Immunohistochemistry and molecular detection of Helicobacter pylori infection and their virulent genes in gastric biopsies from Pakistan

Immunohistochemistry and molecular detection of Helicobacter pylori infection and their virulent genes in gastric biopsies from Pakistan | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Immunohistochemistry and molecular detection of Helicobacter pylori infection and their virulent genes in gastric biopsies from Pakistan Abdullah Riaz, Zeeshan Taj, Dalal Sulaiman Alshaya, Muhammad Saqalein, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4378571/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract An infection with Helicobacter pylori can lead to chronic gastritis, which, if not treated, can cause serious gastroduodenal diseases such as gastric mucosa-associated lymphoid tissue lymphoma, gastric cancer, and peptic ulcer. H. pylori infection usually occurs during childhood, and if left untreated, it can persist throughout a person's lifetime. The main objective of this study was to determine the occurrence of H. pylori infections and the presence of virulence genes such as vacA and cagA. Additionally, the study aimed to investigate the connection between virulence factors and gastroduodenal issues in patients. Several virulence factors play a crucial role in the development of diseases associated with H. pylori. A total of 1038 gastric biopsy specimens were collected from the patient with a history of gastritis in 10% normal saline aseptically. Tissue size was measured, and gross examined, which were processed in an automated tissue processor. After processing, the embedding of tissues was done in paraffin wax. 2–3 µm sections were prepared using a rotary microtome. Hematoxylin and eosin staining and immunohistochemistry were performed. DNA was extracted from the tissue of H. pylori and their virulence factors (cagA and vacA) through PCR. Of 1038 biopsies, 374 (28.5%) were H. pylori infections confirmed by hematoxylin and eosin stain and immunohistochemistry. The mean age was 39.5 (± 15.1) years, and the male-to-female ratio was 1:0.9. The majority of the gastric samples (260; 69.5%) were taken from the antrum, followed by the antrum and body (68; 18.1%), the gastric mucosa (26; 7.0%), and the body (10; 2.6%). The colonisation of H. pylori was classified into three levels: mild (270; 72.2%), moderate (64; 17.1%), and severe (40; 10.7%). Among the antrum, mild active gastritis (n = 78; 30%), and mild chronic active gastritis (n = 60; 23.1%), while in the antrum and body samples, 28 (41.1%) were mild active gastritis. 16S rDNA in biopsy samples of H. pylori isolates. Additionally, in mild gastric colonisation, cagA (103; 27.9%) and vacA (143; 38.2%), and in moderate colonisation, 27 (7.2%) and 24 (6.4%) of the cagA and vacA were identified. There was a high prevalence of H. pylori infection in gastric biopsies with mild colonization, and isolates carried the virulence genes. H. pylori gastric biopsies cagA vacA Immunohistochemistry Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Nearly half of the world's population has Helicobacter pylori (also known as H. pylori ) infection, which affects around 4.4 billion people. In industrialized nations, the prevalence rate is 20–40%, but in developing nations, it can reach 90% [ 1 ]. The prevalence of H. pylori infection in children has been declining over the years, as a result of better sanitation and socioeconomic situations [ 2 ]. However, between 2014 and 2020, it was still found to be 34% worldwide. Most H. pylori infections are acquired during infancy and remain indefinitely, which is why older people tend to have a higher frequency of infection compared to children [ 3 ]. These are the primary cause of chronic gastritis and can potentially result in serious gastroduodenal conditions in certain individuals, such as gastric and duodenal peptic ulcer disease (PUD), gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT) lymphoma and if left untreated, the infection can be passed from one generation of children to the next [ 4 ]. Chronic gastritis can manifest itself in various ways depending on the severity of the inflammation in different parts of the stomach. These different phenotypes are classified as antral-predominant, corpus-predominant, or pangastritis [ 5 ]. The most likely mode of transmission is through contaminated water, particularly in underdeveloped nations, while oral-oral transmission is also possible [ 6 ]. It is estimated that around 10% of those infected with H. pylori will experience peptic ulcer disease (PUD) in their lifetime [ 7 ]. The risk of getting PUD increases to over 11% after 10 years for infected individuals, whereas it is only 1% for healthy individuals [ 8 ]. The diseases associated with H. pylori infection are a result of complex interactions between bacterial virulence, host genetics, and environmental factors [ 9 ]. Two important markers of virulence are vacuolating cytotoxin gene A ( vac A) and cytotoxin-associated gene A ( cag A), which have been the focus of extensive research [ 10 ]. The vac A toxin regulates the immune system and can cause gastric cancer. On the other hand, cag A is characterized as the first bacterial oncoprotein and is likely the most crucial virulence component of H. pylori [ 11 ]. Moreover, the cag A and vac A genes have been linked to gastrointestinal disorders in Pakistan [ 12 ]. Therefore, the purpose of this study was to examine H. pylori in stomach biopsies collected from the people of Pakistan by Hemotoxyline and Eosin stain (H&E), immunohistochemistry (IHC) and molecular detection of associated virulence genes ( vac A and cag A). Materials & Methods Ethical consideration The Ethical Review Committee (ERB) at the Government College University Faisalabad approved the study before it began as per the Declaration of Helsinki involving human subjects. It outlines principles for research ethics, including informed consent, confidentiality of the data, minimize harm and maximize benefits to participants and ethical review by independent ethics committees. Human ethics and informed consent from every participant in the study provided before clinical samples were collected. To obtain informed consent, the relevant information was explained to the participants in a language that they could understand. Each participant willingly gave a specimen for examination and permission for the isolates collected to be used in the study. Ensuring that individuals fully understand the nature, purpose, risks, and potential benefits of participating in research and voluntarily agree to participate without coercion or undue influence. Informed consent declarations typically include detailed information about the research study, such as its objectives, procedures, potential risks and benefits, confidentiality measures, and participants' rights. Furthermore, participants were assured that their private information would be kept confidential and that the samples they provided would only be used for research purposes. Collection of clinical samples We collected a total of 1,308 stomach samples from several clinical diagnostic institutions located in Lahore and Faisalabad. We used a sterile approach to collect the samples suspected to be associated with gastritis, including the stomach body, antrum, and gastric mucosa. The study aimed to gather endoscopic stomach samples that showed varying degrees of chronic inflammation, such as mild, moderate, or severe. Only the pieces measuring 2.0 mm or larger were considered, whereas the smaller fragments (less than 2.0 mm) and samples that had undergone autolysis were eliminated. After collection, the samples were carefully stored in a 10% formalin solution at a diagnostic clinic and sent to the histopathology lab for further processing. Isolation and confirmation of the isolates The tissue samples of each individual under suspicion were subjected to a macroscopic inspection to identify and choose the appropriate part of the tissue for subsequent tissue processing, microscopic analysis and molecular analysis. Tissue Processing The tissues were processed using the automated tissue processor Tissue-Tek VIP 6 AI Vacuum Infiltration Process (Sakura®, Japan). The process had four stages: dehydration, clearing, infiltration, and embedding. The temperature was set to 37°C, and the procedure was conducted under fluctuating pressure conditions, followed by overnight vacuuming. Tissue embedding was performed using paraffin wax in the Tissue-Tek TEC 5 Tissue Embedding Console System (Sakura®, Germany) following the method described by [ 13 ]. Microtomy The embedded tissues were sectioned into sections measuring 1 to 13µ using the Leica RM2125 RTS (Leica Biosystem, Germany). The thin tissue slices were immersed in a warm water bath to eliminate any creases. Subsequently, the slices were carefully transferred onto glass microscope slides and subjected to a drying process in a warm oven. Haematoxylin and Eosin staining Hematoxylin and Eosin (H&E) stains were applied to the tissue samples utilizing the Tissue-Tek system (Sakura®, Germany). DPX media was used to mount the stained slides, which were then covered with a thin glass coverslip. The resulting slides were carefully inspected under an Olympus CX31 microscope with 40x magnification. Immunohistochemistry of H. pylori A histological section measuring 4µm in thickness was carefully prepared and fixed onto silane-coated slides (Muto Pure Chemical, Tokyo, Japan). The sections underwent deparaffinization and rehydration processes and were then subject to antigen retrieval utilizing a 10 mM citrate buffer (pH 6.0) at 99°C for 1 hour through a PT Link system (Agilen DAKO, Denmark). To inhibit endogenous enzymes, a peroxidase-blocking reagent (DAKO Kit, Glostrup, Denmark) was employed. Pre-diluted DAKO-pAb was used for incubation with the sections at room temperature in a humidified chamber for 30 minutes. A secondary biotinylated horse antibody was then applied, specifically recognizing primary rabbit IgG (DAKO Kit, Glostrup, Denmark). To visualize the combination formed between the antibody and antigen, the DAB chromogen from Biocare Medical in Pacheco, California, USA was utilized. Hematoxylin counterstaining was conducted using the AutoStainer-Link 48 instrument manufactured by Dako, Denmark, to visualize the nuclei and overall tissue architecture. The tissue sections were affixed using a DPX mounting medium. The resulting slides were analyzed using a compound microscope (CX 31 Olympus) at a magnification of 40X. Interpretation of the gastric biopsies was performed by the infiltration of gastric mucosa by mononuclear cells and polymorphonuclear leukocytes, atrophy, and intestinal metaplasia (IM) is graded as follows: 0 for no presence, 1 for slight presence, 2 for moderate presence, and 3 for significant presence. Chronic inflammation is characterized by the elevated presence of lymphocytes and plasma cells in the lamina propria, classified as mild, moderate, or marked based on their density. Chronic active gastritis is characterized by persistent inflammation in the lamina propria, pits, or surface epithelium, with the presence of neutrophilic polymorph infiltration. The severity of inflammation is classified as follows: 0 for no inflammation, mild for ≤ 1/3 of pits and surface infiltrated, moderate for 1/3 to 2/3 infiltrated, and marked for ≥ 2/3 infiltrated. Atrophy is characterized as the depletion of natural glandular tissue, either with or without substitution by intestinal-type epithelium. Lymphoid aggregates are clusters of lymphocytes and plasma cells lacking a germinal centre. Bacterial Genomic DNA extraction Initially, tissue sections were treated with xylene (Sigma-Aldrich™) for the removal of paraffin followed by proteinase K-based tissue digestion. Finally, samples were subjected to an alkaline lysis technique for the extraction of bacterial genomic DNA [ 14 ]. 16S r DNA : Molecular-based confirmation of H. pylori was done using species-specific primers HPR-F GCGACCTGCTGGAACATTAC and HPR-R CGTTAGCTGCATTACTGGAGA in PCR. DNA Amplicon was sent to Macrogen™, Korea for DNA sequencing. Molecular detection of cagA and vacA gene Molecular identification of cagA and vacA was done using specific primers; cagA1 -F GGTCAAAATGCGGTCATGG and cagA1 -R TTAGAATAATCAACAAACATCACGCCAT, cagA2 -F AATACACCAACGCCTCCAAG and cagA2 -R TTGTTGCCGCTTGCTCTC vacAm2 -F GGAGCCCCAGGAAACATTG and vacAm2 -R CATAACTAGCGCCTTGCAC by following conditions; initial denaturation: 95 o C for 3 min, secondary denaturation: 95 o C for 30s, annealing: 55 o C for 30s, primary extension: 72 o C for 30s and final extension: 72 o C for 10 min. Amplicons were separated on ethidium bromide-stained 1.5% agarose gel using gel electrophoresis (Bio-Rad, UK) and DNA bands were visualized under UV light using the Gel Documentation system. Sequencing of amplicons DNA was separated from agarose gel using FavorPrep™ GEL/PCR Purification Kit [ 15 ]. The quantification of purified DNA samples was performed spectrophotometrically using Nanodrop (Titertek Berthold™). A 30ng/µl amplified DNA sample was sent to Macrogen™ Korea for di-deoxy Sanger Sequencing. The obtained sequences of DNA were studied using various online bioinformatics tools of NCBI's BLAST program. Results Clinical information of the patients According to the biopsy analysis of 1,308 samples, 374 (28.5%) showed positive results for H. pylori infection, while the remaining 934 (71.4%) tested negative. The age range of patients with positive cases was between 13 to 73 years, with a mean age of 39.5 (± 15.1) years. For negative cases, the age range was 12 to 85 years, with a mean age of 40.5% (± 15.7) years. The male-to-female ratio was 1:0.9. Most of the biopsy samples were collected from the antrum (260; 69.5%), while a combination of antrum and body (72; 19.2%), gastric mucosa (28; 7.4%), and body alone (10; 2.6%) samples were also collected. However, most of the negative results came from 614 (65.7%) samples obtained from the antrum, 214 (22.9%) samples from both the antrum and body and 52 (5.5%) samples from the body alone (Table 1 ). Table 1 Clinical history of the patients H. pylori -positive (n = 374; 28.5%) H. pylori -negative (n = 934; 71.4%) p -value n % n % Age (Years) Range 13–73 12–85 Mean (± SD) 39.5 (± 15.1) 40.5 (± 15.7) 0.285 Gender Male 190 50.8 500 53.5 0.37 Female 184 49.2 434 46.5 Male to female ratio 1:0.9 1:0.8 Source of samples Antrum 260 69.5 614 65.7 0.21 Antrum and body 72 19.2 214 22.9 0.16 Stomach body 10 2.6 52 5.5 0.04 Gastric mucosa 28 7.4 46 4.9 0.09 Prepyloric 2 0.5 2 0.2 0.69 Pylorus 2 0.5 4 0.4 0.9 Antrum, body and duodenum 0 0 2 0.2 - Age and gender base distribution of samples From the 1308 biopsy samples obtained, 690 (52.7%) were from male patients and 618 (47.2%) were from female patients. There were no cases of H. pylori infection detected in children under the age of 10. Among the male patients, 130 (18.8%) were aged between > 40-≤50 years, 126 (18.2%) were between > 30-≤40 years, 122 (17.6%) were between > 20-≤30 years, and 94 (13.6%) were between > 50-≤60 years. However, there were 10 individuals (1.4%) aged between > 70-≤80 years, and 11 individuals (1.6%) aged over 80 years. Out of the total female population, 29.7% (184 out of 618) samples were obtained from the groups aged between 20-≤30 years and > 30-≤40 years. Additionally, 15.6% (108 samples) were obtained from the > 40-≤50 years age group and 13.9% (86 samples) were obtained from the > 50-≤60 years age group. However, 22 individuals (3.5%) aged between > 70-≤80 years, and 16 individuals (2.6%) aged over 80 years were observed (Fig. 1 ). Histological confirmation of H. pylori by H&E and IHC In this investigation, 1308 biopsy samples were collected and out of those, 374 (28.6%) were found to be positive for H. Pylori through H&E and IHC staining. The majority of the gastric samples (260; 69.5%) were taken from the antrum, followed by the antrum and body (68; 18.1%), the gastric mucosa (26; 7.0%), and the body (10; 2.6%). The colonisation of H. pylori was classified into three levels: mild (270; 72.2%), moderate (64; 17.1%), and severe (40; 10.7%). Among antrum (n = 260; 69.5%), H. pylori were primarily found in mild active gastritis (78; 30%), mild chronic active gastritis (60; 23.1%), and moderate active gastritis (36; 13.8%). In the antrum and body (68; 18.1%), mild chronic active gastritis (28; 41.1%), mild active gastritis (10; 14.7%) and moderate chronic active gastritis (10; 14.7%). However, among body samples (10; 2.6%), mild chronic active gastritis was 4 (40%). Among the gastric mucosa (n = 26, 7.0%), unremarkable gastric mucosa in 12 (46.1%) in severe colonization (Table 2 and Fig. 2 A&B, Fig. 3 A&B, Fig. 4 A&B, Fig. 5 ). Molecular detection of cag A and vacA of H. pylori The presence of 16S r DNA in biopsy samples confirmed that 374 (36%) H. pylori isolates were present (Figure S1). Additionally, virulence genes such as cag A and vac A were identified (Figure S2). For mild gastric colonisation, 103 (27.9%) and 143 (38.2%) of the cag A and vac A virulence genes were found, respectively. In moderate colonisation, 27 (7.2%) and 24 (6.4%) of the cagA and vac A were identified, while in severe colonisation, 17 (4.5%) and 22 (5.9%) of the cagA and vac A were detected. Moreover, 62 (16.5%) of the cag A and vac A co-existed in moderate colonisation, and 7 (1.9%) of each virulent genes co-existed in severe colonisation (Table 3 ). Table 3 Coexisted of cagA and vacA virulent genes of H. pylori in gastric biopsies H . pylori colonization n % cagA vacA Mild colonization 103 27.9 + - Moderate colonization 27 7.2 + - Sever colonization 17 4.5 + - Mild colonization 143 38.2 - + Moderate colonization 24 6.4 - + Sever colonization 22 5.9 - + Mild colonization 62 16.5 + + Moderate colonisation 7 1.9 + + Sever colonisation 7 1.9 + + Discussion H. pylori is becoming a serious public health concern particularly to cause gastric cancer [ 16 ]. It continues to be a major threat to human and environmental health worldwide, even in developed countries [ 17 ]. Historically, these illnesses have been linked to high rates of illness and death, particularly in countries with low per capita incomes and large populations living in poverty [ 18 ]. To effectively treat gastrointestinal issues, it is crucial to accurately diagnose H. pylori infection. Among the various procedures developed, the most precise way to diagnose H. pylori is through direct detection of the bacteria in the stomach mucosa [ 19 ]. In this study total of 1038 biopsies were collected from the antrum, antrum & and body, gastric, and body followed by pylorus. In the present study, we have observed that out of 1308 biopsy samples, most of the gastric biopsies from the male patients were 690 (52.7%) compared to females. In the male patients, most of them 130 (18.8%) were collected from the age between > 40-≤50 years and 126 (18.2%) were between > 30-≤40 years. However, in females, 184 (29.7%) samples were from the age group between 20-≤30 years and > 30-≤40 years. A study conducted in Norway they have found a low prevalence of H. pylori infection in children (0.6%) and a high of 20%-45% in adolescent age [ 20 ]. Recently a 10 years comprehensive study on atrophic gastritis caused by H. pylori infection in different age groups revealed that most of the infection was present in male patients compared to females however most of the gastritis cases were found in > 80 years followed by 70years and 6o years while lowest prevalence was observed in children. According to documented evidence, retrospective cohort research found that spontaneous clearance occurred in 9 out of 58 children, which accounts for 15.5% of the total, over a 20-year follow-up period [ 21 ]. However, several global published studies reported that the frequency of H. pylori infection among adults has decreased significantly over the years, dropping from 50–55% in 2014 to 43% in 2020. This reduction can mostly be attributed to the improvement in sanitation, income, and living conditions. Additionally, the increased use of antibiotics, particularly in eradication therapy for infected individuals, might have contributed to the decrease in cases [ 2 , 22 – 25 ]. In the present study out of all the gastric samples collected, 69.5% of them were from the antrum, while 18.1% were from antrum and body samples. The degree of H. Pylori colonisation was mild in 72.2% of the cases, moderate in 17.1%, and severe in 10.7%. A study from Iran determined the correlation of H. pylori with colonisation they revealed that 203 (37.32%) had mild gastritis, 278 (10.51%) moderate, and 16 (2.94%) severe. Mild H. pylori colonization rates had the highest mild activity (33.52%), whereas severe colonization rates had the most severe activity (43.75%). 93.96% of severe H. pylori colonization patients had moderate and severe chronic gastritis [ 26 ]. However, Another study from Tunisia found that 43% of patients exhibited mild H. pylori colonization, 47% moderate, and 9% severe colonization [ 27 ]. Gastric cancer is most strongly correlated with long-term infection with Helicobacter pylori cag A-positive strains [ 28 ]. Further, H. pylori releases a toxic substance called vacA, which can induce various effects on human cells [ 29 ]. In this study, the prevalence of cag A (27.9%) and vacA (38.2%) in H. pylori was predominantly observed in cases of mild gastric colonization. Out of the total colonization, 27 (7.2%) and 24 (6.4%) were found to be cag A and vac A, in moderate colonization respectively. A study conducted in Pakistan found that the vacA gene was present in 54.5% of the cases, while the cag A gene was positive in 24.2% of the cases [ 12 ]. A study in Iran found that 79% of H. pylori samples were positive for cag A. Additionally, the most common combination of vacA alleles was observed in 63 cases of H. pylori isolates [ 30 ]. Out of 192 clinical H.pylori strains identified in a study conducted in China, cagA was detected in all cases of gastric illnesses, representing 87% of the strains [ 31 ]. Further, there are several studies reported from other parts of the world including Japan [ 32 ], Vietnam [ 33 ], Algeria [ 34 ], and Thailand [ 35 ]. Conclusion This study concluded the high prevalence of H. pylori infection in the Pakitani dyspeptic population through H&E and IHC techniques. Further, our analysis shows that vac A and cag A were the most common viluent genes typically associated with mild moderate and severe gastritis. On the other hand, patients with vac A and cag A genes also displayed gastritis. The advanced molecular approaches have become reliable tools for characterizing virulent strains of H. pylori due to their growing sensitivity and specificity. To predict the severity of a disease, it is necessary to identify the environmental and host factors along with the bacterial characteristics. Declarations Funding declaration : Researchers Supporting Project number (PNURSP2024R465) Author Contribution A.R. Z.T, M.S and D.S.A. wrote the main manuscript. K.J, A.A, S.M, Z.T, M.U.Q, methdology, D.A, K.A.A, T.A.S, M.U.Q reviewed the manuscripr, funding, conceptulisation and proof reading. All authors reviewed the manuscript." Acknowledgement Deanship of Scientific Research at Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R465), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. Data availability declaration : All data supporting the findings of this study are available within the paper and its supplementary information. References Khoder G, Muhammad JS, Mahmoud I, Soliman SSM, Burucoa C. Prevalence of Helicobacter pylori and Its Associated Factors among Healthy Asymptomatic Residents in the United Arab Emirates. Pathogens 2019, 8(2). Park JS, Jun JS, Seo JH, Youn HS, Rhee KH. Changing prevalence of Helicobacter pylori infection in children and adolescents. Clin experimental Pediatr. 2021;64(1):21–5. Borka Balas R, Meliț LE, Mărginean CO. Worldwide Prevalence and Risk Factors of Helicobacter pylori Infection in Children. Child (Basel) 2022, 9(9). Malfertheiner P, Camargo MC, El-Omar E, Liou J-M, Peek R, Schulz C, Smith SI, Suerbaum S. Helicobacter pylori infection. Nat Reviews Disease Primers. 2023;9(1):19. Watari J, Chen N, Amenta PS, Fukui H, Oshima T, Tomita T, Miwa H, Lim KJ, Das KM. Helicobacter pylori associated chronic gastritis, clinical syndromes, precancerous lesions, and pathogenesis of gastric cancer development. World J Gastroenterol. 2014;20(18):5461–73. Aziz RK, Khalifa MM, Sharaf RR. Contaminated water as a source of Helicobacter pylori infection: A review. J Adv Res. 2015;6(4):539–47. Narayanan M, Reddy KM, Marsicano E. Peptic Ulcer Disease and Helicobacter pylori infection. Mo Med. 2018;115(3):219–24. Xie X, Ren K, Zhou Z, Dang C, Zhang H. The global, regional and national burden of peptic ulcer disease from 1990 to 2019: a population-based study. BMC Gastroenterol. 2022;22(1):58. Baj J, Forma A, Sitarz M, Portincasa P, Garruti G, Krasowska D, Maciejewski R. Helicobacter pylori Virulence Factors-Mechanisms of Bacterial Pathogenicity in the Gastric Microenvironment. Cells 2020, 10(1). Idowu A, Mzukwa A, Harrison U, Palamides P, Haas R, Mbao M, Mamdoo R, Bolon J, Jolaiya T, Smith S, et al. Detection of Helicobacter pylori and its virulence genes (cagA, dupA, and vacA) among patients with gastroduodenal diseases in Chris Hani Baragwanath Academic Hospital, South Africa. BMC Gastroenterol. 2019;19(1):73. Ansari S, Yamaoka Y. Helicobacter pylori Virulence Factors Exploiting Gastric Colonization and its Pathogenicity. Toxins (Basel) 2019, 11(11). Ahmad T, Sohail K, Rizwan M, Mukhtar M, Bilal R, Khanum A. Prevalence of Helicobacter pylori pathogenicity-associated cagA and vacA genotypes among Pakistani dyspeptic patients. FEMS Immunol Med Microbiol. 2009;55(1):34–8. Chen Y-J, Yang C-M, Huang J-S, Wang P, Lv Y-H, Tang C, Deng W. An introduction of an easy-operating and economical technique for tissue microarray preparation. J Clin Pathol. 2020;73(7):403–7. Nocera AL, Mueller SK, Workman AD, Wu D, McDonnell K, Sadow PM, Amiji MM, Bleier BS. Cystatin SN is a potent upstream initiator of epithelial-derived type 2 inflammation in chronic rhinosinusitis. J Allergy Clin Immunol. 2022;150(4):872–81. Utthiya S, Wonnapinij P, Napaumpaiporn P, Kittiwongwattana C, Sakulkoo J, Suttangkakul A, Vuttipongchaikij S. Gel purification of gDNA for next-generation sequencing applications. Biotechniques. 2022;73(2):99–103. Reyes VE. Helicobacter pylori and Its Role in Gastric Cancer. Microorganisms 2023, 11(5). Öztekin M, Yılmaz B, Ağagündüz D, Capasso R. Overview of Helicobacter pylori Infection: Clinical Features, Treatment, and Nutritional Aspects. Dis (Basel Switzerland) 2021, 9(4). Khalifa MM, Sharaf RR, Aziz RK. Helicobacter pylori: a poor man's gut pathogen? Gut pathogens. 2010;2(1):2. Talebi Bezmin Abadi A. Diagnosis of Helicobacter pylori Using Invasive and Noninvasive Approaches. J Pathog. 2018;2018:9064952. Breckan RK, Paulssen EJ, Asfeldt AM, Kvamme J-M, Straume B, Florholmen J. The All-Age Prevalence of Helicobacter pylori Infection and Potential Transmission Routes. A Population-Based Study. Helicobacter. 2016;21(6):586–95. Malaty HM, El-Kasabany A, Graham DY, Miller CC, Reddy SG, Srinivasan SR, Yamaoka Y, Berenson GS. Age at acquisition of Helicobacter pylori infection: a follow-up study from infancy to adulthood. Lancet. 2002;359(9310):931–5. Hooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, Malfertheiner P, Graham DY, Wong VWS, Wu JCY, et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology. 2017;153(2):420–9. Liou JM, Malfertheiner P, Lee YC, Sheu BS, Sugano K, Cheng HC, Yeoh KG, Hsu PI, Goh KL, Mahachai V, et al. Screening and eradication of Helicobacter pylori for gastric cancer prevention: the Taipei global consensus. Gut. 2020;69(12):2093–112. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, Sibley RK. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med. 1991;325(16):1127–31. Eusebi LH, Zagari RM, Bazzoli F. Epidemiology of Helicobacter pylori infection. Helicobacter. 2014;19(Suppl 1):1–5. Ghasemi Basir HR, Ghobakhlou M, Akbari P, Dehghan A, Seif Rabiei MA. Correlation between the Intensity of Helicobacter pylori Colonization and Severity of Gastritis. Gastroenterol Res Pract 2017, 2017:8320496. Souissi S, Makni C, Belhadj Ammar L, Bousnina O, Kallel L. Correlation between the intensity of Helicobacter pylori colonization and severity of gastritis: Results of a prospective study. Helicobacter. 2022;27(4):e12910. Park JY, Forman D, Waskito LA, Yamaoka Y, Crabtree JE. Epidemiology of Helicobacter pylori and CagA-Positive Infections and Global Variations in Gastric Cancer. Toxins. 2018;10(4):163. Necchi V, Sommi P, Vanoli A, Fiocca R, Ricci V, Solcia E. Natural history of Helicobacter pylori VacA toxin in human gastric epithelium in vivo: vacuoles and beyond. Sci Rep. 2017;7(1):14526. Ghotaslou R, Milani M, Akhi MT, Nahaei MR, Hasani A, Hejazi MS, Meshkini M. Diversity of Helicobacter Pylori cagA and vacA Genes and Its Relationship with Clinical Outcomes in Azerbaijan, Iran. Adv Pharm Bull. 2013;3(1):57–62. Qiao W, Hu JL, Xiao B, Wu KC, Peng DR, Atherton JC, Xue H. cagA and vacA genotype of Helicobacter pylori associated with gastric diseases in Xi'an area. World J Gastroenterol. 2003;9(8):1762–6. Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, Yamazaki Y, Keida Y, Higashi H, Hatakeyama M, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol. 2005;43(8):3906–16. Phan TN, Santona A, Tran VH, Tran TNH, Le VA, Cappuccinelli P, Rubino S, Paglietti B. Genotyping of Helicobacter pylori shows high diversity of strains circulating in central Vietnam. Infect Genet Evol. 2017;52:19–25. Bachir M, Allem R, Tifrit A, Medjekane M, Drici AE-M, Diaf M, Douidi KT. Primary antibiotic resistance and its relationship with cagA and vacA genes in Helicobacter pylori isolates from Algerian patients. Brazilian J Microbiol. 2018;49(3):544–51. Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, Tor-Udom S, Vilaichone R-K. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12(1):30–6. Tables Table 2 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files table2.docx FigureS1S2.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4378571","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":307676707,"identity":"81635021-2e20-400d-bc80-4baa5645d961","order_by":0,"name":"Abdullah Riaz","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Abdullah","middleName":"","lastName":"Riaz","suffix":""},{"id":307676708,"identity":"bafdfeeb-030e-41d8-9654-2f4750c5c2bf","order_by":1,"name":"Zeeshan Taj","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Zeeshan","middleName":"","lastName":"Taj","suffix":""},{"id":307676709,"identity":"24db1938-eaf7-44e3-abd1-ff84f3eab57d","order_by":2,"name":"Dalal Sulaiman Alshaya","email":"","orcid":"","institution":"Department of Biology, College of Science, Princess Nourah bint Abdulrahman University","correspondingAuthor":false,"prefix":"","firstName":"Dalal","middleName":"Sulaiman","lastName":"Alshaya","suffix":""},{"id":307676710,"identity":"a8e56d27-2540-4622-8ebc-aed771154ed1","order_by":3,"name":"Muhammad Saqalein","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Saqalein","suffix":""},{"id":307676711,"identity":"9d3c9f8b-cbf2-43ac-9d2f-8d34bd08ed28","order_by":4,"name":"Diego Andrey","email":"","orcid":"","institution":"University of Geneva","correspondingAuthor":false,"prefix":"","firstName":"Diego","middleName":"","lastName":"Andrey","suffix":""},{"id":307676712,"identity":"cee750fd-f9fd-4d10-9e4c-352689ab6d56","order_by":5,"name":"Kokab Jabeen","email":"","orcid":"","institution":"Department of Pathology Ameer ud Din Medical College Lahore, Lahore, Pakistan","correspondingAuthor":false,"prefix":"","firstName":"Kokab","middleName":"","lastName":"Jabeen","suffix":""},{"id":307676713,"identity":"bf5b9742-7e1a-45cb-96f0-5c896373c774","order_by":6,"name":"Atifa Ambreen","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Atifa","middleName":"","lastName":"Ambreen","suffix":""},{"id":307676714,"identity":"a455a146-1c7e-4962-99f5-9698db2e53a2","order_by":7,"name":"Sana Mustafa","email":"","orcid":"","institution":"Lahore General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Sana","middleName":"","lastName":"Mustafa","suffix":""},{"id":307676715,"identity":"ca35f9f9-d211-4c37-8aae-db0901f40c07","order_by":8,"name":"Zainab Tufail","email":"","orcid":"","institution":"Lahore General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zainab","middleName":"","lastName":"Tufail","suffix":""},{"id":307676716,"identity":"b02c71e2-5a2a-4d65-b0aa-4b9b8b6c5cba","order_by":9,"name":"Tawaf Ali Shah","email":"","orcid":"","institution":"Shandong University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Tawaf","middleName":"Ali","lastName":"Shah","suffix":""},{"id":307676717,"identity":"39021f3e-21d4-4d95-8815-d01e0bbf8b80","order_by":10,"name":"Kotab A. Attia","email":"","orcid":"","institution":"Center of Excellence in Biotechnology Research, King Saud University.","correspondingAuthor":false,"prefix":"","firstName":"Kotab","middleName":"A.","lastName":"Attia","suffix":""},{"id":307676718,"identity":"d6d56ca5-6577-4bce-80c0-3434b803ff21","order_by":11,"name":"Muhammad Usman Qamar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYJADxgdAgh+IDYA4gSgtzCClkg2kaGGTIEqL7oz0pxt+7rCW120/+6zyS81hCQb25m0SjDvScGoxu5FjdrP3TLrhtjPpZrdljgG18Bwrk2A8k4NPC9sN3rbDjNsOpLHdlmw4XMcgkWMmwdhWgUdL+rObf9sO2287/4ytGKhFgkH+DSEtCWa3gbYkbruRxsb4EaRFggekBY/Dzrwxuy3blp687cYzZmmGY+kSbDxpxRaJZ/B4/zjQYW/brG23nU9j/PijxlqCn/3wxhsfdyTj1AIFzBCSB0iwgViJDYR0QLUw/oDxGQlrGQWjYBSMgpEDAPQ3WE0lVrE9AAAAAElFTkSuQmCC","orcid":"","institution":"Government College University","correspondingAuthor":true,"prefix":"","firstName":"Muhammad","middleName":"Usman","lastName":"Qamar","suffix":""}],"badges":[],"createdAt":"2024-05-06 18:03:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4378571/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4378571/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57873848,"identity":"1f2b727e-b56a-4313-894e-93599f2973ee","added_by":"auto","created_at":"2024-06-06 18:42:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":228670,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAge and gender-wise distribution of clinical samples\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/723a0bea28d50e19e8e14f46.png"},{"id":57875009,"identity":"2e9429d6-c969-4566-ba54-c1fed90aaa69","added_by":"auto","created_at":"2024-06-06 18:50:23","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":238071,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA is the normal gastric mucosa in the H\u0026amp;E stain and 2B is the normal gstaric mucosa in IHC.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/b9a7bfa644db673cc51fc21b.jpeg"},{"id":57872802,"identity":"5176709f-22db-4164-9e4a-3c5a35b2a457","added_by":"auto","created_at":"2024-06-06 18:34:23","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":293437,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA is the mild colonisatio of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eH. pylori \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein the H\u0026amp;E stain, and Figure 2B is the mild colonization in IHC.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/fdef390a8cef7386eaccbd13.jpeg"},{"id":57872803,"identity":"6a62708b-cae4-49d6-8e62-8ae03ef28f57","added_by":"auto","created_at":"2024-06-06 18:34:23","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":213471,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA is the moderate colonization of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eH. pylori \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein the H\u0026amp;E stain, and Figure 3B is the moderate colonization in IHC\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/a17aca43527905c23a751a10.jpeg"},{"id":57872798,"identity":"36a6594f-695f-4283-b150-74fdd950388a","added_by":"auto","created_at":"2024-06-06 18:34:23","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":94801,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eshows the sever colonization of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eH. pylori\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in IHC\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/9fb1a4b0395928f41c607f73.jpeg"},{"id":76528352,"identity":"7b26ed19-cf71-434e-94bb-dd9f516285f5","added_by":"auto","created_at":"2025-02-18 06:17:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2023405,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/f4a13f23-5dec-41ca-93af-ac1f3de73579.pdf"},{"id":57872796,"identity":"098618ae-17f4-45e5-b49a-426a223b29e0","added_by":"auto","created_at":"2024-06-06 18:34:23","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17991,"visible":true,"origin":"","legend":"","description":"","filename":"table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/0eb9e69816d1888488e44192.docx"},{"id":57872800,"identity":"d599abd0-34ad-41b0-a5ab-38427acdd9c4","added_by":"auto","created_at":"2024-06-06 18:34:23","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":92365,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1S2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4378571/v1/06642a6ac8df7588054c6539.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Immunohistochemistry and molecular detection of Helicobacter pylori infection and their virulent genes in gastric biopsies from Pakistan","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNearly half of the world's population has \u003cem\u003eHelicobacter pylori\u003c/em\u003e (also known as \u003cem\u003eH. pylori\u003c/em\u003e) infection, which affects around 4.4\u0026nbsp;billion people. In industrialized nations, the prevalence rate is 20\u0026ndash;40%, but in developing nations, it can reach 90% [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The prevalence of \u003cem\u003eH. pylori\u003c/em\u003e infection in children has been declining over the years, as a result of better sanitation and socioeconomic situations [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, between 2014 and 2020, it was still found to be 34% worldwide. Most H. pylori infections are acquired during infancy and remain indefinitely, which is why older people tend to have a higher frequency of infection compared to children [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. These are the primary cause of chronic gastritis and can potentially result in serious gastroduodenal conditions in certain individuals, such as gastric and duodenal peptic ulcer disease (PUD), gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT) lymphoma and if left untreated, the infection can be passed from one generation of children to the next [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Chronic gastritis can manifest itself in various ways depending on the severity of the inflammation in different parts of the stomach. These different phenotypes are classified as antral-predominant, corpus-predominant, or pangastritis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The most likely mode of transmission is through contaminated water, particularly in underdeveloped nations, while oral-oral transmission is also possible [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. It is estimated that around 10% of those infected with H. pylori will experience peptic ulcer disease (PUD) in their lifetime [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The risk of getting PUD increases to over 11% after 10 years for infected individuals, whereas it is only 1% for healthy individuals [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The diseases associated with \u003cem\u003eH. pylori\u003c/em\u003e infection are a result of complex interactions between bacterial virulence, host genetics, and environmental factors [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Two important markers of virulence are vacuolating cytotoxin gene A (\u003cem\u003evac\u003c/em\u003eA) and cytotoxin-associated gene A (\u003cem\u003ecag\u003c/em\u003eA), which have been the focus of extensive research [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The \u003cem\u003evac\u003c/em\u003eA toxin regulates the immune system and can cause gastric cancer. On the other hand, \u003cem\u003ecag\u003c/em\u003eA is characterized as the first bacterial oncoprotein and is likely the most crucial virulence component of H. pylori [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Moreover, the \u003cem\u003ecag\u003c/em\u003eA and \u003cem\u003evac\u003c/em\u003eA genes have been linked to gastrointestinal disorders in Pakistan [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Therefore, the purpose of this study was to examine \u003cem\u003eH. pylori\u003c/em\u003e in stomach biopsies collected from the people of Pakistan by Hemotoxyline and Eosin stain (H\u0026amp;E), immunohistochemistry (IHC) and molecular detection of associated virulence genes (\u003cem\u003evac\u003c/em\u003eA and \u003cem\u003ecag\u003c/em\u003eA).\u003c/p\u003e"},{"header":"Materials \u0026 Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthical consideration\u003c/h2\u003e \u003cp\u003e The Ethical Review Committee (ERB) at the Government College University Faisalabad approved the study before it began as per the Declaration of Helsinki involving human subjects. It outlines principles for research ethics, including informed consent, confidentiality of the data, minimize harm and maximize benefits to participants and ethical review by independent ethics committees. Human ethics and informed consent from every participant in the study provided before clinical samples were collected. To obtain informed consent, the relevant information was explained to the participants in a language that they could understand. Each participant willingly gave a specimen for examination and permission for the isolates collected to be used in the study. Ensuring that individuals fully understand the nature, purpose, risks, and potential benefits of participating in research and voluntarily agree to participate without coercion or undue influence. Informed consent declarations typically include detailed information about the research study, such as its objectives, procedures, potential risks and benefits, confidentiality measures, and participants' rights. Furthermore, participants were assured that their private information would be kept confidential and that the samples they provided would only be used for research purposes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCollection of clinical samples\u003c/h2\u003e \u003cp\u003eWe collected a total of 1,308 stomach samples from several clinical diagnostic institutions located in Lahore and Faisalabad. We used a sterile approach to collect the samples suspected to be associated with gastritis, including the stomach body, antrum, and gastric mucosa. The study aimed to gather endoscopic stomach samples that showed varying degrees of chronic inflammation, such as mild, moderate, or severe. Only the pieces measuring 2.0 mm or larger were considered, whereas the smaller fragments (less than 2.0 mm) and samples that had undergone autolysis were eliminated. After collection, the samples were carefully stored in a 10% formalin solution at a diagnostic clinic and sent to the histopathology lab for further processing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and confirmation of the isolates\u003c/h2\u003e \u003cp\u003eThe tissue samples of each individual under suspicion were subjected to a macroscopic inspection to identify and choose the appropriate part of the tissue for subsequent tissue processing, microscopic analysis and molecular analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTissue Processing\u003c/h2\u003e \u003cp\u003eThe tissues were processed using the automated tissue processor Tissue-Tek VIP 6 AI Vacuum Infiltration Process (Sakura\u0026reg;, Japan). The process had four stages: dehydration, clearing, infiltration, and embedding. The temperature was set to 37\u0026deg;C, and the procedure was conducted under fluctuating pressure conditions, followed by overnight vacuuming. Tissue embedding was performed using paraffin wax in the Tissue-Tek TEC 5 Tissue Embedding Console System (Sakura\u0026reg;, Germany) following the method described by [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMicrotomy\u003c/h2\u003e \u003cp\u003eThe embedded tissues were sectioned into sections measuring 1 to 13\u0026micro; using the Leica RM2125 RTS (Leica Biosystem, Germany). The thin tissue slices were immersed in a warm water bath to eliminate any creases. Subsequently, the slices were carefully transferred onto glass microscope slides and subjected to a drying process in a warm oven.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHaematoxylin and Eosin staining\u003c/h2\u003e \u003cp\u003eHematoxylin and Eosin (H\u0026amp;E) stains were applied to the tissue samples utilizing the Tissue-Tek system (Sakura\u0026reg;, Germany). DPX media was used to mount the stained slides, which were then covered with a thin glass coverslip. The resulting slides were carefully inspected under an Olympus CX31 microscope with 40x magnification.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunohistochemistry of\u003c/b\u003e \u003cb\u003eH. pylori\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA histological section measuring 4\u0026micro;m in thickness was carefully prepared and fixed onto silane-coated slides (Muto Pure Chemical, Tokyo, Japan). The sections underwent deparaffinization and rehydration processes and were then subject to antigen retrieval utilizing a 10 mM citrate buffer (pH 6.0) at 99\u0026deg;C for 1 hour through a PT Link system (Agilen DAKO, Denmark). To inhibit endogenous enzymes, a peroxidase-blocking reagent (DAKO Kit, Glostrup, Denmark) was employed. Pre-diluted DAKO-pAb was used for incubation with the sections at room temperature in a humidified chamber for 30 minutes. A secondary biotinylated horse antibody was then applied, specifically recognizing primary rabbit IgG (DAKO Kit, Glostrup, Denmark). To visualize the combination formed between the antibody and antigen, the DAB chromogen from Biocare Medical in Pacheco, California, USA was utilized. Hematoxylin counterstaining was conducted using the AutoStainer-Link 48 instrument manufactured by Dako, Denmark, to visualize the nuclei and overall tissue architecture. The tissue sections were affixed using a DPX mounting medium. The resulting slides were analyzed using a compound microscope (CX 31 Olympus) at a magnification of 40X.\u003c/p\u003e \u003cp\u003eInterpretation of the gastric biopsies was performed by the infiltration of gastric mucosa by mononuclear cells and polymorphonuclear leukocytes, atrophy, and intestinal metaplasia (IM) is graded as follows: 0 for no presence, 1 for slight presence, 2 for moderate presence, and 3 for significant presence. Chronic inflammation is characterized by the elevated presence of lymphocytes and plasma cells in the lamina propria, classified as mild, moderate, or marked based on their density. Chronic active gastritis is characterized by persistent inflammation in the lamina propria, pits, or surface epithelium, with the presence of neutrophilic polymorph infiltration. The severity of inflammation is classified as follows: 0 for no inflammation, mild for \u0026le;\u0026thinsp;1/3 of pits and surface infiltrated, moderate for 1/3 to 2/3 infiltrated, and marked for \u0026ge;\u0026thinsp;2/3 infiltrated. Atrophy is characterized as the depletion of natural glandular tissue, either with or without substitution by intestinal-type epithelium. Lymphoid aggregates are clusters of lymphocytes and plasma cells lacking a germinal centre.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eBacterial Genomic DNA extraction\u003c/h2\u003e \u003cp\u003eInitially, tissue sections were treated with xylene (Sigma-Aldrich\u0026trade;) for the removal of paraffin followed by proteinase K-based tissue digestion. Finally, samples were subjected to an alkaline lysis technique for the extraction of bacterial genomic DNA [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003e16S\u003c/b\u003e \u003cb\u003er\u003c/b\u003e\u003cb\u003eDNA\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eMolecular-based confirmation of \u003cem\u003eH. pylori\u003c/em\u003e was done using species-specific primers HPR-F GCGACCTGCTGGAACATTAC and HPR-R CGTTAGCTGCATTACTGGAGA in PCR. DNA Amplicon was sent to Macrogen\u0026trade;, Korea for DNA sequencing.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular detection of\u003c/b\u003e \u003cb\u003ecagA\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003evacA\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMolecular identification of \u003cem\u003ecagA\u003c/em\u003e and \u003cem\u003evacA\u003c/em\u003e was done using specific primers; \u003cem\u003ecagA1\u003c/em\u003e-F GGTCAAAATGCGGTCATGG and \u003cem\u003ecagA1\u003c/em\u003e-R TTAGAATAATCAACAAACATCACGCCAT, \u003cem\u003ecagA2\u003c/em\u003e-F AATACACCAACGCCTCCAAG and \u003cem\u003ecagA2\u003c/em\u003e-R TTGTTGCCGCTTGCTCTC \u003cem\u003evacAm2\u003c/em\u003e-F GGAGCCCCAGGAAACATTG and \u003cem\u003evacAm2\u003c/em\u003e-R CATAACTAGCGCCTTGCAC by following conditions; initial denaturation: 95\u003csup\u003eo\u003c/sup\u003eC for 3 min, secondary denaturation: 95\u003csup\u003eo\u003c/sup\u003eC for 30s, annealing: 55\u003csup\u003eo\u003c/sup\u003eC for 30s, primary extension: 72\u003csup\u003eo\u003c/sup\u003eC for 30s and final extension: 72\u003csup\u003eo\u003c/sup\u003eC for 10 min. Amplicons were separated on ethidium bromide-stained 1.5% agarose gel using gel electrophoresis (Bio-Rad, UK) and DNA bands were visualized under UV light using the Gel Documentation system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eSequencing of amplicons\u003c/h2\u003e \u003cp\u003eDNA was separated from agarose gel using FavorPrep\u0026trade; GEL/PCR Purification Kit [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The quantification of purified DNA samples was performed spectrophotometrically using Nanodrop (Titertek Berthold\u0026trade;). A 30ng/\u0026micro;l amplified DNA sample was sent to Macrogen\u0026trade; Korea for di-deoxy Sanger Sequencing. The obtained sequences of DNA were studied using various online bioinformatics tools of NCBI's BLAST program.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eClinical information of the patients\u003c/h2\u003e\n\u003cp\u003eAccording to the biopsy analysis of 1,308 samples, 374 (28.5%) showed positive results for \u003cem\u003eH. pylori\u003c/em\u003e infection, while the remaining 934 (71.4%) tested negative. The age range of patients with positive cases was between 13 to 73 years, with a mean age of 39.5 (\u0026plusmn;\u0026thinsp;15.1) years. For negative cases, the age range was 12 to 85 years, with a mean age of 40.5% (\u0026plusmn;\u0026thinsp;15.7) years. The male-to-female ratio was 1:0.9. Most of the biopsy samples were collected from the antrum (260; 69.5%), while a combination of antrum and body (72; 19.2%), gastric mucosa (28; 7.4%), and body alone (10; 2.6%) samples were also collected. However, most of the negative results came from 614 (65.7%) samples obtained from the antrum, 214 (22.9%) samples from both the antrum and body and 52 (5.5%) samples from the body alone (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eClinical history of the patients\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eH. pylori\u003c/em\u003e-positive (n\u0026thinsp;=\u0026thinsp;374; 28.5%)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eH. pylori\u003c/em\u003e-negative (n\u0026thinsp;=\u0026thinsp;934; 71.4%)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003en\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003en\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e%\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\" align=\"left\"\u003e\n\u003cp\u003eAge (Years)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRange\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13\u0026ndash;73\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e12\u0026ndash;85\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMean (\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e39.5 (\u0026plusmn;\u0026thinsp;15.1)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e40.5 (\u0026plusmn;\u0026thinsp;15.7)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.285\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\" align=\"left\"\u003e\n\u003cp\u003eGender\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMale\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e190\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e50.8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e500\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e53.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.37\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFemale\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e184\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e49.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e434\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e46.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMale to female ratio\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1:0.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1:0.8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\" align=\"left\"\u003e\n\u003cp\u003eSource of samples\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAntrum\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e260\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e69.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e614\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e65.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.21\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAntrum and body\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e72\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e214\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e22.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.16\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eStomach body\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e52\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.04\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGastric mucosa\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e28\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e46\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.09\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePrepyloric\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.69\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePylorus\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.9\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAntrum, body and duodenum\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003eAge and gender base distribution of samples\u003c/h2\u003e\n\u003cp\u003eFrom the 1308 biopsy samples obtained, 690 (52.7%) were from male patients and 618 (47.2%) were from female patients. There were no cases of \u003cem\u003eH. pylori\u003c/em\u003e infection detected in children under the age of 10. Among the male patients, 130 (18.8%) were aged between \u0026gt;\u0026thinsp;40-\u0026le;50 years, 126 (18.2%) were between \u0026gt;\u0026thinsp;30-\u0026le;40 years, 122 (17.6%) were between \u0026gt;\u0026thinsp;20-\u0026le;30 years, and 94 (13.6%) were between \u0026gt;\u0026thinsp;50-\u0026le;60 years. However, there were 10 individuals (1.4%) aged between \u0026gt;\u0026thinsp;70-\u0026le;80 years, and 11 individuals (1.6%) aged over 80 years. Out of the total female population, 29.7% (184 out of 618) samples were obtained from the groups aged between 20-\u0026le;30 years and \u0026gt;\u0026thinsp;30-\u0026le;40 years. Additionally, 15.6% (108 samples) were obtained from the \u0026gt;\u0026thinsp;40-\u0026le;50 years age group and 13.9% (86 samples) were obtained from the \u0026gt;\u0026thinsp;50-\u0026le;60 years age group. However, 22 individuals (3.5%) aged between \u0026gt;\u0026thinsp;70-\u0026le;80 years, and 16 individuals (2.6%) aged over 80 years were observed (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological confirmation of\u003c/strong\u003e \u003cstrong\u003eH. pylori\u003c/strong\u003e \u003cstrong\u003eby H\u0026amp;E and IHC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this investigation, 1308 biopsy samples were collected and out of those, 374 (28.6%) were found to be positive for \u003cem\u003eH. Pylori\u003c/em\u003e through H\u0026amp;E and IHC staining. The majority of the gastric samples (260; 69.5%) were taken from the antrum, followed by the antrum and body (68; 18.1%), the gastric mucosa (26; 7.0%), and the body (10; 2.6%). The colonisation of \u003cem\u003eH. pylori\u003c/em\u003e was classified into three levels: mild (270; 72.2%), moderate (64; 17.1%), and severe (40; 10.7%). Among antrum (n\u0026thinsp;=\u0026thinsp;260; 69.5%), \u003cem\u003eH. pylori\u003c/em\u003e were primarily found in mild active gastritis (78; 30%), mild chronic active gastritis (60; 23.1%), and moderate active gastritis (36; 13.8%). In the antrum and body (68; 18.1%), mild chronic active gastritis (28; 41.1%), mild active gastritis (10; 14.7%) and moderate chronic active gastritis (10; 14.7%). However, among body samples (10; 2.6%), mild chronic active gastritis was 4 (40%). Among the gastric mucosa (n\u0026thinsp;=\u0026thinsp;26, 7.0%), unremarkable gastric mucosa in 12 (46.1%) in severe colonization (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026amp;B, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA\u0026amp;B, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026amp;B, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular detection of\u003c/strong\u003e \u003cstrong\u003ecag\u003c/strong\u003e\u003cstrong\u003eA and\u003c/strong\u003e \u003cstrong\u003evacA\u003c/strong\u003e \u003cstrong\u003eof\u003c/strong\u003e \u003cstrong\u003eH. pylori\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe presence of 16S \u003cem\u003er\u003c/em\u003eDNA in biopsy samples confirmed that 374 (36%) \u003cem\u003eH. pylori\u003c/em\u003e isolates were present (Figure S1). Additionally, virulence genes such as \u003cem\u003ecag\u003c/em\u003eA and \u003cem\u003evac\u003c/em\u003eA were identified (Figure S2). For mild gastric colonisation, 103 (27.9%) and 143 (38.2%) of the \u003cem\u003ecag\u003c/em\u003eA and \u003cem\u003evac\u003c/em\u003eA virulence genes were found, respectively. In moderate colonisation, 27 (7.2%) and 24 (6.4%) of the \u003cem\u003ecagA\u003c/em\u003e and \u003cem\u003evac\u003c/em\u003eA were identified, while in severe colonisation, 17 (4.5%) and 22 (5.9%) of the \u003cem\u003ecagA\u003c/em\u003e and \u003cem\u003evac\u003c/em\u003eA were detected. Moreover, 62 (16.5%) of the \u003cem\u003ecag\u003c/em\u003eA and \u003cem\u003evac\u003c/em\u003eA co-existed in moderate colonisation, and 7 (1.9%) of each virulent genes co-existed in severe colonisation (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eCoexisted of \u003cem\u003ecagA\u003c/em\u003e and \u003cem\u003evacA\u003c/em\u003e virulent genes of \u003cem\u003eH. pylori\u003c/em\u003e in gastric biopsies\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eH\u003c/em\u003e. \u003cem\u003epylori\u003c/em\u003e colonization\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003en\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003e%\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ecagA\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003evacA\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMild colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e103\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e27.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eModerate colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e27\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSever colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMild colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e143\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e38.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eModerate colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSever colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e22\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMild colonization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e62\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eModerate colonisation\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSever colonisation\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cem\u003eH. pylori\u003c/em\u003e is becoming a serious public health concern particularly to cause gastric cancer [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It continues to be a major threat to human and environmental health worldwide, even in developed countries [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Historically, these illnesses have been linked to high rates of illness and death, particularly in countries with low per capita incomes and large populations living in poverty [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. To effectively treat gastrointestinal issues, it is crucial to accurately diagnose \u003cem\u003eH. pylori\u003c/em\u003e infection. Among the various procedures developed, the most precise way to diagnose \u003cem\u003eH. pylori\u003c/em\u003e is through direct detection of the bacteria in the stomach mucosa [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In this study total of 1038 biopsies were collected from the antrum, antrum \u0026amp; and body, gastric, and body followed by pylorus. In the present study, we have observed that out of 1308 biopsy samples, most of the gastric biopsies from the male patients were 690 (52.7%) compared to females. In the male patients, most of them 130 (18.8%) were collected from the age between \u0026gt;\u0026thinsp;40-\u0026le;50 years and 126 (18.2%) were between \u0026gt;\u0026thinsp;30-\u0026le;40 years. However, in females, 184 (29.7%) samples were from the age group between 20-\u0026le;30 years and \u0026gt;\u0026thinsp;30-\u0026le;40 years. A study conducted in Norway they have found a low prevalence of H. pylori infection in children (0.6%) and a high of 20%-45% in adolescent age [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Recently a 10 years comprehensive study on atrophic gastritis caused by \u003cem\u003eH. pylori\u003c/em\u003e infection in different age groups revealed that most of the infection was present in male patients compared to females however most of the gastritis cases were found in \u0026gt;\u0026thinsp;80 years followed by 70years and 6o years while lowest prevalence was observed in children. According to documented evidence, retrospective cohort research found that spontaneous clearance occurred in 9 out of 58 children, which accounts for 15.5% of the total, over a 20-year follow-up period [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, several global published studies reported that the frequency of \u003cem\u003eH. pylori\u003c/em\u003e infection among adults has decreased significantly over the years, dropping from 50\u0026ndash;55% in 2014 to 43% in 2020. This reduction can mostly be attributed to the improvement in sanitation, income, and living conditions. Additionally, the increased use of antibiotics, particularly in eradication therapy for infected individuals, might have contributed to the decrease in cases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In the present study out of all the gastric samples collected, 69.5% of them were from the antrum, while 18.1% were from antrum and body samples. The degree of \u003cem\u003eH. Pylori\u003c/em\u003e colonisation was mild in 72.2% of the cases, moderate in 17.1%, and severe in 10.7%. A study from Iran determined the correlation of \u003cem\u003eH. pylori\u003c/em\u003e with colonisation they revealed that 203 (37.32%) had mild gastritis, 278 (10.51%) moderate, and 16 (2.94%) severe. Mild \u003cem\u003eH. pylori\u003c/em\u003e colonization rates had the highest mild activity (33.52%), whereas severe colonization rates had the most severe activity (43.75%). 93.96% of severe H. pylori colonization patients had moderate and severe chronic gastritis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. However, Another study from Tunisia found that 43% of patients exhibited mild \u003cem\u003eH. pylori\u003c/em\u003e colonization, 47% moderate, and 9% severe colonization [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Gastric cancer is most strongly correlated with long-term infection with Helicobacter pylori \u003cem\u003ecag\u003c/em\u003eA-positive strains [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Further, \u003cem\u003eH. pylori\u003c/em\u003e releases a toxic substance called vacA, which can induce various effects on human cells [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In this study, the prevalence of \u003cem\u003ecag\u003c/em\u003eA (27.9%) and vacA (38.2%) in H. pylori was predominantly observed in cases of mild gastric colonization. Out of the total colonization, 27 (7.2%) and 24 (6.4%) were found to be \u003cem\u003ecag\u003c/em\u003eA and \u003cem\u003evac\u003c/em\u003eA, in moderate colonization respectively. A study conducted in Pakistan found that the vacA gene was present in 54.5% of the cases, while the \u003cem\u003ecag\u003c/em\u003eA gene was positive in 24.2% of the cases [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. A study in Iran found that 79% of \u003cem\u003eH. pylori\u003c/em\u003e samples were positive for \u003cem\u003ecag\u003c/em\u003eA. Additionally, the most common combination of vacA alleles was observed in 63 cases of \u003cem\u003eH. pylori\u003c/em\u003e isolates [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Out of 192 clinical H.pylori strains identified in a study conducted in China, cagA was detected in all cases of gastric illnesses, representing 87% of the strains [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Further, there are several studies reported from other parts of the world including Japan [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], Vietnam [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], Algeria [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and Thailand [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study concluded the high prevalence of \u003cem\u003eH. pylori\u003c/em\u003e infection in the Pakitani dyspeptic population through H\u0026amp;E and IHC techniques. Further, our analysis shows that \u003cem\u003evac\u003c/em\u003eA and \u003cem\u003ecag\u003c/em\u003eA were the most common viluent genes typically associated with mild moderate and severe gastritis. On the other hand, patients with \u003cem\u003evac\u003c/em\u003eA and \u003cem\u003ecag\u003c/em\u003eA genes also displayed gastritis. The advanced molecular approaches have become reliable tools for characterizing virulent strains of \u003cem\u003eH. pylori\u003c/em\u003e due to their growing sensitivity and specificity. To predict the severity of a disease, it is necessary to identify the environmental and host factors along with the bacterial characteristics.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003e \u003cb\u003edeclaration\u003c/b\u003e: Researchers Supporting Project number (PNURSP2024R465)\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eA.R. Z.T, M.S and D.S.A. wrote the main manuscript. K.J, A.A, S.M, Z.T, M.U.Q, methdology, D.A, K.A.A, T.A.S, M.U.Q reviewed the manuscripr, funding, conceptulisation and proof reading. All authors reviewed the manuscript.\"\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eDeanship of Scientific Research at Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R465), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003e \u003cb\u003edeclaration\u003c/b\u003e: All data supporting the findings of this study are available within the paper and its supplementary information.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKhoder G, Muhammad JS, Mahmoud I, Soliman SSM, Burucoa C. Prevalence of Helicobacter pylori and Its Associated Factors among Healthy Asymptomatic Residents in the United Arab Emirates. Pathogens 2019, 8(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark JS, Jun JS, Seo JH, Youn HS, Rhee KH. Changing prevalence of Helicobacter pylori infection in children and adolescents. Clin experimental Pediatr. 2021;64(1):21\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorka Balas R, Meliț LE, Mărginean CO. Worldwide Prevalence and Risk Factors of Helicobacter pylori Infection in Children. Child (Basel) 2022, 9(9).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalfertheiner P, Camargo MC, El-Omar E, Liou J-M, Peek R, Schulz C, Smith SI, Suerbaum S. Helicobacter pylori infection. Nat Reviews Disease Primers. 2023;9(1):19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatari J, Chen N, Amenta PS, Fukui H, Oshima T, Tomita T, Miwa H, Lim KJ, Das KM. Helicobacter pylori associated chronic gastritis, clinical syndromes, precancerous lesions, and pathogenesis of gastric cancer development. World J Gastroenterol. 2014;20(18):5461\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAziz RK, Khalifa MM, Sharaf RR. Contaminated water as a source of Helicobacter pylori infection: A review. J Adv Res. 2015;6(4):539\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNarayanan M, Reddy KM, Marsicano E. Peptic Ulcer Disease and Helicobacter pylori infection. Mo Med. 2018;115(3):219\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie X, Ren K, Zhou Z, Dang C, Zhang H. The global, regional and national burden of peptic ulcer disease from 1990 to 2019: a population-based study. BMC Gastroenterol. 2022;22(1):58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaj J, Forma A, Sitarz M, Portincasa P, Garruti G, Krasowska D, Maciejewski R. Helicobacter pylori Virulence Factors-Mechanisms of Bacterial Pathogenicity in the Gastric Microenvironment. Cells 2020, 10(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIdowu A, Mzukwa A, Harrison U, Palamides P, Haas R, Mbao M, Mamdoo R, Bolon J, Jolaiya T, Smith S, et al. Detection of Helicobacter pylori and its virulence genes (cagA, dupA, and vacA) among patients with gastroduodenal diseases in Chris Hani Baragwanath Academic Hospital, South Africa. BMC Gastroenterol. 2019;19(1):73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnsari S, Yamaoka Y. Helicobacter pylori Virulence Factors Exploiting Gastric Colonization and its Pathogenicity. Toxins (Basel) 2019, 11(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmad T, Sohail K, Rizwan M, Mukhtar M, Bilal R, Khanum A. Prevalence of Helicobacter pylori pathogenicity-associated cagA and vacA genotypes among Pakistani dyspeptic patients. FEMS Immunol Med Microbiol. 2009;55(1):34\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y-J, Yang C-M, Huang J-S, Wang P, Lv Y-H, Tang C, Deng W. An introduction of an easy-operating and economical technique for tissue microarray preparation. J Clin Pathol. 2020;73(7):403\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNocera AL, Mueller SK, Workman AD, Wu D, McDonnell K, Sadow PM, Amiji MM, Bleier BS. Cystatin SN is a potent upstream initiator of epithelial-derived type 2 inflammation in chronic rhinosinusitis. J Allergy Clin Immunol. 2022;150(4):872\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUtthiya S, Wonnapinij P, Napaumpaiporn P, Kittiwongwattana C, Sakulkoo J, Suttangkakul A, Vuttipongchaikij S. Gel purification of gDNA for next-generation sequencing applications. Biotechniques. 2022;73(2):99\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes VE. Helicobacter pylori and Its Role in Gastric Cancer. Microorganisms 2023, 11(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Ouml;ztekin M, Yılmaz B, Ağag\u0026uuml;nd\u0026uuml;z D, Capasso R. Overview of Helicobacter pylori Infection: Clinical Features, Treatment, and Nutritional Aspects. Dis (Basel Switzerland) 2021, 9(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhalifa MM, Sharaf RR, Aziz RK. Helicobacter pylori: a poor man's gut pathogen? Gut pathogens. 2010;2(1):2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTalebi Bezmin Abadi A. Diagnosis of Helicobacter pylori Using Invasive and Noninvasive Approaches. J Pathog. 2018;2018:9064952.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBreckan RK, Paulssen EJ, Asfeldt AM, Kvamme J-M, Straume B, Florholmen J. The All-Age Prevalence of Helicobacter pylori Infection and Potential Transmission Routes. A Population-Based Study. Helicobacter. 2016;21(6):586\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalaty HM, El-Kasabany A, Graham DY, Miller CC, Reddy SG, Srinivasan SR, Yamaoka Y, Berenson GS. Age at acquisition of Helicobacter pylori infection: a follow-up study from infancy to adulthood. Lancet. 2002;359(9310):931\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, Malfertheiner P, Graham DY, Wong VWS, Wu JCY, et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology. 2017;153(2):420\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiou JM, Malfertheiner P, Lee YC, Sheu BS, Sugano K, Cheng HC, Yeoh KG, Hsu PI, Goh KL, Mahachai V, et al. Screening and eradication of Helicobacter pylori for gastric cancer prevention: the Taipei global consensus. Gut. 2020;69(12):2093\u0026ndash;112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, Sibley RK. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med. 1991;325(16):1127\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEusebi LH, Zagari RM, Bazzoli F. Epidemiology of Helicobacter pylori infection. Helicobacter. 2014;19(Suppl 1):1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhasemi Basir HR, Ghobakhlou M, Akbari P, Dehghan A, Seif Rabiei MA. Correlation between the Intensity of Helicobacter pylori Colonization and Severity of Gastritis. Gastroenterol Res Pract 2017, 2017:8320496.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSouissi S, Makni C, Belhadj Ammar L, Bousnina O, Kallel L. Correlation between the intensity of Helicobacter pylori colonization and severity of gastritis: Results of a prospective study. Helicobacter. 2022;27(4):e12910.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark JY, Forman D, Waskito LA, Yamaoka Y, Crabtree JE. Epidemiology of Helicobacter pylori and CagA-Positive Infections and Global Variations in Gastric Cancer. Toxins. 2018;10(4):163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNecchi V, Sommi P, Vanoli A, Fiocca R, Ricci V, Solcia E. Natural history of Helicobacter pylori VacA toxin in human gastric epithelium in vivo: vacuoles and beyond. Sci Rep. 2017;7(1):14526.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhotaslou R, Milani M, Akhi MT, Nahaei MR, Hasani A, Hejazi MS, Meshkini M. Diversity of Helicobacter Pylori cagA and vacA Genes and Its Relationship with Clinical Outcomes in Azerbaijan, Iran. Adv Pharm Bull. 2013;3(1):57\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao W, Hu JL, Xiao B, Wu KC, Peng DR, Atherton JC, Xue H. cagA and vacA genotype of Helicobacter pylori associated with gastric diseases in Xi'an area. World J Gastroenterol. 2003;9(8):1762\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, Yamazaki Y, Keida Y, Higashi H, Hatakeyama M, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol. 2005;43(8):3906\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhan TN, Santona A, Tran VH, Tran TNH, Le VA, Cappuccinelli P, Rubino S, Paglietti B. Genotyping of Helicobacter pylori shows high diversity of strains circulating in central Vietnam. Infect Genet Evol. 2017;52:19\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBachir M, Allem R, Tifrit A, Medjekane M, Drici AE-M, Diaf M, Douidi KT. Primary antibiotic resistance and its relationship with \u0026lt;\u0026thinsp;span class=elsevierStyleItalic\u0026gt;cagA\u0026thinsp;and \u0026lt;\u0026thinsp;span class=elsevierStyleItalic\u0026gt;vacA\u0026thinsp;genes in \u0026lt;\u0026thinsp;span class=elsevierStyleItalic\u0026gt;Helicobacter pylori\u0026thinsp;isolates from Algerian patients. Brazilian J Microbiol. 2018;49(3):544\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, Tor-Udom S, Vilaichone R-K. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12(1):30\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 2 is available in the Supplementary Files section.\u003c/p\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"H. pylori, gastric biopsies, cagA, vacA, Immunohistochemistry","lastPublishedDoi":"10.21203/rs.3.rs-4378571/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4378571/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAn infection with Helicobacter pylori can lead to chronic gastritis, which, if not treated, can cause serious gastroduodenal diseases such as gastric mucosa-associated lymphoid tissue lymphoma, gastric cancer, and peptic ulcer. H. pylori infection usually occurs during childhood, and if left untreated, it can persist throughout a person's lifetime. The main objective of this study was to determine the occurrence of H. pylori infections and the presence of virulence genes such as vacA and cagA. Additionally, the study aimed to investigate the connection between virulence factors and gastroduodenal issues in patients. Several virulence factors play a crucial role in the development of diseases associated with H. pylori. A total of 1038 gastric biopsy specimens were collected from the patient with a history of gastritis in 10% normal saline aseptically. Tissue size was measured, and gross examined, which were processed in an automated tissue processor. After processing, the embedding of tissues was done in paraffin wax. 2\u0026ndash;3 \u0026micro;m sections were prepared using a rotary microtome. Hematoxylin and eosin staining and immunohistochemistry were performed. DNA was extracted from the tissue of H. pylori and their virulence factors (cagA and vacA) through PCR. Of 1038 biopsies, 374 (28.5%) were H. pylori infections confirmed by hematoxylin and eosin stain and immunohistochemistry. The mean age was 39.5 (\u0026plusmn;\u0026thinsp;15.1) years, and the male-to-female ratio was 1:0.9. The majority of the gastric samples (260; 69.5%) were taken from the antrum, followed by the antrum and body (68; 18.1%), the gastric mucosa (26; 7.0%), and the body (10; 2.6%). The colonisation of H. pylori was classified into three levels: mild (270; 72.2%), moderate (64; 17.1%), and severe (40; 10.7%). Among the antrum, mild active gastritis (n\u0026thinsp;=\u0026thinsp;78; 30%), and mild chronic active gastritis (n\u0026thinsp;=\u0026thinsp;60; 23.1%), while in the antrum and body samples, 28 (41.1%) were mild active gastritis. 16S rDNA in biopsy samples of H. pylori isolates. Additionally, in mild gastric colonisation, cagA (103; 27.9%) and vacA (143; 38.2%), and in moderate colonisation, 27 (7.2%) and 24 (6.4%) of the cagA and vacA were identified. There was a high prevalence of H. pylori infection in gastric biopsies with mild colonization, and isolates carried the virulence genes.\u003c/p\u003e","manuscriptTitle":"Immunohistochemistry and molecular detection of Helicobacter pylori infection and their virulent genes in gastric biopsies from Pakistan","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-06 18:34:18","doi":"10.21203/rs.3.rs-4378571/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ef4c26de-1588-4e7c-9215-ee6ac927cb93","owner":[],"postedDate":"June 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-24T00:38:03+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-06 18:34:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4378571","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4378571","identity":"rs-4378571","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}