Targeting pulmonary fibrosis with DDR2-specific chimeric antigen receptor macrophages

Targeting pulmonary fibrosis with DDR2-specific chimeric antigen receptor macrophages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Targeting pulmonary fibrosis with DDR2-specific chimeric antigen receptor macrophages Jin Su, Yunxin Lai, Xihui Huang, Junhui Yang, Xinru Wei, Guilin Li, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8675185/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Idiopathic pulmonary fibrosis (IPF) is a fatal disease with a critical unmet need in therapeutic options. Chimeric antigen receptor (CAR) T cells targeting fibroblast activation protein (FAP) have shown potential for IPF, but other cell-based approaches remain under-explored. In this study, we generated CAR macrophages (DDR2-CARM) targeting DDR2, a collagen receptor specifically upregulated in activated stromal cells, for the treatment of IPF. Murine DDR2-CARM exerted DDR2-specific phagocytosis, upregulation of antifibrotic cytokines, chemokines and matrix metalloproteinases in vitro; and mitigated pulmonary fibrosis in bleomycin-induced unilateral pulmonary fibrosis (UPF) mouse models by targeting DDR2 + stromal cells and degrading collagen. Single-cell RNA sequencing revealed that DDR2-CARM treatment led to attenuation of chronic inflammation accompanied by reduced infiltration of profibrotic neutrophils in the fibrotic lungs. Additionally, human DDR2-CARM suppressed fibrosis in precision-cut lung slices (PCLS) from IPF patients. Thus, DDR2 emerges as a new antifibrotic target, and DDR2-CARM represent potent remodelers of both stromal and immune activities in fibrotic tissues, holding therapeutic potential for IPF. Health sciences/Diseases/Respiratory tract diseases Biological sciences/Drug discovery/Target validation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION Idiopathic pulmonary fibrosis (IPF) is an irreversible and fatal lung disease characterized by persistent inflammation and activation of stromal cells that synthesize collagen-rich extracellular matrix (ECM), with limited therapeutic options and a critical unmet therapeutic need ( 1, 2 ). Current strategies, such as antifibrotic drugs, offer only modest survival benefits. Although IPF patients in late stage survive with lung transplantation, they have a median survival duration of only 6 years after surgery ( 3 ), underscoring the urgency for innovative therapies targeting the fibrotic microenvironment. Chimeric antigen receptor (CAR) macrophages have emerged as a promising cell-based immunotherapy platform, leveraging their phagocytic capacity and immunomodulatory functions. However, in fibrotic diseases, CAR macrophage research has been predominantly confined to targeting fibroblast activation protein (FAP) ( 4, 5 ), leaving other cell-membrane proteins—particularly those involved in stromal dysregulation—largely unexplored. Discoidin Domain Receptor 2 (DDR2), a collagen-binding receptor, is significantly upregulated in stromal cells during IPF progression ( 6 ). Moreover, Ddr2 -deleted mice were reported to be resistant to the induction of pulmonary fibrosis (PF) ( 7, 8 ). These results position DDR2 as a promising novel target for CAR macrophage intervention. In this study, we developed and characterized DDR2-specific CAR macrophages (DDR2-CARM) and evaluated their therapeutic potential in pulmonary fibrosis. We demonstrated that DDR2-CARM effectively mitigated PF through robust tissue remodeling functions. DDR2-CARM targeted DDR2 + stromal cells and promoted collagen degradation. Notably, they also remodeled immune responses in fibrogenesis exemplified by suppressing chronic tissue inflammation through inhibiting inflammatory neutrophil infiltration, a process associated with poor prognosis in IPF patients ( 9, 10 ). Thus, DDR2-CARM represent a novel approach to target fibrosis and address the pathogenic crosstalk between stromal cells and inflammatory mediators in IPF, offering a promising therapeutic strategy for this devastating disease. RESULTS Generation and characterization of DDR2-CARM We recently showed that elevated DDR2 expression is an ideal stromal biomarker for PET/CT diagnosis of IPF (medRxiv preprint doi: https://doi.org/10.1101/2025.11.26.25341068), reminiscent of public data from single cell RNA sequencing (sc-RNAseq) of human IPF which showed enriched DDR2 expression in stromal cells and a small fraction of endothelial cells (fig. S1A). Spatial mapping of transcriptome revealed significant upregulation of DDR2 in human IPF and bleomycin(BLM)-induced mouse PF tissues ( 11, 12 ) (figs. S1B and S1C). We confirmed the upregulation of DDR2 in the fibrotic lungs from BLM-instilled mice by reverse transcription quantitative PCR (RT-qPCR) (fig. S1D). Therefore, DDR2 represents a potential new target for therapeutics in IPF. To target DDR2 by CAR macrophages with antifibrotic functions, we designed a CAR incorporating a DDR2-specific nanobody (fig. S2), the hinge, transmembrane and TIR domains of TLR4, and the intracellular domain of FcgR1 (Fig. 1A). To generate DDR2-CARM, adenoviral transduction was performed on mouse bone marrow derived macrophages (BMDMs), achieving transduction efficiencies exceeding 95% (Fig. 1B). The CAR expression was highly detected by RT-qPCR in DDR2-CARM, but not wild type macrophages (WT-M) or GFP-M (Fig. 1C). Phagocytosis and efferocytosis are two pivotal functions of macrophages. To evaluate DDR2-CAR-mediated phagocytosis, we coated streptavidin magnetic beads (1μm) with ligand of the CAR, extracellular domain of DDR2 (DDR2-ECD), labeled them with dye Cy3, and cocultured them with DDR2-CARM or control macrophages (WT-M were labeled with green dye Dio). Through fluorescence imaging, we found that DDR2-CARM ingested DDR2 + beads more efficiently than control macrophages (Fig. 1, D and E), suggesting that DDR2-CAR can induce phagocytosis and possibly efferocytosis since the size of the beads was comparable to that of apoptotic bodies. To map the transcriptomic changes induced by DDR2-CAR, we stimulated WT-M, GFP-M and DDR2-CARM with DDR2-ECD for 24h and performed bulk RNA sequencing. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that our DDR2-CAR upregulated TNF signaling, NF-kappa B signaling, HIF-1 signaling and Toll-like receptor signaling (Fig. 1F). Gene expression analysis of bulk RNA-seq data also revealed that TLR4 signaling, inflammatory response, and chemokines were specifically upregulated by DDR2-CAR. Nos2, Saa3, and Marco were among the top upregulated genes in DDR2-CARM. Nos2 and Saa3 promote the inflammatory response and Marco encodes a scavenger receptor that phagocytoses un-opsonized particles or pathogens. Moreover, DDR2-CARM showed downregulated S100a4 and S100a8/a9 , which are established therapeutic targets for IPF ( 13-17 ), while upregulating expression of Mmp2, Mmp13, Mmp14 and Mmp25 (Fig. 1G). The above data suggest that DDR2-CARM can induce antifibrotic responses through DDR2-specific phagocytosis and DDR2-induced expression of antifibrotic cytokines, chemokines and MMPs. DDR2-CARM prevented fibrosis progression in bleomycin-induced murine UPF models To ascertain the antifibrotic function of DDR2-CARM in PF, we established a unilateral pulmonary fibrosis (UPF) mouse model by instillation of BLM solution selectively into the left lung lobe, and the establishment of UPF was confirmed by micro-CT on day 8, and UPF mice were randomized to receive intravenous injection of 5 × 10 6 GFP-M or DDR2-CARM on day 10 (Fig. 2A). UPF mice treated with DDR2-CARM experienced improved weight gain compared to those treated with PBS or GFP-M (Fig. 2B). DDR2-CARM treatment significantly inhibited the progression of PF, as revealed by micro-CT imaging (Fig. 2C) and aerated lung volume comparison (Fig. 2, D and E) on day 27. On day 28, all mice were sacrificed, and RT-qPCR revealed reduced expression of Col1a1, Fn and Ddr2 in the left lungs from DDR2-CARM treated mice, compared to those treated with PBS or GFP-M (Fig. 2F). Hematoxylin-eosin (HE) staining and Sirius Red staining of the left lung sections confirmed the reduction of fibrosis in mice treated with DDR2-CARM, but not mice treated with GFP-M (Fig. 2G). α-SMA immunofluorescence staining revealed diminished myofibroblasts in the left lungs of mice treated with DDR2-CARM (Fig. 2H). Serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) as well as histology of major organs indicated that DDR2-CARM treatment did not lead to discernable toxic effects (fig. S3). To determine the minimal effective dosage of DDR2-CARM, we treated UPF mice with reduced numbers of DDR2-CARM and found that 2.5 × 10 6 cells were sufficient for anti-fibrotic efficacy (fig. S4). Taken together, these results demonstrated the potent therapeutic efficacy of DDR2-CARM in PF. DDR2-CARM treatment reduced DDR2 + stromal cells and degraded collagen in the fibrotic lungs To gain insight into how DDR2-CARM function in vivo, we firstly asked whether DDR2-CARM could preferentially migrate to fibrotic lungs. We labeled GFP-M and DDR2-CARM with DiD, a dye that can be used for ex vivo bioluminescence imaging, and labeled cells were intravenously injected into UPF mice, and DiD bioluminescence in different lung lobes was performed 48 hours later (Fig. 3A). The results clearly showed that DiD signals were more enriched in the left lungs (Fig. 3B), suggesting a preferential migration of DDR2-CARM into fibrotic lungs. Then we wanted to know whether DDR2-CARM targeted DDR2 + stromal cells and collagen in fibrotic lungs. We intravenously injected DiD-labeled GFP-M or DDR2-CARM into UPF mice on day 10 post BLM instillation in order to assess collagen degradation extent and DDR2 + stromal cell numbers in the left lungs (Fig. 3A). Collagen degradation is initiated by unfolding and fragmentation of triple helix which can be detected by Cy5-labeled collagen hybridizing peptide (Cy5-CHP) ( 18, 19 ). Through Cy5-CHP immunofluorescence staining, we found that DDR2-CARM treatment led to higher Cy5 signals in the fibrotic lungs compared to GFP-M treatment on day 21 (Fig. 3C). This indicated that DDR2-CARM treatment promoted collagen degradation in the fibrotic lungs. In addition, immunofluorescence imaging showed that more DDR2-CARM retained in the fibrotic lungs on day 28 compared with GFP-M, and DDR2-CARM treatment led to dramatically reduced DDR2 + stromal cells in the fibrotic lungs, with residual DDR2 + cells exhibiting internalization of DDR2; moreover, we observed interactions between DDR2-CARM and DDR2 + stromal cells (Fig. 3D). To confirm the interactions between DDR2-CARM and DDR2 + stromal cells, we conducted two-photon microscopy to analyze the fibrotic lung tissues from mice treated with GFP-M or DDR2-CARM for 2 days. We found that nearly all DDR2 + stromal cells interacted with DDR2-CARM, but few DDR2 + stromal cells interacted with GFP-M (Video S1 and S2). To further evaluate the duration of DDR2-CARM persistence in fibrotic lungs, we infused CD45.1 DiD-labeled DDR2-CARM into CD45.2 UPF mice and monitored DiD signals in the left lungs at different time points (fig. S5A). DDR2-CARM persisted in fibrotic lungs throughout the entire observation period, up to the final time point of 16 weeks (fig. S5B). Further CD45.1 immunohistochemistry confirmed the presence of infused DDR2-CARM as interstitial macrophages but not alveolar macrophages in the fibrotic lungs (fig. S5C), which is important given that monocyte-derived alveolar macrophages are key players in IPF pathogenesis ( 20, 21 ). Therefore, these data demonstrated that our DDR2-CARM can migrate to and reside for a long term in the fibrotic lungs where they drive degradation of collagen, and meanwhile recognize and reduce DDR2 + stromal cells. DDR2-CARM inhibited chronic inflammation via suppressing profibrotic neutrophil infiltration Since macrophages are master regulators of tissue homeostasis, we sought to determine whether DDR2-CARM treatment led to fibrotic microenvironment remodeling necessary for antifibrotic efficacy. To this end, we performed single-cell RNA-sequencing (scRNA-seq) on cells isolated from the left lungs of UPF mice untreated (UTD), treated with GFP-M or DDR2-CARM on day 10 post BLM-instillation for 8 days (Fig. 4A). The scRNA-seq data were subjected to quality control filtering based on UMI counts, gene expression numbers, and mitochondrial gene proportions, retaining only high-quality cells for subsequent analysis (Supplementary table 1). Following quality control and normalization, Uniform Manifold Approximation and Projection (UMAP) visualization of the scRNA-seq data highlighted the separation of major lung cell types, including epithelial cells (AT1 & AT2), B cells, endothelial cells, fibroblasts, myeloid cells, neutrophils, secretory & ciliated cells, smooth muscle cells (SMC) & pericytes and T cells (Fig. 4B). First, we analyzed the ratios of cell types in both stromal and myeloid compartments, which remained largely unaffected by DDR2-CARM treatment (Fig. 4C). To determine the effect of DDR2-CARM treatment on the gene expression profile of endothelial, stromal and myeloid cells, we then performed KEGG and Gene Ontology Biological Process (GOBP) analysis, which revealed that DDR2-CARM treatment led to a contradictory suppression of immune and inflammatory responses in these cell compartments (Fig. 4D). This apparent contradiction was intriguing, given that DDR2-CARM were shown to secrete pro-inflammatory cytokines and chemokines. Yet, we found that DDR2-CARM treatment led to dramatically decreased neutrophil responses in the fibrotic lungs. UMAP analysis revealed five subsets of neutrophils defined by high expression of Retnlg (Retnlg HI ), interferon-stimulated genes (ISG HI ), genes regulated by nuclear factor NFκB) (NFκB HI ), genes regulated by hypoxia inducible factor 1 (HIF-1 HI ), and the classically eosinophilic surface marker SiglecF (SigF HI ) (fig. S6). DDR2-CARM treatment primarily enriched for Retnlg HI neutrophils, with minimal or no presence of other subsets, and therefore led to dramatic decrease in neutrophil number in the fibrotic lungs (Fig. 4, E and F). Retnlg HI neutrophils have been found to be highly immunosuppressive in tumor ( 22 ). Concordantly, theneutrophils in UPF mice treated with DDR2-CARM showed much lower expression of Csf1, Ccl3, Ccl4, Ccl5, Tnf, and Ila , but higher expression of Mmp8 and Mmp9, compared with those from untreated or GFP-M-treated UPF mice (Fig. 4G). For SigF HI neutrophils, recent work revealed that they contribute to PF through the release of neutrophil extracellular traps (NETs) ( 23 ). These results indicated that DDR2-CARM played a complex regulatory role which inhibited profibrotic neutrophil infiltration into injured lung tissues and suppressed chronic inflammation, allowing for their antifibrotic efficacy. Human DDR2-CARM inhibited ex vivo fibrogenesis in IPF lung slices Finally, we sought to determine whether DDR2-CARM were translatable. We designed a human version of DDR2-CAR, which comprised the 1A12 (DDR2 is highly homologous between human and mouse), the hinge, transmembrane and TIR domains of human TLR4, and intracellular domain of human FcγRI (Fig. 5A). Lung tissues from IPF patients were used to generate precision-cut lung slices (PCLS), which were cultured alone or cocultured with GFP-M or DDR2-CARM, followed by detection of DDR2 + cells and expression of key fibrotic genes (Fig. 5B). As a result, significantly lower levels of both DDR2 + cells and transcripts of genes encoding α-SMA, collagen-I and fibronectin were detected in IPF PCLS cocultured with DDR2-CARM, compared to those cultured alone or cocultured with GFP-M (Fig. 5, C and D). This experiment indicated that our DDR2-CARM hold the potential to treat intractable pulmonary fibrosis such IPF in humans. Collectively, our study demonstrated that DDR2-CARM robustly suppressed fibrogenesis in mouse models and ex vivo IPF tissues. We further identified a novel mechanism by which DDR2-CARM mediated antifibrotic effects, prompting further exploration into the cross-talk between CAR macrophages and neutrophils in damaged tissues. Thus, we have established DDR2 as a new stroma-specific biomarker, in addition to FAP, that can be targeted in attempts to treat fibrotic diseases. DISCUSSION We designed a proinflammatory DDR2-CAR that drives M1 polarization of DDR2-CARM, since multiple studies have revealed that targeting M2 macrophages is effective at treating pulmonary fibrosis ( 24-28 ) while M1 macrophages have been shown to ameliorate fibrosis ( 29, 30 ). We demonstrated that DDR2-CARM potently inhibited PF. Paradoxically, despite DDR2-CARM’s induction of pro-inflammatory signaling pathways (e.g., TNF and NF-kappa B; Fig. 1F), scRNA-seq analysis revealed an overall dampening of inflammation. Crucially, we showed that DDR2-CARM treatment dramatically suppressed profibrotic neutrophil infiltration in fibrotic lungs, reducing key subsets such as NFκB HI and HIF-1 HI neutrophils, while retaining Retnlg HI subset which exhibits much lower expression of pro-inflammatory cytokines (e.g., Csf1, Ccl3, Ccl4 ) and upregulated MMPs like Mmp8 and Mmp9 (Fig. 4, E-G). As the most abundant immune cells in circulation, neutrophils play key roles in the early immune responses to tissue damage, but the role of neutrophils in IPF is poorly understood. In many instances, recruited neutrophils are detrimental rather than protective as they release a toxic cargo that compromises vascular integrity or induces thrombosis ( 31 ). Furthermore, an increase of neutrophils and specific NETs components were correlated with the pathogenesis of IPF ( 10, 32, 33 ). Targeting neutrophil represents a new strategy to treat IPF. For example, neutrophil elastase inhibitor Sivelestat has been proved to be a potential candidate drug for acute exacerbation pulmonary fibrosis ( 34 ). In this study, we unprecedentedly revealed a new strategy leveraging CAR macrophages to regulate neutrophil function in fibrogenesis. Further studies are needed to elucidate how DDR2-CARM dampen neutrophil infiltration and inflammation during fibrogenesis. We speculate that DDR2-CARM exerted phagocytosis and efferocytosis, functions that have been shown impaired in alveolar macrophages isolated from IPF patients ( 35 ), facilitating the clearance of cell debris and microbes in injured lung tissues. Moreover, the observation that DDR2-CARM ultimately reside in the lung as interstitial macrophages suggests that they can bind with DDR2 + stromal cells like pericytes and serve as physical barrier preventing neutrophil extravasation. Collectively, our data demonstrated that DDR2-CARM represent a potent and translatable therapeutic strategy for IPF, leveraging the phagocytic and immunomodulatory capacities of macrophages to target stromal dysregulation. Our findings not only validate DDR2 as a viable therapeutic target but also elucidate a multifaceted mechanism by which DDR2-CARM attenuates fibrosis progression, with a particular emphasis on its role in modulating neutrophil-driven inflammation. This multifunctionality addresses a critical gap in IPF therapy, as current antifibrotic agents offer only modest benefits by targeting single pathways. Despite these promising results, several limitations warrant consideration. First, our in vivo models primarily relied on BLM-induced murine fibrosis, which may not fully recapitulate the chronicity and heterogeneity of human IPF. Second, while DDR2-CARM showed no discernible toxicity in major organs (fig. S3), long-term safety profiles—including potential off-target effects or CAR-mediated hyperinflammation—remain unassessed beyond 16 weeks (fig. S5B). Additionally, the reliance on adenoviral transduction for CAR expression introduces scalability concerns for clinical applications. Finally, the scRNA-seq data, though insightful, focused on a single time point following DDR2-CARM treatment; neutrophil subset dynamics and their interactions with other immune cells (e.g., macrophages) merit deeper investigation. MATERIALS AND METHODS Study design The objective of this study was to develop CAR macrophages for treating pulmonary fibrosis. CAR macrophages targeting DDR2 (DDR2-CARM) were generated through adenoviral transduction. DDR2-CARM function was evaluated in vitro through phagocytosis assays and bulk RNA sequencing. Anti-fibrotic efficacy of murine DDR2-CARM was assessed in bleomycin-induced unilateral pulmonary fibrosis (UPF) mouse models. Human DDR2-CARM were tested by coculturing with ex vivo precision-cut lung slices (PCLS) from IPF patients. Single-cell RNA sequencing was performed to characterize the immune remodeling induced by DDR2-CARM in fibrotic lungs. UPF mouse model All mice were housed in cages with an ad libitum access to water and food in specific-pathogen-free (SPF) facilities and all experiments were approved by the First Affiliated Hospital of Guangzhou Medical University. Male C57BL/6 mice (6-8 weeks) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. UPF was induced through a non-invasive unilateral endotracheal instillation of BLM. Briefly, mice were anesthetized through intraperitoneal injection of pentobarbital sodium (50 mg/kg) and fixed on a flat board with the ventral surface and rostrum facing upwards. The tongue was gently retracted using a curved blade Kelly forceps and the respiratory secretions were suctioned with a blunted 22G Indwelling Cannula connected to a 1 ml syringe. Blunted needle of 22G Indwelling Cannula was gently inserted into the main bronchus, and further inserted into the left principal bronchus after rotating the mouse clockwise to ensure a lower position for the left lung. 40 μl BLM (0.5mg/ml, dissolved in sterile 0.9% saline) was added to the 22G Indwelling Cannula, and instilled into the left lung with a 1 ml syringe. Control healthy mice (Ctrl) received equal volumes of sterile 0.9% saline. Micro-computed tomography (micro-CT) analysis (PINGSENG Healthcare Inc., SNC-100, China) was done on day 7 following BLM instillation to confirm UPF establishment. Precision-cut lung slices (PCLS) The human IPF lung tissues were cut into slices with a vibratome (DOSAKA, DTK-1000N). The lung tissues were rinsed three times with cold PBS containing 1% penicillin and streptomycin to remove possible contamination and then embedded in 2% low-melting agarose on ice for 30 min. The agarose gel containing lung tissues were cut into small blocks in sterile condition. The agarose blocks were glued, using standard cyanoacrylate glue, directly onto the platform and the tray were filled with ice cold PBS buffer to completely cover the agarose blocks, which were then cut into slices measuring 600 micrometers in thickness. Quantitative reverse transcription PCR Total RNA was extracted from macrophages, lung tissues or kidneys with an RNA isolation kit (Cat#RC112, Vazyme) and cDNA was synthesized with a cDNA reverse transcription kit (Cat#A0010CGQ, EZB). Quantitative real-time PCR was done according to the protocol for TaqMan gene expression assay kits (Applied Biosystems). Results were normalized to the expression of GAPDH or β-actin mRNA. The primers for target genes were as follows: Col1a1: F, ggagggcgagtgctgtgcttt; R, gggaccaggaggaccaggaagt; Gapdh: F, tggccttccgtgttcctac; R, gagttgctgttgaagtcgca; Ddr2: F, gaggccacattccagatgag; R, agagtccagcctcccatatt; DDR2: F, ctcccagaatttgctccag; R, gccacatctttcctgaga; FN1: F, cggtggctgtcagtcaaag; R, aaacctcggcttcctccataa; COL1A1: F, gagggccaagacgaagacatc; R, cagatcacgtcatcgcacaac; Actb: F, gtgacgttgacatccgtaaaga; R, gccggactcatcgtactcc; ACTB: F, catgtacgttgctatccaggc; R, ctccttaatgtcacgcacgat; DDR2-CAR: F, cctgagcaaacagcagagga; R, cgccatcgcttctaacttgc. DDR2 antibodies We obtained the DDR2 nanobody 1A12 through high throughput screening of an antibody phage library (patent application No. PCT/CN2023/110789). 1A12 containing a His-tag was expressed and produced by 293F cells, and isolated from the supernatant through Ni-NTA affinity purification. 1A12 was labeled with Cy3 for fluorescent staining. Another DDR2 antibody HL2 was derived from chicken immunization with DDR2 extracellular domain. The Fabs of HL2 were fused with human IgG Fc to generate the HL2-hFc chimeric antibody. HL2-hFc was used in the immunofluorescence staining. DDR2 + Cy3 + beads To derive DDR2 + Cy3 + beads for phagocytosis assays, we dissolved sulfo-NHS-Biotin in anhydrous DMF to prepare a Biotin/DMF solution, which was added with DDR2 protein at molar ratio of 50:1 between Biotin and DDR2. The reaction was allowed to proceed on ice for 2 hours to generate Biotin-labeled DDR2, and unbound Biotin was removed from the mixture through Amicon® Ultra Centrifugal Filter (10 kDa). Streptavidin magnetic beads were mixed with Biotin-labeled DDR2 (100 μl beads/μg DDR2-biotin), and vortexed at room temperature for 1 hour, and then wash twice with PBS. Cy3 dye was mix the DDR2-beads at a molar ratio of 1:2. The pH of the mixture was adjusted to 10, and incubate at room temperature in the dark for 1 hour. Beads were washed twice with PBS to remove unbound Cy3. Lung histology and immunohistochemistry Lung tissues from mice were fixed with 10% neutral buffered formalin and then embedded with paraffin wax and sectioned (5-7 micrometers). lung sections (3 μm) were prepared, deparaffinized and stained with hematoxylin and eosin (HE) and Sirius red according to the manufacturer’s instructions. For macrophage tracing, sections were stained with CD45.1 (Cat#MABF591, Sigma) and then Biotin-labeled goat anti-mouse/rabbit IgG (Boster, SA1020). Slides were imaged on a Leica Scanscope XT and analysed using Aperio software. Micro-CT analysis The in vivo micro-CT analysis of mice was done as previously( 19 ). Mice were anesthetized by isoflurane inhalation before subjected to high-resolution scanning (50 μm voxel size) using the Super Nova CT (PINGSENG Healthcare Inc., SNC-100, China) according to the manufacturer’s instructions. Results were analyzed with the algorithms of three-dimensional (3D) finite element (AVATAR 1.5.0, PINGSENG Healthcare Inc., China). Briefly, axial and coronal images were analyzed for identical in vivo signs (e.g., right bronchus bifurcation), which were defined as fibrotic areas. Lung 3D reconstruction 3D Slicer ( http://www.slicer.org ) was used for micro-CT image computing and visualization of the regions of interest (ROI) in each lung CT slice. To quantify progression of lung fibrosis, semi-automatic segmentation was employed to define the airways and total lung volume. Hounsfield Unit (HU) clinical ranges were applied to rescaled HU images, dividing the lung parenchyma into normally aerated (-1000 to -350 HU) regions. Unilateral lung volumes were then quantitatively calculated by segmenting normally aerated regions. Bioluminescence To evaluate the migration of DDR2-CARM into fibrotic lungs, GFP-M and DDR2-CARM were labeled with DiD dye (Ex=644 nm, Em=665 nm), and injected intravenously into UPF mice (5×10 6 cells per mouse). 48 h later, all lung lobes were analyzed by bioluminescence imaging to trace DiD signals emanated from infused macrophages. To determine how long DDR2-CARM could persist in the fibrotic lungs of mice, DDR2-CARM were also labeled with DiD dye and injected intravenously into UPF mice (5×10 6 cells per mouse). At week 4, 6, 8, and 16 post injection, the left fibrotic lungs were analyzed through bioluminescence to detect DiD signals. Indocyanine Green (ICG) conjugated HL2-hFc antibody was used to stain the PCLS for quantification of DDR2 + stromal cells. Immunofluorescence Optimal cutting temperature compound (OCT compound) was used to embed tissue samples prior to frozen sectioning on a microtome - HM525NX. For myofibroblasts staining, lung frozen-sections were stained anti-α-SMA antibody (CA#ab5694, Abcam, 1:200 diluted) and then Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (CA#ab150077, Abcam). To analyze collagen degradation, lung frozen-sections were stained with CHP-Cy5. For anti-DDR2 staining, HL2-hFc (1:200 diluted) antibody and secondary antibody Flare570 (Cat# HKI0015, Haokebio) were used. Staining was amplified using Tyramide Signal Amplification. Sections were finally incubated with DAPI (1:500) for 5 min to stain cell nuclei. The infused Dio-labeled macrophages in lung sections were analyzed through Dio fluorescence. Fluorescent imaging was done on a fluorescence microscope Olympus BX53. Images were processed with CaseViewer. Bulk RNA sequencing UTD, GFP-M, and DDR2-CARM were stimulated with 500 ng/ml DDR2 recombinant protein for 48 hours and sent for bulk RNA-seq. Bulk RNA-seq was performed by Guangzhou IGE Biotechnology Co., Ltd. RNA from macrophages were extracted using the Qiagen RNA isolation kit according to the manufacturer’s instructions. RNA was then fragmented, reverse transcribed, added with adenine at the 3’ end, ligated with adaptors and subjected to polymerase chain reactions (PCR). PCR products were then used for sequencing using the Illumina Novaseq6000PE150. The sequencing data passed quality tests and were used for differential gene expression analysis. Adenovirus packaging The non-replicating Ad5 adenoviruses were packaged by OBiO Technology (Shanghai) Corp., Ltd. AdMax system was used to generate adenoviral vectors. Shuttle plasmid pcADV-EF1-mNeoGreen-CMV-MCS was used to package control adenovirus and pcADV-EF1-mNeoGreen-CMV-CARs containing CAR sequences were used to package adenoviruses. 293A cells were transfected with plasmids (1:1 ratio of shuttle plasmid and Ad5 genomic plasmid) for initial packaging. Media were changed every three days until visible virus plaques formed 7-15 days later. Supernatant containing adenoviruses was collected after complete cytolysis. HEK293 cells were used to expand adenoviruses. Briefly, adenoviruses (about 107-108PFU/ml) were added to HEK293 cells for expansion for 2-3 days, and 10% Nonidet P 40 (NP40) was added to lyse the cells. Cell lysates were centrifuge at 12000 rpm for 10 minutes to collect the supernatant. Precipitation solution (20% PEG8000, 2.5M Nacl) was added to supernatant at 1: 2 volume ratio to precipitate the adenoviruses on ice for 1 hour before centrifugation at 12000 rpm for 20 minutes to collect adenoviruses. Adenoviruses were then resuspended in 10 ml CsCl solution (1.10g/ml, 20 mM Tris-HCl, pH 8.0), centrifuged at 4℃ and 7000 rpm for 5 minutes and adenovirus supernatant was collected. 2 ml 1.4g/ml CsCl solution, 3 ml 1.30 g/ml CsCl solution, and 5 ml adenovirus supernatant were sequentially added to a Beckman ultracentrifuge tube, which was then centrifuged at 22800 rpm and 4℃ for 2.5 hours. Adenoviruses concentrated between 1.3g/ml -1.4g/ml CsCl solution were transferred into dialysis bags for dialysis before storage at -80℃. Mouse DDR2-CARM generation Femur bone marrow cells of C57BL/6 mice were flushed out with cold sterile PBS with a 1ml syringe, and filtered through a 70 μm filter. After red blood cell lysis, bone marrow cells were washed twice with cold PBS and cultured with DMEM media containing 50 ng/ml M-CSF, 10% fetal bovine serum and 1% streptomycin& penicillin at cell density of 1-2×10 6 cells/ml. Half of the media were renewed after culture for three days. On day 5-6, all media were renewed and adenoviruses were added at the MOI of 500. After 24 hours of transfection, BMDMs were cultured in fresh media for another 48 hours and used for subsequent experiments. Human DDR2-CARM generation Mononuclear cells were isolated from cord blood through Ficoll gradient centrifugation. Cord blood was diluted with an equal volume of cold PBS and added gently onto Ficoll in 50 ml tubes and centrifuged at 800g for 20min. Cells were collected from which CD14 + monocytes were purified by magnetic cell sorting (Miltenyi, 130-118-906). Monocytes were cultured in DMEM media with 10ng/ml hGM-CSF for 5 days for macrophage differentiation. Macrophages were then transfected with adenovirus at MOI of 500 for 24h and cultured in fresh media for another 24h. Single-cell RNA-seq data processing Raw sequencing reads were aligned to the mm10 reference genome using CellRanger Count (v7.0.0, 10x Genomics) with default settings. Resulting count matrices were imported into Seurat (v4.1.1) for quality control, filtering cells with 400–7000 detected genes and <15% mitochondrial RNA. Library-specific quality metrics are provided in Table SXXX. Doublets were detected and removed using DoubletFinder (v2.0.3). After per-sample filtering, Seurat objects were merged. Data normalization, identification of the top 2000 highly variable genes (HVGs), scaling, and principal component analysis (PCA) were performed according to the Seurat pbmc3k tutorial. Batch effects across samples were corrected using Harmony (v0.1). Neighborhood graph computing, Leiden clustering and UMAP embedding were conducted based on the first 15 Harmony-corrected PCA coordinates. Major cell types were annotated using canonical markers including epithelial (Epcam, Krt19, Krt8), B (Cd79a, Cd79b，Ms4a1), stromal (Col1a1, Col1a2, Acta2), T (Cd3d, Cd3e), myeloid (Cst3, Lyz2, Cd68, Cd14), neutrophil (Csf3r, Il1r2, G0s2), endothelial (Pecam1, Vwf, Cdh5). Each major cell type was subsetted for further subclustering using the same pipeline. Differentially expressed genes (DEGs) between sample pairs were identified using Seurat’s FindMarkers() (min.pct = 0.1, logfc.threshold = 0). Gene set enrichment analysis (GSEA) was performed on ranked gene lists using clusterProfiler (v4.2.0) with msigdbr (v7.5.1). Pathway activity scores were calculated with Seurat’s AddModuleScore(), retaining only genes expressed in ≥5% of cells, and visualized using SCP’s GroupHeatmap() function (SCP v0.4.8) . Macrophage phagocytosis assays For evaluation of the antigen-specific phagocytosis capacities, BMDMs cells labeled with Dio, GFP-M or DDR2-CARM were incubated with DDR2-Cy3-Beads (beads to cells ratio at 5: 1) for 4h at 37℃, washed with cold PBS to stop phagocytosis and remove soluble beads, and analyzed immediately by confocal microscopy (Nikon Eclipse C1). Ten random fields were counted for the number of phagocytosis events for each group. Dio or GFP： Ex=488nm, Em=507nm, DDR2-Cy3-Beads：Ex=550nm, Em=570nm. Statistical analysis Statistical analysis was done with GraphPad Prism software. P-values of less than 0.05 were considered to be significant. Unless otherwise noted, comparisons between two groups were made with unpaired two-sided Student’s t-test. One-way ANOVA (with the Sidak-Bonferroni correction) was used for multiple comparisons. Two-way ANOVA was used for comparing the weight changes following UPF induction between different treatment groups. Declarations Acknowledgments: We would like to thank professor Yang Li (from Sun Yat-sen University) for providing Cy5-CHP to us which was used to detect collagen degradation in fibrotic lungs. Funding: Guangzhou Science-Brain grant (2023B03J1352) Guangzhou Science and Technology project (202201010174) National Natural Science Foundation of China (82570145, 82370148 and 82003265) R&D Program of Guangzhou Laboratory (GZNL2023A02003) Guangzhou Municipal Science and Technology Bureau, Guangzhou Key Research and Development Program (2024B03J0046) Grant of State Key Laboratory of Respiratory Disease (SKLRD-Z-202307) Plan on enhancing scientific research in GMU (02-410-2302244XM). Author contributions: Conceptualization: YL, XH, JS Methodology: YL, XH, JY, XR, YZ, XB, DW, GL, PY, HW, SQ, KW, PZ Investigation: YL, XH, JY, XR, JL Visualization: YL, XH, JY, JL, JS Funding acquisition: YL, XW, JL, JS Project administration: JS, YL Supervision: JS, JL Writing – original draft: YL Writing – review & editing: JS Competing interests: Authors declare that they have no competing interests. Data and materials availability: All experimental data and materials used in this study are available. scRNA-seq raw data have been deposited into the Genome Sequence Archive (GSA) database under accession number CRA035170 (https://ngdc.cncb.ac.cn/gsa/s/R60nu995). References A. J. Podolanczuk, C. C. Thomson, M. Remy-Jardin, L. Richeldi, F. J. Martinez, M. Kolb, G. Raghu, Idiopathic pulmonary fibrosis: state of the art for 2023. Eur Respir J 61, (2023). M. Ghumman, D. Dhamecha, A. Gonsalves, L. Fortier, P. Sorkhdini, Y. Zhou, J. U. Menon, Emerging drug delivery strategies for idiopathic pulmonary fibrosis treatment. Eur J Pharm Biopharm 164, 1-12 (2021). S. K. Rajan, V. Cottin, R. Dhar, S. Danoff, K. R. Flaherty, K. K. Brown, A. Mohan, E. Renzoni, M. Mohan, Z. Udwadia, P. Shenoy, D. Currow, A. Devraj, B. Jankharia, R. Kulshrestha, S. Jones, C. Ravaglia, S. Quadrelli, R. Iyer, S. Dhooria, M. Kolb, A. U. Wells, Progressive pulmonary fibrosis: an expert group consensus statement. Eur Respir J 61, (2023). J. Yan, S. Y. Wang, Q. Su, M. W. Zou, Z. Y. Zhou, J. Shou, Y. Huo, Targeted immunotherapy rescues pulmonary fibrosis by reducing activated fibroblasts and regulating alveolar cell profile. Nat Commun 16, 3748 (2025). H. Aghajanian, T. Kimura, J. G. Rurik, A. S. Hancock, M. S. Leibowitz, L. Li, J. Scholler, J. Monslow, A. Lo, W. Han, T. Wang, K. Bedi, M. P. Morley, R. A. Linares Saldana, N. A. Bolar, K. McDaid, C. A. Assenmacher, C. L. Smith, D. Wirth, C. H. June, K. B. Margulies, R. Jain, E. Pure, S. M. Albelda, J. A. Epstein, Targeting cardiac fibrosis with engineered T cells. Nature 573, 430-433 (2019). H. Bian, X. Nie, X. Bu, F. Tian, L. Yao, J. Chen, J. Su, The pronounced high expression of discoidin domain receptor 2 in human interstitial lung diseases. ERJ Open Res 4, (2018). H. Zhao, H. Bian, X. Bu, S. Zhang, P. Zhang, J. Yu, X. Lai, D. Li, C. Zhu, L. Yao, J. Su, Targeting of Discoidin Domain Receptor 2 (DDR2) Prevents Myofibroblast Activation and Neovessel Formation During Pulmonary Fibrosis. Mol Ther 24, 1734-1744 (2016). S. Jia, M. Agarwal, J. Yang, J. C. Horowitz, E. S. White, K. K. Kim, Discoidin Domain Receptor 2 Signaling Regulates Fibroblast Apoptosis through PDK1/Akt. Am J Respir Cell Mol Biol 59, 295-305 (2018). S. M. Matson, L. T. Ngo, Y. Sugawara, V. Fernando, C. Lugo, I. Azeem, A. Harrison, A. Alsup, E. Nissen, D. Koestler, M. P. Washburn, M. J. Rekowski, P. J. Wolters, J. S. Lee, J. J. Solomon, M. K. Demoruelle, Neutrophil extracellular traps linked to idiopathic pulmonary fibrosis severity and survival. medRxiv, (2024). A. Achaiah, E. Fraser, P. Saunders, R. K. Hoyles, R. Benamore, L. P. Ho, Neutrophil levels correlate with quantitative extent and progression of fibrosis in IPF: results of a single-centre cohort study. BMJ Open Respir Res 10, (2023). L. Franzen, M. Olsson Lindvall, M. Huhn, V. Ptasinski, L. Setyo, B. P. Keith, A. Collin, S. Oag, T. Volckaert, A. Borde, J. Lundeberg, J. Lindgren, G. Belfield, S. Jackson, A. Ollerstam, M. Stamou, P. L. Stahl, J. J. Hornberg, Mapping spatially resolved transcriptomes in human and mouse pulmonary fibrosis. Nat Genet, (2024). Q. Li, Y. Wang, L. Ji, J. He, H. Liu, W. Xue, H. Yue, R. Dong, X. Liu, D. Wang, H. Zhang, Cellular and molecular mechanisms of fibrosis and resolution in bleomycin-induced pulmonary fibrosis mouse model revealed by spatial transcriptome analysis. Heliyon 9, e22461 (2023). H. Ji, H. Dong, Y. Lan, Y. Bi, X. Gu, Y. Han, C. Yang, M. Cheng, J. Gao, Metformin attenuates fibroblast activation during pulmonary fibrosis by targeting S100A4 via AMPK-STAT3 axis. Front Pharmacol 14, 1089812 (2023). K. Araki, R. Kinoshita, N. Tomonobu, Y. Gohara, S. Tomida, Y. Takahashi, S. Senoo, A. Taniguchi, J. Itano, K. I. Yamamoto, H. Murata, K. Suzawa, K. Shien, H. Yamamoto, M. Okazaki, S. Sugimoto, K. Ichimura, M. Nishibori, N. Miyahara, S. Toyooka, M. Sakaguchi, The heterodimer S100A8/A9 is a potent therapeutic target for idiopathic pulmonary fibrosis. J Mol Med (Berl) 99, 131-145 (2021). Y. Li, J. Bao, Y. Bian, U. Erben, P. Wang, K. Song, S. Liu, Z. Li, Z. Gao, Z. Qin, S100A4(+) Macrophages Are Necessary for Pulmonary Fibrosis by Activating Lung Fibroblasts. Front Immunol 9, 1776 (2018). W. Zhang, S. Ohno, B. Steer, S. Klee, C. A. Staab-Weijnitz, D. Wagner, M. Lehmann, T. Stoeger, M. Konigshoff, H. Adler, S100a4 Is Secreted by Alternatively Activated Alveolar Macrophages and Promotes Activation of Lung Fibroblasts in Pulmonary Fibrosis. Front Immunol 9, 1216 (2018). H. Xia, A. Gilbertsen, J. Herrera, E. Racila, K. Smith, M. Peterson, T. Griffin, A. Benyumov, L. Yang, P. B. Bitterman, C. A. Henke, Calcium-binding protein S100A4 confers mesenchymal progenitor cell fibrogenicity in idiopathic pulmonary fibrosis. J Clin Invest 127, 2586-2597 (2017). J. Hwang, Y. Huang, T. J. Burwell, N. C. Peterson, J. Connor, S. J. Weiss, S. M. Yu, Y. Li, In Situ Imaging of Tissue Remodeling with Collagen Hybridizing Peptides. ACS Nano 11, 9825-9835 (2017). S. Song, Z. Fu, R. Guan, J. Zhao, P. Yang, Y. Li, H. Yin, Y. Lai, G. Gong, S. Zhao, J. Yu, X. Peng, Y. He, Y. Luo, N. Zhong, J. Su, Intracellular hydroxyproline imprinting following resolution of bleomycin-induced pulmonary fibrosis. Eur Respir J 59, (2022). N. Joshi, S. Watanabe, R. Verma, R. P. Jablonski, C. I. Chen, P. Cheresh, N. S. Markov, P. A. Reyfman, A. C. McQuattie-Pimentel, L. Sichizya, Z. Lu, R. Piseaux-Aillon, D. Kirchenbuechler, A. S. Flozak, C. J. Gottardi, C. M. Cuda, H. Perlman, M. Jain, D. W. Kamp, G. R. S. Budinger, A. V. Misharin, A spatially restricted fibrotic niche in pulmonary fibrosis is sustained by M-CSF/M-CSFR signalling in monocyte-derived alveolar macrophages. Eur Respir J 55, (2020). A. V. Misharin, L. Morales-Nebreda, P. A. Reyfman, C. M. Cuda, J. M. Walter, A. C. McQuattie-Pimentel, C. I. Chen, K. R. Anekalla, N. Joshi, K. J. N. Williams, H. Abdala-Valencia, T. J. Yacoub, M. Chi, S. Chiu, F. J. Gonzalez-Gonzalez, K. Gates, A. P. Lam, T. T. Nicholson, P. J. Homan, S. Soberanes, S. Dominguez, V. K. Morgan, R. Saber, A. Shaffer, M. Hinchcliff, S. A. Marshall, A. Bharat, S. Berdnikovs, S. M. Bhorade, E. T. Bartom, R. I. Morimoto, W. E. Balch, J. I. Sznajder, N. S. Chandel, G. M. Mutlu, M. Jain, C. J. Gottardi, B. D. Singer, K. M. Ridge, N. Bagheri, A. Shilatifard, G. R. S. Budinger, H. Perlman, Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span. J Exp Med 214, 2387-2404 (2017). Q. Zhu, G. Zhang, M. Cao, H. Huang, D. He, Z. Zang, J. Xing, M. Zhan, S. Pei, X. Deng, J. Li, G. Meng, J. Xu, D. Dai, G. Hu, M. Zheng, C. Liu, J. Qin, Y. Xiao, Microbiota-shaped neutrophil senescence regulates sexual dimorphism in bladder cancer. Nat Immunol 26, 722-736 (2025). C. H. Hiroki, M. F. Hassanabad, M. Defaye, N. Sarden, A. Bartlett, R. Farias, A. P. Nguyen, I. M. Guerrero-Fonseca, G. Yoon, L. Brown, C. Ma, H. Yang, D. Belke, A. Fatehi Hassanabad, C. McCoy, N. L. Rosin, D. J. Orton, P. W. M. Fedak, B. A. Vallance, H. Yu, K. Jacobson, N. Khan, C. Altier, M. M. Kelly, B. G. Yipp, Nociceptor neurons suppress alveolar macrophage-induced Siglec-F(+) neutrophil-mediated inflammation to protect against pulmonary fibrosis. Immunity 58, 2054-2068 e2056 (2025). Q. Luo, D. Deng, Y. Li, H. Shi, J. Zhao, Q. Qian, W. Wang, J. Cai, W. Yu, J. Liu, TREM2 Insufficiency Protects against Pulmonary Fibrosis by Inhibiting M2 Macrophage Polarization. Int Immunopharmacol 118, 110070 (2023). H. Wang, Y. Gao, L. Wang, Y. Yu, J. Zhang, C. Liu, Y. Song, H. Xu, J. Wang, H. Lou, T. Dong, Lung specific homing of diphenyleneiodonium chloride improves pulmonary fibrosis by inhibiting macrophage M2 metabolic program. J Adv Res 44, 213-225 (2023). B. Liu, Q. Jiang, R. Chen, S. Gao, Q. Xia, J. Zhu, F. Zhang, C. Shao, X. Liu, X. Li, H. Zhou, C. Yang, H. Huang, Tacrolimus ameliorates bleomycin-induced pulmonary fibrosis by inhibiting M2 macrophage polarization via JAK2/STAT3 signaling. Int Immunopharmacol 113, 109424 (2022). Y. Wang, L. Zhang, G. R. Wu, Q. Zhou, H. Yue, L. Z. Rao, T. Yuan, B. Mo, F. X. Wang, L. M. Chen, F. Sun, J. Song, F. Xiong, S. Zhang, Q. Yu, P. Yang, Y. Xu, J. Zhao, H. Zhang, W. Xiong, C. Y. Wang, MBD2 serves as a viable target against pulmonary fibrosis by inhibiting macrophage M2 program. Sci Adv 7, (2021). A. Ghebremedhin, A. B. Salam, B. Adu-Addai, S. Noonan, R. Stratton, M. S. U. Ahmed, C. Khantwal, G. R. Martin, H. Lin, C. Andrews, B. Karanam, U. Rudloff, H. Lopez, J. Jaynes, C. Yates, A Novel CD206 Targeting Peptide Inhibits Bleomycin-Induced Pulmonary Fibrosis in Mice. Cells 12, (2023). P. F. Ma, C. C. Gao, J. Yi, J. L. Zhao, S. Q. Liang, Y. Zhao, Y. C. Ye, J. Bai, Q. J. Zheng, K. F. Dou, H. Han, H. Y. Qin, Cytotherapy with M1-polarized macrophages ameliorates liver fibrosis by modulating immune microenvironment in mice. J Hepatol 67, 770-779 (2017). V. Rybalko, P. L. Hsieh, M. Merscham-Banda, L. J. Suggs, R. P. Farrar, The Development of Macrophage-Mediated Cell Therapy to Improve Skeletal Muscle Function after Injury. PLoS One 10, e0145550 (2015). D. Gomez-Moreno, J. M. Adrover, A. Hidalgo, Neutrophils as effectors of vascular inflammation. Eur J Clin Invest 48 Suppl 2, e12940 (2018). A. Achaiah, A. Rathnapala, A. Pereira, H. Bothwell, K. Dwivedi, R. Barker, R. Benamore, R. K. Hoyles, V. Iotchkova, L. P. Ho, Monocyte and neutrophil levels are potentially linked to progression to IPF for patients with indeterminate UIP CT pattern. BMJ Open Respir Res 8, (2021). A. Pardo, R. Barrios, M. Gaxiola, L. Segura-Valdez, G. Carrillo, A. Estrada, M. Mejia, M. Selman, Increase of lung neutrophils in hypersensitivity pneumonitis is associated with lung fibrosis. Am J Respir Crit Care Med 161, 1698-1704 (2000). W. Xie, X. Chen, Q. Wang, C. Yan, Y. Liu, M. Zhang, Y. Sun, X. Yan, B. Guo, B. Chen, Sivelestat sodium: a novel therapeutic agent in a mouse model of acute exacerbation pulmonary fibrosis through multiple mechanisms. J Thorac Dis 17, 5024-5043 (2025). K. Morimoto, W. J. Janssen, M. Terada, Defective efferocytosis by alveolar macrophages in IPF patients. Respir Med 106, 1800-1803 (2012). Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryMaterials.pdf Dataset 1 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8675185","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":580389397,"identity":"743003cb-6bcf-4ddb-8936-375c371b9e1d","order_by":0,"name":"Jin Su","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApklEQVRIiWNgGAWjYHCChAMMFQw8QJokLWdI1MLAwNgG1kqkavkZCQ8PF86rlTFvT2D8XECMFoMbCQmHZ247ziNz5gGz9AyitEgAtfBuO8YjIZHAxsxDpMOAWuaQooUB5DDehhoStBiceZBwmOfYAR4JnofN0sQ5rD0n+TNPTZ29BHvywc/EOYyBJwFIHAZixgbiNDAwsB8AEnXEqh4Fo2AUjIKRCABsBS74lvQe5AAAAABJRU5ErkJggg==","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jin","middleName":"","lastName":"Su","suffix":""},{"id":580389398,"identity":"8e96f260-84a6-4123-b377-fa5e32a11ddf","order_by":1,"name":"Yunxin Lai","email":"","orcid":"","institution":"Guangzhou Medical Uninversity","correspondingAuthor":false,"prefix":"","firstName":"Yunxin","middleName":"","lastName":"Lai","suffix":""},{"id":580389399,"identity":"f28a5158-aba7-4093-a2de-d16407174d71","order_by":2,"name":"Xihui Huang","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xihui","middleName":"","lastName":"Huang","suffix":""},{"id":580389400,"identity":"5f99dbd8-b1f3-47b7-956d-a73099b27e8a","order_by":3,"name":"Junhui Yang","email":"","orcid":"","institution":"State Key Laboratory of Respiratory Disease, Guangzhou Institute of Respiratory Health, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Junhui","middleName":"","lastName":"Yang","suffix":""},{"id":580389401,"identity":"3b8a8585-bb3a-41fb-a217-7daafb8fad32","order_by":4,"name":"Xinru Wei","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xinru","middleName":"","lastName":"Wei","suffix":""},{"id":580389402,"identity":"b04ab084-c3ee-477e-9650-6136ef27fc8d","order_by":5,"name":"Guilin Li","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Guilin","middleName":"","lastName":"Li","suffix":""},{"id":580389403,"identity":"e38ac98c-5f06-4f3c-8e0d-06bb392accd6","order_by":6,"name":"Penghui Yang","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Penghui","middleName":"","lastName":"Yang","suffix":""},{"id":580389404,"identity":"e7f31582-8f86-4af5-a64b-8bc4422a347a","order_by":7,"name":"Xiao-Song Ben","email":"","orcid":"","institution":"Guangdong Provincial People’s Hospital (Guangdong Academy of Medical Sciences), Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiao-Song","middleName":"","lastName":"Ben","suffix":""},{"id":580389405,"identity":"a6787874-40c8-43c1-9479-2845d440bad1","order_by":8,"name":"Haopeng Wang","email":"","orcid":"https://orcid.org/0000-0002-4995-0838","institution":"Shanghaitech University","correspondingAuthor":false,"prefix":"","firstName":"Haopeng","middleName":"","lastName":"Wang","suffix":""},{"id":580389406,"identity":"2674d3c3-5f23-40f3-b417-1013053bed7e","order_by":9,"name":"Shizhen Qiu","email":"","orcid":"","institution":"ShanghaiTech University","correspondingAuthor":false,"prefix":"","firstName":"Shizhen","middleName":"","lastName":"Qiu","suffix":""},{"id":580389407,"identity":"8a3eff72-dbde-45bc-ad61-f3985cc68073","order_by":10,"name":"Kun Wang","email":"","orcid":"","institution":"ShanghaiTech University","correspondingAuthor":false,"prefix":"","firstName":"Kun","middleName":"","lastName":"Wang","suffix":""},{"id":580389408,"identity":"46168d9c-b9a4-41f2-a5aa-7b6602446b83","order_by":11,"name":"Ping Zhang","email":"","orcid":"","institution":"Feichuang Biomedical Technology (Guangzhou) Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Zhang","suffix":""},{"id":580389409,"identity":"e2f56da6-5c1d-46ba-89f1-a7c9f5361ec0","order_by":12,"name":"Jia Li","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jia","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2026-01-23 05:20:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8675185/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8675185/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101398110,"identity":"5a32f1b2-c089-4135-acff-e809427d77e3","added_by":"auto","created_at":"2026-01-29 09:39:40","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3057335,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration and characterization of DDR2-CARM. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Schematic structure of \u003cem\u003eDDR2-CAR\u003c/em\u003e and its control \u003cem\u003eGFP\u003c/em\u003e. A replication-incompetent adenoviral vector (Ad5) was used for \u003cem\u003eCAR\u003c/em\u003e transduction into macrophages. (\u003cstrong\u003eB\u003c/strong\u003e) Flow cytometry detection of adenoviral transduction efficiencies of GFP-M and DDR2-CARM. (\u003cstrong\u003eC\u003c/strong\u003e)\u003cem\u003e DDR2-CAR\u003c/em\u003e was highly expressed in DDR2-CARM as revealed by RT-qPCR. (\u003cstrong\u003eD\u003c/strong\u003e) Confocal imaging of WT-M (labeled by Dio), GFP-M and DDR2-CARM phagocytosing beads coated with DDR2 and Cy3. Beads and macrophages were incubated for 4h at bead-to-cell ratio of 5: 1 before imaging. Scale bar, 10 μm. (\u003cstrong\u003eE\u003c/strong\u003e) Numbers of beads-containing macrophages from ten random microscopic fields were compared between WT-M, GFP-M and DDR2-CARM. (\u003cstrong\u003eF\u003c/strong\u003e) Bulk RNAseq data were subjected to KEGG pathway enrichment analysis, and selected top upregulated pathways were shown between GFP-M vs WT-M, DDR2-CARM vs WT-M, and DDR2-CARM vs GFP-M. (\u003cstrong\u003eG\u003c/strong\u003e) Heatmap showing top upregulated or downregulated genes involved in cellular response to TLR4, inflammatory response, chemokine-mediated pathway and ECM remodeling (MMPs) in DDR2-CARM, compared to GFP-M and WT-M. Data (Cand E) represent mean ± SD and statistical differences were determined by one-way ANOVA with Tukey’s correction. *, p\u0026lt; 0.05; **, p\u0026lt; 0.01; ***, p\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/9d45be8bee9af5f30ca583fb.jpeg"},{"id":101365701,"identity":"79bdba41-eb28-4dd8-81c0-2195622742d1","added_by":"auto","created_at":"2026-01-29 00:57:09","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5060514,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDDR2-CARM prevented PF progression in a UPF mouse model.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Schematic of the approach used to evaluate the efficacy of DDR2-CARM in BLM-induced UPF mice.\u0026nbsp; (\u003cstrong\u003eB\u003c/strong\u003e) Weight changes of healthy control mice (Ctrl), UPF mice following BLM-instillation and treatment with PBS, GFP-M or DDR2-CARM (5×10\u003csup\u003e6 \u003c/sup\u003ecells per mouse). (\u003cstrong\u003eC\u003c/strong\u003e)\u003cem\u003e \u003c/em\u003eRepresentative images showing micro-CT (grey) and 3D-reconstruction (blue) of the lungs from Ctrl mice and UPF mice before (Day 8) and after (Day 27) treatment with PBS, GFP-M or DDR2-CARM. (\u003cstrong\u003eD\u003c/strong\u003e) Micro-CT results were used to reconstitute the aerated lung regions based on CT attenuation densities. (\u003cstrong\u003eE\u003c/strong\u003e) Fold changes of the aerated lung volumes of Ctrl mice (n=3) and UPF mice treated with PBS (n=3), GFP-M or DDR2-CARM (n=5) on day 27 relative to day 8. (\u003cstrong\u003eF\u003c/strong\u003e) transcriptional levels of genes for collagen I, fibronectin and DDR2 in the left lungs of Ctrl mice and UPF mice treated with PBS, GFP-M or DDR2-CARM (n=3). (\u003cstrong\u003eG\u003c/strong\u003e) HE and Sirius Red staining results (left) of the fibrotic left lungs from Ctrl and UPF mice treated with PBS, GFP-M or DDR2-CARM (n=5). The fibrotic area percentages within lung sections were compared (right). (\u003cstrong\u003eH\u003c/strong\u003e) α-SMA immunofluorescent staining of the fibrotic left lungs from Ctrl mice and UPF mice treated with PBS, GFP-M or DDR2-CARM. Scale bar, 50 μm. Data represent mean ± SEM and statistical differences were determined by one-way ANOVA (E, F, G) or two-way ANOVA (B) with Tukey’s correction. *, p\u0026lt; 0.05; **, p\u0026lt; 0.01; ***, p\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/08ff7e9b5ee5e5fc97cbc9fb.jpeg"},{"id":101398672,"identity":"57c9108d-fc4c-4802-98c6-fd50986522f6","added_by":"auto","created_at":"2026-01-29 09:43:53","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2781299,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDDR2-CARM treatment promoted collagen degradation and reduced DDR2\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+ \u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003estromal cells. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Schematic approaches used to assess the outcome of DDR2-CARM treatment in UPF mice. (\u003cstrong\u003eB\u003c/strong\u003e) Bioluminescent imaging of DiD-labeled GFP-M or DDR2-CARM in different lung lobes of UPF mice (n=5) 48 hours post intravenous injection. S, superior lobe; M, middle lobe; I, inferior lobe; P, post-caval lobe; L, left lung. (\u003cstrong\u003eC\u003c/strong\u003e) Detection of fragmented collagen in the lung cryosections of UPF mice on day 11 post-treatment with GFP-M or DDR2-CARM. Scale bar, 100 μm. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cem\u003e \u003c/em\u003eImmunofluorescent images of lung cryosections showing Dio-labeled infiltrated macrophages and DDR2\u003csup\u003e+ \u003c/sup\u003estromal cells. Scale bar, 10 μm.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/e72f36047816cb6d613ae0a1.jpeg"},{"id":101365704,"identity":"e7c6e83b-e695-4cb1-b4ce-458e4aa2d7f5","added_by":"auto","created_at":"2026-01-29 00:57:09","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2748237,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLung cell scRNA-seq revealed suppressed inflammation and neutrophil infiltration by DDR2-CARM treatment. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Experimental timeline for scRNA-seq analysis of lung cells from UPF mice untreated or treated with GFP-M or DDR2-CARM. (\u003cstrong\u003eB\u003c/strong\u003e) Visualization of UMAP map depicting distribution of color-coded lung cells. (\u003cstrong\u003eC\u003c/strong\u003e) Comparison of the ratios of different cell types within stromal and myeloid compartments in the left lungs between UPF mice untreated, treated with GFP-M or DDR2-CARM. (\u003cstrong\u003eD\u003c/strong\u003e) DDR2-CARM treatment suppressed immune and inflammatory responses in endothelial, stromal and myeloid cells, as revealed by KEGG and GOBP pathway analysis. (\u003cstrong\u003eE\u003c/strong\u003e) UMAP map depicting five subsets of neutrophils. (\u003cstrong\u003eF\u003c/strong\u003e) Comparison of the ratios and cell numbers of neutrophil subsets in the left lungs between UPF mice untreated, treated with GFP-M or DDR2-CARM. (\u003cstrong\u003eG\u003c/strong\u003e) Dot plot depicting expression of key genes in neutrophils from the left lungs of UPF mice untreated, treated with GFP-M or DDR2-CARM.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/195ee2a0bb0c5abc408bea6e.jpeg"},{"id":101365700,"identity":"896b858c-200a-43b0-9b8b-56896fa43984","added_by":"auto","created_at":"2026-01-29 00:57:09","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2131131,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuman DDR2-CARM attenuated fibrosis in IPF tissues.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Structure of the human \u003cem\u003eDDR2-CAR\u003c/em\u003e and its control \u003cem\u003eGFP\u003c/em\u003e. (\u003cstrong\u003eB\u003c/strong\u003e) Schematic of the approach used to evaluate the antifibrotic efficacy of human DDR2-CARM in ex vivo IPF PCLS. (\u003cstrong\u003eC\u003c/strong\u003e) Bioluminescent quantitative detection of DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells in ex vivo IPF PCLS cultured alone or cocultured with GFP-M or DDR2-CARM (5×10\u003csup\u003e5 \u003c/sup\u003ecells/cm\u003csup\u003e2\u003c/sup\u003e) for 5 days via an ICG-conjugated DDR2 antibody. All PCLS were cut from lung tissues from IPF patients. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cem\u003e \u003c/em\u003eRT-qPCR analysis of the transcripts of genes encoding DDR2, α-SMA, collagen-I and fibronectin in IPF PCLS cultured alone or cocultured with GFP-M or DDR2-CARM. Data were combined from three independent experiments. Data represent mean ± SEM and statistical differences were determined by one-way ANOVA with Tukey’s correction. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/ccbce6734843779b59742005.jpeg"},{"id":103597810,"identity":"91a22ef1-c2c8-4b4f-b613-50ee2d1b860c","added_by":"auto","created_at":"2026-02-27 13:26:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16751379,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/ae8c39e1-806c-495c-a4c4-22c025efaa50.pdf"},{"id":101365699,"identity":"f3b0bb66-0f5b-4b56-bfb6-63d010131b9c","added_by":"auto","created_at":"2026-01-29 00:57:09","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":776687,"visible":true,"origin":"","legend":"Dataset 1","description":"","filename":"SupplementaryMaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8675185/v1/8e899b48adb496357534032d.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Targeting pulmonary fibrosis with DDR2-specific chimeric antigen receptor macrophages","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eIdiopathic pulmonary fibrosis (IPF) is an irreversible and fatal lung disease characterized by persistent inflammation and activation of stromal cells that synthesize collagen-rich extracellular matrix (ECM), with limited therapeutic options and a critical unmet therapeutic need (\u003cem\u003e1, 2\u003c/em\u003e). Current strategies, such as antifibrotic drugs, offer only modest survival benefits. Although IPF patients in late stage survive with lung transplantation, they have a median survival duration of only 6 years after surgery (\u003cem\u003e3\u003c/em\u003e), underscoring the urgency for innovative therapies targeting the fibrotic microenvironment.\u003c/p\u003e\n\u003cp\u003eChimeric antigen receptor (CAR) macrophages have emerged as a promising cell-based immunotherapy platform, leveraging their phagocytic capacity and immunomodulatory functions. However, in fibrotic diseases, CAR macrophage research has been predominantly confined to targeting fibroblast activation protein (FAP) (\u003cem\u003e4, 5\u003c/em\u003e), leaving other cell-membrane proteins—particularly those involved in stromal dysregulation—largely unexplored. Discoidin Domain Receptor 2 (DDR2), a collagen-binding receptor, is significantly upregulated in stromal cells during IPF progression (\u003cem\u003e6\u003c/em\u003e). Moreover, \u003cem\u003eDdr2\u003c/em\u003e-deleted mice were reported to be resistant to the induction of pulmonary fibrosis (PF) (\u003cem\u003e7, 8\u003c/em\u003e). These results position DDR2 as a promising novel target for CAR macrophage intervention.\u003c/p\u003e\n\u003cp\u003eIn this study, we developed and characterized DDR2-specific CAR macrophages (DDR2-CARM) and evaluated their therapeutic potential in pulmonary fibrosis. We demonstrated that DDR2-CARM effectively mitigated PF through robust tissue remodeling functions. DDR2-CARM targeted DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells and promoted collagen degradation. Notably, they also remodeled immune responses in fibrogenesis exemplified by suppressing chronic tissue inflammation through inhibiting inflammatory neutrophil infiltration, a process associated with poor prognosis in IPF patients (\u003cem\u003e9, 10\u003c/em\u003e). Thus, DDR2-CARM represent a novel approach to target fibrosis and address the pathogenic crosstalk between stromal cells and inflammatory mediators in IPF, offering a promising therapeutic strategy for this devastating disease.\u003c/p\u003e"},{"header":"RESULTS ","content":"\u003cp\u003e\u003cstrong\u003eGeneration and characterization of DDR2-CARM\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe recently showed that elevated DDR2 expression is an ideal stromal biomarker for PET/CT diagnosis of IPF (medRxiv preprint doi: https://doi.org/10.1101/2025.11.26.25341068), reminiscent of public data from single cell RNA sequencing (sc-RNAseq) of human IPF which showed enriched \u003cem\u003eDDR2\u003c/em\u003e expression in stromal cells and a small fraction of endothelial cells (fig. S1A). Spatial mapping of transcriptome revealed significant upregulation of \u003cem\u003eDDR2\u003c/em\u003e in human IPF and bleomycin(BLM)-induced mouse PF tissues (\u003cem\u003e11, 12\u003c/em\u003e) (figs. S1B and S1C). We confirmed the upregulation of \u003cem\u003eDDR2\u003c/em\u003e in the fibrotic lungs from BLM-instilled mice by reverse transcription quantitative PCR (RT-qPCR) (fig. S1D). Therefore, DDR2 represents a potential new target for therapeutics in IPF. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo target DDR2 by CAR macrophages with antifibrotic functions, we designed a CAR incorporating a DDR2-specific nanobody (fig. S2), the hinge, transmembrane and TIR domains of TLR4, and the intracellular domain of FcgR1 (Fig. 1A). To generate DDR2-CARM, adenoviral transduction was performed on mouse bone marrow derived macrophages (BMDMs), achieving transduction efficiencies exceeding 95% (Fig. 1B). The \u003cem\u003eCAR\u003c/em\u003e expression was highly detected by RT-qPCR in DDR2-CARM, but not wild type macrophages (WT-M) or GFP-M (Fig. 1C). Phagocytosis and efferocytosis are two pivotal functions of macrophages. To evaluate DDR2-CAR-mediated phagocytosis, we coated streptavidin magnetic beads (1\u0026mu;m) with ligand of the CAR, extracellular domain of DDR2 (DDR2-ECD), labeled them with dye Cy3, and cocultured them with DDR2-CARM or control macrophages (WT-M were labeled with green dye Dio). Through fluorescence imaging, we found that DDR2-CARM ingested DDR2\u003csup\u003e+\u003c/sup\u003e beads more efficiently than control macrophages (Fig. 1, D and\u0026nbsp;E), suggesting that DDR2-CAR can induce phagocytosis and possibly efferocytosis since the size of the beads was comparable to that of apoptotic bodies. To map the transcriptomic changes induced by DDR2-CAR, we stimulated WT-M, GFP-M and DDR2-CARM with DDR2-ECD for 24h and performed bulk RNA sequencing. \u0026nbsp;Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that our DDR2-CAR upregulated TNF signaling, NF-kappa B signaling, HIF-1 signaling and Toll-like receptor signaling (Fig. 1F). Gene expression analysis of bulk RNA-seq data also revealed that TLR4 signaling, inflammatory response, and chemokines were specifically upregulated by DDR2-CAR. \u003cem\u003eNos2, Saa3,\u003c/em\u003e and \u003cem\u003eMarco\u003c/em\u003e were among the top upregulated genes in DDR2-CARM. Nos2 and Saa3 promote the inflammatory response and Marco encodes a scavenger receptor that phagocytoses un-opsonized particles or pathogens. Moreover, DDR2-CARM showed downregulated \u003cem\u003eS100a4\u003c/em\u003e and \u003cem\u003eS100a8/a9\u003c/em\u003e, which are established therapeutic targets for IPF (\u003cem\u003e13-17\u003c/em\u003e), while upregulating expression of \u003cem\u003eMmp2, Mmp13, Mmp14\u003c/em\u003e and \u003cem\u003eMmp25\u003c/em\u003e (Fig. 1G). The above data suggest that DDR2-CARM can induce antifibrotic responses through DDR2-specific phagocytosis and DDR2-induced expression of antifibrotic cytokines, chemokines and MMPs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDDR2-CARM prevented fibrosis progression in bleomycin-induced murine UPF models\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo ascertain the antifibrotic function of DDR2-CARM in PF, we established a unilateral pulmonary fibrosis (UPF) mouse model by instillation of BLM solution selectively into the left lung lobe, and the establishment of UPF was confirmed by micro-CT on day 8, and UPF mice were randomized to receive intravenous injection of 5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e GFP-M or DDR2-CARM on day 10 (Fig.\u0026nbsp;2A). UPF mice treated with DDR2-CARM experienced improved weight gain compared to those treated with PBS or GFP-M (Fig. 2B). DDR2-CARM treatment significantly inhibited the progression of PF, as revealed by micro-CT imaging (Fig. 2C) and aerated lung volume comparison (Fig.\u0026nbsp;2, D and E) on day 27. On day 28, all mice were sacrificed, and RT-qPCR revealed reduced expression of \u003cem\u003eCol1a1, Fn\u003c/em\u003e and \u003cem\u003eDdr2\u0026nbsp;\u003c/em\u003ein the left lungs from DDR2-CARM treated mice, compared to those treated with PBS or GFP-M (Fig. 2F). \u0026nbsp;Hematoxylin-eosin (HE) staining and Sirius Red staining of the left lung sections confirmed the reduction of fibrosis in mice treated with DDR2-CARM, but not mice treated with GFP-M (Fig. 2G). \u0026alpha;-SMA immunofluorescence staining revealed diminished myofibroblasts in the left lungs of mice treated with DDR2-CARM (Fig. 2H). \u0026nbsp;Serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) as well as histology of major organs indicated that DDR2-CARM treatment did not lead to discernable toxic effects (fig. S3). To determine the minimal effective dosage of DDR2-CARM, we treated UPF mice with reduced numbers of DDR2-CARM and found that 2.5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells were sufficient for anti-fibrotic efficacy (fig. S4). Taken together, these results demonstrated the potent therapeutic efficacy of DDR2-CARM in PF.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDDR2-CARM treatment reduced DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells and degraded collagen in the fibrotic lungs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain insight into how DDR2-CARM function in vivo, we firstly asked whether DDR2-CARM could preferentially migrate to fibrotic lungs. We labeled GFP-M and DDR2-CARM with DiD, a dye that can be used for ex vivo bioluminescence imaging, and labeled cells were intravenously injected into UPF mice, and DiD bioluminescence in different lung lobes was performed 48 hours later (Fig. 3A). The results clearly showed that DiD signals were more enriched in the left lungs (Fig. 3B), suggesting a preferential migration of DDR2-CARM into fibrotic lungs. Then we wanted to know whether DDR2-CARM targeted DDR2\u003csup\u003e+\u0026nbsp;\u003c/sup\u003estromal cells and collagen in fibrotic lungs. We intravenously injected DiD-labeled GFP-M or DDR2-CARM into UPF mice on day 10 post BLM instillation in order to assess collagen degradation extent and DDR2\u003csup\u003e+\u003c/sup\u003e stromal cell numbers in the left lungs (Fig. 3A). Collagen degradation is initiated by unfolding and fragmentation of triple helix which can be detected by Cy5-labeled collagen hybridizing peptide (Cy5-CHP) (\u003cem\u003e18, 19\u003c/em\u003e). Through Cy5-CHP immunofluorescence staining, we found that DDR2-CARM treatment led to higher Cy5 signals in the fibrotic lungs compared to GFP-M treatment on day 21 (Fig.\u0026nbsp;3C). This indicated that DDR2-CARM treatment promoted collagen degradation in the fibrotic lungs. In addition, immunofluorescence imaging showed that more DDR2-CARM retained in the fibrotic lungs on day 28 compared with GFP-M, and DDR2-CARM treatment led to dramatically reduced DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells in the fibrotic lungs, with residual DDR2\u003csup\u003e+\u003c/sup\u003e cells exhibiting internalization of DDR2; moreover, we observed interactions between DDR2-CARM and DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells (Fig. 3D). To confirm the interactions between DDR2-CARM and DDR2\u003csup\u003e+\u003c/sup\u003estromal cells, we conducted two-photon microscopy to analyze the fibrotic lung tissues from mice treated with GFP-M or DDR2-CARM for 2 days. We found that nearly all DDR2\u003csup\u003e+\u0026nbsp;\u003c/sup\u003estromal cells interacted with DDR2-CARM, but few DDR2\u003csup\u003e+\u0026nbsp;\u003c/sup\u003estromal cells interacted with GFP-M (Video S1 and S2).\u003c/p\u003e\n\u003cp\u003eTo further evaluate the duration of DDR2-CARM persistence in fibrotic lungs, we infused CD45.1 DiD-labeled DDR2-CARM into CD45.2 UPF mice and monitored DiD signals in the left lungs at different time points (fig. S5A). DDR2-CARM persisted in fibrotic lungs throughout the entire observation period, up to the final time point of 16 weeks (fig. S5B). Further CD45.1 immunohistochemistry confirmed the presence of infused DDR2-CARM as interstitial macrophages but not alveolar macrophages in the fibrotic lungs (fig. S5C), which is important given that monocyte-derived alveolar macrophages are key players in IPF pathogenesis (\u003cem\u003e20, 21\u003c/em\u003e). Therefore, these data demonstrated that our DDR2-CARM can migrate to and reside for a long term in the fibrotic lungs where they drive degradation of collagen, and meanwhile recognize and reduce DDR2\u003csup\u003e+\u0026nbsp;\u003c/sup\u003estromal cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDDR2-CARM inhibited chronic inflammation via suppressing profibrotic neutrophil infiltration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince macrophages are master regulators of tissue homeostasis, we sought to determine whether DDR2-CARM treatment led to fibrotic microenvironment remodeling necessary for antifibrotic efficacy. To this end, we performed single-cell RNA-sequencing (scRNA-seq) on cells isolated from the left lungs of UPF mice untreated (UTD), treated with GFP-M or DDR2-CARM on day 10 post BLM-instillation for 8 days (Fig. 4A). The scRNA-seq data were subjected to quality control filtering based on UMI counts, gene expression numbers, and mitochondrial gene proportions, retaining only high-quality cells for subsequent analysis (Supplementary table 1). Following quality control and normalization, Uniform Manifold Approximation and Projection (UMAP) visualization of the scRNA-seq data highlighted the separation of major lung cell types, including epithelial cells (AT1 \u0026amp; AT2), B cells, endothelial cells, fibroblasts, myeloid cells, neutrophils, secretory \u0026amp; ciliated cells, smooth muscle cells (SMC) \u0026amp; pericytes and T cells (Fig. 4B). \u0026nbsp;First, we analyzed the ratios of cell types in both stromal and myeloid compartments, which remained largely unaffected by DDR2-CARM treatment (Fig. 4C). To determine the effect of DDR2-CARM treatment on the gene expression profile of endothelial, stromal and myeloid cells, we then performed KEGG and Gene Ontology Biological Process (GOBP) analysis, which revealed that DDR2-CARM treatment led to a contradictory suppression of immune and inflammatory responses in these cell compartments (Fig. 4D). This apparent contradiction was intriguing, given that DDR2-CARM were shown to secrete pro-inflammatory cytokines and chemokines. Yet, we found that DDR2-CARM treatment led to dramatically decreased neutrophil responses in the fibrotic lungs. UMAP analysis revealed five subsets of neutrophils defined by high expression of \u003cem\u003eRetnlg\u003c/em\u003e (Retnlg\u003csup\u003eHI\u003c/sup\u003e), interferon-stimulated genes (ISG\u003csup\u003eHI\u003c/sup\u003e), genes regulated by nuclear factor NF\u0026kappa;B) (NF\u0026kappa;B\u003csup\u003eHI\u003c/sup\u003e), genes regulated by hypoxia inducible factor 1 (HIF-1\u003csup\u003eHI\u003c/sup\u003e), and the classically eosinophilic surface marker SiglecF (SigF\u003csup\u003eHI\u003c/sup\u003e) (fig. S6). DDR2-CARM treatment primarily enriched for Retnlg\u003csup\u003eHI\u003c/sup\u003e neutrophils, with minimal or no presence of other subsets, and therefore led to dramatic decrease in neutrophil number in the fibrotic lungs (Fig. 4, E and F). Retnlg\u003csup\u003eHI\u003c/sup\u003e neutrophils have been found to be highly immunosuppressive in tumor (\u003cem\u003e22\u003c/em\u003e). Concordantly, theneutrophils in UPF mice treated with DDR2-CARM showed much lower expression of \u003cem\u003eCsf1, Ccl3, Ccl4, Ccl5, Tnf, and Ila\u003c/em\u003e, but higher expression of \u003cem\u003eMmp8\u003c/em\u003e and \u003cem\u003eMmp9,\u0026nbsp;\u003c/em\u003ecompared with those from untreated or GFP-M-treated UPF mice (Fig. 4G). For SigF\u003csup\u003eHI\u0026nbsp;\u003c/sup\u003eneutrophils, recent work revealed that they contribute to PF through the release of neutrophil extracellular traps (NETs) (\u003cem\u003e23\u003c/em\u003e). These results indicated that DDR2-CARM played a complex regulatory role which inhibited profibrotic neutrophil infiltration into injured lung tissues and suppressed chronic inflammation, allowing for their antifibrotic efficacy. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman DDR2-CARM inhibited ex vivo fibrogenesis in IPF lung slices\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFinally, we sought to determine whether DDR2-CARM were translatable. We designed a human version of DDR2-CAR, which comprised the 1A12 (DDR2 is highly homologous between human and mouse), the hinge, transmembrane and TIR domains of human TLR4, and intracellular domain of human Fc\u0026gamma;RI (Fig. 5A). Lung tissues from IPF patients were used to generate precision-cut lung slices (PCLS), which were cultured alone or cocultured with GFP-M or DDR2-CARM, followed by detection of DDR2\u003csup\u003e+\u003c/sup\u003e cells and expression of key fibrotic genes (Fig. 5B). As a result, significantly lower levels of both DDR2\u003csup\u003e+\u003c/sup\u003e cells and transcripts of genes encoding \u0026alpha;-SMA, collagen-I and fibronectin were detected in IPF PCLS cocultured with DDR2-CARM, compared to those cultured alone or cocultured with GFP-M (Fig. 5, C and D). This experiment indicated that our DDR2-CARM hold the potential to treat intractable pulmonary fibrosis such IPF in humans.\u003c/p\u003e\n\u003cp\u003eCollectively, our study demonstrated that DDR2-CARM robustly suppressed fibrogenesis in mouse models and ex vivo IPF tissues. We further identified a novel mechanism by which DDR2-CARM mediated antifibrotic effects, prompting further exploration into the cross-talk between CAR macrophages and neutrophils in damaged tissues. Thus, we have established DDR2 as a new stroma-specific biomarker, in addition to FAP, that can be targeted in attempts to treat fibrotic diseases.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eWe designed a proinflammatory \u003cem\u003eDDR2-CAR\u003c/em\u003e that drives M1 polarization of DDR2-CARM, since multiple studies have revealed that targeting M2 macrophages is effective at treating pulmonary fibrosis (\u003cem\u003e24-28\u003c/em\u003e) while M1 macrophages have been shown to ameliorate fibrosis (\u003cem\u003e29, 30\u003c/em\u003e). We demonstrated that DDR2-CARM potently inhibited PF. Paradoxically, despite DDR2-CARM\u0026rsquo;s induction of pro-inflammatory signaling pathways (e.g., TNF and NF-kappa B; Fig. 1F), scRNA-seq analysis revealed an overall dampening of inflammation. \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCrucially, we showed that DDR2-CARM treatment dramatically suppressed profibrotic neutrophil infiltration in fibrotic lungs, reducing key subsets such as NF\u0026kappa;B\u003csup\u003eHI\u003c/sup\u003e and HIF-1\u003csup\u003eHI\u003c/sup\u003e neutrophils, while retaining Retnlg\u003csup\u003eHI\u003c/sup\u003e subset which exhibits much lower expression of pro-inflammatory cytokines (e.g., \u003cem\u003eCsf1, Ccl3, Ccl4\u003c/em\u003e) and upregulated MMPs like \u003cem\u003eMmp8\u003c/em\u003e and \u003cem\u003eMmp9\u003c/em\u003e (Fig. 4, E-G). As the most abundant immune cells in circulation, neutrophils play key roles in the early immune responses to tissue damage, but the role of neutrophils in IPF is poorly understood. In many instances, recruited neutrophils are detrimental rather than protective as they release a toxic cargo that compromises vascular integrity or induces thrombosis (\u003cem\u003e31\u003c/em\u003e). Furthermore, an increase of neutrophils and specific NETs components were correlated with the pathogenesis of IPF (\u003cem\u003e10, 32, 33\u003c/em\u003e). Targeting neutrophil represents a new strategy to treat IPF. For example, neutrophil elastase inhibitor Sivelestat has been proved to be a potential candidate drug for acute exacerbation pulmonary fibrosis (\u003cem\u003e34\u003c/em\u003e). In this study, we unprecedentedly revealed a new strategy leveraging CAR macrophages to regulate neutrophil function in fibrogenesis.\u003c/p\u003e\n\u003cp\u003eFurther studies are needed to elucidate how DDR2-CARM dampen neutrophil infiltration and inflammation during fibrogenesis. We speculate that DDR2-CARM exerted phagocytosis and efferocytosis, functions that have been shown impaired in alveolar macrophages isolated from IPF patients (\u003cem\u003e35\u003c/em\u003e), facilitating the clearance of cell debris and microbes in injured lung tissues. Moreover, the observation that DDR2-CARM ultimately reside in the lung as interstitial macrophages suggests that they can bind with DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells like pericytes and serve as physical barrier preventing neutrophil extravasation.\u003c/p\u003e\n\u003cp\u003eCollectively, our data demonstrated that DDR2-CARM represent a potent and translatable therapeutic strategy for IPF, leveraging the phagocytic and immunomodulatory capacities of macrophages to target stromal dysregulation. Our findings not only validate DDR2 as a viable therapeutic target but also elucidate a multifaceted mechanism by which DDR2-CARM attenuates fibrosis progression, with a particular emphasis on its role in modulating neutrophil-driven inflammation. This multifunctionality addresses a critical gap in IPF therapy, as current antifibrotic agents offer only modest benefits by targeting single pathways.\u003c/p\u003e\n\u003cp\u003eDespite these promising results, several limitations warrant consideration. First, our in vivo models primarily relied on BLM-induced murine fibrosis, which may not fully recapitulate the chronicity and heterogeneity of human IPF. Second, while DDR2-CARM showed no discernible toxicity in major organs (fig. \u0026nbsp;S3), long-term safety profiles\u0026mdash;including potential off-target effects or CAR-mediated hyperinflammation\u0026mdash;remain unassessed beyond 16 weeks (fig. S5B). Additionally, the reliance on adenoviral transduction for CAR expression introduces scalability concerns for clinical applications. Finally, the scRNA-seq data, though insightful, focused on a single time point following DDR2-CARM treatment; neutrophil subset dynamics and their interactions with other immune cells (e.g., macrophages) merit deeper investigation.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eStudy design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe objective of this study was to develop CAR macrophages for treating pulmonary fibrosis.\u0026nbsp;CAR macrophages targeting DDR2 (DDR2-CARM) were generated through adenoviral transduction. DDR2-CARM function was evaluated in vitro through phagocytosis assays and bulk RNA sequencing. Anti-fibrotic efficacy of murine DDR2-CARM was assessed in bleomycin-induced unilateral pulmonary fibrosis (UPF) mouse models. Human DDR2-CARM were tested by coculturing with ex vivo precision-cut lung slices (PCLS) from IPF patients. Single-cell RNA sequencing was performed to characterize the immune remodeling induced by DDR2-CARM in fibrotic lungs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUPF mouse model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll mice were housed in cages with an ad libitum access to water and food in specific-pathogen-free (SPF) facilities and all experiments were approved by the First Affiliated Hospital of Guangzhou Medical University. Male C57BL/6 mice (6-8 weeks) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. UPF was induced through a non-invasive unilateral endotracheal instillation of BLM. Briefly, mice were anesthetized through intraperitoneal injection of pentobarbital sodium (50 mg/kg) and fixed on a flat board with the ventral surface and rostrum facing upwards. The tongue was gently retracted using a curved blade Kelly forceps and the respiratory secretions were suctioned with a blunted 22G Indwelling Cannula connected to a 1 ml syringe. Blunted needle of 22G Indwelling Cannula was gently inserted into the main bronchus, and further inserted into the left principal bronchus after rotating the mouse clockwise to ensure a lower position for the left lung. 40 μl BLM (0.5mg/ml, dissolved in sterile 0.9% saline) was added to the 22G Indwelling Cannula, and instilled into the left lung with a 1 ml syringe. Control healthy mice (Ctrl) received equal volumes of sterile 0.9% saline. Micro-computed tomography (micro-CT) analysis (PINGSENG Healthcare Inc., SNC-100, China) was done on day 7 following BLM instillation to confirm UPF establishment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrecision-cut lung slices (PCLS)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human IPF lung tissues were cut into slices with a vibratome (DOSAKA, DTK-1000N). The lung tissues were rinsed three times with cold PBS containing 1% penicillin and streptomycin to remove possible contamination and then embedded in 2% low-melting agarose on ice for 30 min. The agarose gel containing lung tissues were cut into small blocks in sterile condition. The agarose blocks were glued, using standard cyanoacrylate glue, directly onto the platform and the tray were filled with ice cold PBS buffer to completely cover the agarose blocks, which were then cut into slices measuring 600 micrometers in thickness.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative reverse transcription PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from macrophages, lung tissues or kidneys with an RNA isolation kit (Cat#RC112, Vazyme) and cDNA was synthesized with a cDNA reverse transcription kit (Cat#A0010CGQ, EZB). Quantitative real-time PCR was done according to the protocol for TaqMan gene expression assay kits (Applied Biosystems). Results were normalized to the expression of GAPDH\u0026nbsp;or β-actin mRNA. The primers for target genes were as follows: Col1a1: F, ggagggcgagtgctgtgcttt; R, gggaccaggaggaccaggaagt; Gapdh: F, tggccttccgtgttcctac; R, gagttgctgttgaagtcgca; Ddr2: F, gaggccacattccagatgag; R, agagtccagcctcccatatt; DDR2: F, ctcccagaatttgctccag; R, gccacatctttcctgaga; FN1: F, cggtggctgtcagtcaaag; R, aaacctcggcttcctccataa; COL1A1: F, gagggccaagacgaagacatc; R, cagatcacgtcatcgcacaac; Actb: F, gtgacgttgacatccgtaaaga; R, gccggactcatcgtactcc; ACTB: F, catgtacgttgctatccaggc; R, ctccttaatgtcacgcacgat; DDR2-CAR: F, cctgagcaaacagcagagga; R, cgccatcgcttctaacttgc.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDDR2 antibodies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe obtained the DDR2 nanobody 1A12 through high throughput screening of an antibody phage library (patent application No. PCT/CN2023/110789). 1A12 containing a His-tag was expressed and produced by 293F cells, and isolated from the supernatant through Ni-NTA affinity purification. 1A12 was labeled with Cy3 for fluorescent staining. Another DDR2 antibody HL2 was derived from chicken immunization with DDR2 extracellular domain. The Fabs of HL2 were fused with human IgG Fc to generate the HL2-hFc chimeric antibody. HL2-hFc was used in the immunofluorescence staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDDR2\u003csup\u003e+\u003c/sup\u003e Cy3\u003csup\u003e+\u0026nbsp;\u003c/sup\u003ebeads\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo derive DDR2\u003csup\u003e+\u003c/sup\u003eCy3\u003csup\u003e+\u003c/sup\u003e beads for phagocytosis assays, we dissolved sulfo-NHS-Biotin in anhydrous DMF to prepare a Biotin/DMF solution, which was added with DDR2 protein at molar ratio of 50:1 between Biotin and DDR2. The reaction was allowed to proceed on ice for 2 hours to generate Biotin-labeled DDR2, and unbound Biotin was removed from the mixture through Amicon® Ultra Centrifugal Filter (10 kDa). Streptavidin magnetic beads were mixed with Biotin-labeled DDR2 (100 μl beads/μg DDR2-biotin), and vortexed at room temperature for 1 hour, and then wash twice with PBS. Cy3 dye was mix the DDR2-beads at a molar ratio of 1:2. The pH of the mixture was adjusted to 10, and incubate at room temperature in the dark for 1 hour. Beads were washed twice with PBS to remove unbound Cy3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLung histology and immunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLung tissues from mice were fixed with 10% neutral buffered formalin and then embedded with paraffin wax and sectioned (5-7 micrometers). lung sections (3 μm) were prepared, deparaffinized and stained with hematoxylin and eosin (HE) and Sirius red according to the manufacturer’s instructions. For macrophage tracing, sections were stained with CD45.1 (Cat#MABF591, Sigma) and then Biotin-labeled goat anti-mouse/rabbit IgG (Boster, SA1020). Slides were imaged on a Leica Scanscope XT and analysed using Aperio software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMicro-CT analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe in vivo micro-CT analysis of mice was done as previously(\u003cem\u003e19\u003c/em\u003e). Mice were anesthetized by isoflurane inhalation before subjected to high-resolution scanning (50 μm voxel size) using the Super Nova CT (PINGSENG Healthcare Inc., SNC-100, China) according to the manufacturer’s instructions. Results were analyzed with the algorithms of three-dimensional (3D) finite element (AVATAR 1.5.0, PINGSENG Healthcare Inc., China). Briefly, axial and coronal images were analyzed for identical in vivo signs (e.g., right bronchus bifurcation), which were defined as fibrotic areas.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLung\u0026nbsp;3D reconstruction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e3D Slicer (\u003ca href=\"http://www.slicer.org\"\u003ehttp://www.slicer.org\u003c/a\u003e) was used for micro-CT image computing and visualization of the regions of interest (ROI) in each lung CT slice. To quantify progression of lung fibrosis, semi-automatic segmentation was employed to define the airways and total lung volume. Hounsfield Unit (HU) clinical ranges were applied to rescaled HU images, dividing the lung parenchyma into normally aerated (-1000 to -350 HU) regions. Unilateral lung volumes were then quantitatively calculated by segmenting normally aerated regions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioluminescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the migration of DDR2-CARM into fibrotic lungs, GFP-M and DDR2-CARM were labeled with DiD dye (Ex=644 nm, Em=665 nm), and injected intravenously into UPF mice (5×10\u003csup\u003e6\u003c/sup\u003e cells per mouse). 48 h later, all lung lobes were analyzed by bioluminescence imaging to trace DiD signals emanated from infused macrophages. To determine how long DDR2-CARM could persist in the fibrotic lungs of mice, DDR2-CARM were also labeled with DiD dye and injected intravenously into UPF mice (5×10\u003csup\u003e6\u003c/sup\u003e cells per mouse). At week 4, 6, 8, and 16 post injection, the left fibrotic lungs were analyzed through bioluminescence to detect DiD signals. Indocyanine Green (ICG) conjugated HL2-hFc antibody was used to stain the PCLS for quantification of DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOptimal cutting temperature compound (OCT compound) was used to embed tissue samples prior to frozen sectioning on a microtome - HM525NX. For myofibroblasts staining, lung frozen-sections were stained anti-α-SMA antibody (CA#ab5694, Abcam, 1:200 diluted) and then Goat Anti-Rabbit IgG H\u0026amp;L (Alexa Fluor® 488) (CA#ab150077, Abcam). To analyze collagen degradation, lung frozen-sections were stained with CHP-Cy5. For anti-DDR2 staining, HL2-hFc (1:200 diluted) antibody and secondary antibody Flare570 (Cat# HKI0015, Haokebio) were used. Staining was amplified using Tyramide Signal Amplification. Sections were finally incubated with DAPI (1:500) for 5 min to stain cell nuclei. The infused Dio-labeled macrophages in lung sections were analyzed through Dio fluorescence. Fluorescent imaging was done on a fluorescence microscope Olympus BX53. Images were processed with CaseViewer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBulk RNA sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUTD, GFP-M, and DDR2-CARM were stimulated with 500 ng/ml DDR2 recombinant protein for 48 hours and sent for bulk RNA-seq. Bulk RNA-seq was performed by Guangzhou IGE Biotechnology Co., Ltd. RNA from macrophages were extracted using the Qiagen RNA isolation kit according to the manufacturer’s instructions. RNA was then fragmented, reverse transcribed, added with adenine at the 3’ end, ligated with adaptors and subjected to polymerase chain reactions (PCR). PCR products were then used for sequencing using the Illumina Novaseq6000PE150. The sequencing data passed quality tests and were used for differential gene expression analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdenovirus packaging\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe non-replicating Ad5 adenoviruses were packaged by OBiO Technology (Shanghai) Corp., Ltd. AdMax system was used to generate adenoviral vectors. Shuttle plasmid pcADV-EF1-mNeoGreen-CMV-MCS was used to package control adenovirus and pcADV-EF1-mNeoGreen-CMV-CARs containing CAR sequences were used to package adenoviruses. 293A cells were transfected with plasmids (1:1 ratio of shuttle plasmid and Ad5 genomic plasmid) for initial packaging. Media were changed every three days until visible virus plaques formed 7-15 days later. Supernatant containing adenoviruses was collected after complete cytolysis. HEK293 cells were used to expand adenoviruses. Briefly, adenoviruses (about 107-108PFU/ml) were added to HEK293 cells for expansion for 2-3 days, and 10% Nonidet P 40 (NP40) was added to lyse the cells. Cell lysates were centrifuge at 12000 rpm for 10 minutes to collect the supernatant. Precipitation solution (20% PEG8000, 2.5M Nacl) was added to supernatant at 1: 2 volume ratio to precipitate the adenoviruses on ice for 1 hour before centrifugation at 12000 rpm for 20 minutes to collect adenoviruses. Adenoviruses were then resuspended in 10 ml CsCl solution (1.10g/ml, 20 mM Tris-HCl, pH 8.0), centrifuged at 4℃ and 7000 rpm for 5 minutes and adenovirus supernatant was collected. 2 ml 1.4g/ml CsCl solution, 3 ml 1.30 g/ml CsCl solution, and 5 ml adenovirus supernatant were sequentially added to a Beckman ultracentrifuge tube, which was then centrifuged at 22800 rpm and 4℃ for 2.5 hours. Adenoviruses concentrated between 1.3g/ml -1.4g/ml CsCl solution were transferred into dialysis bags for dialysis before storage at -80℃.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMouse DDR2-CARM generation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFemur bone marrow cells of C57BL/6 mice were flushed out with cold sterile PBS with a 1ml syringe, and filtered through a 70 μm filter. After red blood cell lysis, bone marrow cells were washed twice with cold PBS and cultured with DMEM media containing 50 ng/ml M-CSF, 10% fetal bovine serum and 1% streptomycin\u0026amp; penicillin at cell density of 1-2×10\u003csup\u003e6\u003c/sup\u003e cells/ml. Half of the media were renewed after culture for three days. On day 5-6, all media were renewed and adenoviruses were added at the MOI of 500. After 24 hours of transfection, BMDMs were cultured in fresh media for another 48 hours and used for subsequent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman DDR2-CARM generation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMononuclear cells were isolated from cord blood through Ficoll gradient centrifugation. Cord blood was diluted with an equal volume of cold PBS and added gently onto Ficoll in 50 ml tubes and centrifuged at 800g for 20min. Cells were collected from which CD14\u003csup\u003e+\u003c/sup\u003e monocytes were purified by magnetic cell sorting (Miltenyi, 130-118-906). Monocytes were cultured in DMEM media with 10ng/ml hGM-CSF for 5 days for macrophage differentiation. Macrophages were then transfected with adenovirus at MOI of 500 for 24h and cultured in fresh media for another 24h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSingle-cell RNA-seq data processing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaw sequencing reads were aligned to the mm10 reference genome using CellRanger Count (v7.0.0, 10x Genomics) with default settings. Resulting count matrices were imported into Seurat (v4.1.1) for quality control, filtering cells with 400–7000 detected genes and \u0026lt;15% mitochondrial RNA. Library-specific quality metrics are provided in Table SXXX. Doublets were detected and removed using DoubletFinder (v2.0.3).\u003c/p\u003e\n\u003cp\u003eAfter per-sample filtering, Seurat objects were merged. Data normalization, identification of the top 2000 highly variable genes (HVGs), scaling, and principal component analysis (PCA) were performed according to the Seurat pbmc3k tutorial. Batch effects across samples were corrected using Harmony (v0.1). Neighborhood graph computing, Leiden clustering and UMAP embedding were conducted based on the first 15 Harmony-corrected PCA coordinates. Major cell types were annotated using canonical markers including epithelial (Epcam, Krt19, Krt8), B (Cd79a, Cd79b，Ms4a1), stromal (Col1a1, Col1a2, Acta2), T (Cd3d, Cd3e), myeloid (Cst3, Lyz2, Cd68, Cd14), neutrophil (Csf3r, Il1r2, G0s2), endothelial (Pecam1, Vwf, Cdh5).\u003c/p\u003e\n\u003cp\u003eEach major cell type was subsetted for further subclustering using the same pipeline. Differentially expressed genes (DEGs) between sample pairs were identified using Seurat’s FindMarkers() (min.pct = 0.1, logfc.threshold = 0). Gene set enrichment analysis (GSEA) was performed on ranked gene lists using clusterProfiler (v4.2.0) with msigdbr (v7.5.1). Pathway activity scores were calculated with Seurat’s AddModuleScore(), retaining only genes expressed in ≥5% of cells, and visualized using SCP’s GroupHeatmap() function (SCP v0.4.8) .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMacrophage phagocytosis assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor evaluation of the antigen-specific phagocytosis capacities, BMDMs cells labeled with Dio, GFP-M or DDR2-CARM were incubated with DDR2-Cy3-Beads (beads to cells ratio at 5: 1) for 4h at 37℃, washed with cold PBS to stop phagocytosis and remove soluble beads, and analyzed immediately by confocal microscopy (Nikon Eclipse C1). Ten random fields were counted for the number of phagocytosis events for each group. Dio or GFP： Ex=488nm, Em=507nm, DDR2-Cy3-Beads：Ex=550nm, Em=570nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was done with GraphPad Prism software. P-values of less than 0.05 were considered to be significant. Unless otherwise noted, comparisons between two groups were made with unpaired two-sided Student’s t-test. One-way ANOVA (with the Sidak-Bonferroni correction) was used for multiple comparisons. Two-way ANOVA was used for comparing the weight changes following UPF induction between different treatment groups.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We would like to thank professor Yang Li (from Sun Yat-sen University) for providing Cy5-CHP to us which was used to detect collagen degradation in fibrotic lungs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGuangzhou Science-Brain grant (2023B03J1352)\u003c/p\u003e\n\u003cp\u003eGuangzhou Science and Technology project (202201010174)\u003c/p\u003e\n\u003cp\u003eNational Natural Science Foundation of China (82570145, 82370148 and 82003265)\u003c/p\u003e\n\u003cp\u003eR\u0026amp;D Program of Guangzhou Laboratory (GZNL2023A02003)\u003c/p\u003e\n\u003cp\u003eGuangzhou Municipal Science and Technology Bureau, Guangzhou Key Research and Development Program (2024B03J0046)\u003c/p\u003e\n\u003cp\u003eGrant of State Key Laboratory of Respiratory Disease (SKLRD-Z-202307)\u003c/p\u003e\n\u003cp\u003ePlan on enhancing scientific research in GMU (02-410-2302244XM).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u003c/strong\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConceptualization: YL, XH, JS\u003c/p\u003e\n\u003cp\u003eMethodology: YL, XH, JY, XR, YZ, XB, DW, GL, PY, HW, SQ, KW, PZ\u003c/p\u003e\n\u003cp\u003eInvestigation: YL, XH, JY, XR, JL\u003c/p\u003e\n\u003cp\u003eVisualization: YL, XH, JY,\u0026nbsp;JL, JS\u003c/p\u003e\n\u003cp\u003eFunding acquisition: YL, XW, JL, JS\u003c/p\u003e\n\u003cp\u003eProject administration: JS, YL\u003c/p\u003e\n\u003cp\u003eSupervision: JS, JL\u003c/p\u003e\n\u003cp\u003eWriting – original draft: YL\u003c/p\u003e\n\u003cp\u003eWriting – review \u0026amp; editing:\u0026nbsp;JS\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e Authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData and materials availability:\u003c/strong\u003e All experimental data and materials used in this study are available. scRNA-seq raw data have been deposited into the Genome Sequence Archive (GSA) database under accession number CRA035170 (https://ngdc.cncb.ac.cn/gsa/s/R60nu995).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eA. J. Podolanczuk, C. C. Thomson, M. Remy-Jardin, L. Richeldi, F. J. Martinez, M. Kolb, G. Raghu, Idiopathic pulmonary fibrosis: state of the art for 2023. Eur Respir J 61, (2023).\u003c/li\u003e\n\u003cli\u003eM. Ghumman, D. Dhamecha, A. Gonsalves, L. Fortier, P. Sorkhdini, Y. Zhou, J. U. Menon, Emerging drug delivery strategies for idiopathic pulmonary fibrosis treatment. Eur J Pharm Biopharm 164, 1-12 (2021).\u003c/li\u003e\n\u003cli\u003eS. K. Rajan, V. Cottin, R. Dhar, S. Danoff, K. R. Flaherty, K. K. Brown, A. Mohan, E. Renzoni, M. Mohan, Z. Udwadia, P. Shenoy, D. Currow, A. Devraj, B. Jankharia, R. Kulshrestha, S. Jones, C. Ravaglia, S. Quadrelli, R. Iyer, S. Dhooria, M. Kolb, A. U. Wells, Progressive pulmonary fibrosis: an expert group consensus statement. Eur Respir J 61, (2023).\u003c/li\u003e\n\u003cli\u003eJ. Yan, S. Y. Wang, Q. Su, M. W. Zou, Z. Y. Zhou, J. Shou, Y. Huo, Targeted immunotherapy rescues pulmonary fibrosis by reducing activated fibroblasts and regulating alveolar cell profile. Nat Commun 16, 3748 (2025).\u003c/li\u003e\n\u003cli\u003eH. Aghajanian, T. Kimura, J. G. Rurik, A. S. Hancock, M. S. Leibowitz, L. Li, J. Scholler, J. Monslow, A. Lo, W. Han, T. Wang, K. Bedi, M. P. Morley, R. A. Linares Saldana, N. A. Bolar, K. McDaid, C. A. Assenmacher, C. L. Smith, D. Wirth, C. H. June, K. B. Margulies, R. Jain, E. Pure, S. M. Albelda, J. A. Epstein, Targeting cardiac fibrosis with engineered T cells. Nature 573, 430-433 (2019).\u003c/li\u003e\n\u003cli\u003eH. Bian, X. Nie, X. Bu, F. Tian, L. Yao, J. Chen, J. Su, The pronounced high expression of discoidin domain receptor 2 in human interstitial lung diseases. ERJ Open Res 4, (2018).\u003c/li\u003e\n\u003cli\u003eH. Zhao, H. Bian, X. Bu, S. Zhang, P. Zhang, J. Yu, X. Lai, D. Li, C. Zhu, L. Yao, J. Su, Targeting of Discoidin Domain Receptor 2 (DDR2) Prevents Myofibroblast Activation and Neovessel Formation During Pulmonary Fibrosis. Mol Ther 24, 1734-1744 (2016).\u003c/li\u003e\n\u003cli\u003eS. Jia, M. Agarwal, J. Yang, J. C. Horowitz, E. S. White, K. K. Kim, Discoidin Domain Receptor 2 Signaling Regulates Fibroblast Apoptosis through PDK1/Akt. Am J Respir Cell Mol Biol 59, 295-305 (2018).\u003c/li\u003e\n\u003cli\u003eS. M. Matson, L. T. Ngo, Y. Sugawara, V. Fernando, C. Lugo, I. Azeem, A. Harrison, A. Alsup, E. Nissen, D. Koestler, M. P. Washburn, M. J. Rekowski, P. J. Wolters, J. S. Lee, J. J. Solomon, M. K. Demoruelle, Neutrophil extracellular traps linked to idiopathic pulmonary fibrosis severity and survival. medRxiv, (2024).\u003c/li\u003e\n\u003cli\u003eA. Achaiah, E. Fraser, P. Saunders, R. K. Hoyles, R. Benamore, L. P. Ho, Neutrophil levels correlate with quantitative extent and progression of fibrosis in IPF: results of a single-centre cohort study. BMJ Open Respir Res 10, (2023).\u003c/li\u003e\n\u003cli\u003eL. Franzen, M. Olsson Lindvall, M. Huhn, V. Ptasinski, L. Setyo, B. P. Keith, A. Collin, S. Oag, T. Volckaert, A. Borde, J. Lundeberg, J. Lindgren, G. Belfield, S. Jackson, A. Ollerstam, M. Stamou, P. L. Stahl, J. J. Hornberg, Mapping spatially resolved transcriptomes in human and mouse pulmonary fibrosis. Nat Genet, (2024).\u003c/li\u003e\n\u003cli\u003eQ. Li, Y. Wang, L. Ji, J. He, H. Liu, W. Xue, H. Yue, R. Dong, X. Liu, D. Wang, H. Zhang, Cellular and molecular mechanisms of fibrosis and resolution in bleomycin-induced pulmonary fibrosis mouse model revealed by spatial transcriptome analysis. Heliyon 9, e22461 (2023).\u003c/li\u003e\n\u003cli\u003eH. Ji, H. Dong, Y. Lan, Y. Bi, X. Gu, Y. Han, C. Yang, M. Cheng, J. Gao, Metformin attenuates fibroblast activation during pulmonary fibrosis by targeting S100A4 via AMPK-STAT3 axis. Front Pharmacol 14, 1089812 (2023).\u003c/li\u003e\n\u003cli\u003eK. Araki, R. Kinoshita, N. Tomonobu, Y. Gohara, S. Tomida, Y. Takahashi, S. Senoo, A. Taniguchi, J. Itano, K. I. Yamamoto, H. Murata, K. Suzawa, K. Shien, H. Yamamoto, M. Okazaki, S. Sugimoto, K. Ichimura, M. Nishibori, N. Miyahara, S. Toyooka, M. Sakaguchi, The heterodimer S100A8/A9 is a potent therapeutic target for idiopathic pulmonary fibrosis. J Mol Med (Berl) 99, 131-145 (2021).\u003c/li\u003e\n\u003cli\u003eY. Li, J. Bao, Y. Bian, U. Erben, P. Wang, K. Song, S. Liu, Z. Li, Z. Gao, Z. Qin, S100A4(+) Macrophages Are Necessary for Pulmonary Fibrosis by Activating Lung Fibroblasts. Front Immunol 9, 1776 (2018).\u003c/li\u003e\n\u003cli\u003eW. Zhang, S. Ohno, B. Steer, S. Klee, C. A. Staab-Weijnitz, D. Wagner, M. Lehmann, T. Stoeger, M. Konigshoff, H. Adler, S100a4 Is Secreted by Alternatively Activated Alveolar Macrophages and Promotes Activation of Lung Fibroblasts in Pulmonary Fibrosis. Front Immunol 9, 1216 (2018).\u003c/li\u003e\n\u003cli\u003eH. Xia, A. Gilbertsen, J. Herrera, E. Racila, K. Smith, M. Peterson, T. Griffin, A. Benyumov, L. Yang, P. B. Bitterman, C. A. Henke, Calcium-binding protein S100A4 confers mesenchymal progenitor cell fibrogenicity in idiopathic pulmonary fibrosis. J Clin Invest 127, 2586-2597 (2017).\u003c/li\u003e\n\u003cli\u003eJ. Hwang, Y. Huang, T. J. Burwell, N. C. Peterson, J. Connor, S. J. Weiss, S. M. Yu, Y. Li, In Situ Imaging of Tissue Remodeling with Collagen Hybridizing Peptides. ACS Nano 11, 9825-9835 (2017).\u003c/li\u003e\n\u003cli\u003eS. Song, Z. Fu, R. Guan, J. Zhao, P. Yang, Y. Li, H. Yin, Y. Lai, G. Gong, S. Zhao, J. Yu, X. Peng, Y. He, Y. Luo, N. Zhong, J. Su, Intracellular hydroxyproline imprinting following resolution of bleomycin-induced pulmonary fibrosis. Eur Respir J 59, (2022).\u003c/li\u003e\n\u003cli\u003eN. Joshi, S. Watanabe, R. Verma, R. P. Jablonski, C. I. Chen, P. Cheresh, N. S. Markov, P. A. Reyfman, A. C. McQuattie-Pimentel, L. Sichizya, Z. Lu, R. Piseaux-Aillon, D. Kirchenbuechler, A. S. Flozak, C. J. Gottardi, C. M. Cuda, H. Perlman, M. Jain, D. W. Kamp, G. R. S. Budinger, A. V. Misharin, A spatially restricted fibrotic niche in pulmonary fibrosis is sustained by M-CSF/M-CSFR signalling in monocyte-derived alveolar macrophages. Eur Respir J 55, (2020).\u003c/li\u003e\n\u003cli\u003eA. V. Misharin, L. Morales-Nebreda, P. A. Reyfman, C. M. Cuda, J. M. Walter, A. C. McQuattie-Pimentel, C. I. Chen, K. R. Anekalla, N. Joshi, K. J. N. Williams, H. Abdala-Valencia, T. J. Yacoub, M. Chi, S. Chiu, F. J. Gonzalez-Gonzalez, K. Gates, A. P. Lam, T. T. Nicholson, P. J. Homan, S. Soberanes, S. Dominguez, V. K. Morgan, R. Saber, A. Shaffer, M. Hinchcliff, S. A. Marshall, A. Bharat, S. Berdnikovs, S. M. Bhorade, E. T. Bartom, R. I. Morimoto, W. E. Balch, J. I. Sznajder, N. S. Chandel, G. M. Mutlu, M. Jain, C. J. Gottardi, B. D. Singer, K. M. Ridge, N. Bagheri, A. Shilatifard, G. R. S. Budinger, H. Perlman, Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span. J Exp Med 214, 2387-2404 (2017).\u003c/li\u003e\n\u003cli\u003eQ. Zhu, G. Zhang, M. Cao, H. Huang, D. He, Z. Zang, J. Xing, M. Zhan, S. Pei, X. Deng, J. Li, G. Meng, J. Xu, D. Dai, G. Hu, M. Zheng, C. Liu, J. Qin, Y. Xiao, Microbiota-shaped neutrophil senescence regulates sexual dimorphism in bladder cancer. Nat Immunol 26, 722-736 (2025).\u003c/li\u003e\n\u003cli\u003eC. H. Hiroki, M. F. Hassanabad, M. Defaye, N. Sarden, A. Bartlett, R. Farias, A. P. Nguyen, I. M. Guerrero-Fonseca, G. Yoon, L. Brown, C. Ma, H. Yang, D. Belke, A. Fatehi Hassanabad, C. McCoy, N. L. Rosin, D. J. Orton, P. W. M. Fedak, B. A. Vallance, H. Yu, K. Jacobson, N. Khan, C. Altier, M. M. Kelly, B. G. Yipp, Nociceptor neurons suppress alveolar macrophage-induced Siglec-F(+) neutrophil-mediated inflammation to protect against pulmonary fibrosis. Immunity 58, 2054-2068 e2056 (2025).\u003c/li\u003e\n\u003cli\u003eQ. Luo, D. Deng, Y. Li, H. Shi, J. Zhao, Q. Qian, W. Wang, J. Cai, W. Yu, J. Liu, TREM2 Insufficiency Protects against Pulmonary Fibrosis by Inhibiting M2 Macrophage Polarization. Int Immunopharmacol 118, 110070 (2023).\u003c/li\u003e\n\u003cli\u003eH. Wang, Y. Gao, L. Wang, Y. Yu, J. Zhang, C. Liu, Y. Song, H. Xu, J. Wang, H. Lou, T. Dong, Lung specific homing of diphenyleneiodonium chloride improves pulmonary fibrosis by inhibiting macrophage M2 metabolic program. J Adv Res 44, 213-225 (2023).\u003c/li\u003e\n\u003cli\u003eB. Liu, Q. Jiang, R. Chen, S. Gao, Q. Xia, J. Zhu, F. Zhang, C. Shao, X. Liu, X. Li, H. Zhou, C. Yang, H. Huang, Tacrolimus ameliorates bleomycin-induced pulmonary fibrosis by inhibiting M2 macrophage polarization via JAK2/STAT3 signaling. Int Immunopharmacol 113, 109424 (2022).\u003c/li\u003e\n\u003cli\u003eY. Wang, L. Zhang, G. R. Wu, Q. Zhou, H. Yue, L. Z. Rao, T. Yuan, B. Mo, F. X. Wang, L. M. Chen, F. Sun, J. Song, F. Xiong, S. Zhang, Q. Yu, P. Yang, Y. Xu, J. Zhao, H. Zhang, W. Xiong, C. Y. Wang, MBD2 serves as a viable target against pulmonary fibrosis by inhibiting macrophage M2 program. Sci Adv 7, (2021).\u003c/li\u003e\n\u003cli\u003eA. Ghebremedhin, A. B. Salam, B. Adu-Addai, S. Noonan, R. Stratton, M. S. U. Ahmed, C. Khantwal, G. R. Martin, H. Lin, C. Andrews, B. Karanam, U. Rudloff, H. Lopez, J. Jaynes, C. Yates, A Novel CD206 Targeting Peptide Inhibits Bleomycin-Induced Pulmonary Fibrosis in Mice. Cells 12, (2023).\u003c/li\u003e\n\u003cli\u003eP. F. Ma, C. C. Gao, J. Yi, J. L. Zhao, S. Q. Liang, Y. Zhao, Y. C. Ye, J. Bai, Q. J. Zheng, K. F. Dou, H. Han, H. Y. Qin, Cytotherapy with M1-polarized macrophages ameliorates liver fibrosis by modulating immune microenvironment in mice. J Hepatol 67, 770-779 (2017).\u003c/li\u003e\n\u003cli\u003eV. Rybalko, P. L. Hsieh, M. Merscham-Banda, L. J. Suggs, R. P. Farrar, The Development of Macrophage-Mediated Cell Therapy to Improve Skeletal Muscle Function after Injury. PLoS One 10, e0145550 (2015).\u003c/li\u003e\n\u003cli\u003eD. Gomez-Moreno, J. M. Adrover, A. Hidalgo, Neutrophils as effectors of vascular inflammation. Eur J Clin Invest 48 Suppl 2, e12940 (2018).\u003c/li\u003e\n\u003cli\u003eA. Achaiah, A. Rathnapala, A. Pereira, H. Bothwell, K. Dwivedi, R. Barker, R. Benamore, R. K. Hoyles, V. Iotchkova, L. P. Ho, Monocyte and neutrophil levels are potentially linked to progression to IPF for patients with indeterminate UIP CT pattern. BMJ Open Respir Res 8, (2021).\u003c/li\u003e\n\u003cli\u003eA. Pardo, R. Barrios, M. Gaxiola, L. Segura-Valdez, G. Carrillo, A. Estrada, M. Mejia, M. Selman, Increase of lung neutrophils in hypersensitivity pneumonitis is associated with lung fibrosis. Am J Respir Crit Care Med 161, 1698-1704 (2000).\u003c/li\u003e\n\u003cli\u003eW. Xie, X. Chen, Q. Wang, C. Yan, Y. Liu, M. Zhang, Y. Sun, X. Yan, B. Guo, B. Chen, Sivelestat sodium: a novel therapeutic agent in a mouse model of acute exacerbation pulmonary fibrosis through multiple mechanisms. J Thorac Dis 17, 5024-5043 (2025).\u003c/li\u003e\n\u003cli\u003eK. Morimoto, W. J. Janssen, M. Terada, Defective efferocytosis by alveolar macrophages in IPF patients. Respir Med 106, 1800-1803 (2012).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8675185/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8675185/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIdiopathic pulmonary fibrosis (IPF) is a fatal disease with a critical unmet need in therapeutic options. Chimeric antigen receptor (CAR) T cells targeting fibroblast activation protein (FAP) have shown potential for IPF, but other cell-based approaches remain under-explored. In this study, we generated CAR macrophages (DDR2-CARM) targeting DDR2, a collagen receptor specifically upregulated in activated stromal cells, for the treatment of IPF. Murine DDR2-CARM exerted DDR2-specific phagocytosis, upregulation of antifibrotic cytokines, chemokines and matrix metalloproteinases in vitro; and mitigated pulmonary fibrosis in bleomycin-induced unilateral pulmonary fibrosis (UPF) mouse models by targeting DDR2\u003csup\u003e+\u003c/sup\u003e stromal cells and degrading collagen. Single-cell RNA sequencing revealed that DDR2-CARM treatment led to attenuation of chronic inflammation accompanied by reduced infiltration of profibrotic neutrophils in the fibrotic lungs.\u0026nbsp; Additionally, human DDR2-CARM suppressed fibrosis in precision-cut lung slices (PCLS) from IPF patients. Thus, DDR2 emerges as a new antifibrotic target, and DDR2-CARM represent potent remodelers of both stromal and immune activities in fibrotic tissues, holding therapeutic potential for IPF.\u003c/p\u003e","manuscriptTitle":"Targeting pulmonary fibrosis with DDR2-specific chimeric antigen receptor macrophages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-29 00:57:04","doi":"10.21203/rs.3.rs-8675185/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"13097bce-63e3-4280-95cd-055ae401fcbf","owner":[],"postedDate":"January 29th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":61740052,"name":"Health sciences/Diseases/Respiratory tract diseases"},{"id":61740053,"name":"Biological sciences/Drug discovery/Target validation"}],"tags":[],"updatedAt":"2026-02-27T13:25:25+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-29 00:57:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8675185","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8675185","identity":"rs-8675185","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}