable binding site for the ligand can be predicted along with the molecular interactions that are explained. Furthermore, interactions between the ligand atoms and amino acids could be identified according to their distance from one another. The objective of the current investigation was to study how Arbutin interacted with IL-17, iNOS, TNF-α, COX-2, NFκB, 5-LOX, IL-4, and IL-10. Together with pharmacological evidence supporting its anti-arthritic efficacy, Arbutin demonstrated strong binding interactions with each of these chosen targets. The \u003cem\u003ein silico\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e analysis of the present study yielded very consistent results.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe present findings of the study suggested that treatment of Arbutin led to significant reductions in paw volume, body weight recovery, normalization of altered biochemical and hematological parameters, and inhibition of the level of mRNA expression of the aforementioned cytokines in arthritic rats. Thus, the anti-arthritic effect of Arbutin showed its ability to raise levels of IL-4 and interleukin-10, and by decreasing IL-17 as well as antioxidant enzyme activity of SOD, GSH and CAT by decreasing levels of NF-κB, COX-2, 5-LOX, TNF-α, IL-1β, and also IL-6. Because of the numerous anti-arthritic qualities that Arbutin possesses, it is therefore, reasonable to conclude, based on these observations, that it is a potent anti-arthritic agent. Computational docking analysis has also supported our current findings. To gain a better understanding of the mechanism underlying Arbutin having anti-arthritic properties and perhaps help develop more potent treatment approaches for rheumatoid arthritis, more thorough mechanistic research should be carried out in the future.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they did not receive any funds, grants or other resources in the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supervised and designed by AM. Data collection, material preparation and experiments were performed by NTS. UI facilitated for performing rt-PCR, ELISA and compilation of results. While, \u003cem\u003eIn-Silico\u003c/em\u003e studies were interpreted by FM. Data analysis was done by NTS and AM. Manuscript drafted by NTS and AM. \u0026nbsp;The final manuscript was read and approved by all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors express their gratitude to the University of Sargodha, Sargodha, Pakistan\u0026apos;s College of Pharmacy (Post Graduate Pharmacology Lab.) for the technical facilities provided.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data in this study mentioned above is transparent.\u003c/p\u003e\n\u003cp\u003eThe authors declare, that there are no known competing financial interests or personal connections that could have appeared to influence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAhmadian, S. R., Ghasemi-Kasman, M., Pouramir, M., \u0026amp; Sadeghi, F. (2019). Arbutin attenuates cognitive impairment and inflammatory response in pentylenetetrazol-induced kindling model of epilepsy. \u003cem\u003eNeuropharmacology\u003c/em\u003e, 146, 117-127.\u003c/li\u003e\n\u003cli\u003eAhsan, H., Irfan, H. M., Alamgeer, Shahzad, M., Asim, M. H., Akram, M., et al. (2021). Anti-rheumatic activity of pseudoephedrine (a substituted phenethylamine) in complete Freund\u0026rsquo;s adjuvant-induced arthritic rats by down regulating IL-1\u0026beta;, IL-6 and TNF-\u0026alpha; as well as upregulating IL-4 and IL-10. \u003cem\u003eInflammopharmacology\u003c/em\u003e, 29, 673-682.\u003c/li\u003e\n\u003cli\u003eAkhter, S., Irfan, H. M., Alamgeer, Jahan, S., Shahzad, M., \u0026amp; Latif, M. B. (2022). Nerolidol: a potential approach in rheumatoid arthritis through reduction of TNF-\u0026alpha;, IL-1\u0026beta;, IL-6, NF-kB, COX-2 and antioxidant effect in CFA-induced arthritic model. \u003cem\u003eInflammopharmacology\u003c/em\u003e, 30(2), 537-548.\u003c/li\u003e\n\u003cli\u003eAlamgeer, Niazi, S. G., Uttra, A. M., Qaiser, M. N., \u0026amp; Ahsan, H. (2017). Appraisal of anti-arthritic and nephroprotective potential of Cuscuta reflexa. \u003cem\u003ePharmaceutical biology\u003c/em\u003e, 55(1), 792-798.\u003c/li\u003e\n\u003cli\u003eAlunno, A., Carubbi, F., Giacomelli, R., \u0026amp; Gerli, R. (2017). Cytokines in the pathogenesis of rheumatoid arthritis: new players and therapeutic targets. \u003cem\u003eBMC rheumatology\u003c/em\u003e, 1(1), 1-13.\u003c/li\u003e\n\u003cli\u003eArya, V., Gupta, V. K., \u0026amp; Kaur, R. (2011). A review on plants having anti-arthritic potential. \u003cem\u003eInt J Pharm Sci Rev Res\u003c/em\u003e, 7(2), 131-136.\u003c/li\u003e\n\u003cli\u003eAzam, S. S., \u0026amp; Abbasi, S. W. (2013). Molecular docking studies for the identification of novel melatoninergic inhibitors for acetylserotonin-O-methyltransferase using different docking routines. \u003cem\u003eTheoretical Biology and Medical Modelling\u003c/em\u003e, 10(1), 1-16.\u003c/li\u003e\n\u003cli\u003eBaliyan, S., Mukherjee, R., Priyadarshini, A., Vibhuti, A., Gupta, A., Pandey, R. P., et al. (2022). Determination of antioxidants by DPPH radical scavenging activity and quantitative phytochemical analysis of Ficus religiosa. 27(4), 1326.\u003c/li\u003e\n\u003cli\u003eBarksby, H., Lea, S., Preshaw, P., \u0026amp; Taylor, J. (2007). The expanding family of interleukin-1 cytokines and their role in destructive inflammatory disorders. \u003cem\u003eClinical \u0026amp; Experimental Immunology\u003c/em\u003e, 149(2), 217-225.\u003c/li\u003e\n\u003cli\u003eBozkurt, F. Y., Ay, Z. Y., Berker, E., Tepe, E., \u0026amp; Akkuş, S. (2006). Anti-inflammatory cytokines in gingival crevicular fluid in patients with periodontitis and rheumatoid arthritis: a preliminary report. \u003cem\u003eCytokine\u003c/em\u003e, 35(3-4), 180-185.\u003c/li\u003e\n\u003cli\u003eChakraborty, M., Bhattacharya, S., Bhattacharjee, P., Das, R., \u0026amp; Mishra, R. (2010). Prevention of the progression of adjuvant induced arthritis by oral supplementation of Indian fresh water mussel (Lamellidens marginalis) aqueous extract in experimental rats. \u003cem\u003eJournal of ethnopharmacology\u003c/em\u003e, 132(1), 316-320.\u003c/li\u003e\n\u003cli\u003eEl-Ashmawy, N. E., Khedr, E. G., Shamloula, M. M., Kamel, M. M. J. E. B., \u0026amp; Medicine (2019). Evaluation of the antirheumatic effects of isoflavone-free soy protein isolate and etanercept in rats with adjuvant-induced arthritis. 244(7), 545-553.\u003c/li\u003e\n\u003cli\u003eFu, Q., Wang, L., Li, L., Li, Y., Liu, R., \u0026amp; Zheng, Y. J. C. r. (2019). Risk factors for progression and prognosis of rheumatoid arthritis\u0026ndash;associated interstitial lung disease: single center study with a large sample of Chinese population. 38, 1109-1116.\u003c/li\u003e\n\u003cli\u003eGheorghe, K. R., Korotkova, M., Catrina, A. I., Backman, L., Af Klint, E., Claesson, H.-E., et al. (2009). Expression of 5-lipoxygenase and 15-lipoxygenase in rheumatoid arthritis synovium and effects of intraarticular glucocorticoids. 11, 1-11.\u003c/li\u003e\n\u003cli\u003eGohil, P., Patel, V., Deshpande, S., Chorawala, M., \u0026amp; Shah, G. (2018). Anti-arthritic activity of cell wall content of Lactobacillus plantarum in freund\u0026rsquo;s adjuvant-induced arthritic rats: involvement of cellular inflammatory mediators and other biomarkers. \u003cem\u003eInflammopharmacology\u003c/em\u003e, 26, 171-181.\u003c/li\u003e\n\u003cli\u003eGul, B., Anwar, R., Saleem, M., Noor, A., \u0026amp; Ullah, M. I. (2023). C assia absus-mediated upregulation of IL-4, IL-10 and downregulation of IL-1\u0026beta;, IL-6, TNF-\u0026alpha;, NF-\u0026kappa;B, IFN-\u0026gamma; in CFA-induced arthritis model. \u003cem\u003eInflammopharmacology\u003c/em\u003e, 31(3), 1241-1256.\u003c/li\u003e\n\u003cli\u003eHerawati, H., Oktanella, Y., \u0026amp; Anisa, A. (2021). Molecular docking analysis of curcuminoids from curcuma longa extract on inos as an immunomodulator candidate in broilers. \u003cem\u003eAdv Anim Vet Sci\u003c/em\u003e, 9(4), 519-524.\u003c/li\u003e\n\u003cli\u003eIqubal, A., Sharma, S., Ansari, M. A., Najmi, A. K., Syed, M. A., Ali, J., et al. (2019). Nerolidol attenuates cyclophosphamide-induced cardiac inflammation, apoptosis and fibrosis in Swiss Albino mice. \u003cem\u003eEuropean Journal of Pharmacology\u003c/em\u003e, 863, 172666.\u003c/li\u003e\n\u003cli\u003eIsaacs, J. D., \u0026amp; Iqbal, K. J. C. T. (2019). Potential pharmacologic targets for the prevention of rheumatoid arthritis. 41(7), 1312-1322.\u003c/li\u003e\n\u003cli\u003eJitta, S. R., Daram, P., Gourishetti, K., Misra, C. S., Polu, P. R., Shah, A., et al. (2019). \u0026lt;i\u0026gt;Terminalia tomentosa \u0026lt;/i\u0026gt;Bark Ameliorates Inflammation and Arthritis in Carrageenan Induced Inflammatory Model and Freund\u0026rsquo;s Adjuvant-Induced Arthritis Model in Rats. \u003cem\u003eJournal of Toxicology\u003c/em\u003e, 2019, 7898914. doi:10.1155/2019/7898914.\u003c/li\u003e\n\u003cli\u003eKhan, Y. H., Qasim, S., Uttra, A. M., Alotaibi, N. H., Alanazi, A. S., Alzarea, A. I., et al. (2023). Enalapril attenuated CFA provoked arthritic manifestation by modulating proinflammatory and anti-inflammatory cytokine network. \u003cem\u003eLife Sciences\u003c/em\u003e, 324, 121742.\u003c/li\u003e\n\u003cli\u003eKim, W., Park, S., Choi, C., Kim, Y. R., Park, I., Seo, C., et al. (2016). Evaluation of anti-inflammatory potential of the new ganghwaljetongyeum on adjuvant-induced inflammatory arthritis in rats. \u003cem\u003eEvidence-Based Complementary and Alternative Medicine\u003c/em\u003e, 2016.\u003c/li\u003e\n\u003cli\u003eKrieger, E., \u0026amp; Vriend, G. (2014). YASARA View\u0026mdash;molecular graphics for all devices\u0026mdash;from smartphones to workstations. \u003cem\u003eBioinformatics\u003c/em\u003e, 30(20), 2981-2982.\u003c/li\u003e\n\u003cli\u003eLee, H.-J., \u0026amp; Kim, K.-W. (2012). Anti-inflammatory effects of arbutin in lipopolysaccharide-stimulated BV2 microglial cells. \u003cem\u003eInflammation Research\u003c/em\u003e, 61, 817-825.\u003c/li\u003e\n\u003cli\u003eLin, N.-Y., Beyer, C., Gie\u0026szlig;l, A., Kireva, T., Scholtysek, C., Uderhardt, S., et al. (2013). Autophagy regulates TNF\u0026alpha;-mediated joint destruction in experimental arthritis. \u003cem\u003eAnnals of the rheumatic diseases\u003c/em\u003e, 72(5), 761-768.\u003c/li\u003e\n\u003cli\u003eLin, Y.-J., Anzaghe, M., \u0026amp; Sch\u0026uuml;lke, S. (2020). Update on the pathomechanism, diagnosis, and treatment options for rheumatoid arthritis. \u003cem\u003eCells\u003c/em\u003e, 9(4), 880.\u003c/li\u003e\n\u003cli\u003eLiu, X., Zou, Q., Zeng, B., Fang, Y., \u0026amp; Wei, H. (2013). Analysis of fecal Lactobacillus community structure in patients with early rheumatoid arthritis. \u003cem\u003eCurrent microbiology\u003c/em\u003e, 67, 170-176.\u003c/li\u003e\n\u003cli\u003eMcInnes, I. B., \u0026amp; Schett, G. (2007). Cytokines in the pathogenesis of rheumatoid arthritis. \u003cem\u003eNature Reviews Immunology\u003c/em\u003e, 7(6), 429-442.\u003c/li\u003e\n\u003cli\u003eMima, T., \u0026amp; Nishimoto, N. J. C. o. i. r. (2009). Clinical value of blocking IL-6 receptor. 21(3), 224-230.\u003c/li\u003e\n\u003cli\u003eNaseem, Z., Zahid, M., Hanif, M. A., \u0026amp; Shahid, M. (2020). Environmentally friendly extraction of bioactive compounds from Mentha arvensis using deep eutectic solvent as green extraction media. \u003cem\u003ePolish Journal of Environmental Studies\u003c/em\u003e, 29(5), 3749-3757.\u003c/li\u003e\n\u003cli\u003eNawaz, S., Irfan, H. M., Akram, M., \u0026amp; Jahan, S. (2023). Linalool: Monoterpene alcohol effectiveness in chronic synovitis through lowering Interleukin-17, spleen and thymus indices. \u003cem\u003eInternational Immunopharmacology\u003c/em\u003e, 121, 110517.\u003c/li\u003e\n\u003cli\u003eNich, C., \u0026amp; Goodman, S. B. (2014). Role of macrophages in the biological reaction to wear debris from joint replacements. \u003cem\u003eJournal of long-term effects of medical implants\u003c/em\u003e, 24(4).\u003c/li\u003e\n\u003cli\u003ePrakash Babu, N., Saravanan, S., Pandikumar, P., Bala Krishna, K., Karunai Raj, M., \u0026amp; Ignacimuthu, S. (2014). Anti-inflammatory and anti-arthritic effects of 3-hydroxy, 2-methoxy sodium butanoate from the leaves of Clerodendrum phlomidis Lf. \u003cem\u003eInflammation research\u003c/em\u003e, 63, 127-138.\u003c/li\u003e\n\u003cli\u003eQasim, S., Alamgeer, Kalsoom, S., Shahzad, M., Bukhari, I. A., Vohra, F., et al. (2021). Rosuvastatin attenuates rheumatoid arthritis-associated manifestations via modulation of the pro-and anti-inflammatory cytokine network: a combination of in vitro and in vivo studies. \u003cem\u003eACS omega\u003c/em\u003e, 6(3), 2074-2084.\u003c/li\u003e\n\u003cli\u003eQasim, S., Khan, Y. H., Uttra, A. M., Alotaibi, N. H., Alanazi, A. S., Alzarea, A. I., et al. (2023). Appraisal of anti-inflammatory and immunomodulatory potential of ramipril against Freund\u0026rsquo;s adjuvant-provoked arthritic rat model. 1-11.\u003c/li\u003e\n\u003cli\u003eRadu, A.-F., \u0026amp; Bungau, S. G. (2021). Management of rheumatoid arthritis: an overview. \u003cem\u003eCells\u003c/em\u003e, 10(11), 2857.\u003c/li\u003e\n\u003cli\u003eRazi, E., Ehteram, H., Akbari, H., Chavoshi, V., \u0026amp; Razi, A. (2012). Evaluation of high-sensitivity C-reactive protein in acute asthma. \u003cem\u003eTanaffos\u003c/em\u003e, 11(1), 32.\u003c/li\u003e\n\u003cli\u003eRen, X., Zhang, M., Chen, L., Zhang, W., Huang, Y., Luo, H., et al. (2017). The anti-inflammatory effects of Yunnan Baiyao are involved in regulation of the phospholipase A2/arachidonic acid metabolites pathways in acute inflammation rat model. \u003cem\u003eMolecular Medicine Reports\u003c/em\u003e, 16(4), 4045-4053.\u003c/li\u003e\n\u003cli\u003eSaleem, A., Saleem, M., Akhtar, M. F., Shahzad, M., \u0026amp; Jahan, S. (2020). Polystichum braunii extracts inhibit Complete Freund\u0026rsquo;s adjuvant-induced arthritis via upregulation of I-\u0026kappa;B, IL-4, and IL-10, downregulation of COX-2, PGE2, IL-1\u0026beta;, IL-6, NF-\u0026kappa;B, and TNF-\u0026alpha;, and subsiding oxidative stress. \u003cem\u003eInflammopharmacology\u003c/em\u003e, 28, 1633-1648.\u003c/li\u003e\n\u003cli\u003eSaleem, M., Iftikhar, A., Asif, M., Hussain, K., Alamgeer, Shah, P. A., et al. (2021). Asphodelus tenuifolius extracts arrested inflammation and arthritis through modulation of TNF-\u0026alpha;, NF-\u0026kappa;B, ILs, and COX-2 activities in in vivo models. \u003cem\u003eInflammopharmacology\u003c/em\u003e, 29, 483-497.\u003c/li\u003e\n\u003cli\u003eSchinocca, C., Rizzo, C., Fasano, S., Grasso, G., La Barbera, L., Ciccia, F., et al. (2021). Role of the IL-23/IL-17 pathway in rheumatic diseases: an overview. 12, 637829.\u003c/li\u003e\n\u003cli\u003eSghaier, M. B., Skandrani, I., Nasr, N., Franca, M.-G. D., Chekir-Ghedira, L., \u0026amp; Ghedira, K. (2011). Flavonoids and sesquiterpenes from Tecurium ramosissimum promote antiproliferation of human cancer cells and enhance antioxidant activity: A structure\u0026ndash;activity relationship study. \u003cem\u003eEnvironmental toxicology and pharmacology\u003c/em\u003e, 32(3), 336-348.\u003c/li\u003e\n\u003cli\u003eShabbir, A., Shahzad, M., Ali, A., \u0026amp; Zia-ur-Rehman, M. (2016). Discovery of new benzothiazine derivative as modulator of pro-and anti-inflammatory cytokines in rheumatoid arthritis. \u003cem\u003eInflammation\u003c/em\u003e, 39, 1918-1929.\u003c/li\u003e\n\u003cli\u003eShahid Chatha, S., Hussain, A., Asad, R., Majeed, M., \u0026amp; Aslam, N. (2014). Bioactive components and antioxidant properties of Terminalia arjuna L. \u003cem\u003eExtracts. J Food Process Technol\u003c/em\u003e, 5(298), 2.\u003c/li\u003e\n\u003cli\u003eShin, T.-H., Kim, H.-S., Kang, T.-W., Lee, B.-C., Lee, H.-Y., Kim, Y.-J., et al. (2016). Human umbilical cord blood-stem cells direct macrophage polarization and block inflammasome activation to alleviate rheumatoid arthritis. \u003cem\u003eCell death \u0026amp; disease\u003c/em\u003e, 7(12), e2524-e2524.\u003c/li\u003e\n\u003cli\u003eSilacci, P., Dayer, J.-M., Desgeorges, A., Peter, R., Manueddu, C., \u0026amp; Guerne, P.-A. (1998). Interleukin (IL)-6 and its soluble receptor induce TIMP-1 expression in synoviocytes and chondrocytes, and block IL-1-induced collagenolytic activity. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, 273(22), 13625-13629.\u003c/li\u003e\n\u003cli\u003eSilpavathi, L., Das, M. K., \u0026amp; Das, D. (2023). Anti-arthritic potentials of aqueous and methanolic leaf extracts of Ardisia solanacea on complete Freund\u0026rsquo;s adjuvant induced rheumatoid arthritis in rats. \u003cem\u003eAdvances in Traditional Medicine\u003c/em\u003e, 23(1), 111-119.\u003c/li\u003e\n\u003cli\u003eSingh, S., Karwasra, R., Nayak, D., Khurana, A. K., \u0026amp; Manchanda, R. K. (2021). Amelioration of experimental rheumatoid arthritis by selected ultra-diluted preparations by down regulating increased expression of TNF-\u0026alpha; \u0026amp; IL-6.\u003c/li\u003e\n\u003cli\u003eUttra, A. M., Shahzad, M., Shabbir, A., \u0026amp; Jahan, S. (2018). Ephedra gerardiana aqueous ethanolic extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley rats by downregulating PGE2, COX2, IL-1\u0026beta;, IL-6, TNF-\u0026alpha;, NF-kB and upregulating IL-4 and IL-10. \u003cem\u003eJournal of ethnopharmacology\u003c/em\u003e, 224, 482-496.\u003c/li\u003e\n\u003cli\u003eUttra, A. M., Shahzad, M., Shabbir, A., Jahan, S., Bukhari, I. A., \u0026amp; Assiri, A. M. (2019). Ribes orientale: A novel therapeutic approach targeting rheumatoid arthritis with reference to pro-inflammatory cytokines, inflammatory enzymes and anti-inflammatory cytokines. \u003cem\u003eJournal of ethnopharmacology\u003c/em\u003e, 237, 92-107.\u003c/li\u003e\n\u003cli\u003eVandooren, B., Noordenbos, T., Ambarus, C., Krausz, S., Cantaert, T., Yeremenko, N., et al. (2009). Absence of a classically activated macrophage cytokine signature in peripheral spondylarthritis, including psoriatic arthritis. \u003cem\u003eArthritis \u0026amp; Rheumatism: Official Journal of the American College of Rheumatology\u003c/em\u003e, 60(4), 966-975.\u003c/li\u003e\n\u003cli\u003eWeyand, C. M., Bryl, E., \u0026amp; Goronzy, J. J. (2001). The role of T cells in rheumatoid arthritis. \u003cem\u003eAutoimmunity\u003c/em\u003e, 183-195.\u003c/li\u003e\n\u003cli\u003eYang, X., Yang, J., \u0026amp; Zou, H. (2013). Baicalin inhibits IL-17-mediated joint inflammation in murine adjuvant-induced arthritis. \u003cem\u003eClinical and Developmental Immunology\u003c/em\u003e, 2013.\u003c/li\u003e\n\u003cli\u003eYap, H.-Y., Tee, S. Z.-Y., Wong, M. M.-T., Chow, S.-K., Peh, S.-C., \u0026amp; Teow, S.-Y. (2018). Pathogenic role of immune cells in rheumatoid arthritis: implications in clinical treatment and biomarker development. \u003cem\u003eCells\u003c/em\u003e, 7(10), 161.\u003c/li\u003e\n\u003cli\u003eYildirim, K., Karatay, S., Melikoglu, M. A., Gureser, G., Ugur, M., \u0026amp; Senel, K. (2004). Associations between acute phase reactant levels and disease activity score (DAS28) in patients with rheumatoid arthritis. \u003cem\u003eAnnals of clinical \u0026amp; laboratory science\u003c/em\u003e, 34(4), 423-426.\u003c/li\u003e\n\u003cli\u003eZhang, Y., Li, M., Liu, Z., \u0026amp; Fu, Q. (2021). Arbutin ameliorates glucocorticoid-induced osteoporosis through activating autophagy in osteoblasts. \u003cem\u003eExperimental Biology and Medicine\u003c/em\u003e, 246(14), 1650-1659.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"inflammopharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"iphm","sideBox":"Learn more about [Inflammopharmacology](https://www.springer.com/journal/10787)","snPcode":"10787","submissionUrl":"https://submission.nature.com/new-submission/10787/3","title":"Inflammopharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Arbutin, inflammation, CFA, Arthritis, COX-2, Molecular docking","lastPublishedDoi":"10.21203/rs.3.rs-3664612/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3664612/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eArbutin, a naturally soluble glycosylated phenol has anti-oxidant, antimicrobial, anti-tumor and anti-inflammatory properties. The current exploration appraises the treatment of arthritis by use of Arbutin (25, 50 and 100 mg/kg) orally in CFA-induced rat Arthritis model. Body weight changes, paw size, and joint diameter were recorded till the 28th day in the arthritic-induced rats. Hematological, biochemical, oxidative and inflammatory biomarkers were measured through the blood samples of anesthetized rats. Arbutin markedly decreased paw volume, PGE-2, anti-CCP and 5-LOX levels, however, maintained metabolic and hematological balance and prevented weight loss. Radiology and histology changes improved significantly in the ankle joints of rats. Moreover, Arbutin increased gene pointers such as IL-10 and IL-4 while significantly reducing the levels of CRP and WBCs, whereas, Hb, Platelets and RBCs count markedly raised in post-treatments. Antioxidant levels of SOD, CAT and GSH were improved and MDA level was reduced in treated groups. Rt-PCR investigation showed a significant reduction of the interleukin-1β, TNF-α, interleukin-6, Cycloxygenase-2, NF-κB and IL-17 and increased expression of gene pointers like IL-4, and IL-10 in treated groups. Assessment of molecular docking revealed a strong binding interaction of Arbutin against 5-LOX, IL-17, TNF-alpha and interleukin-6, Cycloxygenase-2, nuclear factor-κB, IL-4 and iNOS providing a strong association between experimental and theoretical results. As a result, Arbutin has significantly reduced CFA-induced arthritis by modulation of anti-inflammatory cytokines i.e., IL-10 and IL-4, the pro-inflammatory cytokines panel like NF-κB, TNF-alpha, IL-1β, IL-6, PGE-2, 5-LOX and COX-2 and oxidative biomarkers.\u003c/p\u003e","manuscriptTitle":"Arbutin attenuates CFA-induced Arthritis by modulating expression levels of 5- LOX, NF-κB, IL-17, PGE-2 and TNF-α","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-12-13 20:22:51","doi":"10.21203/rs.3.rs-3664612/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvited","content":"Inflammopharmacology","date":"2024-03-09T14:52:44+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-01-18T07:14:33+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-12-11T13:35:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-12-09T17:17:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Inflammopharmacology","date":"2023-12-09T05:57:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"inflammopharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"iphm","sideBox":"Learn more about [Inflammopharmacology](https://www.springer.com/journal/10787)","snPcode":"10787","submissionUrl":"https://submission.nature.com/new-submission/10787/3","title":"Inflammopharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"bb08d71d-13d8-4dd9-b1e4-30d98fe05f95","owner":[],"postedDate":"December 13th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-04-15T12:05:25+00:00","versionOfRecord":[],"versionCreatedAt":"2023-12-13 20:22:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3664612","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3664612","identity":"rs-3664612","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-05T02:00:03.366016+00:00
License: CC-BY-4.0