The respective relations of expression of OSBPL3 with Ki-67 expression and KRAS mutation in CRC for diagnosis and prognosis

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background: OSBPL3 is overexpressed in a variety of malignancies and is closely associated with tumor growth and metastasis. However, its expression and function in colorectal cancer (CRC) are unclear. We aimed to investigate its prognostic and therapeutic value in this disease by detecting its expression in CRC and its correlation with the clinicopathological characteristics and prognosis of patients. Methods: A total of 92 CRC samples were included in this study. According to the 2020 WHO diagnostic criteria, the criteria of the American Joint Committee on Cancer (AJCC) 8th edition staging system were used. OSBPL3 and Ki-67 expression in these samples was detected by immunohistochemistry. OSBPL3 mRNA expression was detected by qRT-PCR. KRAS/NRAS mutations were detected by an amplification refractory mutation system (ARMS). Data analysis was performed using the statistical analysis software Prism 8. Results: OSBPL3 was found to be significantly overexpressed in CRC tumor tissues and was associated with worse progression-free survival and overall survival in patients. Additionally, OSBPL3 expression was negatively correlated with the degree of tumor differentiation. KRAS mutations were detected in approximately 32.6% of patients and were significantly associated with high OSBPL3 expression. In addition, OSBPL3 and Ki-67 expression was significantly correlated. Conclusions: OSBPL3 is highly expressed in CRC samples and predicts a worse prognosis. OSBPL3 may become a new potential therapeutic target for CRC.
Full text 108,087 characters · extracted from preprint-html · click to expand
The respective relations of expression of OSBPL3 with Ki-67 expression and KRAS mutation in CRC for diagnosis and prognosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The respective relations of expression of OSBPL3 with Ki-67 expression and KRAS mutation in CRC for diagnosis and prognosis Min Zhang, Lei Meng, Zhaoxuan Zhang, Jing Wu, Xi Chen, Jie He This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1155690/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Background: OSBPL3 is overexpressed in a variety of malignancies and is closely associated with tumor growth and metastasis. However, its expression and function in colorectal cancer (CRC) are unclear. We aimed to investigate its prognostic and therapeutic value in this disease by detecting its expression in CRC and its correlation with the clinicopathological characteristics and prognosis of patients. Methods: A total of 92 CRC samples were included in this study. According to the 2020 WHO diagnostic criteria, the criteria of the American Joint Committee on Cancer (AJCC) 8th edition staging system were used. OSBPL3 and Ki-67 expression in these samples was detected by immunohistochemistry. OSBPL3 mRNA expression was detected by qRT-PCR. KRAS/NRAS mutations were detected by an amplification refractory mutation system (ARMS). Data analysis was performed using the statistical analysis software Prism 8. Results: OSBPL3 was found to be significantly overexpressed in CRC tumor tissues and was associated with worse progression-free survival and overall survival in patients. Additionally, OSBPL3 expression was negatively correlated with the degree of tumor differentiation. KRAS mutations were detected in approximately 32.6% of patients and were significantly associated with high OSBPL3 expression. In addition, OSBPL3 and Ki-67 expression was significantly correlated. Conclusions: OSBPL3 is highly expressed in CRC samples and predicts a worse prognosis. OSBPL3 may become a new potential therapeutic target for CRC. Colorectal cancer CRC OSBPL3 Ki-67 KRAS prognosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Background In 2020, there were more than 1.9 million new cases of CRC and approximately 935,000 related deaths worldwide, accounting for one-tenth of cancer cases and related deaths, and according to the International Agency for Research on Cancer, CRC ranks third in incidence and second in mortality [1]. It ranks second in cancer incidence in men and third in women. Data from the National Cancer Center of China in 2019 showed that there were 388,000 new cases of CRC and 187,000 deaths in China in 2015, accounting for 9.87% of diagnoses and 8.01% of related deaths. Effective screening measures, early intervention and better treatment measures can reduce the mortality rate of patients [2]. The main treatments currently available are surgery, chemotherapy, targeted therapy and immunotherapy [3]. The 5-year relative survival rate for CRC patients is 65%, and that of rectal cancer (67%) is slightly higher than that of colon cancer (64%) [4]. The 5-year relative survival rates for stage I and II patients are 91% and 82%, respectively, while the 5-year survival rate for stage IV patients is only 12%. Approximately 90% of CRCs are adenocarcinomas in terms of pathological type, while rare types include mucinous adenocarcinoma, signet ring cell carcinoma and myeloid carcinoma. Immunohistochemical detection of the Ki-67 index is an independent factor affecting the prognosis of CRC, and high Ki-67 staining is strongly associated with a poor prognosis in CRC, is positively correlated with CRC invasion depth, lymph node metastasis, and tumor differentiation, and is an independent predictor of prognosis that can be used to stratify patients [5]. Studies on the driver genes and prognostic and predictive molecular mechanisms of CRC have shown that RAS genes are representative of established biomarkers for efficacy prediction and prognostic risk assessment. RAS belongs to a class of GTPase proteins that regulate signaling pathways that control processes such as cell proliferation, cell differentiation, cell adhesion, apoptosis and cell migration. The invasive and metastatic potential of cells is increased when RAS is mutated. The main members of the RAS family are KRAS and NRAS [6]. The KRAS gene is one of the most common oncogenes in solid tumors, and it is mutated in 81.35% of pancreatic cancers and 48.33% of CRCs [7]. KRAS mutation is the main driver of colon cancer [6]. Depletion or inactivation of the KRAS oncoprotein activates intrinsic GTPases through the RAS-RAF-MEK-ERK (MAPK) signaling pathway, which locks the protein in its GTP-binding active state [8]. A mutated RAS gene, which is not regulated by EGFR expression signals, automatically activates its downstream signaling pathways, enabling tumor growth and proliferation [9]. Oxysterol-binding protein (OSBP) and its related proteins (oxysterol-binding protein-related protein (ORP) or OSBP-like proteins (OSBPLs) constitute a conserved family of lipid transfer proteins (LTPs) [10]. One of its members, OSBPL3 (ORP3), is expressed mainly in the brain, kidney, spleen, lymphoid tissue and leukocytes [11, 12] and is significantly more highly expressed in 21 malignancies, including CRC, than in normal controls [13, 14]. Because of its key role in controlling cell adhesion and migration, it is expected to be a drug target for tumor therapy [10]. However, its tumor suppressive function has also been reported [15]. Overexpression of OSBPL3 promotes the proliferation, invasion and metastasis of CRC in vitro and in vivo. The expression level of OSBPL3 in CRC was found to be positively correlated with poor differentiation, tumor-node-metastasis (TNM) stage and Dukes stage [14]. It has also been suggested that the OSBPL3 mRNA level may be a prognostic marker for better stratification of CRC patients [16]. Bioinformatic analysis revealed that OSBPL3 promotes CRC progression by activating the RAS signaling pathway [14]. Hyperphosphorylated OSBPL3 interacts with the endoplasmic reticulum membrane protein VAPA to generate OSBPL3-VAPA complexes to stimulate R-Ras signaling [17]. Overexpression of OSBPL3 leads to the formation of polarized cell surface protrusions, impaired cell spreading, and reduced integrin activity, and OSBPL3 acts upstream of the RAS and may mediate cell matrix adhesion by regulating integrin activity, thereby altering RAS activity [17, 18]. In this study, we detected the mRNA and protein expression of OSBPL3 and Ki-67 in 92 CRC tissues and cancer-adjacent normal tissues by immunohistochemistry and qPCR and detected RAS gene mutation by the amplification refractory mutation system (ARMS) method to initially explore the role of OSBPL3 and the RAS signaling pathway in CRC progression and provide a theoretical basis for therapeutic target screening. Methods Sample information Paraffin samples, including CRC tissues and adjacent normal tissues, were randomly selected from 92 patients who underwent radical abdominal surgery and were confirmed to have CRC by histopathology in Anhui Cancer Hospital between April 2014 and December 2016. Among the patients, 49 had colon cancer and 43 had rectal cancer. Their ages ranged from 20 to 79 years, with a median age of 60 years, and detailed clinical information is shown in Table 1 . The histological grades of the tumors were classified according to the percentage of adenoid structure formation and differentiation status. Lymph node metastasis was classified as negative (no regional lymph node metastasis) or positive (metastasis to regional lymph nodes). Tumor stage was classified according to the TNM staging system of the American Joint Committee on Cancer (AJCC) and was divided into stage I-II and stage III-IV. The study was approved by our ethics committee, and for survival analysis and follow-up, the date of surgical resection was used as the beginning of the follow-up date. Patients who died from diseases other than CRC or died from unexpected events were excluded from the survival analysis. The follow-up period was 4 to 6 years. Table 1 Clinical characteristics of 92 CRC cases Characteristics Characteristics Number of patients (%) Total 92 Age Median (years) 60, 49~64 Gender Male 62 (67.39) Female 30 (32.61) Status Alive 47 (51.09) Dead 40 (43.48) Lost contact 5 (5.43) Location Right 19 (20.65) Left 31 (33.70) Rectum 42 (45.65) TNM stage Stage I 3 (3.26) Stage II 35 (38.04) Stage III 49 (53.26) Stage IV 5 (5.43) Tumor size T1 0(0) T2 4 (4.35) T3 22 (23.91) T4 66 (71.74) Lymph-node metastasis N0 40 (43.48) N1-2 52 (56.52) Distant metastasis M0 88 (95.65) M1 4 (4.35) Differentiation Well 64(69.57) Poor 28(30.43) With intestinal polyps Yes 12 (13.04) No 80 (86.96) Values provide the median with IQR. OSBPL3 mRNA levels by qRT-PCR Total RNA extraction: Depending on the size of the paraffin-embedded tissues, 3-6 white slices of 5-10 µm thickness were cut and dewaxed, tumor cells were enriched (control tissues did not need this step) and digested, and total RNA from paraffin-embedded tissues was extracted using the OMEGA RNA Isolation Kit (Cat. No. R6954-02, OMEGA, USA). The concentration and purity of the extracted RNA were determined using a BioDrop ultramicro nucleic acid protein analyzer, requiring an RNA A260/A280 between 1.8 and 2.0, and stored at -20°C. Then, the High Capacity cDNA Reverse Transcription Kit (Lot No. 00307397, Part No. 4368813, Applied Biosystems by Thermo Fisher Scientific, USA) was used for reverse transcription. qRT-PCR was performed on an Applied Biosystem 7500 PCR instrument with Power SYBR Green PCR Master Mix (Lot No. 1711564, Part No. 4367659, Applied Biosystems by Thermo Fisher Scientific, USA) based on the manufacturer’s scheme. All samples were processed under the same experimental conditions. Primers were synthesized by Shanghai Shiny Crystal Molecular Biotechnology Co. The primer sequence are listed as follows: β-actin-F: AGCCATGTACGTTGCTATCCA; β-actin-R: GTCACCGGAGTCCATCACGAT; OSBPL3-F: GCCTGTCCTTGATAGTGGTCG; OSBPL3-R: CGTGTTCAGGGGCTCGTTC. The cycling conditions were as follows: preincubation at 95°C for 5 min, denaturation at 95°C, annealing at 62°C, extension at 72°C for 10 s each, 40 cycles; cooling at 40°C for 30 s. Each reaction well was repeated 3 times. β-Actin was used as an internal reference to calculate the relative 2-∆∆CT values. Immunochemistry and evaluation The expression of the OSBPL3 gene at the protein level was examined by immunohistochemistry (IHC) in patient's paraffin samples. A polyclonal rabbit anti-OSBPL3 antibody (1:100; NBP1-82968; NOVUS, USA) and a monoclonal rabbit anti-Ki-67 antibody (ready-to-use; 790-4286, clone number 30-9; Roche, USA) were used to detect the corresponding proteins. Immunostaining was performed on a Roche Benchmark XT automated staining system (Roche/Ventana) according to the instructions. Procedure: Three-micrometer sections were dewaxed in EZprep concentration buffer at 75°C for 4 min. Epitope repair was performed in cell conditioning solution at 100°C for 64/76 min. Anti-OSBPL3 and anti-Ki-67 were both incubated at 37°C for 32 min. Then, goat anti-mouse/anti-rabbit IgG/IgM secondary antibody coupled with horseradish peroxidase was added for 8 min followed by DAB visualization and finally hematoxylin staining. Two independent individuals were observed separately, without prior knowledge of either patient's clinical information or outcomes. Differences between the two assessors were resolved by reassessment and discussions until agreement were reached. OSBPL3 analysis: Color development was localized to the nucleus and the plasma membrane. A brownish-yellow color of the nucleus or pulp was considered positive. The immune response score (IRS) was calculated based on the staining intensity (SI) multiplied by the percentage of positively stained cells (PP). The specific scoring criteria were as follows. SI (range 0-3): 0 was negative, 1 was weak, 2 was moderate, and 3 was strong staining; PP (range 0-4): 0 indicated 0%, 1 indicated 1–25%, 2 indicated 26–50%, 3 indicated 51–75%, and 4 indicated 76–100% positively stained cells. IRS scores ranged from 0 to 12. OSBPL3 was considered highly expressed if the IRS was 8-12 and expression at low levels if the IRS was 0-7. Ki-67 analysis: Color development was localized to the nucleus. A brownish-yellow nucleus was considered positive. The proportion of Ki-67-positive cells to total tumor cells was assessed in 10 representative high magnification fields of tumor cells (screening 100 cells in the upper, lower, left, right, and central fields), and in this study, a set cutoff value 60% was used: <60% was considered low expression, and ≥60% was considered high expression. RAS gene mutation by ARMS Pretreatment of paraffin-embedded tissues was performed as previously described. Genomic DNA was extracted from paraffin-embedded tissues using the QIAamp DNA FFPE Tissue Kit (Cat No. 56404, QIAGEN, Germany). And a BioDrop ultramicro nucleic acid protein analyzer were used to determine DNA purity with an A260/A280 ratio between 1.8 and 2.0. The samples were diluted to the appropriate concentration for subsequent testing. The Human KRAS Gene Mutation Detection Kit (PCR-Fluorescent Probe Method) and the Human NRAS Gene Mutation Detection Kit (PCR-Fluorescent Probe Method) (Wuhan Youzhiyou Medical Technology, China) were used to detect KRAS/NRAS mutations in all samples on an Applied Biosystems 7500 PCR instrument. Negative, weakly positive and blank control samples were set up. Statistical analysis Data were analyzed using Prism 8. P-values for assessing the significance of differences between Kaplan-Meier survival curves were estimated using the log-rank test. P < 0.05 was considered to indicate statistical significance. Correlation analysis of clinicopathological parameters with OSBPL3 expression was performed using Fisher's exact test, and P < 0.05 was considered to indicate statistical significance. Histograms and box plots were calculated for statistical analysis (two tailed Student's t-test for both groups). Results OSBPL3 overexpression promotes CRC progression qRT-PCR of paraffin specimens from 78 CRC patient tissues and adjacent normal tissues showed that OSBPL3 mRNA levels were significantly higher in cancer tissues than in normal tissues ( P < 0.0001) (Figure 1 a, b). Immunohistochemical assays of 92 CRC samples also showed that OSBPL3 were highly expressed in cancer tissues ( P < 0.0001) (Figure 1 c, d). Progression-free survival (PFS) and overall survival (OS) were significantly worse in CRC patients with high OSBPL3 expression than in those with low OSBPL3 mRNA or protein expression ( P < 0.05) (Figure 2 ). The results suggest that OSBPL3 promotes the malignant progression of CRC and that high OSBPL3 expression is associated with a poor prognosis. High OSBPL3 protein expression correlates with poor CRC differentiation To investigate the relationship between OSBPL3 differential expression and clinicopathological parameters of CRC patients, statistical analysis of mRNA expression was first performed and found that mRNA expression levels correlated with the degree of tumor differentiation (Table 2 , P < 0.05). There were no significant relationship between mRNA expression levels and clinicopathological parameters such as tumor size, lymph node metastasis, sex, age, presence of concomitant polyps, left and right halves, etc. Further statistical analysis of the OSBPL3 immunohistochemical results was performed. The results showed that the expression of OSBPL3 in tumor tissues was negatively correlated with the degree of tumor differentiation from low to high (Figure 3 a). Significant differences in OSBPL3 immunohistochemical scores were found in normal paracancerous tissues, highly differentiated tumor tissues, and poorly differentiated tumor tissues ( P < 0.001), with increasing intensity of expression in ascending order. It was weakly expressed in the cytoplasm and nucleus of normal intestinal epithelium and highly differentiated tumor tissues and strongly expressed in the cytoplasm and nucleus of poorly differentiated tumor tissues (Figure 3 b). The results suggest that OSBPL3 can be used as a specific molecular indicator of CRC differentiation and is expected to be a new molecular target. Table 2 Correlation of OSBPL3 with clinicopathological parameters of CRC patients Variables OSBPL3 mRNA levels P value Low High Age ≤60 27 19 0.053 >60 23 23 Gender Male 31 31 0.069 Female 15 5 Location Colon 22 20 0.83 Rectum 24 26 TNM stage I - II 23 17 0.29 III-IV 23 29 Tumor size T1-T3 13 13 ༞0.99 T4 33 33 Lymph-node metastasis N0 22 18 0.52 N1-2 24 28 Distant metastasis M0 44 44 >0.99 M1 2 2 Differentiation Well 38 26 0.02* Poor 8 20 polyps Yes 5 7 0.75 No 41 39 KRAS Mutation Wild type 37 24 0.007** Mutant 9 21 P was calculated using Fisher'exact test. * P <0.05, ** P <0.01. The protein expression levels of OSBPL3 and Ki-67 in CRC tissues were significantly correlated To explore the relationship between OSBPL3 differential expression levels and the tumor Ki-67 index in CRC patients, further statistical analysis of the immunochemical results of both was performed. Notably, we found a strong concordance between OSBPL3 overexpression and high Ki-67 expression in tumor cells within most tissue sections that showed immunoreactivity for both OSBPL3 and Ki-67, and OSBPL3 overexpression was strongly associated with high Ki-67 expression (Figure 4 , P < 0.05). This further indicates that OSBPL3 is expected to be a molecular target. Association between the KRAS mutation and OSBPL3 expression KRAS mutations were detected in 30 of 92 CRC cases (32.6%), and the main mutation sites were G12D (13/30, 43.3%), G13D (6/30, 20%), and G12 V (6/30, 20%) in codons 12 and 13 of exon 12, while other mutations, such as G12C (2/30, 6.7%), G12A (2/30, 6.7%), and G12S (1/30, 3.3%). 30, 6.7%), and G12S (1/30, 3.3%), were rare. The expression level of OSBPL3 was significantly elevated in KRAS mutant tumors (Table 2 , P < 0.01), but there was no significant correlation between OSBPL3 expression and each subtype of KRAS mutation. The results showed that CRC samples with high OSBPL3 expression had more KRAS mutations, again confirming the potential of OSBPL3 as a new molecular target. Discussion The early diagnosis of CRC and timely surgery support a good prognosis, but approximately 25% of CRC cases are already advanced at the time of diagnosis [19]. Some still have surgical opportunities after neoadjuvant radiotherapy to reduce the clinical stage, and supplementation with targeted therapy or immunotherapy significantly prolongs survival [20]. Therefore, CRC survival can be improved by means of precision therapy regardless of disease stage, and CRC is curable if early diagnosis can be achieved. Thus, early diagnostic molecular marker screening is particularly important, and molecular target selection provides a reliable basis for targeted therapy. Thus, CRC molecular markers have become a research hotspot in recent years. The results of this study showed that OSBPL3 expression was significantly higher in CRC tissues than in paraneoplastic tissues and correlated with the degree of CRC differentiation; the lower the CRC differentiation, the higher the OSBPL3 mRNA and protein expression, which is consistent with the results of existing studies and biochemical predictions [14]. It has also been shown that the degree of differentiation does not directly correlate with OSBPL3 expression, but rather the prognosis differs between groups with high and low expression in tumors with different degrees of differentiation [16]. In the weighted gene correlation network analysis (WGCNA) study, OSBPL3 was identified as a pivotal gene in CRC, with upregulated expression in cancer tissues, and its high expression correlated with a poor prognosis in CRC [21]. The results of the present study support the association of OSBPL3 with CRC development and progression. OSBP and OSBP-associated proteins (ORPs) constitute a large family of genes with sterol/lipid transport and regulatory activities involved in the control of lipid metabolism, regulation of vesicular transport and cell signaling events [22, 23]. ORP4, ORP5 and many other members of the ORP family have also been associated with tumors. ORP4 promotes the survival of rapidly proliferating cells [24] and is considered a potential marker of solid tumor dissemination and a poor prognosis [25]. Highly spliced variants leading to small changes in mRNA structure have been identified in several ORPs, including ORP1, ORP3 and ORP6 [26]. Differential mRNA splicing may result in functionally different forms of ORP3 genes [11]. Jiao et al. confirmed that OSBPL3 promotes the proliferation, migration, and motility of CRC cells by ex vivo experiments [14]. In the present study, we found that those who overexpressed OSBPL3 in CRC had correspondingly high expression of Ki-67, and there was a positive correlation between them. Ki-67 is a nuclear DNA-binding protein expressed in all vertebrates and is a proliferation marker widely used for tumor grading [27]. Ki-67 is present in the G1, S, and G2 phases of the cell cycle and is commonly used as a marker of cell proliferation [28]. Immunohistochemical detection of the Ki-67 index in tumors can objectively reflect the proliferation of tumors and is well established for clinical application. A high Ki-67 index usually indicates active proliferation and poor prognosis [29]. One study confirmed that the positive expression of Ki-67 in colorectal cancer increased with a decrease in differentiation [30]. High Ki-67 expression indicates a lower survival rate and is a predictor of CRC progression [31]. In this study, we concluded that OSBPL3 and Ki-67 expression were correlated and that OSBPL3 also had a similar pro-proliferative effect on CRC, which was positively correlated with the degree of differentiation. Therefore, it was further hypothesized that OSBPL3 and Ki-67 have the same pro-proliferative function and that high OSBPL3 expression is associated with a poor prognosis and could be used as a marker of CRC cell proliferation. This study also found that KRAS mutations were more common in cases with high OSBPL3 expression, and the two were closely related. However, there was no clear relationship between OSBPL3 expression levels and KRAS mutation subtypes. Considering the effect of the small sample size, the variation in mutant subtypes needs further validation. RAS is an oncogene that plays a crucial role in cell proliferation, differentiation, growth and development [8]. Cyclin D1, the downstream target gene of its downstream signaling pathway Ras/Raf pathway, is a key factor in controlling cell proliferation from G1 to S phase and ultimately promoting cell proliferation [32]. It has been suggested that OSBPL3 is an R-Ras interacting oxysterol-binding protein homolog that regulates cell adhesion and plays a role in promoting tumor cell proliferation, migration and invasion, and evidence was obtained that the OSBPL3-VAPA complex stimulates R-Ras signaling [17]. It can regulate cytoskeleton reconstruction, alter the shape of CRC cells and the number of laminar pseudopods, and promote the motility and migration of CRC cells [14]. KRAS mutations are common driver mutations in CRC and are found at different frequencies in all consensus molecular subtypes (CMSs) [33]. KRAS mutation status has been used as a "molecular" predictor of efficacy for targeted therapy with epidermal growth factor receptor monoclonal antibody and has become class I evidence for clinical treatment. Patients with wild-type and G13D-mutant phenotypes can benefit from this type of drug therapy [9]. A new generation of KRAS mutation inhibitors has been used in the clinic; the first KRAS inhibitor sotorasib (AMG510) [34] became available in 2019, and the FDA approved adagrasib (MRTX849) for patients with the KRAS G12C mutation in 2021 [35]. Recent studies have defined the gene expression changes triggered by RAS [36]. However, mutated KRAS interacts with OSBPL3, and although it has been shown to affect the RAS pathway, some complementary signaling pathways can also play an important role in tumorigenesis progression [37], but this remains to be elucidated in future studies. The high level of OSBPL3 expression indicates that it may be a primary screening indicator for KRAS-mutated patients receiving KRAS inhibitors, and if the sample size is large enough, the clinicopathological characteristics of patients with KRAS mutations and high OSBPL3 expression can be analyzed to better characterize them. Mutations in the NRAS gene were not detected in this study. This may be because the proportion of NRAS mutations in CRC is approximately 2% -6% [38], which is much lower than that of KRAS. Additionally, there are limitations in the detection methods, as next-generation sequencing (NGS) methods detected RAS mutations in approximately 13% more patients [39]. The RAS pathway signature is superior to KRAS mutation status in predicting the dependence on RAS signaling [40]. Therefore, mutations in other members of the RAS pathway, not just the RAS gene, may play the same role in signaling. OSBPL3 may also be regulated by non-RAS pathways; for example, lncRNA MIR4435-2HG may regulate OSBPL3 expression via pathways such as the P38/MAPK pathway and the VEGF pathway [41]. Therefore, it is speculated that OSBPL3 does not facilitate colorectal carcinogenesis exclusively through the RAS pathway. Furthermore, although there is a correlation between KRAS mutations and OSBPL3, it is unclear whether OSBPL3 affects tumor biology regardless of KRAS status. This also deserves further study. Conclusions In summary, our preliminary study demonstrated that OSBPL3 is upregulated in CRC and negatively correlates with the degree of differentiation. In addition, it may affect cell progression in CRC through the activation of RAS. Moreover, we found a significant correlation between OSBPL3 overexpression and high Ki-67 expression. Therefore, OSBPL3 may serve as a molecular marker for CRC diagnosis and progression and may be a new potential therapeutic target for CRC. Abbreviations CRC: Colorectal cancer; OSBP: Oxysterol-binding protein; ARMS: amplification refractory mutation system; OS: Overall survival; PFS: Progression-free survival; PCR: Polymerase chain reaction. Declarations -Ethics approval and consent to participate The study was approved by the Ethics Committee of the First Affiliated Hospital of the USTC (2021-BLK-07). Since this study is retrospective and the clinical samples used were paraffin-embedded tissue blocks, this study did not affect the diagnosis and treatment of patients, and considering the privacy of patients, the ethics committee did not consider a written consent procedure necessary. Prior to the start of follow-up, we communicated with patients by telephone to obtain consent, which was recorded. All individuals gave verbal consent to the study plan, and their clinical samples and personal data were used under the supervision of their physicians. -Consent to public Not applicable. -Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. -Competing interests The authors declare that they have no competing interests. -Funding The present study was supported by the National Natural Science Foundation of China (No. 81872055).The funder, JH, conceived the study and was involved in the design and coordination of the study, as well as providing financial support. -Authors’ contributions MZ carried out the molecular genetic studies and drafted the manuscript; LM participated in the design of the study and performed the statistical analysis; ZZ participated in the acquisition of data; JW carried out the immunohistochemistry; XC participated in the analysis and interpretation of data; JH conceived of the study, and participated in its design and coordination. All authors read and approved the fnal manuscript. -Acknowledgements The authors would like to thank all the patients who participated in this study, the Department of Pathology and Department of Gastrointestinal Surgery of The First Affiliated Hospital of USTC for their support. References Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021; 71: 209-49. Siegel RL, Miller KD, Fedewa SA, et al. Colorectal cancer statistics, 2017. CA Cancer J Clin. 2017; 67: 177-93. Kalyan A, Kircher S, Shah H, Mulcahy M, Benson A. Updates on immunotherapy for colorectal cancer. J Gastrointest Oncol. 2018; 9: 160-9. Miller KD, Nogueira L, Mariotto AB, et al. Cancer treatment and survivorship statistics. 2019. CA Cancer J Clin. 2019; 69: 363-85. Tong G, Zhang G, Liu J, et al. Cutoff of 25% for Ki67 expression is a good classification tool for prognosis in colorectal cancer in the AJCC 8 stratification. Oncol Rep. 2020; 43: 1187-98. Boughdady IS, Kinsella AR, Haboubi NY, Schofield PF. K-ras gene mutations in adenomas and carcinomas of the colon. Surg Oncol. 1992; 1: 275-82. Zhou S, Zhang D, Li J, et al. Landscape of RAS Variations in 17,993 Pan-cancer Patients Identified by Next-generation Sequencing. Pathol Oncol Res. 2020; 26: 2835-7. Vakiani E, Solit DB. KRAS and BRAF: drug targets and predictive biomarkers. J Pathol. 2011; 223: 219-29. McFall T, Diedrich JK, Mengistu M, et al. A systems mechanism for KRAS mutant allele-specific responses to targeted therapy. Sci Signal. 2019; 12: aaw8288. Dong X, Wang Z, Ye S, Zhang R. The crystal structure of ORP3 reveals the conservative PI4P binding pattern. Biochem Biophys Res Commun. 2020; 529: 1005-10. Collier FM, Gregorio-King CC, Apostolopoulos J, Walder K, Kirkland MA. ORP3 splice variants and their expression in human tissues and hematopoietic cells. DNA Cell Biol. 2003; 22: 1-9. Lehto M, Tienari J, Lehtonen S, Lehtonen E, Olkkonen VM. Subfamily III of mammalian oxysterol-binding protein (OSBP) homologues: the expression and intracellular localization of ORP3, ORP6, and ORP7. Cell Tissue Res. 2004; 315: 39-57. Gashaw I, Grümmer R, Klein-Hitpass L, et al. Gene signatures of testicular seminoma with emphasis on expression of ets variant gene 4. Cell Mol Life Sci. 2005; 62: 2359-68. Jiao HL, Weng BS, Yan SS, et al. Upregulation of OSBPL3 by HIF1A promotes colorectal cancer progression through activation of RAS signaling pathway. Cell Death Dis. 2020; 11: 571. Njeru SN, Kraus J, Meena JK, et al. Aneuploidy-inducing gene knockdowns overlap with cancer mutations and identify Orp3 as a B-cell lymphoma suppressor. Oncogene. 2020; 39: 1445-65. Xu P, Richter J, Blatz A, et al. Downregulation of ORP3 Correlates with Reduced Survival of Colon Cancer Patients with Advanced Nodal Metastasis and of Female Patients with Grade 3 Colon Cancer. Int J Mol Sci. 2020; 21: 5894. Weber-Boyvat M, Kentala H, Lilja J, et al. OSBP-related protein 3 (ORP3) coupling with VAMP-associated protein A regulates R-Ras activity. Exp Cell Res. 2015; 331: 278-91. Lehto M, Mäyränpää MI, Pellinen T, et al. The R-Ras interaction partner ORP3 regulates cell adhesion. J Cell Sci. 2008; 121: 695-705. Van Cutsem E, Cervantes A, Nordlinger B, Arnold D. Metastatic colorectal cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol. 2014; 25: Ⅲ1-9.. Van Cutsem E, Cervantes A, Adam R, et al. ESMO consensus guidelines for the management of patients with metastatic colorectal cancer. Ann Oncol. 2016; 27: 1386-422. Zhang Y, Luo J, Liu Z, et al. Identification of hub genes in colorectal cancer based on weighted gene co-expression network analysis and clinical data from The Cancer Genome Atlas. Biosci Rep. 2021. https://doi.org/10.1042/BSR20211280. Lehto M, Olkkonen VM. The OSBP-related proteins: a novel protein family involved in vesicle transport, cellular lipid metabolism, and cell signalling. Biochim Biophys Acta. 2003; 1631: 1-11. Liu H, Huang S. Role of oxysterol-binding protein-related proteins in malignant human tumours. World J Clin Cases. 2020; 8: 1-10. Charman M, Colbourne TR, Pietrangelo A, Kreplak L, Ridgway ND. Oxysterol-binding protein (OSBP)-related protein 4 (ORP4) is essential for cell proliferation and survival. J Biol Chem. 2014; 289: 15705-17. Pan G, Cao X, Liu B, et al. OSBP-related protein 4L promotes phospholipase Cβ3 translocation from the nucleus to the plasma membrane in Jurkat T-cells. J Biol Chem. 2018; 293: 17430-41. Olkkonen VM, Levine TP. Oxysterol binding proteins: in more than one place at one time. Biochem Cell Biol. 2004; 82: 87-98. Sobecki M, Mrouj K, Colinge J, et al. Cell-Cycle Regulation Accounts for Variability in Ki-67 Expression Levels. Cancer Res. 2017; 77: 2722-34. Urruticoechea A, Smith IE, Dowsett M. Proliferation marker Ki-67 in early breast cancer. J Clin Oncol. 2005; 23: 7212-20. Perou CM, Jeffrey SS, van de Rijn M, et al. Distinctive gene expression patterns in human mammary epithelial cells and breast cancers. Proc Natl Acad Sci U S A. 1999; 96: 9212-7. Li W, Zhang G, Wang HL, Wang L. Analysis of expression of cyclin E, p27kip1 and Ki67 protein in colorectal cancer tissues and its value for diagnosis, treatment and prognosis of disease. Eur Rev Med Pharmacol Sci. 2016; 20: 4874-9. Ma YL, Peng JY, Zhang P, Liu WJ, Huang L, Qin HL. Immunohistochemical analysis revealed CD34 and Ki67 protein expression as significant prognostic factors in colorectal cancer. Med Oncol. 2010; 27: 304-9. Bos JL, Rehmann H, Wittinghofer A. GEFs and GAPs: critical elements in the control of small G proteins. Cell. 2007; 129: 865-77. Lal N, White BS, Goussous G, et al. KRAS Mutation and Consensus Molecular Subtypes 2 and 3 Are Independently Associated with Reduced Immune Infiltration and Reactivity in Colorectal Cancer. Clin Cancer Res. 2018; 24: 224-33. Canon J, Rex K, Saiki AY, et al. The clinical KRAS(G12C) inhibitor AMG 510 drives anti-tumour immunity. Nature. 2019; 575: 217-23. Hallin J, Engstrom LD, Hargis L, et al. The KRAS(G12C) Inhibitor MRTX849 Provides Insight toward Therapeutic Susceptibility of KRAS-Mutant Cancers in Mouse Models and Patients. Cancer Discov. 2020; 10: 54-71. Yuan XH, Yang J, Wang XY, Zhang XL, Qin TT, Li K. Association between EGFR/KRAS mutation and expression of VEGFA, VEGFR and VEGFR2 in lung adenocarcinoma. Oncol Lett. 2018; 16: 2105-12. Grant S. Cotargeting survival signaling pathways in cancer. J Clin Invest. 2008; 118: 3003-6. De Roock W, Claes B, Bernasconi D, et al. Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol. 2010; 11: 753-62. Udar N, Lofton-Day C, Dong J, et al. Clinical validation of the next-generation sequencing-based Extended RAS Panel assay using metastatic colorectal cancer patient samples from the phase 3 PRIME study. J Cancer Res Clin Oncol. 2018; 144: 2001-10. Loboda A, Nebozhyn M, Klinghoffer R, et al. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors. BMC Med Genomics. 2010; 3: 26. Chen J, Song Y, Li M, et al. Comprehensive analysis of ceRNA networks reveals prognostic lncRNAs related to immune infiltration in colorectal cancer. BMC Cancer. 2021; 21: 255. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 25 Apr, 2022 Reviewers invited by journal 25 Mar, 2022 First submitted to journal 13 Jan, 2022 Editorial decision: Minor revision 07 Jan, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1155690","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":93548545,"identity":"c2566270-2d97-4325-83c5-c69034402ed3","order_by":0,"name":"Min Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of USTC: Anhui Provincial Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Zhang","suffix":""},{"id":93548546,"identity":"c621052b-8f12-4037-8518-36d5b201cd7e","order_by":1,"name":"Lei Meng","email":"","orcid":"","institution":"The First Affiliated Hospital of USTC: Anhui Provincial Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Meng","suffix":""},{"id":93548547,"identity":"4f5372aa-8800-4592-a56d-64314484b638","order_by":2,"name":"Zhaoxuan Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of USTC: Anhui Provincial Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhaoxuan","middleName":"","lastName":"Zhang","suffix":""},{"id":93548548,"identity":"54360034-af4e-4329-adcd-51524cf1887a","order_by":3,"name":"Jing Wu","email":"","orcid":"","institution":"The First Affiliated Hospital of USTC: Anhui Provincial Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wu","suffix":""},{"id":93548549,"identity":"cfa5a848-ea2a-4720-b19b-6cbb4c5e63f3","order_by":4,"name":"Xi Chen","email":"","orcid":"","institution":"The First Affiliated Hospital of USTC: Anhui Provincial Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Chen","suffix":""},{"id":93548550,"identity":"aadd0fba-96c2-4387-a293-32912dceb020","order_by":5,"name":"Jie He","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIie3OvQrCMBDA8ZNAugTnDn68QqSDiC9zpUMXdXbokKlTwVXfwkdICdQl0rWb9g2yClKMILi1GQXzn+7gfnAAPt8PxgFQwj6bfXbiSnQVfa7dCMAoJ7FwJstAtNJQmp7rujSwX8ciuMpesioklkc22Z6bhISg01iwHfY/1iAqFlJLCLUfqliEjPeT2x3Vk5OU18qSzoU0gAqQIJeJJcKFaMSykNXi1CRRiFUa5WwzQC46MY8um4/rsjUmW08Pge4nAAy/83ukA/e2QA7f+Hw+33/3AnTaSf5xaWRFAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1739-6625","institution":"The First Affiliated Hospital of USTC: Anhui Provincial Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"He","suffix":""}],"badges":[],"createdAt":"2021-12-09 11:24:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1155690/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1155690/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":19692349,"identity":"f1a27a87-19ab-4fb0-b667-3eb743bc0fa8","added_by":"auto","created_at":"2022-03-28 15:14:46","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":275069,"visible":true,"origin":"","legend":"\u003cp\u003eOSBPL3 mRNA and protein expression in pairs of paraffin CRC tissues and paired normal tissues by real-time PCR and immunohistochemistry. \u003cstrong\u003ea\u003c/strong\u003e and \u003cstrong\u003eb\u003c/strong\u003e showed that OSBPL3 mRNA expression levels were significantly higher in colorectal cancer tissues compared with paired normal tissues from the same patients. \u003cstrong\u003ec\u003c/strong\u003e and \u003cstrong\u003ed\u003c/strong\u003e showed that OSBPL3 protein expression levels were significantly higher in colorectal cancer tissues compared with paired normal tissues from the same patients (Magnification ×400).\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1155690/v1/a03c64ab6107c9b5bf586c94.jpg"},{"id":19692351,"identity":"2182c082-32c4-4c01-b31f-0e8a9516cb31","added_by":"auto","created_at":"2022-03-28 15:14:46","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":275873,"visible":true,"origin":"","legend":"\u003cp\u003eKaplan-Meier curves were used of progression free survival and overall survival in high and low risk groups for CRC patients. The cutoff values for the high and low risk groups were based on the median of the risk score. \u003cstrong\u003ea\u003c/strong\u003e: The correlation between OSBPL3 mRNA and progression free survival in CRC patients.\u0026nbsp;\u003cstrong\u003eb\u003c/strong\u003e: The correlation between OSBPL3 protein levels and progression free survival in CRC patients. \u003cstrong\u003ec\u003c/strong\u003e: The correlation between OSBPL3 mRNA and the overall survival time of CRC patients. \u003cstrong\u003ed\u003c/strong\u003e: The correlation between OSBPL3 protein levels and the overall survival time of CRC patients. Prognosis was significantly worse for patients with high expression of either OSBPL3 mRNA or protein, compared with patients with low expression. Green: high OSBPL3 expression groups; Orange: low OSBPL3 expression groups.\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1155690/v1/505011e4f68b832cf1b63e0d.jpg"},{"id":19692352,"identity":"1c1761a5-2e73-4770-aa50-accb526e5973","added_by":"auto","created_at":"2022-03-28 15:14:46","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":712601,"visible":true,"origin":"","legend":"\u003cp\u003eRelationship between OSBPL3 protein expressions and differentiations. \u003cstrong\u003ea\u003c/strong\u003e: There were significant difference in the expression of OSBPL3 between tumor and normal tissues(****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001); the expression of OSBPL3 in tumor tissues was negatively correlated with the degree of tumor differentiation from poor to well. With the decrease of differentiation degree, the scores of OSBPL3 protein expressions tend to be higher, and there were a statistical significance in differentiation(***\u003cem\u003eP\u003c/em\u003e \u0026lt;0.001 ). \u003cstrong\u003eb\u003c/strong\u003e: Representative results of OSBPL3 by IHC. It was weakly expressed in cytoplasm and cell nucleus of normal intestinal epithelium and well differentiated tumor tissues;it was highly expressed in cytoplasm of poorly differentiated tumor tissues (Magnification ×200, ×400).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1155690/v1/651cecab0d48b9204565f857.jpg"},{"id":19692350,"identity":"d148283a-160c-44c5-9df9-8b7dcfd6d019","added_by":"auto","created_at":"2022-03-28 15:14:46","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":501067,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of OSBPL3 and Ki-67 in CRC samples detected by immunohistochemistry. \u003cstrong\u003ea\u003c/strong\u003e: The pie/bar chart show the number of co-expression OSBPL3 and ki-67 in CRC samples. The table under the picture shows the correlation between the expression level of OSBPL3 and the expression level of Ki-67 in CRC samples (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). \u003cstrong\u003eb\u003c/strong\u003e: Representative image of OSBPL3 and ki-67 score from weak to strong on normal intestinal epithelium and tumor tissues. Staining location: OSBPL3 staining is located in the nucleus and cytoplasm, and Ki-67 staining is located in the nucleus. The expression of Ki-67 was also weak in tissues with weak OSBPL3 expression; Ki-67 expression was also strong in tissues with strong expression of OSBPL3 (Magnification ×400).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1155690/v1/f095f35e68e8f3d036a41b93.jpg"},{"id":19692353,"identity":"1632a2ce-07c5-4e98-851c-00618f165b7c","added_by":"auto","created_at":"2022-03-28 15:14:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":940124,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1155690/v1/403c6e9d-aee6-4c4a-90e3-bef779e9035a.pdf"}],"financialInterests":"","formattedTitle":"The respective relations of expression of OSBPL3 with Ki-67 expression and KRAS mutation in CRC for diagnosis and prognosis","fulltext":[{"header":"Background","content":"\u003cp\u003eIn 2020, there were more than 1.9 million new cases of CRC and approximately 935,000 related deaths worldwide, accounting for one-tenth of cancer cases and related deaths, and according to the International Agency for Research on Cancer, CRC ranks third in incidence and second in mortality [1]. It ranks second in cancer incidence in men and third in women. Data from the National Cancer Center of China in 2019 showed that there were 388,000 new cases of CRC and 187,000 deaths in China in 2015, accounting for 9.87% of diagnoses and 8.01% of related deaths. Effective screening measures, early intervention and better treatment measures can reduce the mortality rate of patients [2]. The main treatments currently available are surgery, chemotherapy, targeted therapy and immunotherapy [3]. The 5-year relative survival rate for CRC patients is 65%, and that of rectal cancer (67%) is slightly higher than that of colon cancer (64%) [4]. The 5-year relative survival rates for stage I and II patients are 91% and 82%, respectively, while the 5-year survival rate for stage IV patients is only 12%. Approximately 90% of CRCs are adenocarcinomas in terms of pathological type, while rare types include mucinous adenocarcinoma, signet ring cell carcinoma and myeloid carcinoma. Immunohistochemical detection of the Ki-67 index is an independent factor affecting the prognosis of CRC, and high Ki-67 staining is strongly associated with a poor prognosis in CRC, is positively correlated with CRC invasion depth, lymph node metastasis, and tumor differentiation, and is an independent predictor of prognosis that can be used to stratify patients [5].\u003c/p\u003e \u003cp\u003eStudies on the driver genes and prognostic and predictive molecular mechanisms of CRC have shown that RAS genes are representative of established biomarkers for efficacy prediction and prognostic risk assessment. RAS belongs to a class of GTPase proteins that regulate signaling pathways that control processes such as cell proliferation, cell differentiation, cell adhesion, apoptosis and cell migration. The invasive and metastatic potential of cells is increased when RAS is mutated. The main members of the RAS family are KRAS and NRAS [6]. The KRAS gene is one of the most common oncogenes in solid tumors, and it is mutated in 81.35% of pancreatic cancers and 48.33% of CRCs [7]. KRAS mutation is the main driver of colon cancer [6]. Depletion or inactivation of the KRAS oncoprotein activates intrinsic GTPases through the RAS-RAF-MEK-ERK (MAPK) signaling pathway, which locks the protein in its GTP-binding active state [8]. A mutated RAS gene, which is not regulated by EGFR expression signals, automatically activates its downstream signaling pathways, enabling tumor growth and proliferation [9].\u003c/p\u003e \u003cp\u003eOxysterol-binding protein (OSBP) and its related proteins (oxysterol-binding protein-related protein (ORP) or OSBP-like proteins (OSBPLs) constitute a conserved family of lipid transfer proteins (LTPs) [10]. One of its members, OSBPL3 (ORP3), is expressed mainly in the brain, kidney, spleen, lymphoid tissue and leukocytes [11, 12] and is significantly more highly expressed in 21 malignancies, including CRC, than in normal controls [13, 14]. Because of its key role in controlling cell adhesion and migration, it is expected to be a drug target for tumor therapy [10]. However, its tumor suppressive function has also been reported [15].\u003c/p\u003e \u003cp\u003eOverexpression of OSBPL3 promotes the proliferation, invasion and metastasis of CRC in vitro and in vivo. The expression level of OSBPL3 in CRC was found to be positively correlated with poor differentiation, tumor-node-metastasis (TNM) stage and Dukes stage [14]. It has also been suggested that the OSBPL3 mRNA level may be a prognostic marker for better stratification of CRC patients [16]. Bioinformatic analysis revealed that OSBPL3 promotes CRC progression by activating the RAS signaling pathway [14]. Hyperphosphorylated OSBPL3 interacts with the endoplasmic reticulum membrane protein VAPA to generate OSBPL3-VAPA complexes to stimulate R-Ras signaling [17]. Overexpression of OSBPL3 leads to the formation of polarized cell surface protrusions, impaired cell spreading, and reduced integrin activity, and OSBPL3 acts upstream of the RAS and may mediate cell matrix adhesion by regulating integrin activity, thereby altering RAS activity [17, 18]. In this study, we detected the mRNA and protein expression of OSBPL3 and Ki-67 in 92 CRC tissues and cancer-adjacent normal tissues by immunohistochemistry and qPCR and detected RAS gene mutation by the amplification refractory mutation system (ARMS) method to initially explore the role of OSBPL3 and the RAS signaling pathway in CRC progression and provide a theoretical basis for therapeutic target screening.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003cp\u003e\u003cstrong\u003eSample information\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eParaffin samples, including CRC tissues and adjacent normal tissues, were randomly selected from 92 patients who underwent radical abdominal surgery and were confirmed to have CRC by histopathology in Anhui Cancer Hospital between April 2014 and December 2016. Among the patients, 49 had colon cancer and 43 had rectal cancer. Their ages ranged from 20 to 79 years, with a median age of 60 years, and detailed clinical information is shown in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The histological grades of the tumors were classified according to the percentage of adenoid structure formation and differentiation status. Lymph node metastasis was classified as negative (no regional lymph node metastasis) or positive (metastasis to regional lymph nodes). Tumor stage was classified according to the TNM staging system of the American Joint Committee on Cancer (AJCC) and was divided into stage I-II and stage III-IV. The study was approved by our ethics committee, and for survival analysis and follow-up, the date of surgical resection was used as the beginning of the follow-up date. Patients who died from diseases other than CRC or died from unexpected events were excluded from the survival analysis. The follow-up period was 4 to 6 years.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eClinical characteristics of 92 CRC cases\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCharacteristics\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCharacteristics Number of patients (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e92\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMedian (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60, 49~64\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e62 (67.39)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30 (32.61)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStatus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAlive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e47 (51.09)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDead\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e40 (43.48)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLost contact\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5 (5.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLocation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19 (20.65)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLeft\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e31 (33.70)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRectum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e42 (45.65)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTNM stage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStage I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3 (3.26)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStage II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e35 (38.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStage III\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e49 (53.26)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStage IV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5 (5.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTumor size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0(0)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4 (4.35)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e22 (23.91)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e66 (71.74)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLymph-node metastasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e40 (43.48)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN1-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e52 (56.52)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDistant metastasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e88 (95.65)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4 (4.35)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDifferentiation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWell\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e64(69.57)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePoor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28(30.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWith intestinal polyps\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12 (13.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e80 (86.96)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\"\u003eValues provide the median with IQR.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eOSBPL3 mRNA levels by qRT-PCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cp\u003eTotal RNA extraction: Depending on the size of the paraffin-embedded tissues, 3-6 white slices of 5-10 \u0026micro;m thickness were cut and dewaxed, tumor cells were enriched (control tissues did not need this step) and digested, and total RNA from paraffin-embedded tissues was extracted using the OMEGA RNA Isolation Kit (Cat. No. R6954-02, OMEGA, USA). The concentration and purity of the extracted RNA were determined using a BioDrop ultramicro nucleic acid protein analyzer, requiring an RNA A260/A280 between 1.8 and 2.0, and stored at -20\u0026deg;C. Then, the High Capacity cDNA Reverse Transcription Kit (Lot No. 00307397, Part No. 4368813, Applied Biosystems by Thermo Fisher Scientific, USA) was used for reverse transcription. qRT-PCR was performed on an Applied Biosystem 7500 PCR instrument with Power SYBR Green PCR Master Mix (Lot No. 1711564, Part No. 4367659, Applied Biosystems by Thermo Fisher Scientific, USA) based on the manufacturer\u0026rsquo;s scheme. All samples were processed under the same experimental conditions. Primers were synthesized by Shanghai Shiny Crystal Molecular Biotechnology Co. The primer sequence are listed as follows: \u0026beta;-actin-F: AGCCATGTACGTTGCTATCCA; \u0026beta;-actin-R: GTCACCGGAGTCCATCACGAT; OSBPL3-F: GCCTGTCCTTGATAGTGGTCG; OSBPL3-R: CGTGTTCAGGGGCTCGTTC. The cycling conditions were as follows: preincubation at 95\u0026deg;C for 5 min, denaturation at 95\u0026deg;C, annealing at 62\u0026deg;C, extension at 72\u0026deg;C for 10 s each, 40 cycles; cooling at 40\u0026deg;C for 30 s. Each reaction well was repeated 3 times. \u0026beta;-Actin was used as an internal reference to calculate the relative 2-∆∆CT values.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunochemistry and evaluation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of the OSBPL3 gene at the protein level was examined by immunohistochemistry (IHC) in patient\u0026apos;s paraffin samples. A polyclonal rabbit anti-OSBPL3 antibody (1:100; NBP1-82968; NOVUS, USA) and a monoclonal rabbit anti-Ki-67 antibody (ready-to-use; 790-4286, clone number 30-9; Roche, USA) were used to detect the corresponding proteins. Immunostaining was performed on a Roche Benchmark XT automated staining system (Roche/Ventana) according to the instructions. Procedure: Three-micrometer sections were dewaxed in EZprep concentration buffer at 75\u0026deg;C for 4 min. Epitope repair was performed in cell conditioning solution at 100\u0026deg;C for 64/76 min. Anti-OSBPL3 and anti-Ki-67 were both incubated at 37\u0026deg;C for 32 min. Then, goat anti-mouse/anti-rabbit IgG/IgM secondary antibody coupled with horseradish peroxidase was added for 8 min followed by DAB visualization and finally hematoxylin staining. Two independent individuals were observed separately, without prior knowledge of either patient\u0026apos;s clinical information or outcomes. Differences between the two assessors were resolved by reassessment and discussions until agreement were reached. OSBPL3 analysis: Color development was localized to the nucleus and the plasma membrane. A brownish-yellow color of the nucleus or pulp was considered positive. The immune response score (IRS) was calculated based on the staining intensity (SI) multiplied by the percentage of positively stained cells (PP). The specific scoring criteria were as follows. SI (range 0-3): 0 was negative, 1 was weak, 2 was moderate, and 3 was strong staining; PP (range 0-4): 0 indicated 0%, 1 indicated 1\u0026ndash;25%, 2 indicated 26\u0026ndash;50%, 3 indicated 51\u0026ndash;75%, and 4 indicated 76\u0026ndash;100% positively stained cells. IRS scores ranged from 0 to 12. OSBPL3 was considered highly expressed if the IRS was 8-12 and expression at low levels if the IRS was 0-7. Ki-67 analysis: Color development was localized to the nucleus. A brownish-yellow nucleus was considered positive. The proportion of Ki-67-positive cells to total tumor cells was assessed in 10 representative high magnification fields of tumor cells (screening 100 cells in the upper, lower, left, right, and central fields), and in this study, a set cutoff value 60% was used: \u0026lt;60% was considered low expression, and \u0026ge;60% was considered high expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRAS gene mutation by ARMS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePretreatment of paraffin-embedded tissues was performed as previously described. Genomic DNA was extracted from paraffin-embedded tissues using the QIAamp DNA FFPE Tissue Kit (Cat No. 56404, QIAGEN, Germany). And a BioDrop ultramicro nucleic acid protein analyzer were used to determine DNA purity with an A260/A280 ratio between 1.8 and 2.0. The samples were diluted to the appropriate concentration for subsequent testing. The Human KRAS Gene Mutation Detection Kit (PCR-Fluorescent Probe Method) and the Human NRAS Gene Mutation Detection Kit (PCR-Fluorescent Probe Method) (Wuhan Youzhiyou Medical Technology, China) were used to detect KRAS/NRAS mutations in all samples on an Applied Biosystems 7500 PCR instrument. Negative, weakly positive and blank control samples were set up.\u003c/p\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eData were analyzed using Prism 8. P-values for assessing the significance of differences between Kaplan-Meier survival curves were estimated using the log-rank test. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was considered to indicate statistical significance. Correlation analysis of clinicopathological parameters with OSBPL3 expression was performed using Fisher\u0026apos;s exact test, and \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was considered to indicate statistical significance. Histograms and box plots were calculated for statistical analysis (two tailed Student\u0026apos;s t-test for both groups).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003cp\u003e\u003cstrong\u003eOSBPL3 overexpression promotes CRC progression\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eqRT-PCR of paraffin specimens from 78 CRC patient tissues and adjacent normal tissues showed that OSBPL3 mRNA levels were significantly higher in cancer tissues than in normal tissues (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001) (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). Immunohistochemical assays of 92 CRC samples also showed that OSBPL3 were highly expressed in cancer tissues (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001) (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec, d). Progression-free survival (PFS) and overall survival (OS) were significantly worse in CRC patients with high OSBPL3 expression than in those with low OSBPL3 mRNA or protein expression (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) (Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The results suggest that OSBPL3 promotes the malignant progression of CRC and that high OSBPL3 expression is associated with a poor prognosis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eHigh OSBPL3 protein expression correlates with poor CRC differentiation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the relationship between OSBPL3 differential expression and clinicopathological parameters of CRC patients, statistical analysis of mRNA expression was first performed and found that mRNA expression levels correlated with the degree of tumor differentiation (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). There were no significant relationship between mRNA expression levels and clinicopathological parameters such as tumor size, lymph node metastasis, sex, age, presence of concomitant polyps, left and right halves, etc. Further statistical analysis of the OSBPL3 immunohistochemical results was performed. The results showed that the expression of OSBPL3 in tumor tissues was negatively correlated with the degree of tumor differentiation from low to high (Figure \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). Significant differences in OSBPL3 immunohistochemical scores were found in normal paracancerous tissues, highly differentiated tumor tissues, and poorly differentiated tumor tissues (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001), with increasing intensity of expression in ascending order. It was weakly expressed in the cytoplasm and nucleus of normal intestinal epithelium and highly differentiated tumor tissues and strongly expressed in the cytoplasm and nucleus of poorly differentiated tumor tissues (Figure \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb). The results suggest that OSBPL3 can be used as a specific molecular indicator of CRC differentiation and is expected to be a new molecular target.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eCorrelation of OSBPL3 with clinicopathological parameters of CRC patients\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eVariables\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eOSBPL3 mRNA levels\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLow\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026le;60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.053\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026gt;60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.069\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLocation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eColon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.83\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRectum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTNM stage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eI - II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.29\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIII-IV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTumor size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT1-T3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e༞0.99\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLymph-node metastasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.52\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN1-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDistant metastasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026gt;0.99\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDifferentiation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWell\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.02*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePoor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epolyps\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.75\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKRAS Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWild type\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.007**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMutant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003e\u003cem\u003eP\u003c/em\u003e was calculated using Fisher\u0026apos;exact test. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe protein expression levels of OSBPL3 and Ki-67 in CRC tissues were significantly correlated\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the relationship between OSBPL3 differential expression levels and the tumor Ki-67 index in CRC patients, further statistical analysis of the immunochemical results of both was performed. Notably, we found a strong concordance between OSBPL3 overexpression and high Ki-67 expression in tumor cells within most tissue sections that showed immunoreactivity for both OSBPL3 and Ki-67, and OSBPL3 overexpression was strongly associated with high Ki-67 expression (Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, P \u0026lt; 0.05). This further indicates that OSBPL3 is expected to be a molecular target.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssociation between the KRAS mutation and OSBPL3 expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKRAS mutations were detected in 30 of 92 CRC cases (32.6%), and the main mutation sites were G12D (13/30, 43.3%), G13D (6/30, 20%), and G12 V (6/30, 20%) in codons 12 and 13 of exon 12, while other mutations, such as G12C (2/30, 6.7%), G12A (2/30, 6.7%), and G12S (1/30, 3.3%). 30, 6.7%), and G12S (1/30, 3.3%), were rare. The expression level of OSBPL3 was significantly elevated in KRAS mutant tumors (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01), but there was no significant correlation between OSBPL3 expression and each subtype of KRAS mutation. The results showed that CRC samples with high OSBPL3 expression had more KRAS mutations, again confirming the potential of OSBPL3 as a new molecular target.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe early diagnosis of CRC and timely surgery support a good prognosis, but approximately 25% of CRC cases are already advanced at the time of diagnosis [19]. Some still have surgical opportunities after neoadjuvant radiotherapy to reduce the clinical stage, and supplementation with targeted therapy or immunotherapy significantly prolongs survival [20]. Therefore, CRC survival can be improved by means of precision therapy regardless of disease stage, and CRC is curable if early diagnosis can be achieved. Thus, early diagnostic molecular marker screening is particularly important, and molecular target selection provides a reliable basis for targeted therapy. Thus, CRC molecular markers have become a research hotspot in recent years.\u003c/p\u003e \u003cp\u003eThe results of this study showed that OSBPL3 expression was significantly higher in CRC tissues than in paraneoplastic tissues and correlated with the degree of CRC differentiation; the lower the CRC differentiation, the higher the OSBPL3 mRNA and protein expression, which is consistent with the results of existing studies and biochemical predictions [14]. It has also been shown that the degree of differentiation does not directly correlate with OSBPL3 expression, but rather the prognosis differs between groups with high and low expression in tumors with different degrees of differentiation [16]. In the weighted gene correlation network analysis (WGCNA) study, OSBPL3 was identified as a pivotal gene in CRC, with upregulated expression in cancer tissues, and its high expression correlated with a poor prognosis in CRC [21]. The results of the present study support the association of OSBPL3 with CRC development and progression. OSBP and OSBP-associated proteins (ORPs) constitute a large family of genes with sterol/lipid transport and regulatory activities involved in the control of lipid metabolism, regulation of vesicular transport and cell signaling events [22, 23]. ORP4, ORP5 and many other members of the ORP family have also been associated with tumors. ORP4 promotes the survival of rapidly proliferating cells [24] and is considered a potential marker of solid tumor dissemination and a poor prognosis [25]. Highly spliced variants leading to small changes in mRNA structure have been identified in several ORPs, including ORP1, ORP3 and ORP6 [26]. Differential mRNA splicing may result in functionally different forms of ORP3 genes [11]. Jiao et al. confirmed that OSBPL3 promotes the proliferation, migration, and motility of CRC cells by ex vivo experiments [14].\u003c/p\u003e \u003cp\u003eIn the present study, we found that those who overexpressed OSBPL3 in CRC had correspondingly high expression of Ki-67, and there was a positive correlation between them. Ki-67 is a nuclear DNA-binding protein expressed in all vertebrates and is a proliferation marker widely used for tumor grading [27]. Ki-67 is present in the G1, S, and G2 phases of the cell cycle and is commonly used as a marker of cell proliferation [28]. Immunohistochemical detection of the Ki-67 index in tumors can objectively reflect the proliferation of tumors and is well established for clinical application. A high Ki-67 index usually indicates active proliferation and poor prognosis [29]. One study confirmed that the positive expression of Ki-67 in colorectal cancer increased with a decrease in differentiation [30]. High Ki-67 expression indicates a lower survival rate and is a predictor of CRC progression [31]. In this study, we concluded that OSBPL3 and Ki-67 expression were correlated and that OSBPL3 also had a similar pro-proliferative effect on CRC, which was positively correlated with the degree of differentiation. Therefore, it was further hypothesized that OSBPL3 and Ki-67 have the same pro-proliferative function and that high OSBPL3 expression is associated with a poor prognosis and could be used as a marker of CRC cell proliferation.\u003c/p\u003e \u003cp\u003eThis study also found that KRAS mutations were more common in cases with high OSBPL3 expression, and the two were closely related. However, there was no clear relationship between OSBPL3 expression levels and KRAS mutation subtypes. Considering the effect of the small sample size, the variation in mutant subtypes needs further validation. RAS is an oncogene that plays a crucial role in cell proliferation, differentiation, growth and development [8]. Cyclin D1, the downstream target gene of its downstream signaling pathway Ras/Raf pathway, is a key factor in controlling cell proliferation from G1 to S phase and ultimately promoting cell proliferation [32]. It has been suggested that OSBPL3 is an R-Ras interacting oxysterol-binding protein homolog that regulates cell adhesion and plays a role in promoting tumor cell proliferation, migration and invasion, and evidence was obtained that the OSBPL3-VAPA complex stimulates R-Ras signaling [17]. It can regulate cytoskeleton reconstruction, alter the shape of CRC cells and the number of laminar pseudopods, and promote the motility and migration of CRC cells [14]. KRAS mutations are common driver mutations in CRC and are found at different frequencies in all consensus molecular subtypes (CMSs) [33]. KRAS mutation status has been used as a \"molecular\" predictor of efficacy for targeted therapy with epidermal growth factor receptor monoclonal antibody and has become class I evidence for clinical treatment. Patients with wild-type and G13D-mutant phenotypes can benefit from this type of drug therapy [9]. A new generation of KRAS mutation inhibitors has been used in the clinic; the first KRAS inhibitor sotorasib (AMG510) [34] became available in 2019, and the FDA approved adagrasib (MRTX849) for patients with the KRAS G12C mutation in 2021 [35]. Recent studies have defined the gene expression changes triggered by RAS [36]. However, mutated KRAS interacts with OSBPL3, and although it has been shown to affect the RAS pathway, some complementary signaling pathways can also play an important role in tumorigenesis progression [37], but this remains to be elucidated in future studies. The high level of OSBPL3 expression indicates that it may be a primary screening indicator for KRAS-mutated patients receiving KRAS inhibitors, and if the sample size is large enough, the clinicopathological characteristics of patients with KRAS mutations and high OSBPL3 expression can be analyzed to better characterize them. Mutations in the NRAS gene were not detected in this study. This may be because the proportion of NRAS mutations in CRC is approximately 2% -6% [38], which is much lower than that of KRAS. Additionally, there are limitations in the detection methods, as next-generation sequencing (NGS) methods detected RAS mutations in approximately 13% more patients [39]. The RAS pathway signature is superior to KRAS mutation status in predicting the dependence on RAS signaling [40]. Therefore, mutations in other members of the RAS pathway, not just the RAS gene, may play the same role in signaling. OSBPL3 may also be regulated by non-RAS pathways; for example, lncRNA MIR4435-2HG may regulate OSBPL3 expression via pathways such as the P38/MAPK pathway and the VEGF pathway [41]. Therefore, it is speculated that OSBPL3 does not facilitate colorectal carcinogenesis exclusively through the RAS pathway. Furthermore, although there is a correlation between KRAS mutations and OSBPL3, it is unclear whether OSBPL3 affects tumor biology regardless of KRAS status. This also deserves further study.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, our preliminary study demonstrated that OSBPL3 is upregulated in CRC and negatively correlates with the degree of differentiation. In addition, it may affect cell progression in CRC through the activation of RAS. Moreover, we found a significant correlation between OSBPL3 overexpression and high Ki-67 expression. Therefore, OSBPL3 may serve as a molecular marker for CRC diagnosis and progression and may be a new potential therapeutic target for CRC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCRC: Colorectal cancer; OSBP: Oxysterol-binding protein; ARMS: amplification refractory mutation system; OS: Overall survival; PFS: Progression-free survival; PCR: Polymerase chain reaction.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e-Ethics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Ethics Committee of the First Affiliated Hospital of the USTC (2021-BLK-07). Since this study is retrospective and the clinical samples used were paraffin-embedded tissue blocks, this study did not affect the diagnosis and treatment of patients, and considering the privacy of patients, the ethics committee did not consider a written consent procedure necessary. Prior to the start of follow-up, we communicated with patients by telephone to obtain consent, which was recorded. All individuals gave verbal consent to the study plan, and their clinical samples and personal data were used under the supervision of their physicians.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e-Consent to public\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e-Availability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e-Competing interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e-Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was supported by the National Natural Science Foundation of China (No. 81872055).The funder, JH, conceived the study and was involved in the design and coordination of the study, as well as providing financial support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e-Authors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMZ carried out the molecular genetic studies and drafted the manuscript; LM participated in the design of the study and performed the statistical analysis; ZZ participated in the acquisition of data; JW carried out the immunohistochemistry; XC participated in the analysis and interpretation of data; JH conceived of the study, and participated in its design and coordination. All authors read and approved the fnal manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e-Acknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank all the patients who participated in this study, the Department of Pathology and Department of Gastrointestinal Surgery of The First Affiliated Hospital of USTC for their support.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eSung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021; 71: 209-49.\u003c/li\u003e\n \u003cli\u003eSiegel RL, Miller KD, Fedewa SA, et al. Colorectal cancer statistics, 2017. CA Cancer J Clin. 2017; 67: 177-93.\u003c/li\u003e\n \u003cli\u003eKalyan A, Kircher S, Shah H, Mulcahy M, Benson A. Updates on immunotherapy for colorectal cancer. J Gastrointest Oncol. 2018; 9: 160-9.\u003c/li\u003e\n \u003cli\u003eMiller KD, Nogueira L, Mariotto AB, et al. Cancer treatment and survivorship statistics. 2019. CA Cancer J Clin. 2019; 69: 363-85.\u003c/li\u003e\n \u003cli\u003eTong G, Zhang G, Liu J, et al. Cutoff of 25% for Ki67 expression is a good classification tool for prognosis in colorectal cancer in the AJCC 8 stratification. Oncol Rep. 2020; 43: 1187-98.\u003c/li\u003e\n \u003cli\u003eBoughdady IS, Kinsella AR, Haboubi NY, Schofield PF. K-ras gene mutations in adenomas and carcinomas of the colon. Surg Oncol. 1992; 1: 275-82.\u003c/li\u003e\n \u003cli\u003eZhou S, Zhang D, Li J, et al. Landscape of RAS Variations in 17,993 Pan-cancer Patients Identified by Next-generation Sequencing. Pathol Oncol Res. 2020; 26: 2835-7.\u003c/li\u003e\n \u003cli\u003eVakiani E, Solit DB. KRAS and BRAF: drug targets and predictive biomarkers. J Pathol. 2011; 223: 219-29.\u003c/li\u003e\n \u003cli\u003eMcFall T, Diedrich JK, Mengistu M, et al. A systems mechanism for KRAS mutant allele-specific responses to targeted therapy. Sci Signal. 2019; 12: aaw8288.\u003c/li\u003e\n \u003cli\u003eDong X, Wang Z, Ye S, Zhang R. The crystal structure of ORP3 reveals the conservative PI4P binding pattern. Biochem Biophys Res Commun. 2020; 529: 1005-10.\u003c/li\u003e\n \u003cli\u003eCollier FM, Gregorio-King CC, Apostolopoulos J, Walder K, Kirkland MA. ORP3 splice variants and their expression in human tissues and hematopoietic cells. DNA Cell Biol. 2003; 22: 1-9.\u003c/li\u003e\n \u003cli\u003eLehto M, Tienari J, Lehtonen S, Lehtonen E, Olkkonen VM. Subfamily III of mammalian oxysterol-binding protein (OSBP) homologues: the expression and intracellular localization of ORP3, ORP6, and ORP7. Cell Tissue Res. 2004; 315: 39-57.\u003c/li\u003e\n \u003cli\u003eGashaw I, Gr\u0026uuml;mmer R, Klein-Hitpass L, et al. Gene signatures of testicular seminoma with emphasis on expression of ets variant gene 4. Cell Mol Life Sci. 2005; 62: 2359-68.\u003c/li\u003e\n \u003cli\u003eJiao HL, Weng BS, Yan SS, et al. Upregulation of OSBPL3 by HIF1A promotes colorectal cancer progression through activation of RAS signaling pathway. Cell Death Dis. 2020; 11: 571.\u003c/li\u003e\n \u003cli\u003eNjeru SN, Kraus J, Meena JK, et al. Aneuploidy-inducing gene knockdowns overlap with cancer mutations and identify Orp3 as a B-cell lymphoma suppressor. Oncogene. 2020; 39: 1445-65.\u003c/li\u003e\n \u003cli\u003eXu P, Richter J, Blatz A, et al. Downregulation of ORP3 Correlates with Reduced Survival of Colon Cancer Patients with Advanced Nodal Metastasis and of Female Patients with Grade 3 Colon Cancer. Int J Mol Sci. 2020; 21: 5894.\u003c/li\u003e\n \u003cli\u003eWeber-Boyvat M, Kentala H, Lilja J, et al. OSBP-related protein 3 (ORP3) coupling with VAMP-associated protein A regulates R-Ras activity. Exp Cell Res. 2015; 331: 278-91.\u003c/li\u003e\n \u003cli\u003eLehto M, M\u0026auml;yr\u0026auml;np\u0026auml;\u0026auml; MI, Pellinen T, et al. The R-Ras interaction partner ORP3 regulates cell adhesion. J Cell Sci. 2008; 121: 695-705.\u003c/li\u003e\n \u003cli\u003eVan Cutsem E, Cervantes A, Nordlinger B, Arnold D. Metastatic colorectal cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol. 2014; 25: Ⅲ1-9..\u003c/li\u003e\n \u003cli\u003eVan Cutsem E, Cervantes A, Adam R, et al. ESMO consensus guidelines for the management of patients with metastatic colorectal cancer. Ann Oncol. 2016; 27: 1386-422.\u003c/li\u003e\n \u003cli\u003eZhang Y, Luo J, Liu Z, et al. Identification of hub genes in colorectal cancer based on weighted gene co-expression network analysis and clinical data from The Cancer Genome Atlas. Biosci Rep. 2021. https://doi.org/10.1042/BSR20211280.\u003c/li\u003e\n \u003cli\u003eLehto M, Olkkonen VM. The OSBP-related proteins: a novel protein family involved in vesicle transport, cellular lipid metabolism, and cell signalling. Biochim Biophys Acta. 2003; 1631: 1-11.\u003c/li\u003e\n \u003cli\u003eLiu H, Huang S. Role of oxysterol-binding protein-related proteins in malignant human tumours. World J Clin Cases. 2020; 8: 1-10.\u003c/li\u003e\n \u003cli\u003eCharman M, Colbourne TR, Pietrangelo A, Kreplak L, Ridgway ND. Oxysterol-binding protein (OSBP)-related protein 4 (ORP4) is essential for cell proliferation and survival. J Biol Chem. 2014; 289: 15705-17.\u003c/li\u003e\n \u003cli\u003ePan G, Cao X, Liu B, et al. OSBP-related protein 4L promotes phospholipase C\u0026beta;3 translocation from the nucleus to the plasma membrane in Jurkat T-cells. J Biol Chem. 2018; 293: 17430-41.\u003c/li\u003e\n \u003cli\u003eOlkkonen VM, Levine TP. Oxysterol binding proteins: in more than one place at one time. Biochem Cell Biol. 2004; 82: 87-98.\u003c/li\u003e\n \u003cli\u003eSobecki M, Mrouj K, Colinge J, et al. Cell-Cycle Regulation Accounts for Variability in Ki-67 Expression Levels. Cancer Res. 2017; 77: 2722-34.\u003c/li\u003e\n \u003cli\u003eUrruticoechea A, Smith IE, Dowsett M. Proliferation marker Ki-67 in early breast cancer. J Clin Oncol. 2005; 23: 7212-20.\u003c/li\u003e\n \u003cli\u003ePerou CM, Jeffrey SS, van de Rijn M, et al. Distinctive gene expression patterns in human mammary epithelial cells and breast cancers. Proc Natl Acad Sci U S A. 1999; 96: 9212-7.\u003c/li\u003e\n \u003cli\u003eLi W, Zhang G, Wang HL, Wang L. Analysis of expression of cyclin E, p27kip1 and Ki67 protein in colorectal cancer tissues and its value for diagnosis, treatment and prognosis of disease. Eur Rev Med Pharmacol Sci. 2016; 20: 4874-9.\u003c/li\u003e\n \u003cli\u003eMa YL, Peng JY, Zhang P, Liu WJ, Huang L, Qin HL. Immunohistochemical analysis revealed CD34 and Ki67 protein expression as significant prognostic factors in colorectal cancer. Med Oncol. 2010; 27: 304-9.\u003c/li\u003e\n \u003cli\u003eBos JL, Rehmann H, Wittinghofer A. GEFs and GAPs: critical elements in the control of small G proteins. Cell. 2007; 129: 865-77.\u003c/li\u003e\n \u003cli\u003eLal N, White BS, Goussous G, et al. KRAS Mutation and Consensus Molecular Subtypes 2 and 3 Are Independently Associated with Reduced Immune Infiltration and Reactivity in Colorectal Cancer. Clin Cancer Res. 2018; 24: 224-33.\u003c/li\u003e\n \u003cli\u003eCanon J, Rex K, Saiki AY, et al. The clinical KRAS(G12C) inhibitor AMG 510 drives anti-tumour immunity. Nature. 2019; 575: 217-23.\u003c/li\u003e\n \u003cli\u003eHallin J, Engstrom LD, Hargis L, et al. The KRAS(G12C) Inhibitor MRTX849 Provides Insight toward Therapeutic Susceptibility of KRAS-Mutant Cancers in Mouse Models and Patients. Cancer Discov. 2020; 10: 54-71.\u003c/li\u003e\n \u003cli\u003eYuan XH, Yang J, Wang XY, Zhang XL, Qin TT, Li K. Association between EGFR/KRAS mutation and expression of VEGFA, VEGFR and VEGFR2 in lung adenocarcinoma. Oncol Lett. 2018; 16: 2105-12.\u003c/li\u003e\n \u003cli\u003eGrant S. Cotargeting survival signaling pathways in cancer. J Clin Invest. 2008; 118: 3003-6.\u003c/li\u003e\n \u003cli\u003eDe Roock W, Claes B, Bernasconi D, et al. Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol. 2010; 11: 753-62.\u003c/li\u003e\n \u003cli\u003eUdar N, Lofton-Day C, Dong J, et al. Clinical validation of the next-generation sequencing-based Extended RAS Panel assay using metastatic colorectal cancer patient samples from the phase 3 PRIME study. J Cancer Res Clin Oncol. 2018; 144: 2001-10.\u003c/li\u003e\n \u003cli\u003eLoboda A, Nebozhyn M, Klinghoffer R, et al. A gene expression signature of RAS pathway dependence predicts response to PI3K and RAS pathway inhibitors and expands the population of RAS pathway activated tumors. BMC Med Genomics. 2010; 3: 26.\u003c/li\u003e\n \u003cli\u003eChen J, Song Y, Li M, et al. Comprehensive analysis of ceRNA networks reveals prognostic lncRNAs related to immune infiltration in colorectal cancer. BMC Cancer. 2021; 21: 255.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-medical-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mgnm","sideBox":"Learn more about [BMC Medical Genomics](http://bmcmedgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mgnm/default.aspx","title":"BMC Medical Genomics","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Colorectal cancer, CRC, OSBPL3, Ki-67, KRAS, prognosis","lastPublishedDoi":"10.21203/rs.3.rs-1155690/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1155690/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eOSBPL3 is overexpressed in a variety of malignancies and is closely associated with tumor growth and metastasis. However, its expression and function in colorectal cancer (CRC) are unclear. We aimed to investigate its prognostic and therapeutic value in this disease by detecting its expression in CRC and its correlation with the clinicopathological characteristics and prognosis of patients. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eA total of 92 CRC samples were included in this study. According to the 2020 WHO diagnostic criteria, the criteria of the American Joint Committee on Cancer (AJCC) 8th edition staging system were used. OSBPL3 and Ki-67 expression in these samples was detected by immunohistochemistry. OSBPL3 mRNA expression was detected by qRT-PCR. KRAS/NRAS mutations were detected by an amplification refractory mutation system (ARMS). Data analysis was performed using the statistical analysis software Prism 8. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eOSBPL3 was found to be significantly overexpressed in CRC tumor tissues and was associated with worse progression-free survival and overall survival in patients. Additionally, OSBPL3 expression was negatively correlated with the degree of tumor differentiation. KRAS mutations were detected in approximately 32.6% of patients and were significantly associated with high OSBPL3 expression. In addition, OSBPL3 and Ki-67 expression was significantly correlated. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e OSBPL3 is highly expressed in CRC samples and predicts a worse prognosis. OSBPL3 may become a new potential therapeutic target for CRC.\u003c/p\u003e","manuscriptTitle":"The respective relations of expression of OSBPL3 with Ki-67 expression and KRAS mutation in CRC for diagnosis and prognosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-03-28 15:14:44","doi":"10.21203/rs.3.rs-1155690/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2022-04-25T23:12:20+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-03-25T10:09:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Medical Genomics","date":"2022-01-13T08:59:22+00:00","index":"","fulltext":""},{"type":"decision","content":"Minor revision","date":"2022-01-07T09:38:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-medical-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mgnm","sideBox":"Learn more about [BMC Medical Genomics](http://bmcmedgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mgnm/default.aspx","title":"BMC Medical Genomics","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bf4971c5-530d-44c1-8d56-e31482a245b4","owner":[],"postedDate":"March 28th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-11-25T07:39:06+00:00","versionOfRecord":[],"versionCreatedAt":"2022-03-28 15:14:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1155690","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1155690","identity":"rs-1155690","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-06-05T02:00:03.366016+00:00
License: CC-BY-4.0