Identification of MYC genes in four Cucurbitaceae species and the response to temperature stress

Identification of MYC genes in four Cucurbitaceae species and the response to temperature stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of MYC genes in four Cucurbitaceae species and the response to temperature stress Tao Liu, Yani Zheng, Jingyu Yang, Rourou Li, Huan Chang, Nanyang Li, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4203459/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Sep, 2024 Read the published version in BMC Genomics → Version 1 posted 11 You are reading this latest preprint version Abstract Background Myelocytomatosis ( MYC ) transcription factors are crucial mediators of plants responding to environmental stresses through binding DNA regulatory regions. However, little systematic characterization of MYC genes is available in Cucurbitaceae species. Results In this study, we identified 10, 8, 12, and 10 MYC genes separately in Cucumis sativus , Cucumis melo , Citrullus lanatus , and Benincasa hispida . Characterization analysis revealed that all of the MYC proteins contain a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence, which is essential for the binding DNA regulatory regions. The evolutionary analysis enabled us to categorize the predicted 40 MYC proteins from seven species into five distinct groups, which was also discovered that the expansion of the MYC genes occurred before the divergence of monocots and dicots. The upstream promoter region of the MYC genes contain a variety of developmental, stress, and hormone-responsive regulatory elements. The expression of cucumber MYC genes varies significantly across organs, with particularly high expression of CsaV3_3G001710 observed across all organs. Transcriptomic analysis reveals that certain cucumber MYC genes undergo specific upregulation or downregulation in response to both biotic and abiotic stressors. Particularly under temperature stress, cucumber genes CsaV3_3G007980 and CsaV3_3G001710 showed significant upregulation. Interestingly, the homologous genes of these two in C. lanatus exhibited a similar expression pattern to C. sativus , while in B. hispida , they displayed a significant downregulation, which is quite the opposite. These findings indicated that these two genes indeed responded to temperature stress with different expression patterns, highlighting the divergent functions of homologous genes across different species. Conclusions This study analyzed the size and composition of the MYC gene family in four Cucurbitaceae species, and investigated stress-responsive expression profiles, especially under temperature stress. All the results showed that MYC play important roles in development and stress-responsive, laying a theoretical foundation for further investigating its response mechanisms. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Background Myelocytomatosis oncogene ( MYC ), an important class of transcription factors (TFs) belong to basic helix-loop-helix (bHLH) TF family, contains two conserved functional domains, namely bHLH_MYC_N domain in the N-terminal region and bHLH region in the C-terminal [ 1 – 3 ]. As a sub-genetic family in the bHLH family member, MYC play an important role in plant growth and development, secondary metabolism and signal transduction [ 4 ]. The first MYC gene was cloned form Arabidopsis thaliana , named AtMYC1 , functional studies showed that it played a certain role in plant seed development [ 5 ]. Successively, more MYC genes were found in Arabidopsis . It was found that MYC2 could regulate leaf aging by antagonizing with bHLH Ⅲd subfamily transcription factors [ 6 ], and could also interact with JAZ7 to inhibit leaf aging under dark conditions [ 7 ]. In Arabidopsis thaliana , AtMYC2 could cooperate with AtMYC3 and AtMYC4 in regulating leaf development [ 8 ], chlorophyll degradation [ 9 ], seed production and seed storage protein accumulation [ 10 , 11 ]. Previous studies also found that AtMYC2 could inhibit the growth of leaf veins by inhibiting the synthesis of auxin in plant leaves [ 12 ]. Others, the Arabidopsis Aborted MicrosporeS ( AMS ) gene, encoded a MYC class transcription factor, plays a crucial role in tapetum cell development and pollen wall formation [ 13 ]. In addition, MYC genes in other plants have been identified to be involved in plant growth and development. In apple ( Malus pumila Mill.), at the fruit ripening stage, MdMYC2 can affect ethylene biosynthesis and promote fruit ripening by promoting the expression of MdACS1 and MdACO1 [ 14 ]. In rice ( Oryza sativa ), overexpression of OsMYC2 could interact with OsJAZ1 and activate the downstream gene OsMADS1 , and then regulate the development of spikelet [ 15 ]. The MYC genes also have important effect on the accumulation of plant secondary metabolites. Such as, overexpressed the AtMYC3 and AtMYC4 resulted in the excessive accumulation of anthocyanins in Arabidopsis . Likewise, wheat ( Triticum aestivum ) MYC1 could also regulate anthocyanin synthesis in pericarp [ 16 ]. The CrMYC2 could control the jasmonate-responsive expression of the ORCA genes that regulated alkaloid biosynthesis in Catharanthus roseus . In few, TcJAMYC could bind to E-box and activate the gene promoter related to paclitaxel pathway, which can effectively improve the yield of paclitaxel in suspension cell culture system [ 17 ]. In Artemisia annua , AaMYC2 could bind to AaJAZ1-4 and activate the expression of artemisinin biosynthetic enzymes CYP71AV1 and DBR2 , which positively regulates artemisinin biosynthesis [ 18 ]. Although a large number of studies on MYC genes in various species have been conducted, studies on MYC genes in Cucurbitaceae crops is still weak. Cucurbitaceae is one of the most important edible plant families in the world, among which cucumbers, melons, watermelons and wax gourds are widely grown worldwide, coming into being the great economic benefits. In this study, we aim to identify MYC genes in four Cucurbitaceae crops and compare the evolution and variations of MYC genes among species through bioinformatics analysis. We will also analyze the expression patterns of MYC genes under biotic and abiotic stresses, focusing on identifying MYC genes involved in temperature stress response, for providing theoretical support for stress-resistant breeding in Cucurbitaceae crops. Methods Identification and bioinformatics analysis of the MYC gene family in Cucurbitaceae crops Download the HMM model file (PF14215.7 and PF00010) for the MYC gene family from the Pfam database ( http://pfam.xfam.org/ ), and download the protein sequence file of Cucumis sativus L., Cucumis melo L., Citrullus lanatus , Benincasa hispida from the Cucurbitaceae Genomic Database ( http://cucurbitgenomics.org ; [ 19 – 22 ] ). Use the Hidden Markov Model (HMM) plugin in the HMMER v3 software package to predict candidate MYC gene family members in the Cucumis sativus L., Cucumis melo L., Citrullus lanatus , Benincasa hispida genome [ 23 ], and extract the sequence information of high-quality candidate proteins using Perl scripts (E < 1 × 10 − 5 ). Then, identify the candidate MYC gene family genes using the BLASTP program and the NCBI-Conserved Domain Data (CDD) ( http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi ; [ 24 ]). MYC gene family characterization and phylogenetic tree construction in Cucurbitaceae crops Utilizing the online tool ExPASy ( https://web.expasy.org/protparam/ ) [ 25 ], we analyzed the amino acid count, molecular weight, isoelectric point, instability coefficient, aliphatic index, and average hydrophobicity of the members of the MYC gene family. We used the online website CELLO ( http://cello.life.nctu.edu.tw/ ) for subcellular localization prediction. We employed the online software MEME ( http://meme-suite.org/ ) to analyze the conserved motifs of MYC family proteins, with the parameters set as follows: 10 motifs, optimal motif width range from 6 to 200. The multiple sequence alignment was performed using the ClustalX 2.0 and visualized by Jalview [ 26 ]. Phylogenetic analysis was performed using MEGA7 [ 27 ] with the neighbor-joining (NJ) method, and the parameters were set as the Poisson model, pairwise deletion, and 1000 bootstrap replications [ 28 ]. Chromosomal distribution and collinearity analysis of MYC genes Based on the physical location information in the genome database, we used the mapchart to map the MYC gene family members onto Cucurbitaceae crops chromosomes, respectively [ 29 ]. The distribution of the Cucurbitaceae crops SRS gene family on the chromosomes were visualized using TBtools software [ 30 ]. Gene duplication events were analyzed using the multiple collinearity scan tool (MCScanX) [ 31 ]. A collinearity analysis plot was generated using the Dual Systeny Plotter software ( https://github.com/CJ-Chen/TBtools ) [ 32 ]. Gene Expression Analysis Transcriptome sequencing data related to cucumbers were downloaded from the NCBI database ( https://www.ncbi.nlm.nih.gov/ ). The SRA to Fastq plugin in TBtools was used to convert the downloaded SRA data into Fastq format. Data quality was assessed using the FastQC plugin [ 33 ], and adapter sequences and low-quality sequences were removed with the Trimmomatics plugin [ 34 ], resulting in clean data. The filtered transcriptome data was aligned to the cucumber ChineseLong_V3 genome using the STAR plugin, generating SAM files [ 35 ]. Gene expression levels were analyzed using the StringTie Quantify plugin [ 36 ]. Finally, differential gene expression analysis was conducted using the DESeq2 plugin [ 37 ]. Tissue-specific expression analysis of Cucumber MYC genes Using transcriptome sequencing data from the NCBI database (PRJNA80169) [ 38 ], we analyzed the tissue-specific expression of the cucumber MYC gene family in various tissues and organs, including cucumber leaves, stems, female flowers, male flowers, unfertilized ovaries, fertilized ovaries, ovaries, roots, tendrils, and the base of tendrils. We utilized the TBtools software to create an expression heatmap, depicting the specific expression patterns of the cucumber MYC gene family in different cucumber tissues and organs. Stress-responsive expression analysis of Cucumber MYC genes Using transcriptome sequencing data from the NCBI database, including PRJNA634519 [ 39 ], PRJNA438923 [ 40 ], PRJNA477930 [ 41 ], PRJNA321023 [ 42 ], and PRJNA419665 [ 43 ], we analyzed the specific expression patterns of the cucumber MYC gene family in response to various stress conditions, such as high temperature, low temperature, high salinity, silicon, powdery mildew, downy mildew, and southern root-knot nematodes. We used TBtools software to create expression heatmaps, illustrating the gene expression responses of the cucumber MYC gene family undering abiotic and biotic stress conditions. Temperature stress treatment, RNA extraction and qRT-PCR The cultivars Jinyan-4( Cucumis sativus ), Harukei-3 ( Cucumis melo ), B227 ( Benincasa hispida ), and 8424 ( Citrullus lanatus ) provided by Hebei Engineering Research Center for Seedling Breeding of Solanaceae and Fruit Vegetables of Hebei University of Engineering were used to explore the genes expression under temperature stress. The seedlings of four cultivars were treated at 42°C, and the leaves of the seedlings were taken at 0, 3, 6 and 12 h after treatment for qRT-PCR. At the same time, the seedlings of four cultivars were treated at 10°C, and the leaves of the seedlings were taken at 0, 3, 6 and 12 h after treatment for qRT-PCR. All samples have three biological replicates, and frozen in liquid nitrogen and then immediately stored at -80℃. Total RNA was extracted using the RNAprep Pure Plant Kit (DP432, Tiangen Bio-tech, Beijing, China) according to the manufacturer's instructions. The cDNA was synthesized from the total RNA using the PrimeScript RT Kit (Takara). Specific primers for each gene were designed through primer 6 (Table 1 ). Subsequently, the synthesized cDNA underwent qRT-PCR on an Opticon thermocycler (CFX96 Connect Real-Time System; Bio-Rad, Hercules, CA) using SYBR Green PCR master mix (Vazyme, Nanjing, China) according to the manufacturer's instructions. The 2-ΔΔCT method was employed to calculate the relative expression of the MYC genes [ 44 ]. Table 1 List of primers used in quantitative RT-PCR. All primers are designed by Primer 6. Gene Sense Primer Anti-sense Primer CsaV3_3G007980 TAGTCAGTGGAGTCAGAGAT CTACACGGTTAATCACAGAAG CsaV3_3G001710 GGATGCGATGATAAGGATTC TCTTCACTGTTGCTTGTTG Bhi01M000362 GCGGTTCTATGCTCTACG TTGAGGTGAGGCTGGATT Cla97C05G080890 CTAGTTAATGGAGTCAGAGATG CACGGTTAATCACAGAAGG MELO3C006016 CGGTGAGGAATGATGAGAA AATGAGACAGTTGCCAGAA MELO3C013851 CGAGACGAGTTCTTGGATT ACGGTGGTGGTAATTGAAT Bhi11M000137 CGACTCAGACCACTCAGA GATTCAATGGCTCTTCTCTTC Cla97C10G186220 GGACTCAGACCACTCAGA GATTCAATGGCTCTTCTCTTC Bhi10G001911 ( Actin ) ATGTTCACAACCACTGCCGA GTCGAGCGCAACATAAGCAA MELO3C008032 ( Actin ) CATGTTCACCACCACTGCCGA TGGCTGGAATAGAACTTCTGGGC ClActin CCATGTATGTTGCCATCCAG GGATAGCATGGGGTAGAGCA CuActin GGAGAAGATCTGGCATCACA CTCCAATCCAGACACTGTACT Results Identification and physicochemical property analysis of MYC genes A total of 40 MYC genes were identified in the genomes of four Cucurbitaceae crops. 10 in C. sativus , 8 in C. melo , 12 in C. lanatus , and 10 in B. hispida . All the MYC genes were unequally distributed on each chromosome. For example, in C. sativus L., there are 6 MYC genes on chromosome 3, while there are none on chromosome 1, 2, 4, and 5. In C. melo L., except for chromosomes 2, 3, 5, 7, 8, 9, 10, and 12 where there is no distribution, the other chromosomes each have 1, 2, or 3 MYC genes (Fig. 1 ). Sequence analysis revealed that the amino acid lengths encoded by CsMYC genes varied from 431aa ( CsMYC8 ) to 694aa ( CsMYC5 ), by CmMYC genes varied from 433aa ( CmMYC8 ) to 745aa ( CmMYC1 ), by ClMYC genes varied from 423aa ( ClMYC3 ) to 969aa ( ClMYC1 ), and by BhMYC genes varied from 501aa ( BhMYC4 ) to 968aa ( BhMYC3 ). In Cucurbitaceae crops, except for the CsMYC1 , CmMYC5, ClMYC10 and BhMYC1 were acidic proteins, the others are alkaline proteins. The most proteins are unstable (instability index greater than 40), while the CsMYC5, CmMYC1, ClMYC12, BhMYC7 , and BhMYC9. The average hydrophilicity values of all are less than 0, indicating that all the proteins are hydrophobic. Subcellular localization prediction results revealed that the most MYC proteins are localized in the cell nucleus, followed by chloroplasts. (Table 2 ). Table 2 Protein information of MYC gene family members in Cucurbitaceae crops. Species Gene ID Name Number of amino acids (aa) Molecular weight (D) pI Instability index Aliphatic index Average of hydropathicity Prediction of subcellular location Cucumis sativus L. CsaV3_3G000850.1 CsMYC1 447 49398.41 8.65 43.61 82.37 -0.416 Nucleus CsaV3_3G001710.1 CsMYC2 642 69911.19 6.21 50.44 64.14 -0.578 Nucleus CsaV3_3G007980.1 CsMYC3 649 71943.89 5.83 49.00 77.66 -0.490 Nucleus CsaV3_3G022420.1 CsMYC4 501 55301.14 5.70 44.81 78.60 -0.445 Nucleus CsaV3_3G034600.1 CsMYC5 694 78486.44 5.24 38.28 84.84 -0.370 Chloroplast\Nucleus CsaV3_3G049150.1 CsMYC6 688 75666.20 5.11 58.15 69.71 -0.617 Nucleus CsaV3_6G000530.1 CsMYC7 644 72769.50 5.51 43.25 78.57 -0.500 Nucleus CsaV3_6G008940.1 CsMYC8 431 48394.52 5.42 47.63 76.43 -0.429 Nucleus CsaV3_6G037080.1 CsMYC9 650 71869.01 5.91 48.30 83.31 -0.347 Nucleus CsaV3_7G027460.1 CsMYC10 691 76190.07 5.66 41.31 76.58 -0.372 Nucleus Cucumis melo L. MELO3C015748.2.1 CmMYC1 745 82003.24 5.70 37.16 81.25 -0.269 Nucleus MELO3C003412.2.1 CmMYC2 723 79597.55 5.32 56.07 68.62 -0.628 Nucleus MELO3C024041.2.1 CmMYC3 501 55262.12 6.16 48.09 78.06 -0.486 Nucleus MELO3C006016.2.1 CmMYC4 586 65067.91 5.55 47.76 80.00 -0.535 Nucleus MELO3C013772.2.1 CmMYC5 442 48984.93 7.68 48.03 81.52 -0.439 Nucleus MELO3C013851.2.1 CmMYC6 662 72281.88 6.03 49.58 64.24 -0.570 Nucleus MELO3C021212.2.1 CmMYC7 656 74227.22 5.61 42.86 79.07 -0.473 Nucleus MELO3C022250.2.1 CmMYC8 433 48684.93 5.59 47.11 76.07 -0.442 Nucleus Citrullus lanatus Cla97C03G062520.1 ClMYC1 969 105839.97 6.15 47.45 78.86 -0.415 Nucleus Cla97C05G080890.1 ClMYC2 618 68589.08 5.85 46.81 76.99 -0.547 Nucleus Cla97C06G112130.1 ClMYC3 423 47569.45 5.14 52.02 71.70 -0.513 Nucleus Cla97C06G112140.1 ClMYC4 427 47692.74 5.09 52.44 52.44 -0.424 Nucleus Cla97C06G113160.1 ClMYC5 645 72922.74 5.78 46.22 79.64 -0.469 Nucleus Cla97C07G128490.1 ClMYC6 637 70287.21 6.36 45.59 81.93 -0.368 Nucleus Cla97C07G129080.1 ClMYC7 501 55179.91 5.96 49.98 76.47 -0.504 Nucleus Cla97C09G170270.1 ClMYC8 690 76046.16 5.87 40.82 80.36 -0.345 Nucleus Cla97C09G174730.1 ClMYC9 680 74878.38 5.24 53.48 70.68 -0.610 Nucleus Cla97C10G185380.1 ClMYC10 463 51021.92 8.77 53.53 79.74 -0.471 Nucleus Cla97C10G186220.1 ClMYC11 694 76681.99 6.35 49.20 64.81 -0.573 Nucleus Cla97C10G204640.1 ClMYC12 695 78085.01 4.97 38.55 83.87 -0.326 Chloroplast\Nucleus Benincasa hispida BhiUN179M27 BhMYC1 453 49798.89 8.19 47.72 83.43 -0.371 Nucleus Bhi01M000362 BhMYC2 617 68250.67 5.77 44.99 78.36 -0.520 Nucleus Bhi02M001191 BhMYC3 968 105559.53 6.12 44.22 79.96 -0.421 Nucleus Bhi05M000179 BhMYC4 501 55182.03 6.02 45.65 79.20 -0.464 Nucleus Bhi05M000251 BhMYC5 647 71471.31 5.91 43.64 80.06 -0.370 Nucleus Bhi05M000336 BhMYC6 682 75237.76 5.22 48.52 71.17 -0.632 Nucleus Bhi09M000958 BhMYC7 604 66789.67 6.01 39.23 80.83 -0.350 Nucleus Bhi11M000137 BhMYC8 660 72104.63 5.99 47.48 65.35 -0.570 Nucleus Bhi11M001900 BhMYC9 697 78638.85 5.07 39.16 84.61 -0.314 Chloroplast\Nucleus Bhi12M001654 BhMYC10 643 72375.09 5.60 47.35 80.34 -0.451 Nucleus Structure and phylogenetic analysis of Cucurbitaceae crops MYC gene Motif prediction analysis on the protein sequences of the MYC family members showed that when the number of motifs is limited to 10, no MYC family member contains all the motifs (Fig. 2 ). And the motif 1, 2, 5, 7, and 8 were relatively conservative, common to all MYC genes. Gene structure analysis revealed that the number of exons in MYC genes ranges from 1 to 15 (Fig. 2 ). The gene structures of most MYC genes within the same lineage are similar, further indicating the conservation of protein motifs and gene structures within the same evolutionary branch of MYCs . According to the alignment of bHLH domains in MYC proteins, there was a basic amino acid region (Basic) composed of approximately 12 amino acids. This region contains a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence, which is essential for the binding of bHLH to target genes. This region also includes two helical structures, comprising approximately 37 amino acids. Notably, the 22th and 38th leucine (Leu) amino acids in the HLH domain are highly conserved, indicating their necessity for dimer formation (Fig. 3 ). To clarify the evolutionary relationships among the MYC gene family in Cucurbitaceae crops, Zea mays , Brachypodium distachyon , and Oryza sativa , we constructed a phylogenetic tree. As the result showed that All MYC proteins could be divided into five subgroups, labeled as I to Ⅴ. In each subgroup, there are both monocotyledonous and dicotyledonous plants, indicating that the MYC genes were relatively conserved during the evolutionary processes of both monocots and dicots. Group Ⅳ is the largest subgroup, consisting of 4, 4, 6, 3, 2, 1, and 1 MYC proteins from C. sativus L., C. melo L., C. lanatus , B. hispida , Z.mays , B. distachyon , and O. sativa , respectively. while the group I was the smallest, only with 4 MYC genes (Fig. 4 ). In group Ⅱ, there were 7 MYC genes, while only 1 belongs to monocotyledonous plants. Collinearity analysis of MYC gene among Cucurbitaceae crops To infer the evolution of MYC genes, synteny analysis was carried out among the four Cucurbitaceae species (Fig. 5 ; Table 3 ). A total of 36 MYC genes (9 in C. sativus L., 7 in C. melo L., 11 in C. lanatus , and 9 in B. hispida ) were located within synteny blocks of the four Cucurbitaceae genomes. We found five orthologous gene pairs which exist among all four species. The result showed that these MYC genes were conserved during the evolution of all the four Cucurbitaceae species, suggesting the conserved roles in Cucurbitaceae species. Furthermore, it was also observed that some MYC genes were lost in some species. For instance, certain MYC genes were found in C. sativus L., C. melo L., and B. hispida , but were lost in B. hispida , such as the CsaV3_3G000850 / MELO3C013772.2 / Cla97C10G185380 collinear gene pair. The result showed that the specific traits in different Cucurbitaceae species during the evolution and the amplification of genome. In addition, there were two collinear gene pairs only existed in C. lanatus , and B. hispida . Table 3 The collinear gene pairs existed in four Cucurbitaceae genomes. Number Cucumber Melon Watermelon Waxgourp 1 CsaV3_3G000850 MELO3C013772.2 Cla97C10G185380 - 2 CsaV3_7G027460 MELO3C015748.2 Cla97C09G170270 Bhi09M000958 3 CsaV3_6G037080 - Cla97C07G128490 Bhi05M000251 4 CsaV3_6G008940 MELO3C022250.2 Cla97C06G112130 - 5 CsaV3_6G000530 MELO3C021212.2 Cla97C06G113160 Bhi12M001654 6 CsaV3_3G049150 CsaV3_3G001710 MELO3C003412.2 MELO3C013851.2 Cla97C09G174730 Cla97C10G186220 Bhi05M000336 Bhi11M000137 7 8 CsaV3_3G007980 MELO3C006016.2 Cla97C05G080890 Bhi01M000362 9 CsaV3_3G034600 - Cla97C10G204640 Bhi11M001900 10 - - Cla97C03G062520 Bhi02M001191 11 - - Cla97C07G129080 Bhi05M000179 The regulatory TFs of MYC genes The 1.5-kb upstream sequences of MYC genes were selected to predicate theirs regulatory TFs. As the results showed that three types of cis -elements related to development, hormone stress, and abiotic stresses were identified (Fig. 6 ). Among the cis -elements related to development, the number of G-box (CACGTC) elements is the highest, which is a light-responsive element. For example, genes of MELO3C021212.2.1 , MELO3C003412.2.1 , and Cla97C10G186220.1 contain 9 G-box elements, indicating that they might be regulated by the light environment. For the cis -elements related to hormone stress, the abscisic acid (ABA)-responsive element ABRE (ACGTG) occupies a relatively large proportion, 8 in genes of MELO3C021212.2.1 , MELO3C003412.2.1 , and Cla97C10G186220.1 , 6 in genes of Bhi02M001191 , CsaV3_3G001710.1 , and Bhi11M000137 . Among the cis -elements related to abiotic stresses, anaerobic induction ARE (AAACCA) were detected in a series of members, such as 6 in Cla97C07G128490.1 and CsaV3_3G007980.1 , 5 in Cla97C05G080890.1 . Tissue-specific expression analysis of MYC genes in C. sativus To investigate the expression profiles of the MYC gene family in different tissues, using cucumber as a representative, we conducted the transcriptome analysis based on publicly available cucumber transcriptome sequencing data among various tissues (PRJNA80169). We utilized the cucumber ChineseLong_V3 genome information for this reanalysis, focusing on the expression levels of the cucumber MYC gene family in 10 different tissues or organs, including root, stem, leave, tendril, male flower, female flower, ovary, ovary unfertilized, ovary fertilized and tendrils base. As the result showed that there was significant expression variation of the MYC gene family across different tissues (Fig. 7 ). Such as, While the CsaV3_3G001710 gene showed a relatively high level of expression across all tissues or organs, three genes ( CsaV3_3G000850 , CsaV3_6G008940 , and CsaV3_6G037080 ), on the other hand, exhibited relatively low expression levels across all tissues or organs. Some genes exhibited significant tissue-specific expression patterns. For example, the CsaV3_3G049150 gene showed relatively high expression in root and fertilized ovary, while demonstrating low expression in other tissues or organs. Similarly, compared to other tissues or organs, the CsaV3_7G027460 gene displayed higher expression in root. The above results indicate that the cucumber MYC family genes played distinct roles in the development of tissues or organs, contributing to various functions in the growth and development of the plant. Expression analysis of cucumber MYC genes under different stress conditions. Based on publicly available transcriptome data from the NCBI SRA database, we conducted a analysis of the expression levels of the cucumber MYC genes under both biotic and abiotic (high temperature, low temperature, salt and silicon stress, powdery mildew, and southern root-knot nematode) stress conditions. Under high-temperature stress, most MYC genes did not show significant differential expression (Fig. 8 ). For instance, genes of CsaV3_6G037080 , CsaV3_3G000850 , and CsaV3_6G008940 exhibited no change in expression levels under high-temperature stress, and their expression levels were relatively low. However, gene CsaV3_3G001710 demonstrated a significant upregulation at 6 hours post high-temperature treatment (6hph), while gene CsaV3_3G007980 showed high expression levels at both 3hph and 6 hph. These results suggest that gene CsaV3_3G007980 is likely involved in the response of cucumber to high-temperature stress. Under low-temperature stress, the expression levels of four genes ( CsaV3_6G037080 , CsaV3_3G000850 , CsaV3_6G008940 , and CsaV3_6G000530 ) showed no significant change and remained at relatively low levels. Two genes exhibited relatively high expression levels during low-temperature treatment, with CsaV3_3G007980 gene showing a significant upregulation at 6hph. The expression levels of the other genes remained unchanged before and after low-temperature treatment. Additionally, CsaV3_3G049150 showed a significant downregulation in expression both at 6hph and 12hph. Worth noting is that the expression levels of all genes did not undergo significant changes at 3hph. These results suggest that CsaV3_3G007980 and CsaV3_3G049150 genes play a key role in the response of cucumber to prolonged low-temperature stress, and CsaV3_3G007980 was positively regulated, while CsaV3_3G049150 was negatively regulated (Fig. 9 ). Under salt and silicon stress, most genes did not show differential expression after NaCl and Silicon treatments. One gene ( CsaV3_3G000850 ) exhibited significant downregulation after NaCl treatment and show significant upregulation after Silicon treatment. However, when treated simultaneously with NaCl and Silicon, it displayed a higher degree of downregulation (Fig. 10 ). Despite the significant differential expression observed for CsaV3_3G00850 gene after treatment, its expression level remained relatively low under both control and stress. Similarly, we analyzed the response of the MYC gene to biological stress. After inoculation with powdery mildew for 48 hours, most genes showed no significant difference in expression in both resistant (SSL508-28) and susceptible (D8) material (Fig. 11 ). However, certain MYC genes exhibited differential expression patterns between SSL508-28 and D8. For instance, CsaV3_3G000850 , treated with powdery mildew, demonstrated a significantly higher level of upregulation in D8, compared to a relatively lower fold-change in SSL508-28. Interestingly, post-inoculation, the absolute expression level of CsaV3_3G000850 in D8 was much lower than its expression in SSL508-28. In addition, after inoculation with powdery mildew, CsaV3_3G049150 showed a significantly downregulated expression in D8 and a certain degree of upregulation in SSL508-28. After inoculation with root-knot nematode ( Meloidogyne incognita ), the expression levels of most genes in both resistant (IL10-1) and susceptible (CC3) material generally exhibited similar trends, such as CsaV3_3G000850 and CsaV3_3G034600 (Fig. 12 ). However, there were two genes, CsaV3_6G000530 and CsaV3_6G037080 , that showed an upregulation trend in resistant materials and a downregulation trend in susceptible materials. Nevertheless, the degree of differential expression for these genes is relatively low, whether in resistant or susceptible materials. The responding of eight genes of four Cucurbitaceae crops under temperature stress These eight genes in four Cucurbitaceae crops ( CsaV3_3G007980 , CsaV3_3G001710 , MELO3C006016 , MELO3C013851 , Bhi01M000362 , Bhi11M000137 , Cla97C10G186220, Cla97C05G080890 ) were selected for analysis in response to temperature stress. As the result showed (Fig. 13 ), in Cucumis sativus , that genes CsaV3_3G007980 and CsaV3_3G001710 showed upregulated expression under both low and high temperature stress, which is relatively consistent with the transcriptome results, indicating their involvement in cucumber response to temperature stress. This expression pattern also appeared in Cucumis melo and Citrullus lanatus . The homologous genes MELO3C006016 and Cla97C05G080890 of CsaV3_3G007980 showed mainly upregulated expression under high temperature stress. However, under low temperature stress, The homologous gene MELO3C013851 exhibited significant downregulation at 3 and 6 hours of low temperature treatment, and then showed upregulated expression at 12 hours of low temperature treatment. While, in Benincasa hispida , these two homologous genes Bhi01M000362 and Bhi11M000137 show significantly downregulated expression in all time periods of both low and high temperature treatments. Discussion Characteristics of MYC genes in Cucurbitaceae crops The MYC transcription factor has been reported to participate in various life activities in plants, playing a crucial role in regulating the growth and development of plant organs as well as in modulating tolerance to abiotic stress responses. The MYC protein has a bHLH_MYC_N domain in the N-terminal region, which consists of two subdomains: JID and TAD. The former is essential for interacting with JAZ proteins, while the latter is a putative transcriptional activation domain [ 45 ]. In the C-terminal region, the conserved bHLH domain present determines its specificity and affinity for DNA sequence binding, and it can facilitate the formation of various homodimers and heterodimers [ 46 ]. The bHLH domain comprises a basic region and a HLH region. The basic region is located at the N-terminus of the domain, containing sites for DNA recognition and binding. In this study, a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence were detected in basic region, in which the highly conserved Leu in the 22th and 38th were necessity for dimer formation (Fig. 3 ) [ 47 ] had proved that the mutations at the two Leu sites significantly affect bHLH dimerization in Arabidopsis . According to the differences in the recognition mode between the basic region and the cis -acting elements, bHLH-type transcription factors can be classified into six main groups (designated A to F) [ 1 ]. Most of the MYC genes in Cucurbitaceae crops can specifically bind to the G-box (5’-CACNTG-3’), and belongs to group B. Consistent with previous findings, the C-terminus of the domain includes a conserved helix-loop-helix (HLH) structure that can form homodimers or heterodimers with other proteins. According to the analysis of gene structure, the MYC genes in group Ⅲ and Ⅳ had fewer introns (less than or equal to 2), with even 50% of all MYC genes lacking introns. In contrast, MYC genes in the other three groups contain a large number of introns. Previous studies have indicated that introns and exons play important roles in the diversity and evolution of gene families through gain/loss and insertion/deletion events [ 48 , 49 ]. The significant difference in the number of introns among MYC genes suggests that Cucurbitaceae crops have undergone intron loss events during their evolutionary process to adapt to environmental changes. [ 50 ] found that having fewer introns in genes enables plants to respond more rapidly to environmental changes. In addition, evolutionary analysis between monocots and dicots revealed that all groups include both monocot and dicot species, indicating the MYC genes were relatively conserved during the evolutionary processes of both monocots and dicots. Functions of MYC genes and its responding to the temperature stree A wealth of research has shown that MYC transcription factors play significant roles in the growth and development of plants. For instance, MYC is involved in regulating processes such as plant seed production [ 51 ], stamen development [ 52 ], hormone regulation [ 53 ], and secondary metabolism [ 54 ]. In this study, the majority of MYC genes are expressed in roots, leaf, and unfertilized ovary (Fig. 7 ). Coupled with the identification of numerous cis -elements related to development, and hormone stress, these findings further underscore their functions in growth and development. Meanwhile, MYC genes play important roles in response to abiotic and biotic stresses. Judging from the results of this study, gene ( CsaV3_3G000850 ) exhibited significant downregulation after NaCl treatment and show significant upregulation after Silicon treatment. These results indicate that silicon treatment induced high expression of CsaV3_3G000850 , thereby enhancing salt tolerance in cucumber. Similar results have been reported in Arabidopsis , where overexpression of the AtMYC2 gene significantly increased osmotic stress tolerance [ 55 ]. In recent years, there has been a growing focus on the response of the MYC gene to temperature stress. Overexpressing SlICE1 , which encodes a MYC-type transcription factor, enhances cold tolerance in tomatoes [ 56 ]. In Arabidopsis , MYC67 and MYC70 interact with ICE1 , leading to negative regulation of cold tolerance [ 57 ]. Overexpression of PtrbHLH , a basic helix-loop-helix transcription factor from Poncirus trifoliata , confers enhanced cold tolerance in pummelo ( Citrus grandis ) by regulating CAT to modulate the level of H 2 O 2 [ 58 ]. Under cold conditions, StICE1 of potato enhanced the stability of cell membranes by upregulating the expression of the StLTI6A gene, thereby increasing its tolerance [ 59 ]. The MYC-type TF MdbHLH4 negatively regulates apple cold tolerance by inhibiting the expression of MdCBF1/3 and the promoter-binding activity of MdICE1L , as well as by promoting the expression of MdCAX3L-2 and the cold-induced degradation of MdICE1L [ 60 ]. In this study, we found two MYC genes ( CsaV3_3G007980 and CsaV3_3G001710 ) in cucumber that show significant differential expression under temperature stress (Figs. 8 and 9 ). To validate the involvement of these two genes in temperature stress response in other cucurbit species, we extracted their homologous genes for analysis of their reactions under temperature stress. Gene expression analysis revealed differential expression of these two genes across all four species, albeit with varying patterns. Homologous genes of these two genes in Citrullus lanatus exhibit a closer resemblance to those in cucumber, showing a certain degree of upregulation under both low and high temperature stress. In Cucumis melo , homolog of CsaV3_3G001710 demonstrate a downregulation trend under temperature stress. Remarkably different is the case in Benincasa hispida , where homologs of these two genes exhibit significant downregulation under both low and high temperature stress, opposite to what is observed in Cucumis sativus . Comparative functional genomics research indicated that if evolutionarily related species regulatory elements are conserved, then gene expression characteristics within species will correspondingly be conserved [ 61 ]. In this study, cis -regulatory element analysis revealed certain differences in both the type and quantity of these elements among the eight homologous genes, which could potentially account for the differential expression of homologous genes across species. All these findings suggest that CsaV3_3G007980 and CsaV3_3G001710 , along with their homologs in other Cucurbitaceae crops, are highly responsive to temperature stress. However, the differential expression patterns between species remain unresolved. Further exploration of these genes' response mechanisms to temperature stress will be the focus of future research. Conclusions In summary, we had identified 10, 8, 12, and 10 MYC genes respectively in C. sativus , C. melo , C. lanatus , and B. hispida , each playing distinct roles in the developmental processes of plant. Particularly under environmental stress, some genes respond actively to external pressures through upregulation or downregulation of expression. Additionally, we had observed two genes that are more sensitive to temperature stress, labeled as CsaV3_3G007980 and CsaV3_3G001710 . However, these two genes exhibit contrasting expression patterns across different species. This implied that there had been some degree of alterations in gene function following species divergence. All those results provide valuable insights for future functional studies of MYC genes and present potential candidate genes for enhancing environmental adaptability of Cucurbitaceae species. Abbreviations MYC Myelocytomatosis TF Transcription Factor AMS Arabidopsis Aborted MicrosporeS CDD Conserved Domain Data ABA Abscisic Acid hph Post High-temperature Treatment HLH Helix-Loop-Helix Declarations Ethics approval and consent to participate This study has not directly involved humans, animals or plants. Consent for publication Not applicable. Data Availability Statement The authors confirm that the data supporting the findings of this study are available within the manuscript . Competing interests The authors declare that they have no competing interests. Funding This work was supported by the National Natural Science Foundation of China (32302542), which provide support for design of the study; Science Research Project of Hebei Education Department (QN2022062), which provide support for data collection; Science and Technology Research and Developmental Guidance Program of Handan (23313014019) and Construction of Innovative Teams in Modern Agricultural Industry Systems in Hebei Province (HBCT2024140206), which support for the analysis and interpretation of data. Authors' contributions W.X. designed, performed the experiments, analyzed data and wrote the paper; L.T. prepared the material and wrote the paper; Z.Y.N., Y.J.Y., L.R.R. and C.H. analyzed data; L.N.Y. revised the paper; W.S.N. and W.L.P. wrote and revised the paper. All authors read and approved the final version of the manuscript. Acknowledgements Not applicable . References Ledent V, Vervoort M. The basic helix-loop-helix protein family: Comparative genomics and phylogenetic analysis. Genome Res. 2001;11:754–770. Nuno P, Liam D. Origin and diversification of basic-helix-loop-helix proteins in plants. Mol Biol Evol. 2010;27:862–874. Xu YH, Liao YC, Lv FF, Zhang Z, Sun PW, Gao ZH, Hu KP, Sui C, Jin Y, Wei JH. Transcription Factor AsMYC2 Controls the Jasmonate-responsive Expression of ASS1 Regulating Sesquiterpene Biosynthesis in Aquilaria sinensis (Lour.) Gilg. Plant Cell Physiol. 2017;58:1924–1933. Pires N, Dolan L. Origin and diversification of basic-helix-loop-helix proteins in plants. Mol Biol Evol. 2010;27(4):862–874. Urao T, Yamaguchi-Shinozaki K, Mitsukawa N, et al. Molecular cloning and characterization of a gene that encodes a MYC-related protein in Arabidopsis . Plant Mol Biol. 1996;32(3):571-576. Butterfield DA, Drake J, Pocernich C, et al. Evidence of oxidative damage in Alzheimer's disease brain: central role for amyloid β-peptide. Trends Mol Med. 2001;7(12):548-554. Zong S, Zeng G, Zou B, et al. Effects of Polygonatum sibiricum polysaccharide on the osteogenic differentiation of bone mesenchymal stem cells in mice. Int J Clin Exp Pathol. 2015;8(6):6169. Qi T, Wang J, Huang H, et al. Regulation of jasmonate-induced leaf senescence by antagonism between bHLH subgroup IIIe and IIId factors in Arabidopsis . Plant Cell. 2015a;27(6): 1634-1649. Zhu X, Chen J, Xie Z, et al. Jasmonic acid promotes degreening via MYC 2/3/4‐and ANAC 019/055/072‐mediated regulation of major chlorophyll catabolic genes. Plant J. 2015;84(3): 597-610. Qi T, Huang H, Song S, et al. Regulation of jasmonate-mediated stamen development and seed production by a bHLH-MYB complex in Arabidopsis . Plant Cell. 2015b;27(6):1620-1633. Gao C, Qi S, Liu K, et al. MYC2 , MYC3 , and MYC4 function redundantly in seed storage protein accumulation in Arabidopsis . Plant Physiol Biochem. 2016;108:63-70. Huang CF, Yu CP, Wu YH, et al. Elevated auxin biosynthesis and transport underlie high vein density in C4 leaves[J]. PNAS. 2017;114(33):E6884-E6891. Sorensen AM, Kröber S, Unte US, et al. The Arabidopsis ABORTED MICROSPORES (AMS) gene encodes a MYC class transcription factor[J]. Plant J. 2003;33(2):413-423. Li T, Xu Y, Zhang L, et al. The jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening[J]. Plant Cell. 2017; 29(6):1316-1334. Uji Y, Taniguchi S, Tamaoki D, et al. Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice[J]. Plant Cell Physiol. 2016; 57(9):1814-1827. Zong Y, Xi X, Li S, et al. Allelic variation and transcriptional isoforms of wheat TaMYC1 gene regulating anthocyanin synthesis in pericarp[J]. Front Plant Sci. 2017;8:1645. Nims E, Vongpaseuth K, Roberts SC, et al. TcJAMYC: a bHLH transcription factor that activates paclitaxel biosynthetic pathway genes in yew. J Biol Chem. 2015;290(33):20104-20104. Shen Q, Lu X, Yan T, et al. The jasmonate‐responsive Aa MYC 2 transcription factor positively regulates artemisinin biosynthesis in Artemisia annua . New Phytol. 2016;210(4):1269-1281. Li Q, Li H, Huang WU, et al. A chromosome-scale genome assembly of cucumber ( Cucumis sativus L.). GigaScience. 2019;8(6):giz072. Garcia-Mas J, Benjak A, Sanseverino W, et al. The genome of melon ( Cucumis melo L.). PNAS. 2012;109(29):11872-11877. Guo S, Zhang J, Sun H, et al. The draft genome of watermelon ( Citrullus lanatus ) and resequencing of 20 diverse accessions. Nat Genet. 2013;45(1):51-58. Xie D, Xu Y, Wang J, et al. The wax gourd genomes offer insights into the genetic diversity and ancestral cucurbit karyotype. Nat Commun. 2019;10(1):5158. Robert DF, Jody C, Sean RE. 2011. HMMER web server: interactive sequence similarity searching. Nucleic Acids Res. 39:29–37. Marchlerbauer A, Bo Y, Han L, He J, Lanczycki C J, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR. 2017. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 45:D200–D203. Walker JM. 2006. The proteomics protocols handbook. Biochemistry. 71 (6):696–696. Waterhouse A, Procter J, Martin DA, et al. Jalview: visualization and analysis of molecular sequences, alignments, and structures[J]. BMC Bioinformatics. 2005;6(3):1-1. Kumar S, Stecher G, Tamura K. 2015. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 33:1870-1874. Sinsheimer JS, Little RJA, Lake JA. 2012. Rooting Gene Trees without Outgroups: EP Rooting. Genome Biol Evol. 4(8):709–719. Voorrips RE. 2002. MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered. 93(1):77–78. Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, Xia R. 2020. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant. 13(8):1194–1202. Wang Y, Tang H, Jeremy DD, Xu T, Li J, Wang X, Lee T, Jin H, Barry M, Guo H, Kissinger J, Paterson A. 2012. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. 40 (7):e49–e49. Liu C, Xie T, Chen C, Luan A, Long J, Li C, Ding Y, He Y. 2017. Genome-wide organization and expression profiling of the R2R3-MYB transcription factor family in pineapple（Ananas comosus）. BMC Genomics. 18(1):503. Brown J, Pirrung M, McCue LA. 2017. FQC Dashboard: integrates FastQC results into a web-based,interactive,and extensible FASTQ quality control tool. Bioinformatics. 33:3137–3139. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 30:2114–2120. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. 2009. The sequence alignment/map format and SAMtools. Bioinformatics. 25:2078–2079. Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. 2015. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 33(3):290–295. Varet H, Brillet-Guéguen L, Coppée JY, Dillies MA. 2016. SARTools: A DESeq2- and EdgeR-Based R pipeline for comprehensive differential analysis of RNA-seq data. PloS One. 11:e0157022. Li Z, Zhang Z, Yan P, Huang S, Fei Z, Lin K. 2011. RNA-Seq improves annotation of protein-coding genes in the cucumber genome. BMC Genomics. 12:1–11. Chen C, Chen X, Han J, Lu W, Ren Z. 2020. Genome-wide analysis of the WRKY gene family in the cucumber genome and transcriptome-wide identification of WRKY transcription factors that respond to biotic and abiotic stresses. BMC Plant Biol. 20:1–19. Li C, Dong S, Liu X, Bo K, Miao H, Beckles DM, Zhang S, Gu X. 2020. Genome-wide characterization of Cucumber（Cucumis sativus L.）GRAS genes and their response to various abiotic stresses. Horticulturae. 6(4):110–127. Zhu Y, Yin J, Liang Y, Liu J, Jia J, Huo H, Wu Z, Yang R, Gong H. 2019. Transcriptomic dynamics provide an insight into the mechanism for silicon-mediated alleviation of salt stress in cucumber plants. Ecotoxicol Environ Saf. 174:245–254. Xu Q, Xu X, Shi Y, Qi X, Chen X. 2017. Elucidation of the molecular responses of a cucumber segment substitution line carrying Pm5.1 and its recurrent parent triggered by powdery mildew by comparative transcriptome profiling. BMC Genomics. 18:1–14. Wang X, Cheng C, Zhang K, Tian Z, Xu J, Yang S, Lou Q, Li J, Chen JF. 2018. Comparative transcriptomics reveals suppressed expression of genes related to auxin and the cell cycle contributes to the resistance of cucumber against Meloidogyne incognita. BMC Genomics. 19:1–14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method[J]. methods. 2001;25(4):402-408. Kazan K, Manners JM. MYC2: The Master in Action. Mol Plant. 2013;6:686–703. Blackwood E, Eisenman R. Max: A helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science. 1991;251:1211. Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC. The Basic Helix-Loop-Helix Transcription Factor Family in Plants: A Genome-Wide Study of Protein Structure and Functional Diversity. Mol Biol Evol. 2003;20:735–747. Jeffares DC, Mourier T, Penny D. The biology of intron gain and loss[J]. Trends Genet. 2006; 22(1):16-22. Xu G, Guo C, Shan H, et al. Divergence of duplicate genes in exon–intron structure[J]. PNAS. 2012;109(4):1187-1192. Jeffares DC, Penkett CJ, Bähler J. Rapidly regulated genes are intron poor[J]. Trends Genet. 2008;24(8):375-378. Qi TC, Huang H, Song SS, Xie DX. Regulation of Jasmonate-Mediated Stamen Development and Seed Production by a bHLH-MYB Complex in Arabidopsis. Plant Cell. 2015;27:1620–1633. Li S, Hu Y, Yang H, et al. The Regulatory Roles of MYC TFs in Plant Stamen Development[J]. Plant Sci. 2023;111734. Fukazawa J, Mori K, Ando H, et al. Jasmonate inhibits plant growth and reduces gibberellin levels via microRNA5998 and transcription factor MYC2[J]. Plant Physiol. 2023;193(3): 2197-2214. Johnson LYD, Major IT, Chen Y, et al. Diversification of JAZ‐MYC signaling function in immune metabolism[J]. New Phytol. 2023;239(6): 2277-2291. Shinozaki K, Yamaguchi-Shinozaki K. Gene networks involved in drought stress response and tolerance. J Exp Bot. 2007;58:221-227. Miura K, Shiba H, Ohta M, et al. SlICE1 encoding a MYC-type transcription factor controls cold tolerance in tomato, Solanum lycopersicum[J]. Plant Biotechnol J. 2012;29(3):253-260. Ohta M, Sato A, Renhu N, et al. MYC-type transcription factors, MYC67 and MYC70, interact with ICE1 and negatively regulate cold tolerance in Arabidopsis[J]. Sci Rep. 2018;8(1):11622. Geng J, Wei T, Wang Y, et al. Overexpression of PtrbHLH, a basic helix-loop-helix transcription factor from Poncirus trifoliata, confers enhanced cold tolerance in pummelo (Citrus grandis) by modulation of H2O2 level via regulating a CAT gene[J]. Tree Physiol. 2019;39(12):2045-2054. Wang X, Song Q, Guo H, et al. StICE1 enhances plant cold tolerance by directly upregulating StLTI6A expression[J]. Plant Cell Rep. 2023;42(1):197-210. Yang J, Guo X, Mei Q, et al. MdbHLH4 negatively regulates apple cold tolerance by inhibiting MdCBF1/3 expression and promoting MdCAX3L-2 expression[J]. Plant Physiol. 2023;191(1): 789-806. Lee JS, Chu IS, Mikaelyan A, et al. Application of comparative functional genomics to identify best-fit mouse models to study human cancer[J]. Nat Genet.2004;36(12):1306-1311. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 16 Sep, 2024 Read the published version in BMC Genomics → Version 1 posted Editorial decision: Revision requested 27 Jun, 2024 Reviews received at journal 26 Jun, 2024 Reviewers agreed at journal 17 Jun, 2024 Reviews received at journal 17 Jun, 2024 Reviewers agreed at journal 29 May, 2024 Reviewers agreed at journal 29 May, 2024 Reviewers invited by journal 29 May, 2024 Editor invited by journal 02 Apr, 2024 Submission checks completed at journal 02 Apr, 2024 Editor assigned by journal 02 Apr, 2024 First submitted to journal 01 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4203459","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":286626750,"identity":"1b40a766-5d56-4a12-bce8-9f2496ac27d0","order_by":0,"name":"Tao Liu","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Liu","suffix":""},{"id":286626751,"identity":"a3950031-c132-4345-a9da-92e037777308","order_by":1,"name":"Yani Zheng","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yani","middleName":"","lastName":"Zheng","suffix":""},{"id":286626754,"identity":"f476ef09-3cc9-441a-9887-f5375c209816","order_by":2,"name":"Jingyu Yang","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jingyu","middleName":"","lastName":"Yang","suffix":""},{"id":286626757,"identity":"ca230285-c028-4ddf-a3ea-699f72564b76","order_by":3,"name":"Rourou Li","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rourou","middleName":"","lastName":"Li","suffix":""},{"id":286626760,"identity":"2dd0d6d0-4c79-4f40-a2fe-c130d25fc757","order_by":4,"name":"Huan Chang","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Huan","middleName":"","lastName":"Chang","suffix":""},{"id":286626762,"identity":"23b84d93-93aa-4194-a7dc-6a1acb1df1d9","order_by":5,"name":"Nanyang Li","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nanyang","middleName":"","lastName":"Li","suffix":""},{"id":286626763,"identity":"b3b8ffa3-4bcc-47c9-a8c2-a24d4d18417a","order_by":6,"name":"Suna Wang","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Suna","middleName":"","lastName":"Wang","suffix":""},{"id":286626764,"identity":"a9c2abbf-08ff-49fc-b9fb-4bf65dfdca48","order_by":7,"name":"Liping Wang","email":"","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Liping","middleName":"","lastName":"Wang","suffix":""},{"id":286626766,"identity":"28f2978b-05ae-4117-a514-0576d2ed3129","order_by":8,"name":"Xing Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYNACAwYGfgkGNgjnALFaJGeQpgWk6waxWgyOnz38mqfgjt3m283HHnxsY5Dju5HA+LkAn5YzeWmWMwyeJW+7cyzdcGYbg7HkjQRm6Rl4tJgdyDEz+GBwONnsRo6ZNG8bQ+KGGwlszDz4tJx/Y2aQANRiPCP/m/TfNoZ6wlpu5Bg/ANpiZyCRwybN2MaQYEBIi/2NN2aMMwwOJ0jcSDM37DknYTjzzMNmaXxaJPtzjD/z/Dlszz8j+dmDH2U28nzHkw9+xqcFCNgkgERiA4QDYjM24NfAwMD8AeRAQqpGwSgYBaNgBAMAZj9QEXckcHUAAAAASUVORK5CYII=","orcid":"","institution":"Hebei University of Engineering","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-04-02 03:14:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4203459/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4203459/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12864-024-10771-8","type":"published","date":"2024-09-16T15:57:46+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":54135898,"identity":"7becd0f2-8b7f-435c-81d6-062999105fed","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":100387,"visible":true,"origin":"","legend":"\u003cp\u003eThe distribution of MYC family genes on chromosomes of four Cucurbitaceae crops. (A), C. sativus (B), C. melo (C), B. hispida (D), C. lanatus\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/b9506fd7f43bba652fd3a1b1.png"},{"id":54136275,"identity":"a4274b83-53ce-4b19-98e1-34c402234dc1","added_by":"auto","created_at":"2024-04-05 06:31:06","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":234660,"visible":true,"origin":"","legend":"\u003cp\u003eThe phylogenetic tree, gene structure and conserved domains of MYC genes of four Cucurbitaceae crops. (A), The MYC phylogenetic tree is divided into five groups, and different colors indicate different branches (B), Conserved sequence of MYC genes (C), The MYC genes structure, green indicates CDS sequence, yellow indicates untranslated region, and black line indicates intron.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/33e56236001429d7628ceab1.jpeg"},{"id":54135900,"identity":"2bf7ba4f-9cf2-4bf3-a478-856105275263","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":548719,"visible":true,"origin":"","legend":"\u003cp\u003eSequence alignment of MYC\u003cem\u003e \u003c/em\u003eproteins of four \u003cem\u003eCucurbitaceae\u003c/em\u003ecrops\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/03516024018323101d495ec2.jpeg"},{"id":54135905,"identity":"2a2ce3c1-8b8d-4308-9798-73582c9bf4d4","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":274558,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of MYC family members in\u003cem\u003e C. sativus\u003c/em\u003e, \u003cem\u003eC. melo\u003c/em\u003e, \u003cem\u003eC. lanatus\u003c/em\u003e, \u003cem\u003eB. hispida\u003c/em\u003e, \u003cem\u003eZ. mays\u003c/em\u003e, \u003cem\u003eB. distachyon\u003c/em\u003e, and \u003cem\u003eO. sativa\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/91a7196d2aba20739f9e60e4.jpeg"},{"id":54135901,"identity":"ab87e908-bc95-4198-94b3-9d0d635ccc47","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":747714,"visible":true,"origin":"","legend":"\u003cp\u003eSyntenic analysis of MYC genes among \u003cem\u003eC. sativus\u003c/em\u003e, \u003cem\u003eC. melo\u003c/em\u003e, \u003cem\u003eC. lanatus\u003c/em\u003e, and \u003cem\u003eB. hispida.\u003c/em\u003e Gray lines in the background indicate the collinear blocks within \u003cem\u003eC. sativus\u003c/em\u003e, \u003cem\u003eC. melo\u003c/em\u003e, \u003cem\u003eC. lanatus\u003c/em\u003e, and \u003cem\u003eB. hispida\u003c/em\u003e genomes, while the red lines highlight the homologous gene pairs.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/86c48010aa4ad70bcfddb66c.png"},{"id":54135908,"identity":"5af8a304-50d6-4247-bbdf-6d3ab232afaf","added_by":"auto","created_at":"2024-04-05 06:23:07","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":281827,"visible":true,"origin":"","legend":"\u003cp\u003eThe heatmap of various \u003cem\u003ecis\u003c/em\u003e-elements in the promoters of each \u003cem\u003eCucurbitaceae\u003c/em\u003e MYC gene. Colors represent the quantity of\u003cem\u003e cis\u003c/em\u003e elements, with deeper red indicating higher quantities. The numbers in the image represent the counts of cis elements.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/ce74bd7008eb2968122370f4.jpeg"},{"id":54135907,"identity":"89064841-8eec-4403-88de-e72c2a4ff060","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":199625,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression heatmap of MYC\u003cem\u003e \u003c/em\u003efamily genes in different tissues of \u003cem\u003eC. sativus\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/92f7311245b0d71517c99327.jpeg"},{"id":54135910,"identity":"ac3f997b-2d69-4098-80d1-9192e22f1326","added_by":"auto","created_at":"2024-04-05 06:23:07","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":164168,"visible":true,"origin":"","legend":"\u003cp\u003eExpression heatmap of cucumber MYC genes under High-temperature stress. HT0h represents the control treatment, HT3h represents high-temperature treatment for 3 hours, and HT6h represents high-temperature treatment for 6 hours. (A), The data in the table represents the raw FPKM values (B), The data in the table represents the log2 FC of raw FPKM values.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/d21a55ea2e9ce2cec3946f13.jpeg"},{"id":54135909,"identity":"996544cd-04f4-41bc-8e83-a99d1cf130a5","added_by":"auto","created_at":"2024-04-05 06:23:07","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":149652,"visible":true,"origin":"","legend":"\u003cp\u003eExpression heatmap of cucumber MYC family genes under Low-temperature stress. CT represents the control treatment, CS_2h represents low-temperature treatment for 2 hours, CS_6h represents low-temperature treatment for 6 hours, and CS_12h represents low-temperature treatment for 12 hours. (A), The data in the table represents the raw FPKM values. (B), The data in the table represents the log2 FC of raw FPKM values.\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/eebefb38d55fe7859b659698.jpeg"},{"id":54135911,"identity":"253090ec-ca96-4ed2-a1f3-8cd174d0d764","added_by":"auto","created_at":"2024-04-05 06:23:07","extension":"jpeg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":214478,"visible":true,"origin":"","legend":"\u003cp\u003eExpression heatmap of cucumber MYC family genes under salt and silicon stress treatments. CT represents the control treatment, Na represents salt stress, Si represents silicon stress, and NaSi represents combined salt and silicon stress. (A), The data in the table represents the raw FPKM values. (B), The data in the table represents the log2 FC of raw FPKM values.\u003c/p\u003e","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/409fa61849e72b723686edac.jpeg"},{"id":54135912,"identity":"ae7582a6-ca19-4586-813e-9735d4299e14","added_by":"auto","created_at":"2024-04-05 06:23:07","extension":"jpeg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":190535,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of cucumber MYC family genes under powdery mildew stress treatment. SSL508-28: resistant material; D8: susceptible material; CT: uninfected; 48h, 48h after inoculation. (A), The data in the table represents the raw FPKM values. (B), The data in the table represents the log2 FC of raw FPKM values.\u003c/p\u003e","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/c2cd9a147bf959c4331f052c.jpeg"},{"id":54135902,"identity":"800a8239-9e31-4ab3-bbbe-453b9b6eeb9b","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"jpeg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":224547,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of cucumber MYC family genes under southern root-knot nematode stress treatment. IL10-1: resistant material; CC3: susceptible material; 0d, 1d, 2d, 3d represent 1 day, 2 days, and 3 days after inoculation, respectively. (A), The data in the table represents the raw FPKM values. (B), The data in the table represents the log2 FC of raw FPKM values.\u003c/p\u003e","description":"","filename":"floatimage12.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/1dcabceea40bba0a4ef0e4e6.jpeg"},{"id":54135904,"identity":"8ad3be44-b21e-48b1-ade1-4c680f4a0b58","added_by":"auto","created_at":"2024-04-05 06:23:06","extension":"jpeg","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":163636,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of MYC genes in four \u003cem\u003eCucurbitaceae\u003c/em\u003e crops under High-temperature and Low-temperature stress. HT: High-temperature; LT: Low-temperature; CK: the control check.\u003c/p\u003e","description":"","filename":"floatimage13.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/1bfedfb196d887e47028b93e.jpeg"},{"id":65104045,"identity":"4dd10838-8df3-44c7-95a0-52b2d4a2c53f","added_by":"auto","created_at":"2024-09-23 16:11:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4506189,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4203459/v1/9a0f0457-bf82-4495-a1eb-500dfb85c07a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of MYC genes in four Cucurbitaceae species and the response to temperature stress","fulltext":[{"header":"Background","content":"\u003cp\u003eMyelocytomatosis oncogene (\u003cem\u003eMYC\u003c/em\u003e), an important class of transcription factors (TFs) belong to basic helix-loop-helix (bHLH) TF family, contains two conserved functional domains, namely bHLH_MYC_N domain in the N-terminal region and bHLH region in the C-terminal [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. As a sub-genetic family in the bHLH family member, \u003cem\u003eMYC\u003c/em\u003e play an important role in plant growth and development, secondary metabolism and signal transduction [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe first \u003cem\u003eMYC\u003c/em\u003e gene was cloned form \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, named \u003cem\u003eAtMYC1\u003c/em\u003e, functional studies showed that it played a certain role in plant seed development [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Successively, more \u003cem\u003eMYC\u003c/em\u003e genes were found in \u003cem\u003eArabidopsis\u003c/em\u003e. It was found that \u003cem\u003eMYC2\u003c/em\u003e could regulate leaf aging by antagonizing with bHLH Ⅲd subfamily transcription factors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and could also interact with \u003cem\u003eJAZ7\u003c/em\u003e to inhibit leaf aging under dark conditions [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, \u003cem\u003eAtMYC2\u003c/em\u003e could cooperate with \u003cem\u003eAtMYC3\u003c/em\u003e and \u003cem\u003eAtMYC4\u003c/em\u003e in regulating leaf development [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], chlorophyll degradation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], seed production and seed storage protein accumulation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Previous studies also found that \u003cem\u003eAtMYC2\u003c/em\u003e could inhibit the growth of leaf veins by inhibiting the synthesis of auxin in plant leaves [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Others, the \u003cem\u003eArabidopsis\u003c/em\u003e Aborted MicrosporeS (\u003cem\u003eAMS\u003c/em\u003e) gene, encoded a \u003cem\u003eMYC\u003c/em\u003e class transcription factor, plays a crucial role in tapetum cell development and pollen wall formation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In addition, MYC genes in other plants have been identified to be involved in plant growth and development. In apple (\u003cem\u003eMalus pumila\u003c/em\u003e Mill.), at the fruit ripening stage, \u003cem\u003eMdMYC2\u003c/em\u003e can affect ethylene biosynthesis and promote fruit ripening by promoting the expression of \u003cem\u003eMdACS1\u003c/em\u003e and \u003cem\u003eMdACO1\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In rice (\u003cem\u003eOryza sativa\u003c/em\u003e), overexpression of \u003cem\u003eOsMYC2\u003c/em\u003e could interact with \u003cem\u003eOsJAZ1\u003c/em\u003e and activate the downstream gene \u003cem\u003eOsMADS1\u003c/em\u003e, and then regulate the development of spikelet [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The \u003cem\u003eMYC\u003c/em\u003e genes also have important effect on the accumulation of plant secondary metabolites. Such as, overexpressed the \u003cem\u003eAtMYC3\u003c/em\u003e and \u003cem\u003eAtMYC4\u003c/em\u003e resulted in the excessive accumulation of anthocyanins in \u003cem\u003eArabidopsis\u003c/em\u003e. Likewise, wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e) \u003cem\u003eMYC1\u003c/em\u003e could also regulate anthocyanin synthesis in pericarp [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The \u003cem\u003eCrMYC2\u003c/em\u003e could control the jasmonate-responsive expression of the \u003cem\u003eORCA\u003c/em\u003e genes that regulated alkaloid biosynthesis in \u003cem\u003eCatharanthus roseus\u003c/em\u003e. In few, \u003cem\u003eTcJAMYC\u003c/em\u003e could bind to E-box and activate the gene promoter related to paclitaxel pathway, which can effectively improve the yield of paclitaxel in suspension cell culture system [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In \u003cem\u003eArtemisia annua\u003c/em\u003e, \u003cem\u003eAaMYC2\u003c/em\u003e could bind to \u003cem\u003eAaJAZ1-4\u003c/em\u003e and activate the expression of artemisinin biosynthetic enzymes \u003cem\u003eCYP71AV1\u003c/em\u003e and \u003cem\u003eDBR2\u003c/em\u003e, which positively regulates artemisinin biosynthesis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlthough a large number of studies on MYC genes in various species have been conducted, studies on MYC genes in \u003cem\u003eCucurbitaceae\u003c/em\u003e crops is still weak. \u003cem\u003eCucurbitaceae\u003c/em\u003e is one of the most important edible plant families in the world, among which cucumbers, melons, watermelons and wax gourds are widely grown worldwide, coming into being the great economic benefits. In this study, we aim to identify MYC genes in four \u003cem\u003eCucurbitaceae\u003c/em\u003e crops and compare the evolution and variations of MYC genes among species through bioinformatics analysis. We will also analyze the expression patterns of MYC genes under biotic and abiotic stresses, focusing on identifying MYC genes involved in temperature stress response, for providing theoretical support for stress-resistant breeding in Cucurbitaceae crops.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eIdentification and bioinformatics analysis of the MYC gene family in\u003c/b\u003e \u003cb\u003eCucurbitaceae\u003c/b\u003e \u003cb\u003ecrops\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDownload the HMM model file (PF14215.7 and PF00010) for the MYC gene family from the Pfam database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pfam.xfam.org/\u003c/span\u003e\u003cspan address=\"http://pfam.xfam.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and download the protein sequence file of \u003cem\u003eCucumis sativus\u003c/em\u003e L., \u003cem\u003eCucumis melo\u003c/em\u003e L., \u003cem\u003eCitrullus lanatus\u003c/em\u003e, \u003cem\u003eBenincasa hispida\u003c/em\u003e from the Cucurbitaceae Genomic Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cucurbitgenomics.org\u003c/span\u003e\u003cspan address=\"http://cucurbitgenomics.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; [\u003cspan additionalcitationids=\"CR20 CR21\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] ). Use the Hidden Markov Model (HMM) plugin in the HMMER v3 software package to predict candidate MYC gene family members in the \u003cem\u003eCucumis sativus\u003c/em\u003e L., \u003cem\u003eCucumis melo\u003c/em\u003e L., \u003cem\u003eCitrullus lanatus\u003c/em\u003e, \u003cem\u003eBenincasa hispida\u003c/em\u003e genome [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and extract the sequence information of high-quality candidate proteins using Perl scripts (E\u0026thinsp;\u0026lt;\u0026thinsp;1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e). Then, identify the candidate \u003cem\u003eMYC\u003c/em\u003e gene family genes using the BLASTP program and the NCBI-Conserved Domain Data (CDD) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMYC gene family characterization and phylogenetic tree construction in\u003c/b\u003e \u003cb\u003eCucurbitaceae\u003c/b\u003e \u003cb\u003ecrops\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUtilizing the online tool ExPASy (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], we analyzed the amino acid count, molecular weight, isoelectric point, instability coefficient, aliphatic index, and average hydrophobicity of the members of the MYC gene family. We used the online website CELLO (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cello.life.nctu.edu.tw/\u003c/span\u003e\u003cspan address=\"http://cello.life.nctu.edu.tw/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for subcellular localization prediction. We employed the online software MEME (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://meme-suite.org/\u003c/span\u003e\u003cspan address=\"http://meme-suite.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to analyze the conserved motifs of MYC family proteins, with the parameters set as follows: 10 motifs, optimal motif width range from 6 to 200. The multiple sequence alignment was performed using the ClustalX 2.0 and visualized by Jalview [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Phylogenetic analysis was performed using MEGA7 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] with the neighbor-joining (NJ) method, and the parameters were set as the Poisson model, pairwise deletion, and 1000 bootstrap replications [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eChromosomal distribution and collinearity analysis of MYC genes\u003c/h2\u003e \u003cp\u003eBased on the physical location information in the genome database, we used the mapchart to map the MYC gene family members onto \u003cem\u003eCucurbitaceae\u003c/em\u003e crops chromosomes, respectively [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The distribution of the \u003cem\u003eCucurbitaceae\u003c/em\u003e crops SRS gene family on the chromosomes were visualized using TBtools software [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Gene duplication events were analyzed using the multiple collinearity scan tool (MCScanX) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. A collinearity analysis plot was generated using the Dual Systeny Plotter software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/CJ-Chen/TBtools\u003c/span\u003e\u003cspan address=\"https://github.com/CJ-Chen/TBtools\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGene Expression Analysis\u003c/h2\u003e \u003cp\u003eTranscriptome sequencing data related to cucumbers were downloaded from the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The SRA to Fastq plugin in TBtools was used to convert the downloaded SRA data into Fastq format. Data quality was assessed using the FastQC plugin [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and adapter sequences and low-quality sequences were removed with the Trimmomatics plugin [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], resulting in clean data. The filtered transcriptome data was aligned to the cucumber ChineseLong_V3 genome using the STAR plugin, generating SAM files [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Gene expression levels were analyzed using the StringTie Quantify plugin [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Finally, differential gene expression analysis was conducted using the DESeq2 plugin [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eTissue-specific expression analysis of Cucumber MYC genes\u003c/h2\u003e \u003cp\u003eUsing transcriptome sequencing data from the NCBI database (PRJNA80169) [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], we analyzed the tissue-specific expression of the cucumber MYC gene family in various tissues and organs, including cucumber leaves, stems, female flowers, male flowers, unfertilized ovaries, fertilized ovaries, ovaries, roots, tendrils, and the base of tendrils. We utilized the TBtools software to create an expression heatmap, depicting the specific expression patterns of the cucumber MYC gene family in different cucumber tissues and organs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStress-responsive expression analysis of Cucumber MYC genes\u003c/h2\u003e \u003cp\u003eUsing transcriptome sequencing data from the NCBI database, including PRJNA634519 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], PRJNA438923 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], PRJNA477930 [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], PRJNA321023 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and PRJNA419665 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], we analyzed the specific expression patterns of the cucumber MYC gene family in response to various stress conditions, such as high temperature, low temperature, high salinity, silicon, powdery mildew, downy mildew, and southern root-knot nematodes. We used TBtools software to create expression heatmaps, illustrating the gene expression responses of the cucumber MYC gene family undering abiotic and biotic stress conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTemperature stress treatment, RNA extraction and qRT-PCR\u003c/h2\u003e \u003cp\u003eThe cultivars Jinyan-4(\u003cem\u003eCucumis sativus\u003c/em\u003e), Harukei-3 (\u003cem\u003eCucumis melo\u003c/em\u003e), B227 (\u003cem\u003eBenincasa hispida\u003c/em\u003e), and 8424 (\u003cem\u003eCitrullus lanatus\u003c/em\u003e) provided by Hebei Engineering Research Center for Seedling Breeding of Solanaceae and Fruit Vegetables of Hebei University of Engineering were used to explore the genes expression under temperature stress. The seedlings of four cultivars were treated at 42\u0026deg;C, and the leaves of the seedlings were taken at 0, 3, 6 and 12 h after treatment for qRT-PCR. At the same time, the seedlings of four cultivars were treated at 10\u0026deg;C, and the leaves of the seedlings were taken at 0, 3, 6 and 12 h after treatment for qRT-PCR. All samples have three biological replicates, and frozen in liquid nitrogen and then immediately stored at -80℃.\u003c/p\u003e \u003cp\u003e Total RNA was extracted using the RNAprep Pure Plant Kit (DP432, Tiangen Bio-tech, Beijing, China) according to the manufacturer's instructions. The cDNA was synthesized from the total RNA using the PrimeScript RT Kit (Takara). Specific primers for each gene were designed through primer 6 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Subsequently, the synthesized cDNA underwent qRT-PCR on an Opticon thermocycler (CFX96 Connect Real-Time System; Bio-Rad, Hercules, CA) using SYBR Green PCR master mix (Vazyme, Nanjing, China) according to the manufacturer's instructions. The 2-ΔΔCT method was employed to calculate the relative expression of the MYC genes [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers used in quantitative RT-PCR. All primers are designed by Primer 6.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnti-sense Primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G007980\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGTCAGTGGAGTCAGAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTACACGGTTAATCACAGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G001710\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATGCGATGATAAGGATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTCACTGTTGCTTGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBhi01M000362\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGTTCTATGCTCTACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGAGGTGAGGCTGGATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCla97C05G080890\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTAGTTAATGGAGTCAGAGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACGGTTAATCACAGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMELO3C006016\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTGAGGAATGATGAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATGAGACAGTTGCCAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMELO3C013851\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGAGACGAGTTCTTGGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGGTGGTGGTAATTGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBhi11M000137\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACTCAGACCACTCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTCAATGGCTCTTCTCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCla97C10G186220\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACTCAGACCACTCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTCAATGGCTCTTCTCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBhi10G001911\u003c/em\u003e(\u003cem\u003eActin\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGTTCACAACCACTGCCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCGAGCGCAACATAAGCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMELO3C008032\u003c/em\u003e(\u003cem\u003eActin\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGTTCACCACCACTGCCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCTGGAATAGAACTTCTGGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eClActin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATGTATGTTGCCATCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATAGCATGGGGTAGAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCuActin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGAAGATCTGGCATCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCAATCCAGACACTGTACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eIdentification and physicochemical property analysis of MYC genes\u003c/h2\u003e \u003cp\u003eA total of 40 MYC genes were identified in the genomes of four \u003cem\u003eCucurbitaceae\u003c/em\u003e crops. 10 in \u003cem\u003eC. sativus\u003c/em\u003e, 8 in \u003cem\u003eC. melo\u003c/em\u003e, 12 in \u003cem\u003eC. lanatus\u003c/em\u003e, and 10 in \u003cem\u003eB. hispida\u003c/em\u003e. All the MYC genes were unequally distributed on each chromosome. For example, in \u003cem\u003eC. sativus\u003c/em\u003e L., there are 6 MYC genes on chromosome 3, while there are none on chromosome 1, 2, 4, and 5. In \u003cem\u003eC. melo\u003c/em\u003e L., except for chromosomes 2, 3, 5, 7, 8, 9, 10, and 12 where there is no distribution, the other chromosomes each have 1, 2, or 3 MYC genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Sequence analysis revealed that the amino acid lengths encoded by \u003cem\u003eCsMYC\u003c/em\u003e genes varied from 431aa (\u003cem\u003eCsMYC8\u003c/em\u003e) to 694aa (\u003cem\u003eCsMYC5\u003c/em\u003e), by \u003cem\u003eCmMYC\u003c/em\u003e genes varied from 433aa (\u003cem\u003eCmMYC8\u003c/em\u003e) to 745aa (\u003cem\u003eCmMYC1\u003c/em\u003e), by \u003cem\u003eClMYC\u003c/em\u003e genes varied from 423aa (\u003cem\u003eClMYC3\u003c/em\u003e) to 969aa (\u003cem\u003eClMYC1\u003c/em\u003e), and by \u003cem\u003eBhMYC\u003c/em\u003e genes varied from 501aa (\u003cem\u003eBhMYC4\u003c/em\u003e) to 968aa (\u003cem\u003eBhMYC3\u003c/em\u003e). In \u003cem\u003eCucurbitaceae\u003c/em\u003e crops, except for the \u003cem\u003eCsMYC1\u003c/em\u003e, \u003cem\u003eCmMYC5, ClMYC10\u003c/em\u003e and \u003cem\u003eBhMYC1\u003c/em\u003e were acidic proteins, the others are alkaline proteins. The most proteins are unstable (instability index greater than 40), while the \u003cem\u003eCsMYC5, CmMYC1, ClMYC12, BhMYC7\u003c/em\u003e, and \u003cem\u003eBhMYC9.\u003c/em\u003e The average hydrophilicity values of all are less than 0, indicating that all the proteins are hydrophobic. Subcellular localization prediction results revealed that the most MYC proteins are localized in the cell nucleus, followed by chloroplasts. (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eProtein information of MYC gene family members in Cucurbitaceae crops.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNumber of amino acids (aa)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMolecular weight (D)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003epI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eInstability index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eAliphatic index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eAverage of hydropathicity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003ePrediction of subcellular location\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"9\" rowspan=\"10\"\u003e \u003cp\u003e\u003cem\u003eCucumis sativus\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G000850.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e49398.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e43.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e82.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.416\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G001710.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e642\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e69911.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e50.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e64.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.578\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G007980.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e649\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e71943.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e49.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e77.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G022420.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e55301.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e78.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.445\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G034600.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e694\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e78486.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e38.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e84.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.370\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eChloroplast\\Nucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_3G049150.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e75666.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e58.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e69.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.617\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_6G000530.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e644\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72769.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e43.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e78.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_6G008940.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e431\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e48394.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e76.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_6G037080.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e650\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e71869.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e48.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e83.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.347\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCsaV3_7G027460.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCsMYC10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e691\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e76190.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e41.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e76.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.372\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"7\" rowspan=\"8\"\u003e \u003cp\u003e\u003cem\u003eCucumis melo\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C015748.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e745\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e82003.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e37.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e81.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.269\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C003412.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e723\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e79597.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e56.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e68.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.628\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C024041.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e55262.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e48.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e78.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.486\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C006016.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e586\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e65067.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e80.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.535\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C013772.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e48984.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e7.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e48.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e81.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.439\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C013851.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72281.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e49.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e64.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.570\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C021212.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e656\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e74227.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e42.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e79.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMELO3C022250.2.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eCmMYC8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e433\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e48684.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e76.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"11\" rowspan=\"12\"\u003e \u003cp\u003e\u003cem\u003eCitrullus lanatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C03G062520.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e969\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e105839.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e78.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.415\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C05G080890.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e618\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e68589.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e46.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e76.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C06G112130.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e423\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47569.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e52.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e71.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.513\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C06G112140.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e427\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47692.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e52.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e52.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.424\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C06G113160.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e645\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72922.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e46.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e79.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.469\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C07G128490.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e637\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e70287.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e45.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e81.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.368\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C07G129080.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e55179.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e49.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e76.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.504\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C09G170270.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e690\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e76046.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e40.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e80.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.345\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C09G174730.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e680\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e74878.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e53.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e70.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.610\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C10G185380.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e463\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e51021.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e53.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e79.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.471\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C10G186220.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC11\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e694\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e76681.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e49.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e64.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.573\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCla97C10G204640.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eClMYC12\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e695\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e78085.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e38.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e83.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.326\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eChloroplast\\Nucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"9\" rowspan=\"10\"\u003e \u003cp\u003e\u003cem\u003eBenincasa hispida\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhiUN179M27\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e453\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e49798.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e83.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.371\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi01M000362\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e617\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e68250.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e78.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.520\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi02M001191\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e968\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e105559.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e79.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.421\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi05M000179\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e55182.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e45.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e79.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.464\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi05M000251\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e71471.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e43.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e80.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.370\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi05M000336\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e682\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e75237.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e48.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e71.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.632\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi09M000958\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e604\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e66789.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e39.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e80.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.350\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi11M000137\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e660\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72104.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e65.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.570\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi11M001900\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e78638.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e39.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e84.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.314\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eChloroplast\\Nucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBhi12M001654\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBhMYC10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e643\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72375.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e80.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-0.451\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eNucleus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eStructure and phylogenetic analysis of\u003c/b\u003e \u003cb\u003eCucurbitaceae\u003c/b\u003e \u003cb\u003ecrops MYC gene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMotif prediction analysis on the protein sequences of the MYC family members showed that when the number of motifs is limited to 10, no MYC family member contains all the motifs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). And the motif 1, 2, 5, 7, and 8 were relatively conservative, common to all MYC genes. Gene structure analysis revealed that the number of exons in MYC genes ranges from 1 to 15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The gene structures of most MYC genes within the same lineage are similar, further indicating the conservation of protein motifs and gene structures within the same evolutionary branch of \u003cem\u003eMYCs\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAccording to the alignment of bHLH domains in MYC proteins, there was a basic amino acid region (Basic) composed of approximately 12 amino acids. This region contains a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence, which is essential for the binding of bHLH to target genes. This region also includes two helical structures, comprising approximately 37 amino acids. Notably, the 22th and 38th leucine (Leu) amino acids in the HLH domain are highly conserved, indicating their necessity for dimer formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo clarify the evolutionary relationships among the MYC gene family in \u003cem\u003eCucurbitaceae\u003c/em\u003e crops, \u003cem\u003eZea mays\u003c/em\u003e, \u003cem\u003eBrachypodium distachyon\u003c/em\u003e, and \u003cem\u003eOryza sativa\u003c/em\u003e, we constructed a phylogenetic tree. As the result showed that All MYC proteins could be divided into five subgroups, labeled as I to Ⅴ. In each subgroup, there are both monocotyledonous and dicotyledonous plants, indicating that the MYC genes were relatively conserved during the evolutionary processes of both monocots and dicots. Group Ⅳ is the largest subgroup, consisting of 4, 4, 6, 3, 2, 1, and 1 MYC proteins from \u003cem\u003eC. sativus\u003c/em\u003e L., \u003cem\u003eC. melo\u003c/em\u003e L., \u003cem\u003eC. lanatus\u003c/em\u003e, \u003cem\u003eB. hispida\u003c/em\u003e, \u003cem\u003eZ.mays\u003c/em\u003e, \u003cem\u003eB. distachyon\u003c/em\u003e, and \u003cem\u003eO. sativa\u003c/em\u003e, respectively. while the group I was the smallest, only with 4 MYC genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In group Ⅱ, there were 7 MYC genes, while only 1 belongs to monocotyledonous plants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCollinearity analysis of MYC gene among Cucurbitaceae crops\u003c/h2\u003e \u003cp\u003eTo infer the evolution of MYC genes, synteny analysis was carried out among the four \u003cem\u003eCucurbitaceae\u003c/em\u003e species (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e; Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). A total of 36 MYC genes (9 in \u003cem\u003eC. sativus\u003c/em\u003e L., 7 in \u003cem\u003eC. melo\u003c/em\u003e L., 11 in \u003cem\u003eC. lanatus\u003c/em\u003e, and 9 in \u003cem\u003eB. hispida\u003c/em\u003e) were located within synteny blocks of the four \u003cem\u003eCucurbitaceae\u003c/em\u003e genomes. We found five orthologous gene pairs which exist among all four species. The result showed that these MYC genes were conserved during the evolution of all the four \u003cem\u003eCucurbitaceae\u003c/em\u003e species, suggesting the conserved roles in \u003cem\u003eCucurbitaceae\u003c/em\u003e species. Furthermore, it was also observed that some MYC genes were lost in some species. For instance, certain MYC genes were found in \u003cem\u003eC. sativus\u003c/em\u003e L., \u003cem\u003eC. melo\u003c/em\u003e L., and \u003cem\u003eB. hispida\u003c/em\u003e, but were lost in \u003cem\u003eB. hispida\u003c/em\u003e, such as the \u003cem\u003eCsaV3_3G000850\u003c/em\u003e/\u003cem\u003eMELO3C013772.2\u003c/em\u003e/\u003cem\u003eCla97C10G185380\u003c/em\u003e collinear gene pair. The result showed that the specific traits in different \u003cem\u003eCucurbitaceae\u003c/em\u003e species during the evolution and the amplification of genome. In addition, there were two collinear gene pairs only existed in \u003cem\u003eC. lanatus\u003c/em\u003e, and \u003cem\u003eB. hispida\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe collinear gene pairs existed in four \u003cem\u003eCucurbitaceae\u003c/em\u003e genomes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCucumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMelon\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWatermelon\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWaxgourp\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_3G000850\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMELO3C013772.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C10G185380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_7G027460\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMELO3C015748.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C09G170270\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi09M000958\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_6G037080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C07G128490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi05M000251\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_6G008940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMELO3C022250.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C06G112130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_6G000530\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMELO3C021212.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C06G113160\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi12M001654\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCsaV3_3G049150\u003c/p\u003e \u003cp\u003eCsaV3_3G001710\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMELO3C003412.2\u003c/p\u003e \u003cp\u003eMELO3C013851.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCla97C09G174730\u003c/p\u003e \u003cp\u003eCla97C10G186220\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBhi05M000336\u003c/p\u003e \u003cp\u003eBhi11M000137\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_3G007980\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMELO3C006016.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C05G080890\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi01M000362\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCsaV3_3G034600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C10G204640\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi11M001900\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C03G062520\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi02M001191\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCla97C07G129080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBhi05M000179\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eThe regulatory TFs of MYC genes\u003c/h2\u003e \u003cp\u003eThe 1.5-kb upstream sequences of MYC genes were selected to predicate theirs regulatory TFs. As the results showed that three types of \u003cem\u003ecis\u003c/em\u003e-elements related to development, hormone stress, and abiotic stresses were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Among the \u003cem\u003ecis\u003c/em\u003e-elements related to development, the number of G-box (CACGTC) elements is the highest, which is a light-responsive element. For example, genes of \u003cem\u003eMELO3C021212.2.1\u003c/em\u003e, \u003cem\u003eMELO3C003412.2.1\u003c/em\u003e, and \u003cem\u003eCla97C10G186220.1\u003c/em\u003e contain 9 G-box elements, indicating that they might be regulated by the light environment. For the \u003cem\u003ecis\u003c/em\u003e-elements related to hormone stress, the abscisic acid (ABA)-responsive element ABRE (ACGTG) occupies a relatively large proportion, 8 in genes of \u003cem\u003eMELO3C021212.2.1\u003c/em\u003e, \u003cem\u003eMELO3C003412.2.1\u003c/em\u003e, and \u003cem\u003eCla97C10G186220.1\u003c/em\u003e, 6 in genes of \u003cem\u003eBhi02M001191\u003c/em\u003e, \u003cem\u003eCsaV3_3G001710.1\u003c/em\u003e, and \u003cem\u003eBhi11M000137\u003c/em\u003e. Among the \u003cem\u003ecis\u003c/em\u003e-elements related to abiotic stresses, anaerobic induction ARE (AAACCA) were detected in a series of members, such as 6 in \u003cem\u003eCla97C07G128490.1\u003c/em\u003e and \u003cem\u003eCsaV3_3G007980.1\u003c/em\u003e, 5 in \u003cem\u003eCla97C05G080890.1\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTissue-specific expression analysis of MYC genes in\u003c/b\u003e \u003cb\u003eC. sativus\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo investigate the expression profiles of the MYC gene family in different tissues, using cucumber as a representative, we conducted the transcriptome analysis based on publicly available cucumber transcriptome sequencing data among various tissues (PRJNA80169). We utilized the cucumber ChineseLong_V3 genome information for this reanalysis, focusing on the expression levels of the cucumber MYC gene family in 10 different tissues or organs, including root, stem, leave, tendril, male flower, female flower, ovary, ovary unfertilized, ovary fertilized and tendrils base. As the result showed that there was significant expression variation of the MYC gene family across different tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Such as, While the \u003cem\u003eCsaV3_3G001710\u003c/em\u003e gene showed a relatively high level of expression across all tissues or organs, three genes (\u003cem\u003eCsaV3_3G000850\u003c/em\u003e, \u003cem\u003eCsaV3_6G008940\u003c/em\u003e, and \u003cem\u003eCsaV3_6G037080\u003c/em\u003e), on the other hand, exhibited relatively low expression levels across all tissues or organs. Some genes exhibited significant tissue-specific expression patterns. For example, the \u003cem\u003eCsaV3_3G049150\u003c/em\u003e gene showed relatively high expression in root and fertilized ovary, while demonstrating low expression in other tissues or organs. Similarly, compared to other tissues or organs, the \u003cem\u003eCsaV3_7G027460\u003c/em\u003e gene displayed higher expression in root. The above results indicate that the cucumber MYC family genes played distinct roles in the development of tissues or organs, contributing to various functions in the growth and development of the plant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression analysis of cucumber MYC genes under different stress conditions.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBased on publicly available transcriptome data from the NCBI SRA database, we conducted a analysis of the expression levels of the cucumber MYC genes under both biotic and abiotic (high temperature, low temperature, salt and silicon stress, powdery mildew, and southern root-knot nematode) stress conditions.\u003c/p\u003e \u003cp\u003eUnder high-temperature stress, most MYC genes did not show significant differential expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). For instance, genes of \u003cem\u003eCsaV3_6G037080\u003c/em\u003e, \u003cem\u003eCsaV3_3G000850\u003c/em\u003e, and \u003cem\u003eCsaV3_6G008940\u003c/em\u003e exhibited no change in expression levels under high-temperature stress, and their expression levels were relatively low. However, gene \u003cem\u003eCsaV3_3G001710\u003c/em\u003e demonstrated a significant upregulation at 6 hours post high-temperature treatment (6hph), while gene \u003cem\u003eCsaV3_3G007980\u003c/em\u003e showed high expression levels at both 3hph and 6 hph. These results suggest that gene \u003cem\u003eCsaV3_3G007980\u003c/em\u003e is likely involved in the response of cucumber to high-temperature stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUnder low-temperature stress, the expression levels of four genes (\u003cem\u003eCsaV3_6G037080\u003c/em\u003e, \u003cem\u003eCsaV3_3G000850\u003c/em\u003e, \u003cem\u003eCsaV3_6G008940\u003c/em\u003e, and \u003cem\u003eCsaV3_6G000530\u003c/em\u003e) showed no significant change and remained at relatively low levels. Two genes exhibited relatively high expression levels during low-temperature treatment, with \u003cem\u003eCsaV3_3G007980\u003c/em\u003e gene showing a significant upregulation at 6hph. The expression levels of the other genes remained unchanged before and after low-temperature treatment. Additionally, \u003cem\u003eCsaV3_3G049150\u003c/em\u003e showed a significant downregulation in expression both at 6hph and 12hph. Worth noting is that the expression levels of all genes did not undergo significant changes at 3hph. These results suggest that \u003cem\u003eCsaV3_3G007980\u003c/em\u003e and \u003cem\u003eCsaV3_3G049150\u003c/em\u003e genes play a key role in the response of cucumber to prolonged low-temperature stress, and \u003cem\u003eCsaV3_3G007980\u003c/em\u003e was positively regulated, while \u003cem\u003eCsaV3_3G049150\u003c/em\u003e was negatively regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUnder salt and silicon stress, most genes did not show differential expression after NaCl and Silicon treatments. One gene (\u003cem\u003eCsaV3_3G000850\u003c/em\u003e) exhibited significant downregulation after NaCl treatment and show significant upregulation after Silicon treatment. However, when treated simultaneously with NaCl and Silicon, it displayed a higher degree of downregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). Despite the significant differential expression observed for \u003cem\u003eCsaV3_3G00850\u003c/em\u003e gene after treatment, its expression level remained relatively low under both control and stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilarly, we analyzed the response of the MYC gene to biological stress. After inoculation with powdery mildew for 48 hours, most genes showed no significant difference in expression in both resistant (SSL508-28) and susceptible (D8) material (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e). However, certain MYC genes exhibited differential expression patterns between SSL508-28 and D8. For instance, \u003cem\u003eCsaV3_3G000850\u003c/em\u003e, treated with powdery mildew, demonstrated a significantly higher level of upregulation in D8, compared to a relatively lower fold-change in SSL508-28. Interestingly, post-inoculation, the absolute expression level of \u003cem\u003eCsaV3_3G000850\u003c/em\u003e in D8 was much lower than its expression in SSL508-28. In addition, after inoculation with powdery mildew, \u003cem\u003eCsaV3_3G049150\u003c/em\u003e showed a significantly downregulated expression in D8 and a certain degree of upregulation in SSL508-28.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAfter inoculation with root-knot nematode (\u003cem\u003eMeloidogyne incognita\u003c/em\u003e), the expression levels of most genes in both resistant (IL10-1) and susceptible (CC3) material generally exhibited similar trends, such as \u003cem\u003eCsaV3_3G000850\u003c/em\u003e and \u003cem\u003eCsaV3_3G034600\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e). However, there were two genes, \u003cem\u003eCsaV3_6G000530\u003c/em\u003e and \u003cem\u003eCsaV3_6G037080\u003c/em\u003e, that showed an upregulation trend in resistant materials and a downregulation trend in susceptible materials. Nevertheless, the degree of differential expression for these genes is relatively low, whether in resistant or susceptible materials.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eThe responding of eight genes of four Cucurbitaceae crops under temperature stress\u003c/h2\u003e \u003cp\u003eThese eight genes in four \u003cem\u003eCucurbitaceae\u003c/em\u003e crops (\u003cem\u003eCsaV3_3G007980\u003c/em\u003e, \u003cem\u003eCsaV3_3G001710\u003c/em\u003e, \u003cem\u003eMELO3C006016\u003c/em\u003e, \u003cem\u003eMELO3C013851\u003c/em\u003e, \u003cem\u003eBhi01M000362\u003c/em\u003e, \u003cem\u003eBhi11M000137\u003c/em\u003e, \u003cem\u003eCla97C10G186220, Cla97C05G080890\u003c/em\u003e) were selected for analysis in response to temperature stress. As the result showed (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e13\u003c/span\u003e), in \u003cem\u003eCucumis sativus\u003c/em\u003e, that genes \u003cem\u003eCsaV3_3G007980\u003c/em\u003e and \u003cem\u003eCsaV3_3G001710\u003c/em\u003e showed upregulated expression under both low and high temperature stress, which is relatively consistent with the transcriptome results, indicating their involvement in cucumber response to temperature stress. This expression pattern also appeared in \u003cem\u003eCucumis melo\u003c/em\u003e and \u003cem\u003eCitrullus lanatus\u003c/em\u003e. The homologous genes \u003cem\u003eMELO3C006016\u003c/em\u003e and \u003cem\u003eCla97C05G080890\u003c/em\u003e of \u003cem\u003eCsaV3_3G007980\u003c/em\u003e showed mainly upregulated expression under high temperature stress. However, under low temperature stress, The homologous gene \u003cem\u003eMELO3C013851\u003c/em\u003e exhibited significant downregulation at 3 and 6 hours of low temperature treatment, and then showed upregulated expression at 12 hours of low temperature treatment. While, in \u003cem\u003eBenincasa hispida\u003c/em\u003e, these two homologous genes \u003cem\u003eBhi01M000362\u003c/em\u003e and \u003cem\u003eBhi11M000137\u003c/em\u003e show significantly downregulated expression in all time periods of both low and high temperature treatments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of MYC genes in Cucurbitaceae crops\u003c/h2\u003e \u003cp\u003eThe MYC transcription factor has been reported to participate in various life activities in plants, playing a crucial role in regulating the growth and development of plant organs as well as in modulating tolerance to abiotic stress responses. The MYC protein has a bHLH_MYC_N domain in the N-terminal region, which consists of two subdomains: JID and TAD. The former is essential for interacting with JAZ proteins, while the latter is a putative transcriptional activation domain [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In the C-terminal region, the conserved bHLH domain present determines its specificity and affinity for DNA sequence binding, and it can facilitate the formation of various homodimers and heterodimers [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The bHLH domain comprises a basic region and a HLH region. The basic region is located at the N-terminus of the domain, containing sites for DNA recognition and binding. In this study, a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence were detected in basic region, in which the highly conserved Leu in the 22th and 38th were necessity for dimer formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] had proved that the mutations at the two Leu sites significantly affect bHLH dimerization in \u003cem\u003eArabidopsis\u003c/em\u003e. According to the differences in the recognition mode between the basic region and the \u003cem\u003ecis\u003c/em\u003e-acting elements, bHLH-type transcription factors can be classified into six main groups (designated A to F) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Most of the MYC genes in \u003cem\u003eCucurbitaceae\u003c/em\u003e crops can specifically bind to the G-box (5\u0026rsquo;-CACNTG-3\u0026rsquo;), and belongs to group B. Consistent with previous findings, the C-terminus of the domain includes a conserved helix-loop-helix (HLH) structure that can form homodimers or heterodimers with other proteins.\u003c/p\u003e \u003cp\u003eAccording to the analysis of gene structure, the MYC genes in group Ⅲ and Ⅳ had fewer introns (less than or equal to 2), with even 50% of all MYC genes lacking introns. In contrast, MYC genes in the other three groups contain a large number of introns. Previous studies have indicated that introns and exons play important roles in the diversity and evolution of gene families through gain/loss and insertion/deletion events [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The significant difference in the number of introns among MYC genes suggests that \u003cem\u003eCucurbitaceae\u003c/em\u003e crops have undergone intron loss events during their evolutionary process to adapt to environmental changes. [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] found that having fewer introns in genes enables plants to respond more rapidly to environmental changes. In addition, evolutionary analysis between monocots and dicots revealed that all groups include both monocot and dicot species, indicating the MYC genes were relatively conserved during the evolutionary processes of both monocots and dicots.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFunctions of MYC genes and its responding to the temperature stree\u003c/h2\u003e \u003cp\u003eA wealth of research has shown that MYC transcription factors play significant roles in the growth and development of plants. For instance, MYC is involved in regulating processes such as plant seed production [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], stamen development [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], hormone regulation [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], and secondary metabolism [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In this study, the majority of MYC genes are expressed in roots, leaf, and unfertilized ovary (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Coupled with the identification of numerous \u003cem\u003ecis\u003c/em\u003e-elements related to development, and hormone stress, these findings further underscore their functions in growth and development.\u003c/p\u003e \u003cp\u003eMeanwhile, MYC genes play important roles in response to abiotic and biotic stresses. Judging from the results of this study, gene (\u003cem\u003eCsaV3_3G000850\u003c/em\u003e) exhibited significant downregulation after NaCl treatment and show significant upregulation after Silicon treatment. These results indicate that silicon treatment induced high expression of \u003cem\u003eCsaV3_3G000850\u003c/em\u003e, thereby enhancing salt tolerance in cucumber. Similar results have been reported in \u003cem\u003eArabidopsis\u003c/em\u003e, where overexpression of the \u003cem\u003eAtMYC2\u003c/em\u003e gene significantly increased osmotic stress tolerance [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. In recent years, there has been a growing focus on the response of the MYC gene to temperature stress. Overexpressing \u003cem\u003eSlICE1\u003c/em\u003e, which encodes a MYC-type transcription factor, enhances cold tolerance in tomatoes [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In \u003cem\u003eArabidopsis\u003c/em\u003e, \u003cem\u003eMYC67\u003c/em\u003e and \u003cem\u003eMYC70\u003c/em\u003e interact with \u003cem\u003eICE1\u003c/em\u003e, leading to negative regulation of cold tolerance [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Overexpression of \u003cem\u003ePtrbHLH\u003c/em\u003e, a basic helix-loop-helix transcription factor from \u003cem\u003ePoncirus trifoliata\u003c/em\u003e, confers enhanced cold tolerance in pummelo (\u003cem\u003eCitrus grandis\u003c/em\u003e) by regulating CAT to modulate the level of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Under cold conditions, \u003cem\u003eStICE1\u003c/em\u003e of potato enhanced the stability of cell membranes by upregulating the expression of the StLTI6A gene, thereby increasing its tolerance [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. The MYC-type TF \u003cem\u003eMdbHLH4\u003c/em\u003e negatively regulates apple cold tolerance by inhibiting the expression of \u003cem\u003eMdCBF1/3\u003c/em\u003e and the promoter-binding activity of \u003cem\u003eMdICE1L\u003c/em\u003e, as well as by promoting the expression of \u003cem\u003eMdCAX3L-2\u003c/em\u003e and the cold-induced degradation of \u003cem\u003eMdICE1L\u003c/em\u003e [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. In this study, we found two MYC genes (\u003cem\u003eCsaV3_3G007980\u003c/em\u003e and \u003cem\u003eCsaV3_3G001710\u003c/em\u003e) in cucumber that show significant differential expression under temperature stress (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). To validate the involvement of these two genes in temperature stress response in other cucurbit species, we extracted their homologous genes for analysis of their reactions under temperature stress. Gene expression analysis revealed differential expression of these two genes across all four species, albeit with varying patterns. Homologous genes of these two genes in \u003cem\u003eCitrullus lanatus\u003c/em\u003e exhibit a closer resemblance to those in cucumber, showing a certain degree of upregulation under both low and high temperature stress. In \u003cem\u003eCucumis melo\u003c/em\u003e, homolog of \u003cem\u003eCsaV3_3G001710\u003c/em\u003e demonstrate a downregulation trend under temperature stress. Remarkably different is the case in \u003cem\u003eBenincasa hispida\u003c/em\u003e, where homologs of these two genes exhibit significant downregulation under both low and high temperature stress, opposite to what is observed in \u003cem\u003eCucumis sativus\u003c/em\u003e. Comparative functional genomics research indicated that if evolutionarily related species regulatory elements are conserved, then gene expression characteristics within species will correspondingly be conserved [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. In this study, \u003cem\u003ecis\u003c/em\u003e-regulatory element analysis revealed certain differences in both the type and quantity of these elements among the eight homologous genes, which could potentially account for the differential expression of homologous genes across species. All these findings suggest that \u003cem\u003eCsaV3_3G007980\u003c/em\u003e and \u003cem\u003eCsaV3_3G001710\u003c/em\u003e, along with their homologs in other \u003cem\u003eCucurbitaceae\u003c/em\u003e crops, are highly responsive to temperature stress. However, the differential expression patterns between species remain unresolved. Further exploration of these genes' response mechanisms to temperature stress will be the focus of future research.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, we had identified 10, 8, 12, and 10 MYC genes respectively in \u003cem\u003eC. sativus\u003c/em\u003e, \u003cem\u003eC. melo\u003c/em\u003e, \u003cem\u003eC. lanatus\u003c/em\u003e, and \u003cem\u003eB. hispida\u003c/em\u003e, each playing distinct roles in the developmental processes of plant. Particularly under environmental stress, some genes respond actively to external pressures through upregulation or downregulation of expression. Additionally, we had observed two genes that are more sensitive to temperature stress, labeled as \u003cem\u003eCsaV3_3G007980\u003c/em\u003e and \u003cem\u003eCsaV3_3G001710\u003c/em\u003e. However, these two genes exhibit contrasting expression patterns across different species. This implied that there had been some degree of alterations in gene function following species divergence. All those results provide valuable insights for future functional studies of MYC genes and present potential candidate genes for enhancing environmental adaptability of \u003cem\u003eCucurbitaceae\u003c/em\u003e species.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eMYC\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Myelocytomatosis\u003c/p\u003e\n\u003cp\u003eTF\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Transcription Factor\u003c/p\u003e\n\u003cp\u003eAMS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Arabidopsis Aborted MicrosporeS\u003c/p\u003e\n\u003cp\u003eCDD\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Conserved Domain Data\u003c/p\u003e\n\u003cp\u003eABA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Abscisic Acid\u003c/p\u003e\n\u003cp\u003ehph\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Post High-temperature Treatment\u003c/p\u003e\n\u003cp\u003eHLH \u0026nbsp; \u0026nbsp; \u0026nbsp; Helix-Loop-Helix\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has not directly involved humans, animals or plants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm that the data supporting the findings of this study are available within the manuscript\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (32302542), which provide support for design of the study; Science Research Project of Hebei Education Department (QN2022062), which provide support for data collection; Science and Technology Research and Developmental Guidance Program of Handan (23313014019) and Construction of Innovative Teams in Modern Agricultural Industry Systems in Hebei Province (HBCT2024140206), which support for the analysis and interpretation of data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eW.X. designed, performed the experiments, analyzed data and wrote the paper; L.T. prepared the material and wrote the paper; Z.Y.N., Y.J.Y., L.R.R. and C.H. analyzed data; L.N.Y. revised the paper; W.S.N. and W.L.P. wrote and revised the paper. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLedent V, Vervoort M. The basic helix-loop-helix protein family: Comparative genomics and phylogenetic analysis. Genome Res. 2001;11:754\u0026ndash;770.\u003c/li\u003e\n\u003cli\u003eNuno P, Liam D. Origin and diversification of basic-helix-loop-helix proteins in plants. Mol Biol Evol. 2010;27:862\u0026ndash;874.\u003c/li\u003e\n\u003cli\u003eXu YH, Liao YC, Lv FF, Zhang Z, Sun PW, Gao ZH, Hu KP, Sui C, Jin Y, Wei JH. Transcription Factor \u003cem\u003eAsMYC2\u003c/em\u003e Controls the Jasmonate-responsive Expression of \u003cem\u003eASS1\u003c/em\u003e Regulating Sesquiterpene Biosynthesis in \u003cem\u003eAquilaria sinensis\u003c/em\u003e (Lour.) Gilg. Plant Cell Physiol. 2017;58:1924\u0026ndash;1933.\u003c/li\u003e\n\u003cli\u003ePires N, Dolan L. Origin and diversification of basic-helix-loop-helix proteins in plants. Mol Biol Evol. 2010;27(4):862\u0026ndash;874.\u003c/li\u003e\n\u003cli\u003eUrao T, Yamaguchi-Shinozaki K, Mitsukawa N, et al. Molecular cloning and characterization of a gene that encodes a MYC-related protein in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Mol Biol. 1996;32(3):571-576.\u003c/li\u003e\n\u003cli\u003eButterfield DA, Drake J, Pocernich C, et al. Evidence of oxidative damage in Alzheimer\u0026apos;s disease brain: central role for amyloid \u0026beta;-peptide. Trends Mol Med. 2001;7(12):548-554.\u003c/li\u003e\n\u003cli\u003eZong S, Zeng G, Zou B, et al. Effects of Polygonatum sibiricum polysaccharide on the osteogenic differentiation of bone mesenchymal stem cells in mice. Int J Clin Exp Pathol. 2015;8(6):6169.\u003c/li\u003e\n\u003cli\u003eQi T, Wang J, Huang H, et al. Regulation of jasmonate-induced leaf senescence by antagonism between bHLH subgroup IIIe and IIId factors in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell. 2015a;27(6): 1634-1649.\u003c/li\u003e\n\u003cli\u003eZhu X, Chen J, Xie Z, et al. Jasmonic acid promotes degreening via MYC 2/3/4‐and ANAC 019/055/072‐mediated regulation of major chlorophyll catabolic genes. Plant J. 2015;84(3): 597-610.\u003c/li\u003e\n\u003cli\u003eQi T, Huang H, Song S, et al. Regulation of jasmonate-mediated stamen development and seed production by a bHLH-MYB complex in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell. 2015b;27(6):1620-1633.\u003c/li\u003e\n\u003cli\u003eGao C, Qi S, Liu K, et al. \u003cem\u003eMYC2\u003c/em\u003e, \u003cem\u003eMYC3\u003c/em\u003e, and \u003cem\u003eMYC4\u003c/em\u003e function redundantly in seed storage protein accumulation in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Physiol Biochem. 2016;108:63-70.\u003c/li\u003e\n\u003cli\u003eHuang CF, Yu CP, Wu YH, et al. Elevated auxin biosynthesis and transport underlie high vein density in C4 leaves[J]. PNAS. 2017;114(33):E6884-E6891.\u003c/li\u003e\n\u003cli\u003eSorensen AM, Kr\u0026ouml;ber S, Unte US, et al. The Arabidopsis ABORTED MICROSPORES (AMS) gene encodes a MYC class transcription factor[J]. Plant J. 2003;33(2):413-423.\u003c/li\u003e\n\u003cli\u003eLi T, Xu Y, Zhang L, et al. The jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening[J]. Plant Cell. 2017; 29(6):1316-1334.\u003c/li\u003e\n\u003cli\u003eUji Y, Taniguchi S, Tamaoki D, et al. Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice[J]. Plant Cell Physiol. 2016; 57(9):1814-1827.\u003c/li\u003e\n\u003cli\u003eZong Y, Xi X, Li S, et al. Allelic variation and transcriptional isoforms of wheat TaMYC1 gene regulating anthocyanin synthesis in pericarp[J]. Front Plant Sci. 2017;8:1645.\u003c/li\u003e\n\u003cli\u003eNims E, Vongpaseuth K, Roberts SC, et al. TcJAMYC: a bHLH transcription factor that activates paclitaxel biosynthetic pathway genes in yew. J Biol Chem. 2015;290(33):20104-20104.\u003c/li\u003e\n\u003cli\u003eShen Q, Lu X, Yan T, et al. The jasmonate‐responsive Aa MYC 2 transcription factor positively regulates artemisinin biosynthesis in \u003cem\u003eArtemisia annua\u003c/em\u003e. New Phytol. 2016;210(4):1269-1281.\u003c/li\u003e\n\u003cli\u003eLi Q, Li H, Huang WU, et al. A chromosome-scale genome assembly of cucumber (\u003cem\u003eCucumis sativus \u003c/em\u003eL.). GigaScience. 2019;8(6):giz072.\u003c/li\u003e\n\u003cli\u003eGarcia-Mas J, Benjak A, Sanseverino W, et al. The genome of melon (\u003cem\u003eCucumis melo\u003c/em\u003e L.). PNAS. 2012;109(29):11872-11877.\u003c/li\u003e\n\u003cli\u003eGuo S, Zhang J, Sun H, et al. The draft genome of watermelon (\u003cem\u003eCitrullus lanatus\u003c/em\u003e) and resequencing of 20 diverse accessions. Nat Genet. 2013;45(1):51-58.\u003c/li\u003e\n\u003cli\u003eXie D, Xu Y, Wang J, et al. The wax gourd genomes offer insights into the genetic diversity and ancestral cucurbit karyotype. Nat Commun. 2019;10(1):5158.\u003c/li\u003e\n\u003cli\u003eRobert DF, Jody C, Sean RE. 2011. HMMER web server: interactive sequence similarity searching. Nucleic Acids Res. 39:29\u0026ndash;37.\u003c/li\u003e\n\u003cli\u003eMarchlerbauer A, Bo Y, Han L, He J, Lanczycki C J, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR. 2017. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 45:D200\u0026ndash;D203.\u003c/li\u003e\n\u003cli\u003eWalker JM. 2006. The proteomics protocols handbook. Biochemistry. 71 (6):696\u0026ndash;696.\u003c/li\u003e\n\u003cli\u003eWaterhouse A, Procter J, Martin DA, et al. Jalview: visualization and analysis of molecular sequences, alignments, and structures[J]. BMC Bioinformatics. 2005;6(3):1-1.\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Tamura K. 2015. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 33:1870-1874.\u003c/li\u003e\n\u003cli\u003eSinsheimer JS, Little RJA, Lake JA. 2012. Rooting Gene Trees without Outgroups: EP Rooting. Genome Biol Evol. 4(8):709\u0026ndash;719.\u003c/li\u003e\n\u003cli\u003eVoorrips RE. 2002. MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered. 93(1):77\u0026ndash;78.\u003c/li\u003e\n\u003cli\u003eChen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, Xia R. 2020. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant. 13(8):1194\u0026ndash;1202.\u003c/li\u003e\n\u003cli\u003eWang Y, Tang H, Jeremy DD, Xu T, Li J, Wang X, Lee T, Jin H, Barry M, Guo H, Kissinger J, Paterson A. 2012. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. 40 (7):e49\u0026ndash;e49.\u003c/li\u003e\n\u003cli\u003eLiu C, Xie T, Chen C, Luan A, Long J, Li C, Ding Y, He Y. 2017. Genome-wide organization and expression profiling of the R2R3-MYB transcription factor family in pineapple（Ananas comosus）. BMC Genomics. 18(1):503.\u003c/li\u003e\n\u003cli\u003eBrown J, Pirrung M, McCue LA. 2017. FQC Dashboard: integrates FastQC results into a web-based,interactive,and extensible FASTQ quality control tool. Bioinformatics. 33:3137\u0026ndash;3139.\u003c/li\u003e\n\u003cli\u003eBolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 30:2114\u0026ndash;2120.\u003c/li\u003e\n\u003cli\u003eLi H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. 2009. The sequence alignment/map format and SAMtools. Bioinformatics. 25:2078\u0026ndash;2079.\u003c/li\u003e\n\u003cli\u003ePertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. 2015. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 33(3):290\u0026ndash;295.\u003c/li\u003e\n\u003cli\u003eVaret H, Brillet-Gu\u0026eacute;guen L, Copp\u0026eacute;e JY, Dillies MA. 2016. SARTools: A DESeq2- and EdgeR-Based R pipeline for comprehensive differential analysis of RNA-seq data. PloS One. 11:e0157022.\u003c/li\u003e\n\u003cli\u003eLi Z, Zhang Z, Yan P, Huang S, Fei Z, Lin K. 2011. RNA-Seq improves annotation of protein-coding genes in the cucumber genome. BMC Genomics. 12:1\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eChen C, Chen X, Han J, Lu W, Ren Z. 2020. Genome-wide analysis of the WRKY gene family in the cucumber genome and transcriptome-wide identification of WRKY transcription factors that respond to biotic and abiotic stresses. BMC Plant Biol. 20:1\u0026ndash;19.\u003c/li\u003e\n\u003cli\u003eLi C, Dong S, Liu X, Bo K, Miao H, Beckles DM, Zhang S, Gu X. 2020. Genome-wide characterization of Cucumber（Cucumis sativus L.）GRAS genes and their response to various abiotic stresses. Horticulturae. 6(4):110\u0026ndash;127.\u003c/li\u003e\n\u003cli\u003eZhu Y, Yin J, Liang Y, Liu J, Jia J, Huo H, Wu Z, Yang R, Gong H. 2019. Transcriptomic dynamics provide an insight into the mechanism for silicon-mediated alleviation of salt stress in cucumber plants. Ecotoxicol Environ Saf. 174:245\u0026ndash;254.\u003c/li\u003e\n\u003cli\u003eXu Q, Xu X, Shi Y, Qi X, Chen X. 2017. Elucidation of the molecular responses of a cucumber segment substitution line carrying Pm5.1 and its recurrent parent triggered by powdery mildew by comparative transcriptome profiling. BMC Genomics. 18:1\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eWang X, Cheng C, Zhang K, Tian Z, Xu J, Yang S, Lou Q, Li J, Chen JF. 2018. Comparative transcriptomics reveals suppressed expression of genes related to auxin and the cell cycle contributes to the resistance of cucumber against Meloidogyne incognita. BMC Genomics. 19:1\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026minus; \u0026Delta;\u0026Delta;CT method[J]. methods. 2001;25(4):402-408.\u003c/li\u003e\n\u003cli\u003eKazan K, Manners JM. MYC2: The Master in Action. Mol Plant. 2013;6:686\u0026ndash;703.\u003c/li\u003e\n\u003cli\u003eBlackwood E, Eisenman R. Max: A helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science. 1991;251:1211.\u003c/li\u003e\n\u003cli\u003eHeim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC. The Basic Helix-Loop-Helix Transcription Factor Family in Plants: A Genome-Wide Study of Protein Structure and Functional Diversity. Mol Biol Evol. 2003;20:735\u0026ndash;747.\u003c/li\u003e\n\u003cli\u003eJeffares DC, Mourier T, Penny D. The biology of intron gain and loss[J]. Trends Genet. 2006; 22(1):16-22.\u003c/li\u003e\n\u003cli\u003eXu G, Guo C, Shan H, et al. Divergence of duplicate genes in exon\u0026ndash;intron structure[J]. PNAS. 2012;109(4):1187-1192.\u003c/li\u003e\n\u003cli\u003eJeffares DC, Penkett CJ, B\u0026auml;hler J. Rapidly regulated genes are intron poor[J]. Trends Genet. 2008;24(8):375-378.\u003c/li\u003e\n\u003cli\u003eQi TC, Huang H, Song SS, Xie DX. Regulation of Jasmonate-Mediated Stamen Development and Seed Production by a bHLH-MYB Complex in Arabidopsis. Plant Cell. 2015;27:1620\u0026ndash;1633.\u003c/li\u003e\n\u003cli\u003eLi S, Hu Y, Yang H, et al. The Regulatory Roles of MYC TFs in Plant Stamen Development[J]. Plant Sci. 2023;111734.\u003c/li\u003e\n\u003cli\u003eFukazawa J, Mori K, Ando H, et al. Jasmonate inhibits plant growth and reduces gibberellin levels via microRNA5998 and transcription factor MYC2[J]. Plant Physiol. 2023;193(3): 2197-2214.\u003c/li\u003e\n\u003cli\u003eJohnson LYD, Major IT, Chen Y, et al. Diversification of JAZ‐MYC signaling function in immune metabolism[J]. New Phytol. 2023;239(6): 2277-2291.\u003c/li\u003e\n\u003cli\u003eShinozaki K, Yamaguchi-Shinozaki K. Gene networks involved in drought stress response and tolerance. J Exp Bot. 2007;58:221-227.\u003c/li\u003e\n\u003cli\u003eMiura K, Shiba H, Ohta M, et al. SlICE1 encoding a MYC-type transcription factor controls cold tolerance in tomato, Solanum lycopersicum[J]. Plant Biotechnol J. 2012;29(3):253-260.\u003c/li\u003e\n\u003cli\u003eOhta M, Sato A, Renhu N, et al. MYC-type transcription factors, MYC67 and MYC70, interact with ICE1 and negatively regulate cold tolerance in Arabidopsis[J]. Sci Rep. 2018;8(1):11622.\u003c/li\u003e\n\u003cli\u003eGeng J, Wei T, Wang Y, et al. Overexpression of PtrbHLH, a basic helix-loop-helix transcription factor from Poncirus trifoliata, confers enhanced cold tolerance in pummelo (Citrus grandis) by modulation of H2O2 level via regulating a CAT gene[J]. Tree Physiol. 2019;39(12):2045-2054.\u003c/li\u003e\n\u003cli\u003eWang X, Song Q, Guo H, et al. StICE1 enhances plant cold tolerance by directly upregulating StLTI6A expression[J]. Plant Cell Rep. 2023;42(1):197-210.\u003c/li\u003e\n\u003cli\u003eYang J, Guo X, Mei Q, et al. MdbHLH4 negatively regulates apple cold tolerance by inhibiting MdCBF1/3 expression and promoting MdCAX3L-2 expression[J]. Plant Physiol. 2023;191(1): 789-806.\u003c/li\u003e\n\u003cli\u003eLee JS, Chu IS, Mikaelyan A, et al. Application of comparative functional genomics to identify best-fit mouse models to study human cancer[J]. Nat Genet.2004;36(12):1306-1311.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4203459/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4203459/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMyelocytomatosis (\u003cem\u003eMYC\u003c/em\u003e) transcription factors are crucial mediators of plants responding to environmental stresses through binding DNA regulatory regions. However, little systematic characterization of \u003cem\u003eMYC\u003c/em\u003e genes is available in \u003cem\u003eCucurbitaceae\u003c/em\u003e species.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, we identified 10, 8, 12, and 10 MYC genes separately in \u003cem\u003eCucumis sativus\u003c/em\u003e, \u003cem\u003eCucumis melo\u003c/em\u003e, \u003cem\u003eCitrullus lanatus\u003c/em\u003e, and \u003cem\u003eBenincasa hispida\u003c/em\u003e. Characterization analysis revealed that all of the MYC proteins contain a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence, which is essential for the binding DNA regulatory regions. The evolutionary analysis enabled us to categorize the predicted 40 MYC proteins from seven species into five distinct groups, which was also discovered that the expansion of the MYC genes occurred before the divergence of monocots and dicots. The upstream promoter region of the MYC genes contain a variety of developmental, stress, and hormone-responsive regulatory elements. The expression of cucumber MYC genes varies significantly across organs, with particularly high expression of \u003cem\u003eCsaV3_3G001710\u003c/em\u003e observed across all organs. Transcriptomic analysis reveals that certain cucumber \u003cem\u003eMYC\u003c/em\u003e genes undergo specific upregulation or downregulation in response to both biotic and abiotic stressors. Particularly under temperature stress, cucumber genes \u003cem\u003eCsaV3_3G007980\u003c/em\u003e and \u003cem\u003eCsaV3_3G001710\u003c/em\u003e showed significant upregulation. Interestingly, the homologous genes of these two in \u003cem\u003eC. lanatus\u003c/em\u003e exhibited a similar expression pattern to \u003cem\u003eC. sativus\u003c/em\u003e, while in \u003cem\u003eB. hispida\u003c/em\u003e, they displayed a significant downregulation, which is quite the opposite. These findings indicated that these two genes indeed responded to temperature stress with different expression patterns, highlighting the divergent functions of homologous genes across different species.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study analyzed the size and composition of the MYC gene family in four \u003cem\u003eCucurbitaceae\u003c/em\u003e species, and investigated stress-responsive expression profiles, especially under temperature stress. All the results showed that MYC play important roles in development and stress-responsive, laying a theoretical foundation for further investigating its response mechanisms.\u003c/p\u003e","manuscriptTitle":"Identification of MYC genes in four Cucurbitaceae species and the response to temperature stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-05 06:23:01","doi":"10.21203/rs.3.rs-4203459/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-27T09:19:26+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-26T13:26:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"316538476833558200192938963189473986340","date":"2024-06-18T01:13:20+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-17T04:03:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"105583607230556503591303390597668206569","date":"2024-05-29T12:20:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"304342742070232568365646188441964798374","date":"2024-05-29T12:03:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-29T11:56:03+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-04-02T12:26:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-02T07:03:39+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-02T07:03:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2024-04-02T03:04:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"99e191e0-46aa-4291-90a6-2247b5b4e8e4","owner":[],"postedDate":"April 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-23T16:03:16+00:00","versionOfRecord":{"articleIdentity":"rs-4203459","link":"https://doi.org/10.1186/s12864-024-10771-8","journal":{"identity":"bmc-genomics","isVorOnly":false,"title":"BMC Genomics"},"publishedOn":"2024-09-16 15:57:46","publishedOnDateReadable":"September 16th, 2024"},"versionCreatedAt":"2024-04-05 06:23:01","video":"","vorDoi":"10.1186/s12864-024-10771-8","vorDoiUrl":"https://doi.org/10.1186/s12864-024-10771-8","workflowStages":[]},"version":"v1","identity":"rs-4203459","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4203459","identity":"rs-4203459","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}