NRF2 signaling plays an essential role in cancer progression through the NRF2-GPX2-NOTCH3 axis in head and neck squamous cell carcinoma

NRF2 signaling plays an essential role in cancer progression through the NRF2-GPX2-NOTCH3 axis in head and neck squamous cell carcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article NRF2 signaling plays an essential role in cancer progression through the NRF2-GPX2-NOTCH3 axis in head and neck squamous cell carcinoma Xiaoye Jin, Xiayuan Lou, Haoxiang Qi, Chao Zheng, Bo Li, Xuerong Siwu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4132275/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The activation of nuclear factor erythroid 2–related factor 2 (NRF2) has been observed in various cancers. Yet its exact contribution to the development of head and neck squamous cell carcinoma (HNSCC) remains undetermined. Methods: We systematically investigated the role of NRF2 in HNSCC, ultimately selecting GPX2 , which exhibited a marked downregulation, for a detailed mechanistic analysis. Firstly, we knocked out NRF2 by CRISPR-Cas9, and subsequently confirmed by RT-qPCR and Western Blot. The role of NRF2was evaluated through various assays, including cell growth assays, colony formation assays, 3D cultures, cell migration and invasion assessments, ROS detection, and xenograft tumor models. Furthermore, we performed RNA sequencing on NRF2 -KO cells compared to NRF2 -WT cells identified GPX2 as a downstream target of NRF2. This finding led us to examine the role of GPX2 in the maintenance of cancer stem cells (CSCs). Notably, CSC analysis indicated the involvement of the NOTCH signaling pathway in HNSCC progression, and the critical role of NOTCH3 was confirmed using the serious experimental approaches mentioned earlier. Results: We previously found that NRF2 signaling is critical for the differentiation of squamous basal progenitor cells, while disruption of NRF2 causes basal cell hyperplasia. In this study, we revealed a correlation between elevated NRF2 activity and poor outcomes in HNSCC patients. We demonstrated that NRF2 facilitates tumor proliferation, migration, and invasion, as evidenced by both in vitro and in vivo studies. Significantly, NRF2 augments the expression of the antioxidant enzyme GPX2, thereby enhancing the proliferative, migratory, and invasive properties of HNSCC cells. Activation of GPX2 is critical for sustaining CSCs by up-regulating NOTCH3, a key driver of cancer progression. Conclusions: NRF2 regulates HNSCC progression through the NRF2-GPX2-NOTCH3 axis. Our findings proposed that pharmacological targeting of the NRF2-GPX2-NOTCH3 axis could be a potential therapeutic approach against HNSCC. NRF2 GPX2 NOTCH3 Head and neck squamous cell carcinoma Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Head and neck squamous cell carcinom (HNSCC) represents a diverse group of cancers arising from the squamous cells lining the mucosal surfaces of the head and neck region, including the oral cavity, oropharynx, larynx, and hypopharynx[1]. HNSCC is one of the most common cancers worldwide, accounting for over 870,000 cases per year[2]. Tobacco use, alcohol consumption, and human papillomavirus (HPV) infection are the primary etiological factors[3]. Genetic alterations are common in HNSCC including growth factor receptors (e.g., EGFR), tumor suppressor genes (e.g., TP53) and signaling pathways (e.g., PI3K), etc[4–6]. Despite advances in surgical techniques, radiation therapy, and chemotherapy, the overall survival rates for HNSCC have only modestly improved over the past few decades. The development of resistance to therapy, the presence of distant metastases at diagnosis, and the significant morbidity associated with treatment highlight the need for innovative therapeutic strategies. Recent advancements in immunotherapy and targeted therapies offer new hope for improving outcomes in HNSCC patients. However, the cure rate for advanced HNSCC patients remains poor and only 40–50% of patients survive for 5 years[7]. NRF2 signaling is pivotal in maintaining cellular redox homeostasis and defending against oxidative stress. NRF2 operates as a master regulator, controlling the expression of various genes involved in antioxidant response and detoxification processes to maintain cellular redox homeostasis. The regulation of NRF2 expression is intricately controlled through its interaction with KEAP1 to form a CUL3-based E3 ubiquitin ligase complex. This KEAP1-mediated ubiquitination and subsequent proteasomal degradation of NRF2 ensures that NRF2 levels remain low under unstressed conditions[8,9]. Upon oxidative stress, modifications in KEAP1 lead to the stabilization and nuclear translocation of NRF2, where it binds to antioxidant response elements (ARE) in the DNA to activate the transcription of its target genes. Multiple studies have shown that NRF2 plays a paradoxical role in cancer development. Activation of NRF2 in normal cells promotes antioxidant defenses and detoxification, protecting against DNA damage and mutagenesis, thus acting as a tumor suppressor by eliminating potential cancer initiation[10,11]. However, the constitutive activation of NRF2 in cancer cells enhances cancer cell proliferation, metabolic reprogramming, and resistance to chemotherapy and radiotherapy, thus promoting tumor progression and metastasis[12–16]. Clinical evidence also indicates that elevated expression of NRF2 is significantly associated with poor prognosis[16,17]. This duality highlights the complexity of NRF2 signaling in the cancer milieu. Glutathione peroxidases (GPXs) are selenium-containing enzymes crucial in the defense of oxidative stress by reducing peroxides with the oxidization of glutathione (GSH) to glutathione disulfide (GSSG)[18,19]. There are eight GPX family members who have distinct cellular locations and substrate specificities, contributing to various physiological functions beyond their antioxidant roles[20]. GPX members play multifaceted roles in cancers as both tumor-suppressive and oncogenic activities depending on the context and specific family member involved[21–23]. GPX4 has been identified as a critical player in conferring resistance to ferroptosis, garnering attention as a potential novel target for anticancer therapies[24]. GPX7 has been demonstrated to be downregulated and hypermethylated in gastric cancer, and its reconstitution suppresses tumor cell growth[25]. GPX8 has been implicated in the promotion of cancer cell growth[26]. Recent studies have shown that GPX2 serves as a predictive marker for recurrence-free survival in prostate cancer and promotes cancer development through the Wnt/β-catenin/EMT pathway[27]. Previous studies also indicate that the expression level of GPX2 is a prognostic factor in esophageal squamous cell carcinoma (ESCC), correlating with clinicopathological features[28]. In addition, Kazi et al. suggests that GPX2 as a targetable factor influences immune escape in cold tumors, thus affecting the response to immune checkpoint inhibitors[29]. In this study, we observed that GPX2 was significantly overexpressed in patients with NRF2 mutations in HNSCC, contributing to accelerated tumor progression compared to patients with normal NRF2 . We further found that NRF2 enhances GPX2 expression, influencing the NOTCH pathway by sustaining NOTCH3 levels. Reduction of GPX2 level led to a decrease in tumor cell growth both in vitro and in vivo . Moreover, increased levels of GPX2 were observed in HNSCC patients, correlating with poorer patient outcomes. This study sheds light on the critical role of the NRF2-GPX2-NOTCH3 axis in advancing HNSCC, suggesting that targeting the NRF2-GPX2-NOTCH3 axis might offer a novel strategy to enhance treatment efficacy in HNSCC. Materials and Methods Bioinformatic data collection and analysis From UCSC XENA ( https://xenabrowser.net/ ), transcriptome data, clinical information, and survival data of TCGA-HNSC patients were downloaded. Patients were divided into two groups based on the expression level of the corresponding genes. Volcano plot and boxplot were performed with R “ggplot2” package. Tissue samples Human head and neck squamous cell carcinoma (HNSCC) tissues were procured from patients who underwent curative surgery at Jiangxi Cancer Hospital (Jiangxi, China). The research was carried out in compliance with relevant national ethical guidelines and was approved by the Research Ethics Committee of Jiangxi Cancer Hospital under approval number (2024ky008). Xenograft model The animal experiments conducted in this study were ethically approved by the Institutional Animal Care and Use Committee of Zhejiang University (approval number: 20221576). Female and male Nu/Nu nude mice, aged six weeks, sourced from Slac (Zhejiang, China), were utilized for the experiments. A total of 2 × 10 6 cells were subcutaneously injected into the nude mice in a random manner. Tumor volumes were calculated using the formula: 1/2 × length × width 2 . The mice were humanely euthanized approximately 30–36 days post-injection, and the tumors were subsequently excised for further analysis. Cell Culture FADU cell line was procured from Procell Life Science &Technology (Wuhan, China). Detroit 562 cell line was procured from Zhejiang Meisen Cell Technology Co., LTD (Zhejiang, China). Cell lines were maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a 5% CO 2 atmosphere. Authentication of the cell lines were performed using short tandem repeat (STR) profiling. NRF2 knockout and GPX2 knockdown cell generation NRF2 knockout and GPX2 knockdown cells were established by lentiviral infection. The sgRNA sequence of NRF2 as described before[30]. The target sequence for sh NRF2 -1 is 5′- CTTGCATTAATTCGGGATATA-3′, for sh NRF2 -2 is 5′- CCGGCATTTCACTAAACACAA − 3′. The target sequence for sh GPX2 -1 is 5′- GAAGGTAGATTTCAATACGTT-3′, for sh GPX2 -2 is 5′- CCTACCCTTATGATGACCCAT-3′. The target sequence for sh NOTCH3 -1 is 5′- GGTGATCGGCTCGGTAGTAAT-3′, for sh NOTCH3 -2 is 5′- CCAATGCCAACTGAAGAGGAT-3′. Colony formation assay An equivalent quantity of cells was cultured in a 6-well plate in DMEM supplemented with 10% FBS, and incubated for a period of 10–14 days. Subsequently, the cells were washed with PBS and fixed by 4% paraformaldehyde for 20 minutes at RT, then stained with 1% crystal violet for 10 minutes. colonies were captured quantified utilizing ImageJ. Cell growth assay Cell growth was assessed through the utilization of the Cell Counting Kit-8 (CCK-8) (Vazyme, A311-01, China). Specifically, cells were plated at a density of 1500 cells per well in 96-well plates. The quantification of viable cells was conducted in accordance with the manufacturer's guidelines at specified time intervals. Transwell Assay For the migration assay, 5 × 10 4 cells were resuspended in 300 µL of DMEM medium and seeded in the upper transwell chamber, while for the invasion assay, 1 × 10 5 cells were utilized. The lower chamber contained 500 µL of DMEM supplemented with 10% FBS. Following a 48-hour incubation period, the cells were fixed in 4% paraformaldehyde at room temperature for 20 minutes, stained with 1% crystal violet for 10 minutes, subsequently imaged and quantified using ImageJ. Immunohistochemistry Firstly, the tissues underwent fixation in 4% paraformaldehyde for 48 h, followed by dehydration using gradient alcohol. Next the tissues were embedded in paraffin and then sectioned into 5 µm slides. After deparaffinization, the slides were hydrated with gradient alcohol and xylene respectively. Then washing 3 times by PBS, the slides were further repaired with citrate buffer. Endogenous peroxidase activity was eliminated using 3% H 2 O 2 , followed by blocking with 5% Bovine serum albumin (BSA). Subsequently, the slides were incubated with primary antibody (Ki67, 1:500, BD Pharmingen (610968); NRF2, 1:50, Santa Cruz (365949); GPX2, 1:1000, Gene Tex (GTX100292); NOTCH3, 1:1000, Abcam (ab23426); NQO1, 1:10000, Proteintech (67240-1-Ig)) night at 4°C, incubated with second antibody (Proteintech, Cat No. PK10006, China) at room temperature for 1 hour, and stained with DAB reagent. At last, the slides were restained with hematoxylin, dehydrated with gradient alcohol, mounted, and photographed under a microscope. Quantitative real-time PCR Total RNA was extracted from cells with RNAex Pro RNA Reagent (AG, AG21101, China) and SteadyPure RNA Extraction Kit (AG, AG21024, China) following manufacturer’s instructions. Reverse transcription was performed with Evo M-MLV Premix for qPCR (AG,11706, China) with 500 ng RNA. The target cDNA was amplified by SYBR Green Pro Taq HS qPCR Kit (AG,11701, China) and Bio-Rad CFX96 to detection (Bio-Rad, USA). Gene expression was analyzed using the 2 −ΔΔCt method with ACTB as a control. The primers are listed in Supplemental Table 1. Western Blot Cells were lysed by RIPA lysis with 1% PMSF on ice for 30 min, and then centrifuged with 12,000× g at 4°C for 30 min. The protein concentration was determined by an enhanced BCA protein assay kit (Beyotime, P0010, China). Equal amounts of protein were separated by an appropriate concentration of the SDS-PAGE gel and transferred into a polyvinylidene difluoride (PVDF) membrane with a Mini Trans-Blot Module (Bio-Rad). 5% skim milk was used to block the membrane for 1h at room temperature. The membrane was incubated with different primary antibodies(NRF2, 1:1000, Abclonal(A3577); NOTCH3, 1:1000, Abclonal(A13522); GCLC, 1:1000, Abclonal(A4499); NQO1, 1:10000, Proteintech(67240-1-Ig); GPX2, 1:1000, Abclonal(A15999); β-ACTIN, 1:5000, Bioworld(AP0060)) at 4°C overnight and incubated secondary antibodies(Goat-Anti-Mouse, 1:5000, ZENBIO (511103); Goat-Anti-Rabbit,1:5000, ZENBIO (511203))sequentially for 1h at room temperature. Target proteins were visualized using BeyoECL Plus kit (Beyotime, P0018S, China). 3D sphere formation The cells were counted and cultured in 80% Matrigel mixed in DMEM with 10% FBS. Replace with fresh medium after 2–3 days. Cell was photographed in day 14. Cellular Reactive Oxygen Species (ROS) Level and Cell Apoptosis Measurement Cellular reactive oxygen species (ROS) levels were quantified in viable cells using the DCFH-DA probe (Beyotime, S0033S, China). The probe was introduced into the cell culture medium at a 1:1000 ratio and incubated with the cells for 30 minutes at 37 ℃. Subsequently, the cell culture medium was removed, and the cells were washed twice with PBS. Following trypsin digestion at a concentration of 0.25%, the cells were suspended in PBS and subjected to flow cytometric analysis (ACEA NovoCyteTM, ACEA Biosciences, USA) for assessment. Cell apoptosis was evaluated using Annexin V-mCherry (Beyotime, C1069M, China) through flow cytometry. Statistical analysis The data were analyzed using GraphPad Prism version 9.5 software and presented as mean ± SD. Student's t-test or two-way analysis of variance (ANOVA) was employed when comparing groups with similar differences. p < 0.05 was deemed to be statistically significant. Results Enhanced NRF2 signaling correlates with poor survival rates in patients with HNSCC. The NRF2 degradation complex is crucial in the regulation of NRF2 signaling and comprises KEAP1 and CUL3 components. To investigate the role of NRF2 components in HNSCC, we performed an extensive analysis utilizing The Cancer Genome Atlas (TCGA) database. About 12% of all cancers carried mutations in at least one of these three genes (Fig. 1 A). NRF2 mutations are present in about 6% of HNSCC cases (Fig. 1 A), consistent with previous report[31]. In addition, we analyzed the occurrence of mutations in KEAP1 and CUL3 , and identified at rates of 4% and 2%, respectively (Fig. 1 A). Notably, the missense mutations of NRF2 in the Neh 2 domain primarily impair its capacity to bind to KEAP1, enhancing its nuclear translocation and prolonging its activity (Fig. 1 A and B). Mutations of KEAP1 were found not only in the DGR (Kelch) domain, which is crucial for NRF2 interaction, but also in various structural domains, and a similar pattern is observed in CUL3 as well (Supplementary Fig. 1). Following stress stimuli, the activation of NRF2 promotes a broad spectrum of downstream target genes involved in various cellular processes such as iron catabolism ( FTH1 , FTL ), metabolism ( G6PD , TKT ), antioxidant signaling ( TXN , GCLC , GCLM ), and xenobiotic transformation ( NQO1 ), et al[32]. Increased expression of these genes was observed in patients harboring NRF2 mutations (Fig. 1 C). Subsequent analysis suggested that up-regulation of NRF2 downstream genes correlated with decreased overall survival rate in patients (Fig. 1 D and Supplementary Fig. 2)[33]. Notably, high expression of NRF2 markedly enhanced cell proliferation compared to cells with lower levels of NRF2, as evidenced by Ki67 staining (Fig. 1 E). The results indicate that missense mutations in NRF2 are associated with poor prognoses in patients with HNSCC. NRF2 is essential for HNSCC progression in vitro and in vivo Multiple studies have demonstrated that the activation of NRF2 acts protectively against tumor initiation[11,34,35]. In contrast, sustained activation of NRF2 is associated with the progression of various cancers, substantially enhancing resistance to cancer treatments[36–38]. To elucidate the role of NRF2 in the progression of HNSCC, the NRF2 gene was specifically knocked out in the FADU cell line using CRISPR-Cas9 technology. This knockout was confirmed by reduced expression of NRF2 target genes, NQO1 and GCLC (Fig. 2 A and B). Deletion of NRF2 resulted in a notable decline in cell proliferation, demonstrated by decreased cell growth rates and colony formation capabilities (Fig. 2 C and D). Deletion of NRF2 also led to a significant reduction in both the size and number of spheres formed (Fig. 2 E). Furthermore, we found that deletion of NRF2 markedly impaired the ability of migration and invasion (Fig. 2 F). In addition, deletion of NRF2 significantly increases the cellular level of ROS determined by DCFH-DA flow cytometry (Fig. 2 G). There was a significant increase in apoptotic cells in NRF2 -deleted cells compared to control cells (Fig. 2 H). Furthermore, following injection into Nude mice (2x10^ 6 cells per injection), tumors initiated by NRF2 -deleted cells were observably smaller compared to those derived from control cells (Fig. 2 I). Immunohistochemistry (IHC) staining revealed that the deletion of NRF2 significantly reduced Ki67 staining intensity (Fig. 2 J). Suppressing NRF2 by shRNA knockdown in Detroit 562 cells significantly reduced proliferation, migration, and invasion capabilities, consistent with those observed in FADU cells (Supplemental Fig. 3). GPX2 is a potential downstream target of NRF2 signaling To elucidate the role of NRF2 in the progression of HNSCC, we performed RNA sequencing analysis in both control and NRF2 knockout FADU cells. Gene expression profiling, as well as the associated biological processes and pathways, were evaluated. We identified a list of differentially expressed genes. 707 genes (approximately 66.95%) were up-regulated, and 349 genes (approximately 33.05%) were down-regulated following NRF2 knockout (Fig. 3 A). By targeting differentially expressed mRNAs, the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed that the differentially expressed mRNAs were predominantly associated with cellular processes and metabolism (Fig. 3 B). Heatmap cluster analysis of metabolic-related genes revealed that the gene expression profiles between the control and NRF2 knockout cells were distinct (Fig. 3 C). Correspondingly, these gene expression differences were also represented in the volcano plot (Fig. 3 D). Among these genes, the mRNA expression of GPX2 was notably suppressed in the NRF2 knockout cells (Fig. 3 C and D). RT-qPCR and WB confirmed that the expression of GPX2 was decreased in FADU and Detroit 562 cells after deletion of NRF2 (Fig. 3 E and Supplemental Fig. 3A). In cohort study of TCGA database, the mRNA expression levels of GPX2 were positively correlated with NRF2 (r = 0.48, p < 2.2e-16) and higher in patients with NRF2 mutations (Fig. 3 F and G). High levels of GPX2 were associated with a poor survival ratio in HNSCC patients (Fig. 3 H). GPX2 promotes tumor growth in HNSCC. To explore the role of GPX2 in the malignant processes of HNSCC, we performed lentivirus-mediated shRNA knockdown of GPX2 in FADU and Detroit 562 cell lines. The knockdown efficiency was confirmed by RT-qPCR and western blot (Fig. 4 A-B and Supplementary Fig. 4A). Inhibition of GPX2 caused a significant reduction in cell proliferation measured by growth rate and colony formation assay (Fig. 4 C-D and Supplementary Fig. 4B). GPX2 knockdown reduced the size of the tumor spheres formed in the 3D culture system (Fig. 4 E). FADU and Detroit562 cells exhibited decreased migrating and invasive capability following GPX2 knockdown (Fig. 4 F and Supplementary Fig. 4C). Meanwhile, GPX2 knockdown significantly increased the cellular level of ROS (Fig. 4 G and Supplementary Fig. 4D). An increase in the proportion of apoptotic cells was also observed in GPX2 knockdown cells (Fig. 4 H and Supplementary Fig. 4E). Moreover, GPX2 knockdown in FADU cells led to smaller xenograft tumors and reduced proliferation than in controls (Fig. 4 I and J). Depletion of GPX2 Expression disrupts NOTCH3 expression. NRF2 signaling is activated in cancer stem cells (CSCs) and contributes to CSC properties, such as proliferation, metastasis and therapeutic resistance[13,39]. Meanwhile, GPX2 can maintain the genomic integrity of pluripotent stem cells through antioxidant defense[40–42]. GPX2 is concentrated in stem cells and proliferative compartments of epithelial tissues to maintain tissue integrity and homeostasis[20]. To test whether GPX2 is involved in the maintenance of CSCs, we analyzed CSC contents of FADU cells by flow cytometry with CD44, a marker for CSCs[43]. Loss of GPX2 markedly diminished the proportion of CSCs (Fig. 5 A and B). Wnt, Hedgehog (HH), and NOTCH are canonical CSC pathways crucial to the tumorigenicity of CSCs[44]. We found that depletion of GPX2 significantly reduces HH and NOTCH signaling (Supplementary Fig. 5A and C). We further found that the NOTCH target gene, HES1 , is highly expressed in HNSCC cells. In contrast, the expression of Gli1 and Gli2 are either low or undetectable (Supplementary Fig. 5B). To determine the specific NOTCH signaling implicated downstream of GPX2, we first examined all NOTCH ligands and receptors in the TCGA database. We revealed that the high mRNA expression of NOTCH2 and NOTCH3 are positively correlated with GPX2 (Supplementary Fig. 6). We further detected that GPX2 predominantly regulates the expression of NOTCH1 , NOTCH2 and NOTCH3 in HNSCC cells (Fig. 5 C-D and Supplementary Fig. 5D). According to RNA-seq data from the FADU cell line, we found a significant decrease of NOTCH3 following NRF2 knockout (Fig. 5 C-D and Supplementary Fig. 7). The cohort analysis of the TCGA database demonstrated a strong association between the mRNA expression of NOTCH3 and GPX2 (r = 0.33, p < 6.1e-15) (Fig. 5 E-F and Supplementary Fig. 8). High levels of NOTCH3 are also correlated with a decreased overall survival rate in patients (Fig. 5 G). NOTCH3 is critical for HNSCC progression To determine whether activation of NOTCH3 is responsible for promoting the CSC phenotype of HNSCC, we performed lentivirus-mediated shRNA knockdown of NOTCH3 in FADU cells. The knockdown efficiency was confirmed by RT-qPCR and western blot (Fig. 6 A and B). Inhibition of NOTCH3 caused a significant reduction in cell proliferation, as measured by growth rate and colony formation assay (Fig. 6 C and D). NOTCH3 knockdown reduced the size of the tumor spheres formed in the 3D culture system (Fig. 6 E). Additionally, FADU cells exhibited decreased migrating and invasive capability following NOTCH3 knockdown (Fig. 6 F and G). NOTCH3 knockdown significantly increased the cellular level of ROS (Fig. 6 H). An increase in the proportion of apoptotic cells was also observed in NOTCH3 knockdown cells (Fig. 6 I). Moreover, NOTCH3 knockdown in FADU cells led to smaller xenograft tumors and reduced proliferation than in controls (Fig. 6 J). Consistently, high expression of GPX2 markedly enhanced NOTCH3 levels in HNSCC patients(Fig. 6 K). Therefore, these results suggest that NOTCH signaling affects HNSCC progression mediated by NOTCH3. Discussion The role of NRF2 in the malignant progression of cancers has emerged as a focal point of contemporary oncological research. Notably, activation of NRF2 has been associated with a poorer overall survival rate in various cancers, suggesting that NRF2 may play a critical role in cancer pathogenesis[45]. Yet the molecular mechanisms of NRF2 regulating cancer progression remain unexplored. In this study, we elucidated that GPX2 functions as a downstream target of NRF2 in HNSCC. The patients exhibiting elevated activation of NRF2 experience an upregulation of GPX2 mRNA, correlating with decreased overall survival rates. We demonstrate that GPX2 regulates HNSCC cell proliferation, migration, and metastasis by regulating CSC phenotype. Analysis of TCGA database revealed that mRNA expression of NOTCH3 was significantly higher in patients with increased GPX2 expression. We further revealed that the inhibition of GPX2 notably reduced the expression of NOTCH3 in both FADU and Detroit 562 cells These findings suggest a pivotal role for the NRF2-GPX2-NOTCH3 axis in NOTCH3-mediated regulation of CSCs in HNSCC. NRF2 mutation is specifically frequent in multiple squamous cell carcinomas (SCC) of the lung, skin, esophagus, and larynx, et al.[31,46,47]. Most of these SCC-associated NRF2 mutations harbor gain-of-function activity[48]. Numerous studies have highlighted that activation of NRF2 contributes to cancer progression and metastasis, while also endowing resistance to chemotherapy and radiotherapy[12–16]. Our analysis of a cohort of HNSCC cases has elucidated the clinical relevance of NRF2 mutation. We identified that approximately 12% of patients exhibited mutations in the NRF2 complex. These mutations were strong correlated with tumor progression and emerged as a significant prognostic factor. Recenet studies have revealed that NRF2 directly regulates the expression of gene groups that are related to cellular metabolism, in addition to the detoxification response[49]. Upon depleting NRF2, we revealed that the most significantly altered genes were predominantly linked to cellular metabolism. We further found that GPX2 was significantly reduced in NRF2 knockout cells. GPX2 is a glutathione peroxidase, playing a crucial role in maintaining cellular redox balance by regulating the levels of reactive oxygen and nitrogen species. It functions within the antioxidant system, leveraging the GSH (reduced glutathione) and GSSG (oxidized glutathione) cycle to protect cells against oxidative damage[50]. The antioxidant function of GPX2 is evident not only by its enzymatic activity but also by its upregulation in response to oxidative stress. A prominent pathway for the induction of GPX2 expression involves the p62/KEAP1/ NRF2 complex[51]. Kleeburger’s group further identified potential NRF2 activation sites within the GPX2 gene, suggesting a direct regulatory mechanism by NRF2 on GPX2 expression[52]. An increasing number of studies indicate that GPX2 is also involved in the development of cancers[27,28]. Many studies have shown that high level of GPX2 promotes tumor growth, metastasis, and drug resistance, while reducing its expression helps inhibit tumor development[27,53]. When we depletion of GPX2 in HNSCC, the growth of tumor cells was significantly inhibited, while the proportion of apoptotic cells substantially increased. Indeed, GPX2 was demonstrated to play contrasting roles across various cancers. Loss of GPX2 reduces oxidative phosphorylation (OXPHOS) and enhances aerobic glycolysis to promote malignant progression in breast cancer[23]. This controversial function of GPX2 could be attributed to tissue-specific factors. We observed increased apoptosis caused by the absence of GPX2 in HNSCC. Considering a susceptibility of stem cells to apoptotic stimuli[42,54], the emerging evidence following GPX2 depletion prompts us to test whether GPX2 promotes tumor progression by affecting CSCs. By performing CD44 staining on GPX2 knockdown cells, we observed a significant reduction in the CSC population, indicating that GPX2 plays a role in the maintenance of CSCs. Aberrant activation of pathways regulating stem cell self-renewal, such as Notch, Hedgehog (HH), and Wnt, are also pivotal in the tumorigenic potential of CSCs[44]. Dysregulation of these pathways contributes to drive tumor progression[55]. We examined all three signaling pathways and found that Notch signaling was disrupted in GPX2 depletion HNSCC cells, especially NOTCH3. The NOTCH signaling has been reported to associate with CSCs[56]. NOTCH1 and NOTCH2 facilitates cancer metastasis and contributing to a poor prognosis[57–59]. NOTCH3 promotes tumor development in various cancers, although it has been shown to inhibit tumor growth in breast cancer through the activation of PTEN and subsequent inhibition of the AKT-mTOR pathway[60]. Kondratyev et al. have also verified the oncogenic role of NOTCH3 in HNSCC[61]. Of note, NRF2 is a direct activator of the NOTCH3 enhancer, and the co-expression of NRF2 and NOTCH3 is associated with a poor prognosis in lung adenocarcinoma[62]. We further showed that loss of NOTCH3 dramatically reduced CSC population, subsequently preventing tumor growth and metastasis. Conclusions In conclusion, our findings illustrate that aberrant activation of NRF2 contributes to acquisition of malignant features and poor prognosis through NRF2-GPX2-NOTCH3 axis. Therefore, targeting the involvement of NRF2-GPX2-NOTCH3 axis holds potential as a therapeutic strategy for treating HNSCC characterized by NRF2 activation. Abbreviations HNSCC: Head and neck squamous cell cancer NRF2: The activation of nuclear factor erythroid 2–related factor 2 TCGA: The Cancer Genome Atlas IHC: Immunohistochemistry KEGG: Kyoto Encyclopedia of Genes and Genomes RT-qPCR: Quantitative Real-time PCR WB: Western Blot shRNA: short hairpin RNA CSC: cancer stem cell HH: Hedgehog ROS: Reactive oxygen species PVDF: Polyvinylidene fluoride DMEM: Dulbecco’s modified Eagle’s medium FBS: Fetal bovine serum CCK-8: Cell Counting Kit-8 ECL: Enhanced chemiluminescence BSA:Bovine serum albumin Declarations Ethics approval and consent to participate Human HNSCC tissues were obtained from patients who received curative surgery at Jiangxi Cancer Hospital (Jiangxi, China). The research was conducted in accordance with the applicable national ethical standards. This study was approved by the Research Ethics Committee of Jiangxi Cancer Hospital (approval number (2024ky008)). Animal experiments were approved by the Institutional Animal Care and Use Committee of Zhejiang University (approval number:20221576). Funding This study was supported by the National Natural Science Foundation of China (No. 32270863) and the National Key Research and Development Program of China (2021YFC2501800). Consent for publication The authors declare their consent for this publication. Competing interests The authors declare no competing interests. Availability of data and materials The data that support the findings of this study are available from the corresponding authors upon reasonable request. Author contributions JXY and JM conceived and supervised the study. JXY, LXY, ZC and RJ contributed to data interpretation, manuscript writing, and performed experiments. QHX, LB, SWXR, ZA and LQL contributed to the data collection and analysis. All authors read and approved the final manuscript. Corresponding authors Correspondence to Ming Jiang. Authors and Affiliations Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China. Institute of Genetics, Zhejiang University International School of Medicine, Hangzhou, Zhejiang, China. Zhejiang Provincial Key Laboratory of Genetic & Developmental Disorders, Hangzhou, Zhejiang, China. Xiaoye Jin, Xiayuan Lou, Chao Zheng, Bo Li, Xuerong Siwu, Ming Jiang School of Pharmacy and Department of Hepatology, the Affiliated Hospital of Hangzhou Normal University, Hangzhou Normal University, Hangzhou, China. Key Laboratory of Elemene Class Anti-Cancer Chinese Medicines; Engineering Laboratory of Development and Application of Traditional Chinese Medicines; Collaborative Innovation Center of Traditional Chinese Medicines of Zhejiang Province, School of Pharmacy, Hangzhou Normal University, Hangzhou , China. Haoxiang Qi Department of Medical Oncology, The First Affiliated Hospital, School of Medicine, Zhejiang University and Key Laboratory of Cancer Prevention and Intervention, Ministry of Education, Hangzhou, China. Jian Ruan Institute of Cancer Research, Zhejiang Cancer Hospital, Hangzhou, China. An Zhao Institute of Cancer Research, Jiangxi Cancer Hospital, Nanchang, China. Qiaoli Lv References Johnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers. 2020;6:1–22. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209–49. Li Q, Tie Y, Alu A, Ma X, Shi H. Targeted therapy for head and neck cancer: signaling pathways and clinical studies. Sig Transduct Target Ther. 2023;8:1–28. Zhou G, Liu Z, Myers JN. TP53 Mutations in Head and Neck Squamous Cell Carcinoma and Their Impact on Disease Progression and Treatment Response. Journal of Cellular Biochemistry. 2016;117:2682–92. Chung CH, Ely K, McGavran L, Varella-Garcia M, Parker J, Parker N, et al. Increased epidermal growth factor receptor gene copy number is associated with poor prognosis in head and neck squamous cell carcinomas. J Clin Oncol. 2006;24:4170–6. Iglesias-Bartolome R, Martin D, Gutkind JS. Exploiting the Head and Neck Cancer Oncogenome: Widespread PI3K-mTOR Pathway Alterations and Novel Molecular Targets. Cancer Discovery. 2013;3:722–5. Leemans CR, Braakhuis BJM, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer. 2011;11:9–22. Furukawa M, Xiong Y. BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol. 2005;25:162–71. Kansanen E, Kuosmanen SM, Leinonen H, Levonen A-L. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox Biol. 2013;1:45–9. Ramos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, Talalay P, et al. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient mice. Proc Natl Acad Sci U S A. 2001;98:3410–5. Ramos-Gomez M, Dolan PM, Itoh K, Yamamoto M, Kensler TW. Interactive effects of nrf2 genotype and oltipraz on benzo[a]pyrene-DNA adducts and tumor yield in mice. Carcinogenesis. 2003;24:461–7. Chio IIC, Jafarnejad SM, Ponz-Sarvise M, Park Y, Rivera K, Palm W, et al. NRF2 Promotes Tumor Maintenance by Modulating mRNA Translation in Pancreatic Cancer. Cell. 2016;166:963–76. Lignitto L, LeBoeuf SE, Homer H, Jiang S, Askenazi M, Karakousi TR, et al. Nrf2 Activation Promotes Lung Cancer Metastasis by Inhibiting the Degradation of Bach1. Cell. 2019;178:316-329.e18. Fox DB, Garcia NMG, McKinney BJ, Lupo R, Noteware LC, Newcomb R, et al. NRF2 activation promotes the recurrence of dormant tumour cells through regulation of redox and nucleotide metabolism. Nat Metab. 2020;2:318–34. Taniguchi S, Elhance A, Van Duzer A, Kumar S, Leitenberger JJ, Oshimori N. Tumor-initiating cells establish an IL-33–TGF-β niche signaling loop to promote cancer progression. Science. 2020;369:eaay1813. Feng L, Zhao K, Sun L, Yin X, Zhang J, Liu C, et al. SLC7A11 regulated by NRF2 modulates esophageal squamous cell carcinoma radiosensitivity by inhibiting ferroptosis. Journal of Translational Medicine. 2021;19:367. Singh A, Daemen A, Nickles D, Jeon S-M, Foreman O, Sudini K, et al. NRF2 Activation Promotes Aggressive Lung Cancer and Associates with Poor Clinical Outcomes. Clin Cancer Res. 2021;27:877–88. Forstrom JW, Zakowski JJ, Tappel AL. Identification of the catalytic site of rat liver glutathione peroxidase as selenocysteine. Biochemistry. 1978;17:2639–44. Schwarz M, Löser A, Cheng Q, Wichmann-Costaganna M, Schädel P, Werz O, et al. Side-by-side comparison of recombinant human glutathione peroxidases identifies overlapping substrate specificities for soluble hydroperoxides. Redox Biol. 2023;59:102593. Esworthy RS, Doroshow JH, Chu F-F. The beginning of GPX2 and 30 years later. Free Radical Biology and Medicine. 2022;188:419–33. Lee E, Choi A, Jun Y, Kim N, Yook JI, Kim SY, et al. Glutathione peroxidase-1 regulates adhesion and metastasis of triple-negative breast cancer cells via FAK signaling. Redox Biology. 2020;29:101391. Cheng L, He Q, Liu B, Chen L, Lv F, Li X, et al. SGK2 promotes prostate cancer metastasis by inhibiting ferroptosis via up-regulating GPX4. Cell Death and Disease. 2023;14:1–14. Ren Z, Liang H, Galbo PM, Dharmaratne M, Kulkarni AS, Fard AT, et al. Redox signaling by glutathione peroxidase 2 links vascular modulation to metabolic plasticity of breast cancer. Proc Natl Acad Sci U S A. 2022;119:e2107266119. Ding Y, Chen X, Liu C, Ge W, Wang Q, Hao X, et al. Identification of a small molecule as inducer of ferroptosis and apoptosis through ubiquitination of GPX4 in triple negative breast cancer cells. J Hematol Oncol. 2021;14:19. Peng D, Hu T, Soutto M, Belkhiri A, Zaika A, El-Rifai W. Glutathione peroxidase 7 has potential tumour suppressor functions that are silenced by location-specific methylation in oesophageal adenocarcinoma. Gut. 2014;63:540–51. Nguyen TTM, Nguyen TH, Kim HS, Dao TTP, Moon Y, Seo M, et al. GPX8 regulates clear cell renal cell carcinoma tumorigenesis through promoting lipogenesis by NNMT. J Exp Clin Cancer Res. 2023;42:42. Yang M, Zhu X, Shen Y, He Q, Qin Y, Shao Y, et al. GPX2 predicts recurrence-free survival and triggers the Wnt/β-catenin/EMT pathway in prostate cancer. PeerJ. 2022;10:e14263. Lei Z, Tian D, Zhang C, Zhao S, Su M. Clinicopathological and prognostic significance of GPX2 protein expression in esophageal squamous cell carcinoma. BMC Cancer. 2016;16:410. Ahmed KM, Veeramachaneni R, Deng D, Putluri N, Putluri V, Cardenas MF, et al. Glutathione peroxidase 2 is a metabolic driver of the tumor immune microenvironment and immune checkpoint inhibitor response. J Immunother Cancer. 2022;10:e004752. Bialk P, Wang Y, Banas K, Kmiec EB. Functional Gene Knockout of NRF2 Increases Chemosensitivity of Human Lung Cancer A549 Cells In Vitro and in a Xenograft Mouse Model. Mol Ther Oncolytics. 2018;11:75–89. Cancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature. 2015;517:576–82. Torrente L, DeNicola GM. Targeting NRF2 and Its Downstream Processes: Opportunities and Challenges. Annu Rev Pharmacol Toxicol. 2022;62:279–300. Tang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019;47:W556–60. Kensler TW, Wakabayashi N, Biswal S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol. 2007;47:89–116. Iida K, Itoh K, Kumagai Y, Oyasu R, Hattori K, Kawai K, et al. Nrf2 is essential for the chemopreventive efficacy of oltipraz against urinary bladder carcinogenesis. Cancer Research. 2004;64:6424–31. Kim T-H, Hur E, Kang S-J, Kim J-A, Thapa D, Lee YM, et al. NRF2 blockade suppresses colon tumor angiogenesis by inhibiting hypoxia-induced activation of HIF-1α. Cancer Res. 2011;71:2260–75. Pillai R, Hayashi M, Zavitsanou A-M, Papagiannakopoulos T. NRF2: KEAPing Tumors Protected. Cancer Discov. 2022;12:625–43. Ge W, Zhao K, Wang X, Li H, Yu M, He M, et al. iASPP Is an Antioxidative Factor and Drives Cancer Growth and Drug Resistance by Competing with Nrf2 for Keap1 Binding. Cancer Cell. 2017;32:561-573.e6. Zhou Y, Chen Y, Shi Y, Wu L, Tan Y, Li T, et al. FAM117B promotes gastric cancer growth and drug resistance by targeting the KEAP1/NRF2 signaling pathway. J Clin Invest [Internet]. 2023 [cited 2024 Jan 22];133. Available from: https://www.jci.org/articles/view/158705 Tan W, Zhang K, Chen X, Yang L, Zhu S, Wei Y, et al. GPX2 is a potential therapeutic target to induce cell apoptosis in lenvatinib against hepatocellular carcinoma. Journal of Advanced Research [Internet]. 2022 [cited 2022 May 9]; Available from: https://www.sciencedirect.com/science/article/pii/S2090123222000741 Lu X, Liu R, Liao Y, Cui L, Sun H, Zhang D, et al. ACVRL1 drives resistance to multitarget tyrosine kinase inhibitors in colorectal cancer by promoting USP15-mediated GPX2 stabilization. BMC Med. 2023;21:366. Dannenmann B, Lehle S, Hildebrand DG, Kübler A, Grondona P, Schmid V, et al. High glutathione and glutathione peroxidase-2 levels mediate cell-type-specific DNA damage protection in human induced pluripotent stem cells. Stem Cell Reports. 2015;4:886–98. Ludwig N, Szczepanski MJ, Gluszko A, Szafarowski T, Azambuja JH, Dolg L, et al. CD44(+) tumor cells promote early angiogenesis in head and neck squamous cell carcinoma. Cancer Letters. 2019;467:85–95. Lu J, Ye X, Fan F, Xia L, Bhattacharya R, Bellister S, et al. Endothelial Cells Promote the Colorectal Cancer Stem Cell Phenotype Through a Soluble Form of Jagged-1. Cancer Cell. 2013;23:171–85. Cui Y, Chen H, Xi R, Cui H, Zhao Y, Xu E, et al. Whole-genome sequencing of 508 patients identifies key molecular features associated with poor prognosis in esophageal squamous cell carcinoma. Cell Res. 2020;30:902–13. Cancer Genome Atlas Research Network. Comprehensive genomic characterization of squamous cell lung cancers. Nature. 2012;489:519–25. Chang D, Shain AH. The landscape of driver mutations in cutaneous squamous cell carcinoma. npj Genom Med. 2021;6:1–10. Kerins MJ, Ooi A. A catalogue of somatic NRF2 gain-of-function mutations in cancer. Sci Rep. 2018;8:12846. Hayes JD, Dinkova-Kostova AT. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem Sci. 2014;39:199–218. Panday S, Talreja R, Kavdia M. The role of glutathione and glutathione peroxidase in regulating cellular level of reactive oxygen and nitrogen species. Microvasc Res. 2020;131:104010. Banning A, Deubel S, Kluth D, Zhou Z, Brigelius-Flohé R. The GI-GPx gene is a target for Nrf2. Mol Cell Biol. 2005;25:4914–23. Cho H-Y, van Houten B, Wang X, Miller-DeGraff L, Fostel J, Gladwell W, et al. Targeted deletion of nrf2 impairs lung development and oxidant injury in neonatal mice. Antioxid Redox Signal. 2012;17:1066–82. Xu H, Hu C, Wang Y, Shi Y, Yuan L, Xu J, et al. Glutathione peroxidase 2 knockdown suppresses gastric cancer progression and metastasis via regulation of kynurenine metabolism. Oncogene. 2023; Huang T, Song X, Xu D, Tiek D, Goenka A, Wu B, et al. Stem cell programs in cancer initiation, progression, and therapy resistance. Theranostics. 2020;10:8721–43. Manni W, Min W. Signaling pathways in the regulation of cancer stem cells and associated targeted therapy. MedComm (2020). 2022;3:e176. Fendler A, Bauer D, Busch J, Jung K, Wulf-Goldenberg A, Kunz S, et al. Inhibiting WNT and NOTCH in renal cancer stem cells and the implications for human patients. Nat Commun. 2020;11:929. Liu L, Tao T, Liu S, Yang X, Chen X, Liang J, et al. An RFC4/Notch1 signaling feedback loop promotes NSCLC metastasis and stemness. Nat Commun. 2021;12:2693. Jackstadt R, van Hooff SR, Leach JD, Cortes-Lavaud X, Lohuis JO, Ridgway RA, et al. Epithelial NOTCH Signaling Rewires the Tumor Microenvironment of Colorectal Cancer to Drive Poor-Prognosis Subtypes and Metastasis. Cancer Cell. 2019;36:319-336.e7. Wang F, Zhang J, Tang H, Pang Y, Ke X, Peng W, et al. Nup54-induced CARM1 nuclear importation promotes gastric cancer cell proliferation and tumorigenesis through transcriptional activation and methylation of Notch2. Oncogene. 2022;41:246–59. Zhang Y-Q, Liang Y-K, Wu Y, Chen M, Chen W-L, Li R-H, et al. Notch3 inhibits cell proliferation and tumorigenesis and predicts better prognosis in breast cancer through transactivating PTEN. Cell Death Dis. 2021;12:1–16. Kondratyev M, Pesic A, Ketela T, Stickle N, Beswick C, Shalev Z, et al. Identification of acquired Notch3 dependency in metastatic Head and Neck Cancer. Commun Biol. 2023;6:538. Okazaki K, Anzawa H, Liu Z, Ota N, Kitamura H, Onodera Y, et al. Enhancer remodeling promotes tumor-initiating activity in NRF2-activated non-small cell lung cancers. Nat Commun. 2020;11:5911. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFile.docx WBRAWDATA.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4132275","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":283811919,"identity":"83af8549-cd10-41f8-a8ab-473951fb82f8","order_by":0,"name":"Xiaoye Jin","email":"","orcid":"","institution":"Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoye","middleName":"","lastName":"Jin","suffix":""},{"id":283811920,"identity":"55ff47b6-011f-4317-b498-202f96eb2a53","order_by":1,"name":"Xiayuan Lou","email":"","orcid":"","institution":"Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiayuan","middleName":"","lastName":"Lou","suffix":""},{"id":283811921,"identity":"614c9bf7-45fd-480d-8d1c-d6f226d4c10e","order_by":2,"name":"Haoxiang Qi","email":"","orcid":"","institution":"School of Pharmacy and Department of Hepatology, the Affiliated Hospital of Hangzhou Normal University, Hangzhou Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haoxiang","middleName":"","lastName":"Qi","suffix":""},{"id":283811922,"identity":"d0b8ef75-a5bd-4a22-bf7e-f629d17e8ef7","order_by":3,"name":"Chao Zheng","email":"","orcid":"","institution":"Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Zheng","suffix":""},{"id":283811923,"identity":"374955f7-d8f1-4404-9dce-2914e99af7aa","order_by":4,"name":"Bo Li","email":"","orcid":"","institution":"Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Li","suffix":""},{"id":283811926,"identity":"331f3723-ac25-475f-8c1e-15687f22a9ab","order_by":5,"name":"Xuerong Siwu","email":"","orcid":"","institution":"Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuerong","middleName":"","lastName":"Siwu","suffix":""},{"id":283811928,"identity":"097a8f90-2cd0-4b3e-8bea-096994af2715","order_by":6,"name":"Qiaoli Lv","email":"","orcid":"","institution":"Institute of Cancer Research, Jiangxi Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiaoli","middleName":"","lastName":"Lv","suffix":""},{"id":283811930,"identity":"743242a0-0851-46bf-a854-e80263bcf52b","order_by":7,"name":"An Zhao","email":"","orcid":"","institution":"Institute of Cancer Research, Zhejiang Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"An","middleName":"","lastName":"Zhao","suffix":""},{"id":283811933,"identity":"1a29e58f-7def-4e08-b5a1-6e38a62a99b9","order_by":8,"name":"Jian Ruan","email":"","orcid":"","institution":"Department of Medical Oncology, The First Affiliated Hospital, School of Medicine, Zhejiang University and Key Laboratory of Cancer Prevention and Intervention, Ministry of Education","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Ruan","suffix":""},{"id":283811935,"identity":"06137303-d3ad-4c29-88b2-f0e2d06c044d","order_by":9,"name":"Ming Jiang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYFCCw8d/fvxjw8DYAGTzEKflWIK0ZEMaSVp4DCR4Gw5D2cRo0G08YGAgueO8PfOMBMYHb9sY5M0JaTE7cCAhofDMbWbGGQnMhnPbGAx3NhDWcuCABNttNqAWNmneNoYEgwMEtRxsbOBhO8cD1ML+m0gth5kZeNsOSIBsYSZSyzE2ZokzyQaMPQ+bJeeckzDcQFDLjfPfGD9U2Nkbticf/PCmzEaeoC0MElAVhg3gyJQgpB4I+BsgtDwRakfBKBgFo2CEAgCtsEN/1FyPDgAAAABJRU5ErkJggg==","orcid":"","institution":"Center for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Jiang","suffix":""}],"badges":[],"createdAt":"2024-03-19 17:59:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4132275/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4132275/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53750440,"identity":"61a4a982-1102-4cb6-be1c-f926a93b52c6","added_by":"auto","created_at":"2024-03-29 18:39:54","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":834354,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNRF2 is correlated with poor prognosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Oncoplot depicting the frequency of mutated genes \u003cem\u003eKEAP1\u003c/em\u003e,\u003cem\u003e NRF2 \u003c/em\u003eand \u003cem\u003eCUL3\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e(B) Lollipop plots of \u003cem\u003eNRF2\u003c/em\u003e gene somatic alterations in TCGA-HNSCC cohort.\u003c/p\u003e\n\u003cp\u003e(C) Differential analysis comparing the differences of \u003cem\u003eNRF2\u003c/em\u003e target genes mRNA levels in \u003cem\u003eNRF2\u003c/em\u003e-Mutation and \u003cem\u003eNRF2\u003c/em\u003e-WT samples from the TCGA-HNSCC cohort (n=546). Mean±SD, ***P \u0026lt; 0.001, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(D) Kaplan–Meier survival analysis showed that patients with high \u003cem\u003eNRF2\u003c/em\u003e-targeted genes suffered from inferior survival outcomes relative to those with low \u003cem\u003eNRF2\u003c/em\u003e-targeted genes levels in the TCGA-HNSCC cohort(n=518).\u003c/p\u003e\n\u003cp\u003e(E) Representative IHC staining indicated Expression of NRF2 correlated with Ki67 and NQO1 in HNSCC patients. Scale bar = 100μm.\u003c/p\u003e\n\u003cp\u003eAbbreviations: FPKM, Fragments Per Kilobase of exon model per Million mapped fragments.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/d05135e7125f37828f4b1e43.jpg"},{"id":53750458,"identity":"a5c177f7-b725-4ce4-b72b-cc07e371ecf6","added_by":"auto","created_at":"2024-03-29 18:39:54","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":977389,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNRF2 promotes tumor growth \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) RT-qPCR analysis of indicated \u003cem\u003eNFR2\u003c/em\u003e, \u003cem\u003eNQO1\u003c/em\u003e, \u003cem\u003eGCLC\u003c/em\u003e in \u003cem\u003eNRF2\u003c/em\u003e-WT and\u003cem\u003e NRF2\u003c/em\u003e-KO FADU cells. Mean±SD, n = 3. **P \u0026lt; 0.01.\u003c/p\u003e\n\u003cp\u003e(B) Western blotting assay showing the protein levels of NRF2, GCLC, and NQO1 in \u003cem\u003eNRF2\u003c/em\u003e-WT and\u003cem\u003e NRF2\u003c/em\u003e-KO FADU cells.\u003c/p\u003e\n\u003cp\u003e(C) Knockout of \u003cem\u003eNRF2\u003c/em\u003e reduced cell proliferation of FADU cells as evaluated by CCK-8 assay. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(D) Knockout of \u003cem\u003eNRF2\u003c/em\u003e impaired colony formation of FADU cells and the quantification of cell colony formation assay results was shown. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(E) Knockout of \u003cem\u003eNRF2\u003c/em\u003e impaired cell sphere-formation ability in FADU cells and the quantification of sphere-formation assay results was shown. Scale bar =100μm. Mean±SD, n \u0026gt; 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(F) Knockout of \u003cem\u003eNRF2\u003c/em\u003e significantly decreased migration and invasion of FADU cells by transwell assay and the quantification of cell migration and invasion results were shown. Scale bar =200 μm. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(G) ROS level was up-regulated by knocking out \u003cem\u003eNRF2\u003c/em\u003emeasured by flow cytometry in FADU cells and the quantification of Fluorescence intensity results was shown. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(H)Apoptosis was assessed by the Annexin V-mCherry staining analysis of\u003cem\u003e NRF2\u003c/em\u003e-WT and\u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells and Fluorescence intensity results was shown. Mean±SD, n = 3, ***P \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e(I) Knockout of \u003cem\u003eNRF2\u003c/em\u003e significantly suppressed tumor growth in subcutaneous nude mice (n =5 for each group). Images, tumor size and tumor weight are shown. Mean±SD, **P \u0026lt; 0.01.\u003c/p\u003e\n\u003cp\u003e(J) Representative graphs showing the indicated sections of tumors that were stained with anti-Ki67, anti-NRF2 antibodies by IHC and the quantification of Ki67 positive stained cells in tumors was shown. Scale bar = 100 μm. Mean±SD, *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/74a168c5610f350ccc82bbb9.jpg"},{"id":53750448,"identity":"853d954a-6594-4cbf-9dd5-bb0431e11d70","added_by":"auto","created_at":"2024-03-29 18:39:54","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":764210,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX2is a potential downstream target of NRF2 signaling.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) 707 genes upregulation and 349 genes downregulation in \u003cem\u003eNRF2\u003c/em\u003e-WT and \u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells by RNA-Seq.\u003c/p\u003e\n\u003cp\u003e(B) Gene categories significantly (P ≤ 0.05) enriched for genes changed in KEGG pathways, owing to knockout of \u003cem\u003eNRF2\u003c/em\u003ein FADU cells.\u003c/p\u003e\n\u003cp\u003e(C) Heatmap indicating the altered \u003cem\u003eNRF2\u003c/em\u003e mRNA levels in FADU cells treated with knockout that target various metabolism genes, which were normalized by the data in the \u003cem\u003eNRF2\u003c/em\u003e-WT.\u003c/p\u003e\n\u003cp\u003e(D) The volcano plot showing the DEGs in \u003cem\u003eNRF2\u003c/em\u003e-WT and \u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells according to the heatmap(C). Blue, downregulated genes; Red, up-regulated genes upon \u003cem\u003eNRF2\u003c/em\u003eloss.\u003c/p\u003e\n\u003cp\u003e(E) Western blotting assay showing the protein levels of NRF2, GCLC, NQO1, GPX2 in \u003cem\u003eNRF2\u003c/em\u003e-WT and \u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells.\u003c/p\u003e\n\u003cp\u003e(F) Pearson correlation analysis of \u003cem\u003eNRF2\u003c/em\u003e mRNA level with \u003cem\u003eGPX2\u003c/em\u003e mRNA level.\u003c/p\u003e\n\u003cp\u003e(G) Differential analysis comparing the differences of \u003cem\u003eNRF2\u003c/em\u003e mRNA levels in \u003cem\u003eNRF2\u003c/em\u003e-Mutation and \u003cem\u003eNRF2\u003c/em\u003e-WT samples from the TCGA-HNSCC cohort (n=546). Mean±SD,****P＜0.0001.\u003c/p\u003e\n\u003cp\u003e(H) Kaplan–Meier survival analysis showed that patients with high \u003cem\u003eGPX2\u003c/em\u003e suffered from inferior survival outcomes relative to those with low \u003cem\u003eGPX2\u003c/em\u003e levels in the TCGA-HNSCC cohort(n=518).\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/fcda183dd98729e46ab991a6.jpg"},{"id":53750476,"identity":"4d219328-f0de-43d8-9728-8849df2a2a6b","added_by":"auto","created_at":"2024-03-29 18:39:54","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":980668,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX2 promotes tumor growth\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The efficiency of \u003cem\u003eGPX2\u003c/em\u003e knockdown was verified in FADU cell line by real-time PCR. Mean±SD, n = 3, ***P \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e(B) Western blotting assay showing the protein levels of GPX2 in \u003cem\u003eGPX2\u003c/em\u003e-shNC and \u003cem\u003eGPX2\u003c/em\u003e-KD FADU cells.\u003c/p\u003e\n\u003cp\u003e(C) Knockout of \u003cem\u003eGPX2\u003c/em\u003e reduced cell proliferation of FADU cells as evaluated by CCK-8 assay. Mean±SD, n = 3,*P＜0.05,****P \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e(D) Knockout of \u003cem\u003eGPX2\u003c/em\u003e impaired colony formation of FADU cells and the quantification of cell colony formation assay results was shown. Mean±SD, n = 3, **P \u0026lt; 0.01.\u003c/p\u003e\n\u003cp\u003e(E) Knockout of \u003cem\u003eGPX2\u003c/em\u003e impaired cell sphere-formation ability in FADU cells and the quantification of sphere-formation assay results was shown. Scale bar =100μm. Mean±SD, n \u0026gt; 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(F) Knockout of \u003cem\u003eGPX2\u003c/em\u003e significantly decreased migration and invasion of FADU cells by transwell assay and the quantification of cell migration and invasion results were shown. Scale bar =200 μm. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(G) ROS level was up-regulated by knocking out \u003cem\u003eGPX2\u003c/em\u003emeasured by flow cytometry in FADU cells and the quantification of Fluorescence intensity results was shown. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(H)Apoptosis was assessed by the Annexin V-mCherry staining analysis of \u003cem\u003eGPX2\u003c/em\u003e-shNC and \u003cem\u003eGPX2\u003c/em\u003e-KD FADU cells and Fluorescence intensity results was shown. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(I) Knockout of \u003cem\u003eGPX2\u003c/em\u003e significantly suppressed tumor growth in subcutaneous nude mice (n =5 for each group). Images, tumor size and tumor weight are shown. Mean±SD, **P \u0026lt; 0.01, ***\u0026lt;0.001.\u003c/p\u003e\n\u003cp\u003e(J) Representative graphs showing the indicated sections of tumors that were stained with anti-Ki67, anti-NRF2 antibodies by IHC and the quantification of Ki67 positive stained cells in tumors was shown. Scale bar = 100 μm. Mean±SD, **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/0e4120a6859412d71ece1c6a.jpg"},{"id":53751777,"identity":"21fd3418-d2d2-4d8e-9b0c-489a66ed5f72","added_by":"auto","created_at":"2024-03-29 18:47:55","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":724300,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGPX2 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eexpression correlates with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eNOTCH3 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eexpression level in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)CD44 as a stem cell marker was labeled in \u003cem\u003eNRF2\u003c/em\u003e-WT and \u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells by FACs and the quantification of cells labeled with CD44 result was shown. Mean±SD, n = 3, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003e(B)CD44 as a stem cell marker was labeled in \u003cem\u003eGPX2\u003c/em\u003e-shNC and \u003cem\u003eGPX2\u003c/em\u003e-KD FADU cells by FACs and the quantification of cells labeled with CD44 result was shown. Mean±SD, n = 3, ***P\u0026lt;0.001, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003e(C) \u003cem\u003eNOTCH3\u003c/em\u003e expression is significantly reduced in \u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells by RNA-Seq and RT-qPCR analysis of indicated NOTCH 4 paralogs\u003cem\u003e \u003c/em\u003emRNAs in \u003cem\u003eGPX2\u003c/em\u003e-shNC and \u003cem\u003eGPX2\u003c/em\u003e-KD FADU cells. Mean±SD, n = 3,**P \u0026lt; 0.01,***P \u0026lt; 0.001, ****P＜0.0001.\u003c/p\u003e\n\u003cp\u003e(D) Western blotting assay showing the protein levels of NOTCH3 in \u003cem\u003eNRF2\u003c/em\u003e-WT and \u003cem\u003eNRF2\u003c/em\u003e-KO FADU cells and \u003cem\u003eGPX2\u003c/em\u003e-shNC and \u003cem\u003eGPX2\u003c/em\u003e-KD FADU cells. “*” is an unspecific band.\u003c/p\u003e\n\u003cp\u003e(E) Differential analysis comparing the differences of NOTCH 4 paralogs mRNA levels in \u003cem\u003eGPX2\u003c/em\u003e-HIGH and \u003cem\u003eGPX2\u003c/em\u003e-LOW samples from the TCGA-HNSCC cohort (n=546). Mean±SD, *P \u0026lt; 0.05, ****P \u0026lt; 0.0001, ns, no significant.\u003c/p\u003e\n\u003cp\u003e(F) Pearson correlation analysis of \u003cem\u003eGPX2\u003c/em\u003e mRNA level with \u003cem\u003eNOTCH3\u003c/em\u003e mRNA level.\u003c/p\u003e\n\u003cp\u003e(G) Kaplan–Meier survival analysis showed that patients with high \u003cem\u003eNOTCH3 \u003c/em\u003esuffered from inferior survival outcomes relative to those with low \u003cem\u003eNOTCH3\u003c/em\u003e levels in the TCGA-HNSCC cohort(n=518).\u003c/p\u003e\n\u003cp\u003eAbbreviations: FPKM, Fragments Per Kilobase of exon model per Million mapped fragments.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/74b2187b84fb391b2d6680fc.jpg"},{"id":53750480,"identity":"685cb5dc-c949-4f5d-a798-7eda9ad4419b","added_by":"auto","created_at":"2024-03-29 18:39:55","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":985763,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eNOTCH3\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e regulated by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eGPX2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and promotes tumor growth \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)Efficiency of \u003cem\u003eNOTCH3\u003c/em\u003e knockdown was verified in FADU cell line by real-time PCR. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(B) Western blotting assay showing the protein levels of NOTCH3 in \u003cem\u003eNOTCH3\u003c/em\u003e-shNC and \u003cem\u003eNOTCH3\u003c/em\u003e-KD FADU cells. “*” is an unspecific band.\u003c/p\u003e\n\u003cp\u003e(C) Knockout of \u003cem\u003eNOTCH3\u003c/em\u003e reduced cell proliferation of FADU cells as evaluated by CCK-8 assay. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(D) Knockout of \u003cem\u003eNOTCH3\u003c/em\u003e impaired colony formation of FADU cells and the quantification of cell colony formation assay results was shown. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(E) Knockout of \u003cem\u003eNOTCH3\u003c/em\u003e impaired cell sphere-formation ability in FADU cells and the quantification of sphere-formation assay results was shown. Scale bar =100μm. Mean±SD, n \u0026gt; 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(F) Knockout of \u003cem\u003eNOTCH3 \u003c/em\u003esignificantly decreased migration and invasion of FADU cells by transwell assay and the quantification of cell migration and invasion results were shown(G). Scale bar =200 μm. Mean±SD, n = 3, ****P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(H) ROS level was up-regulated by knocking out \u003cem\u003eNOTCH3\u003c/em\u003emeasured by flow cytometry in FADU cells and the quantification of Fluorescence intensity results was shown. Mean±SD, n = 3, ***P \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e(I)Apoptosis was assessed by the Annexin V-mCherry staining analysis of\u003cem\u003e NOTCH3\u003c/em\u003e-shNC and \u003cem\u003eNOTCH3\u003c/em\u003e-KD FADU cells and Fluorescence intensity results was shown. Mean±SD, n = 3, **P \u0026lt; 0.01, ***P \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e(J) Knockout of \u003cem\u003eNOTCH3\u003c/em\u003e significantly suppressed tumor growth in subcutaneous nude mice (n =5 for each group). Images, tumor size and tumor weight are shown. Mean±SD, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003e(K) Representative IHC staining indicated GPX2 expressed highly correlated with high NOTCH3 in human HNSCC specimen. Scale bar = 100μm.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/092974d870a310dfce38b62c.jpg"},{"id":53973628,"identity":"d6060d04-1f4f-497e-93e0-291f3eb506ce","added_by":"auto","created_at":"2024-04-02 22:37:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1593667,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/fab23736-bcce-42e5-a5fa-a34896ecd183.pdf"},{"id":53750481,"identity":"c7b651c9-d6a1-4ba2-931f-e2a78673bd94","added_by":"auto","created_at":"2024-03-29 18:39:55","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4562558,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile.docx","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/56044575d6e99bc03aa85044.docx"},{"id":53750477,"identity":"10fab8b0-eb49-4dec-8708-084d6b68a717","added_by":"auto","created_at":"2024-03-29 18:39:55","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1479586,"visible":true,"origin":"","legend":"","description":"","filename":"WBRAWDATA.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4132275/v1/5f93f022545aa6bc2025cbe3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"NRF2 signaling plays an essential role in cancer progression through the NRF2-GPX2-NOTCH3 axis in head and neck squamous cell carcinoma","fulltext":[{"header":"Background","content":"\u003cp\u003eHead and neck squamous cell carcinom (HNSCC) represents a diverse group of cancers arising from the squamous cells lining the mucosal surfaces of the head and neck region, including the oral cavity, oropharynx, larynx, and hypopharynx[1]. HNSCC is one of the most common cancers worldwide, accounting for over 870,000 cases per year[2]. Tobacco use, alcohol consumption, and human papillomavirus (HPV) infection are the primary etiological factors[3]. Genetic alterations are common in HNSCC including growth factor receptors (e.g., EGFR), tumor suppressor genes (e.g., TP53) and signaling pathways (e.g., PI3K), etc[4\u0026ndash;6]. Despite advances in surgical techniques, radiation therapy, and chemotherapy, the overall survival rates for HNSCC have only modestly improved over the past few decades. The development of resistance to therapy, the presence of distant metastases at diagnosis, and the significant morbidity associated with treatment highlight the need for innovative therapeutic strategies. Recent advancements in immunotherapy and targeted therapies offer new hope for improving outcomes in HNSCC patients. However, the cure rate for advanced HNSCC patients remains poor and only 40\u0026ndash;50% of patients survive for 5 years[7].\u003c/p\u003e \u003cp\u003eNRF2 signaling is pivotal in maintaining cellular redox homeostasis and defending against oxidative stress. NRF2 operates as a master regulator, controlling the expression of various genes involved in antioxidant response and detoxification processes to maintain cellular redox homeostasis. The regulation of NRF2 expression is intricately controlled through its interaction with KEAP1 to form a CUL3-based E3 ubiquitin ligase complex. This KEAP1-mediated ubiquitination and subsequent proteasomal degradation of NRF2 ensures that NRF2 levels remain low under unstressed conditions[8,9]. Upon oxidative stress, modifications in KEAP1 lead to the stabilization and nuclear translocation of NRF2, where it binds to antioxidant response elements (ARE) in the DNA to activate the transcription of its target genes. Multiple studies have shown that NRF2 plays a paradoxical role in cancer development. Activation of NRF2 in normal cells promotes antioxidant defenses and detoxification, protecting against DNA damage and mutagenesis, thus acting as a tumor suppressor by eliminating potential cancer initiation[10,11]. However, the constitutive activation of NRF2 in cancer cells enhances cancer cell proliferation, metabolic reprogramming, and resistance to chemotherapy and radiotherapy, thus promoting tumor progression and metastasis[12\u0026ndash;16]. Clinical evidence also indicates that elevated expression of NRF2 is significantly associated with poor prognosis[16,17]. This duality highlights the complexity of NRF2 signaling in the cancer milieu.\u003c/p\u003e \u003cp\u003eGlutathione peroxidases (GPXs) are selenium-containing enzymes crucial in the defense of oxidative stress by reducing peroxides with the oxidization of glutathione (GSH) to glutathione disulfide (GSSG)[18,19]. There are eight GPX family members who have distinct cellular locations and substrate specificities, contributing to various physiological functions beyond their antioxidant roles[20]. GPX members play multifaceted roles in cancers as both tumor-suppressive and oncogenic activities depending on the context and specific family member involved[21\u0026ndash;23]. GPX4 has been identified as a critical player in conferring resistance to ferroptosis, garnering attention as a potential novel target for anticancer therapies[24]. GPX7 has been demonstrated to be downregulated and hypermethylated in gastric cancer, and its reconstitution suppresses tumor cell growth[25]. GPX8 has been implicated in the promotion of cancer cell growth[26]. Recent studies have shown that GPX2 serves as a predictive marker for recurrence-free survival in prostate cancer and promotes cancer development through the Wnt/β-catenin/EMT pathway[27]. Previous studies also indicate that the expression level of GPX2 is a prognostic factor in esophageal squamous cell carcinoma (ESCC), correlating with clinicopathological features[28]. In addition, Kazi et al. suggests that GPX2 as a targetable factor influences immune escape in cold tumors, thus affecting the response to immune checkpoint inhibitors[29].\u003c/p\u003e \u003cp\u003eIn this study, we observed that GPX2 was significantly overexpressed in patients with \u003cem\u003eNRF2\u003c/em\u003e mutations in HNSCC, contributing to accelerated tumor progression compared to patients with normal \u003cem\u003eNRF2\u003c/em\u003e. We further found that NRF2 enhances GPX2 expression, influencing the NOTCH pathway by sustaining NOTCH3 levels. Reduction of GPX2 level led to a decrease in tumor cell growth both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Moreover, increased levels of GPX2 were observed in HNSCC patients, correlating with poorer patient outcomes. This study sheds light on the critical role of the NRF2-GPX2-NOTCH3 axis in advancing HNSCC, suggesting that targeting the NRF2-GPX2-NOTCH3 axis might offer a novel strategy to enhance treatment efficacy in HNSCC.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic data collection and analysis\u003c/h2\u003e \u003cp\u003eFrom UCSC XENA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://xenabrowser.net/\u003c/span\u003e\u003cspan address=\"https://xenabrowser.net/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), transcriptome data, clinical information, and survival data of TCGA-HNSC patients were downloaded. Patients were divided into two groups based on the expression level of the corresponding genes. Volcano plot and boxplot were performed with R “ggplot2” package.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTissue samples\u003c/h2\u003e \u003cp\u003eHuman head and neck squamous cell carcinoma (HNSCC) tissues were procured from patients who underwent curative surgery at Jiangxi Cancer Hospital (Jiangxi, China). The research was carried out in compliance with relevant national ethical guidelines and was approved by the Research Ethics Committee of Jiangxi Cancer Hospital under approval number (2024ky008).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eXenograft model\u003c/h2\u003e \u003cp\u003eThe animal experiments conducted in this study were ethically approved by the Institutional Animal Care and Use Committee of Zhejiang University (approval number: 20221576). Female and male Nu/Nu nude mice, aged six weeks, sourced from Slac (Zhejiang, China), were utilized for the experiments. A total of 2 × 10 \u003csup\u003e6\u003c/sup\u003e cells were subcutaneously injected into the nude mice in a random manner. Tumor volumes were calculated using the formula: 1/2 × length × width\u003csup\u003e2\u003c/sup\u003e. The mice were humanely euthanized approximately 30–36 days post-injection, and the tumors were subsequently excised for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture\u003c/h2\u003e \u003cp\u003eFADU cell line was procured from Procell Life Science \u0026amp;Technology (Wuhan, China). Detroit 562 cell line was procured from Zhejiang Meisen Cell Technology Co., LTD (Zhejiang, China). Cell lines were maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere. Authentication of the cell lines were performed using short tandem repeat (STR) profiling.\u003c/p\u003e \u003cp\u003e \u003cb\u003eNRF2\u003c/b\u003e \u003cb\u003eknockout and\u003c/b\u003e \u003cb\u003eGPX2\u003c/b\u003e \u003cb\u003eknockdown cell generation\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eNRF2\u003c/em\u003e knockout and \u003cem\u003eGPX2\u003c/em\u003e knockdown cells were established by lentiviral infection. The sgRNA sequence of \u003cem\u003eNRF2\u003c/em\u003e as described before[30]. The target sequence for sh\u003cem\u003eNRF2\u003c/em\u003e-1 is 5′- CTTGCATTAATTCGGGATATA-3′, for sh\u003cem\u003eNRF2\u003c/em\u003e-2 is 5′- CCGGCATTTCACTAAACACAA − 3′. The target sequence for sh\u003cem\u003eGPX2\u003c/em\u003e-1 is 5′- GAAGGTAGATTTCAATACGTT-3′, for sh\u003cem\u003eGPX2\u003c/em\u003e-2 is 5′- CCTACCCTTATGATGACCCAT-3′. The target sequence for sh\u003cem\u003eNOTCH3\u003c/em\u003e-1 is 5′- GGTGATCGGCTCGGTAGTAAT-3′, for sh\u003cem\u003eNOTCH3\u003c/em\u003e-2 is 5′- CCAATGCCAACTGAAGAGGAT-3′.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eColony formation assay\u003c/h2\u003e \u003cp\u003eAn equivalent quantity of cells was cultured in a 6-well plate in DMEM supplemented with 10% FBS, and incubated for a period of 10–14 days. Subsequently, the cells were washed with PBS and fixed by 4% paraformaldehyde for 20 minutes at RT, then stained with 1% crystal violet for 10 minutes. colonies were captured quantified utilizing ImageJ.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell growth assay\u003c/h2\u003e \u003cp\u003eCell growth was assessed through the utilization of the Cell Counting Kit-8 (CCK-8) (Vazyme, A311-01, China). Specifically, cells were plated at a density of 1500 cells per well in 96-well plates. The quantification of viable cells was conducted in accordance with the manufacturer's guidelines at specified time intervals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTranswell Assay\u003c/h2\u003e \u003cp\u003eFor the migration assay, 5 × 10\u003csup\u003e4\u003c/sup\u003e cells were resuspended in 300 µL of DMEM medium and seeded in the upper transwell chamber, while for the invasion assay, 1 × 10\u003csup\u003e5\u003c/sup\u003e cells were utilized. The lower chamber contained 500 µL of DMEM supplemented with 10% FBS. Following a 48-hour incubation period, the cells were fixed in 4% paraformaldehyde at room temperature for 20 minutes, stained with 1% crystal violet for 10 minutes, subsequently imaged and quantified using ImageJ.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eFirstly, the tissues underwent fixation in 4% paraformaldehyde for 48 h, followed by dehydration using gradient alcohol. Next the tissues were embedded in paraffin and then sectioned into 5 µm slides. After deparaffinization, the slides were hydrated with gradient alcohol and xylene respectively. Then washing 3 times by PBS, the slides were further repaired with citrate buffer. Endogenous peroxidase activity was eliminated using 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, followed by blocking with 5% Bovine serum albumin (BSA). Subsequently, the slides were incubated with primary antibody (Ki67, 1:500, BD Pharmingen (610968); NRF2, 1:50, Santa Cruz (365949); GPX2, 1:1000, Gene Tex (GTX100292); NOTCH3, 1:1000, Abcam (ab23426); NQO1, 1:10000, Proteintech (67240-1-Ig)) night at 4°C, incubated with second antibody (Proteintech, Cat No. PK10006, China) at room temperature for 1 hour, and stained with DAB reagent. At last, the slides were restained with hematoxylin, dehydrated with gradient alcohol, mounted, and photographed under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cells with RNAex Pro RNA Reagent (AG, AG21101, China) and SteadyPure RNA Extraction Kit (AG, AG21024, China) following manufacturer’s instructions. Reverse transcription was performed with Evo M-MLV Premix for qPCR (AG,11706, China) with 500 ng RNA. The target cDNA was amplified by SYBR Green Pro Taq HS qPCR Kit (AG,11701, China) and Bio-Rad CFX96 to detection (Bio-Rad, USA). Gene expression was analyzed using the 2\u003csup\u003e−ΔΔCt\u003c/sup\u003e method with \u003cem\u003eACTB\u003c/em\u003e as a control. The primers are listed in Supplemental Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot\u003c/h2\u003e \u003cp\u003eCells were lysed by RIPA lysis with 1% PMSF on ice for 30 min, and then centrifuged with 12,000× g at 4°C for 30 min. The protein concentration was determined by an enhanced BCA protein assay kit (Beyotime, P0010, China). Equal amounts of protein were separated by an appropriate concentration of the SDS-PAGE gel and transferred into a polyvinylidene difluoride (PVDF) membrane with a Mini Trans-Blot Module (Bio-Rad). 5% skim milk was used to block the membrane for 1h at room temperature. The membrane was incubated with different primary antibodies(NRF2, 1:1000, Abclonal(A3577); NOTCH3, 1:1000, Abclonal(A13522); GCLC, 1:1000, Abclonal(A4499); NQO1, 1:10000, Proteintech(67240-1-Ig); GPX2, 1:1000, Abclonal(A15999); β-ACTIN, 1:5000, Bioworld(AP0060)) at 4°C overnight and incubated secondary antibodies(Goat-Anti-Mouse, 1:5000, ZENBIO (511103); Goat-Anti-Rabbit,1:5000, ZENBIO (511203))sequentially for 1h at room temperature. Target proteins were visualized using BeyoECL Plus kit (Beyotime, P0018S, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3D sphere formation\u003c/h2\u003e \u003cp\u003eThe cells were counted and cultured in 80% Matrigel mixed in DMEM with 10% FBS. Replace with fresh medium after 2–3 days. Cell was photographed in day 14.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCellular Reactive Oxygen Species (ROS) Level and Cell Apoptosis Measurement\u003c/h2\u003e \u003cp\u003eCellular reactive oxygen species (ROS) levels were quantified in viable cells using the DCFH-DA probe (Beyotime, S0033S, China). The probe was introduced into the cell culture medium at a 1:1000 ratio and incubated with the cells for 30 minutes at 37 ℃. Subsequently, the cell culture medium was removed, and the cells were washed twice with PBS. Following trypsin digestion at a concentration of 0.25%, the cells were suspended in PBS and subjected to flow cytometric analysis (ACEA NovoCyteTM, ACEA Biosciences, USA) for assessment. Cell apoptosis was evaluated using Annexin V-mCherry (Beyotime, C1069M, China) through flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data were analyzed using GraphPad Prism version 9.5 software and presented as mean ± SD. Student's t-test or two-way analysis of variance (ANOVA) was employed when comparing groups with similar differences. p \u0026lt; 0.05 was deemed to be statistically significant.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEnhanced NRF2 signaling correlates with poor survival rates in patients with HNSCC.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eThe NRF2 degradation complex is crucial in the regulation of NRF2 signaling and comprises KEAP1 and CUL3 components. To investigate the role of NRF2 components in HNSCC, we performed an extensive analysis utilizing The Cancer Genome Atlas (TCGA) database. About 12% of all cancers carried mutations in at least one of these three genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). \u003cem\u003eNRF2\u003c/em\u003e mutations are present in about 6% of HNSCC cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), consistent with previous report[31]. In addition, we analyzed the occurrence of mutations in \u003cem\u003eKEAP1\u003c/em\u003e and \u003cem\u003eCUL3\u003c/em\u003e, and identified at rates of 4% and 2%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Notably, the missense mutations of \u003cem\u003eNRF2\u003c/em\u003e in the Neh 2 domain primarily impair its capacity to bind to KEAP1, enhancing its nuclear translocation and prolonging its activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). Mutations of \u003cem\u003eKEAP1\u003c/em\u003e were found not only in the DGR (Kelch) domain, which is crucial for NRF2 interaction, but also in various structural domains, and a similar pattern is observed in \u003cem\u003eCUL3\u003c/em\u003e as well (Supplementary Fig.\u0026nbsp;1). Following stress stimuli, the activation of NRF2 promotes a broad spectrum of downstream target genes involved in various cellular processes such as iron catabolism (\u003cem\u003eFTH1\u003c/em\u003e, \u003cem\u003eFTL\u003c/em\u003e), metabolism (\u003cem\u003eG6PD\u003c/em\u003e, \u003cem\u003eTKT\u003c/em\u003e), antioxidant signaling (\u003cem\u003eTXN\u003c/em\u003e, \u003cem\u003eGCLC\u003c/em\u003e, \u003cem\u003eGCLM\u003c/em\u003e), and xenobiotic transformation (\u003cem\u003eNQO1\u003c/em\u003e), et al[32]. Increased expression of these genes was observed in patients harboring \u003cem\u003eNRF2\u003c/em\u003e mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Subsequent analysis suggested that up-regulation of NRF2 downstream genes correlated with decreased overall survival rate in patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and Supplementary Fig.\u0026nbsp;2)[33]. Notably, high expression of NRF2 markedly enhanced cell proliferation compared to cells with lower levels of NRF2, as evidenced by Ki67 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). The results indicate that missense mutations in \u003cem\u003eNRF2\u003c/em\u003e are associated with poor prognoses in patients with HNSCC.\u003c/p\u003e\u003cp\u003e \u003cb\u003eNRF2 is essential for HNSCC progression\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMultiple studies have demonstrated that the activation of NRF2 acts protectively against tumor initiation[11,34,35]. In contrast, sustained activation of \u003cem\u003eNRF2\u003c/em\u003e is associated with the progression of various cancers, substantially enhancing resistance to cancer treatments[36–38]. To elucidate the role of NRF2 in the progression of HNSCC, the \u003cem\u003eNRF2\u003c/em\u003e gene was specifically knocked out in the FADU cell line using CRISPR-Cas9 technology. This knockout was confirmed by reduced expression of NRF2 target genes, \u003cem\u003eNQO1\u003c/em\u003e and \u003cem\u003eGCLC\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and B). Deletion of \u003cem\u003eNRF2\u003c/em\u003e resulted in a notable decline in cell proliferation, demonstrated by decreased cell growth rates and colony formation capabilities (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and D). Deletion of \u003cem\u003eNRF2\u003c/em\u003e also led to a significant reduction in both the size and number of spheres formed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Furthermore, we found that deletion of \u003cem\u003eNRF2\u003c/em\u003e markedly impaired the ability of migration and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). In addition, deletion of \u003cem\u003eNRF2\u003c/em\u003e significantly increases the cellular level of ROS determined by DCFH-DA flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). There was a significant increase in apoptotic cells in \u003cem\u003eNRF2\u003c/em\u003e-deleted cells compared to control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Furthermore, following injection into Nude mice (2x10^\u003csup\u003e6\u003c/sup\u003e cells per injection), tumors initiated by \u003cem\u003eNRF2\u003c/em\u003e-deleted cells were observably smaller compared to those derived from control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). Immunohistochemistry (IHC) staining revealed that the deletion of \u003cem\u003eNRF2\u003c/em\u003e significantly reduced Ki67 staining intensity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ). Suppressing \u003cem\u003eNRF2\u003c/em\u003e by shRNA knockdown in Detroit 562 cells significantly reduced proliferation, migration, and invasion capabilities, consistent with those observed in FADU cells (Supplemental Fig.\u0026nbsp;3).\u003c/p\u003e\u003ch2\u003eGPX2 is a potential downstream target of NRF2 signaling\u003c/h2\u003e\u003cp\u003eTo elucidate the role of NRF2 in the progression of HNSCC, we performed RNA sequencing analysis in both control and \u003cem\u003eNRF2\u003c/em\u003e knockout FADU cells. Gene expression profiling, as well as the associated biological processes and pathways, were evaluated. We identified a list of differentially expressed genes. 707 genes (approximately 66.95%) were up-regulated, and 349 genes (approximately 33.05%) were down-regulated following \u003cem\u003eNRF2\u003c/em\u003e knockout (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). By targeting differentially expressed mRNAs, the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed that the differentially expressed mRNAs were predominantly associated with cellular processes and metabolism (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Heatmap cluster analysis of metabolic-related genes revealed that the gene expression profiles between the control and \u003cem\u003eNRF2\u003c/em\u003e knockout cells were distinct (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Correspondingly, these gene expression differences were also represented in the volcano plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Among these genes, the mRNA expression of \u003cem\u003eGPX2\u003c/em\u003e was notably suppressed in the \u003cem\u003eNRF2\u003c/em\u003e knockout cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). RT-qPCR and WB confirmed that the expression of \u003cem\u003eGPX2\u003c/em\u003e was decreased in FADU and Detroit 562 cells after deletion of \u003cem\u003eNRF2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and Supplemental Fig.\u0026nbsp;3A). In cohort study of TCGA database, the mRNA expression levels of \u003cem\u003eGPX2\u003c/em\u003e were positively correlated with \u003cem\u003eNRF2\u003c/em\u003e (r = 0.48, \u003cem\u003ep\u003c/em\u003e \u0026lt; 2.2e-16) and higher in patients with \u003cem\u003eNRF2\u003c/em\u003e mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF and G). High levels of \u003cem\u003eGPX2\u003c/em\u003e were associated with a poor survival ratio in HNSCC patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e \u003cb\u003eGPX2 promotes tumor growth in HNSCC.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eTo explore the role of GPX2 in the malignant processes of HNSCC, we performed lentivirus-mediated shRNA knockdown of \u003cem\u003eGPX2\u003c/em\u003e in FADU and Detroit 562 cell lines. The knockdown efficiency was confirmed by RT-qPCR and western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B and Supplementary Fig.\u0026nbsp;4A). Inhibition of GPX2 caused a significant reduction in cell proliferation measured by growth rate and colony formation assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D and Supplementary Fig.\u0026nbsp;4B). \u003cem\u003eGPX2\u003c/em\u003e knockdown reduced the size of the tumor spheres formed in the 3D culture system (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). FADU and Detroit562 cells exhibited decreased migrating and invasive capability following \u003cem\u003eGPX2\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF and Supplementary Fig.\u0026nbsp;4C). Meanwhile, \u003cem\u003eGPX2\u003c/em\u003e knockdown significantly increased the cellular level of ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG and Supplementary Fig.\u0026nbsp;4D). An increase in the proportion of apoptotic cells was also observed in \u003cem\u003eGPX2\u003c/em\u003e knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH and Supplementary Fig.\u0026nbsp;4E). Moreover, \u003cem\u003eGPX2\u003c/em\u003e knockdown in FADU cells led to smaller xenograft tumors and reduced proliferation than in controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI and J).\u003c/p\u003e\u003cp\u003e \u003cb\u003eDepletion of GPX2 Expression disrupts NOTCH3 expression.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eNRF2 signaling is activated in cancer stem cells (CSCs) and contributes to CSC properties, such as proliferation, metastasis and therapeutic resistance[13,39]. Meanwhile, GPX2 can maintain the genomic integrity of pluripotent stem cells through antioxidant defense[40–42]. GPX2 is concentrated in stem cells and proliferative compartments of epithelial tissues to maintain tissue integrity and homeostasis[20]. To test whether GPX2 is involved in the maintenance of CSCs, we analyzed CSC contents of FADU cells by flow cytometry with CD44, a marker for CSCs[43]. Loss of \u003cem\u003eGPX2\u003c/em\u003e markedly diminished the proportion of CSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B). Wnt, Hedgehog (HH), and NOTCH are canonical CSC pathways crucial to the tumorigenicity of CSCs[44]. We found that depletion of \u003cem\u003eGPX2\u003c/em\u003e significantly reduces HH and NOTCH signaling (Supplementary Fig.\u0026nbsp;5A and C). We further found that the NOTCH target gene, \u003cem\u003eHES1\u003c/em\u003e, is highly expressed in HNSCC cells. In contrast, the expression of \u003cem\u003eGli1\u003c/em\u003e and \u003cem\u003eGli2\u003c/em\u003e are either low or undetectable (Supplementary Fig.\u0026nbsp;5B). To determine the specific NOTCH signaling implicated downstream of GPX2, we first examined all NOTCH ligands and receptors in the TCGA database. We revealed that the high mRNA expression of \u003cem\u003eNOTCH2\u003c/em\u003e and \u003cem\u003eNOTCH3\u003c/em\u003e are positively correlated with \u003cem\u003eGPX2\u003c/em\u003e (Supplementary Fig.\u0026nbsp;6). We further detected that \u003cem\u003eGPX2\u003c/em\u003e predominantly regulates the expression of \u003cem\u003eNOTCH1\u003c/em\u003e, \u003cem\u003eNOTCH2\u003c/em\u003e and \u003cem\u003eNOTCH3\u003c/em\u003e in HNSCC cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D and Supplementary Fig.\u0026nbsp;5D). According to RNA-seq data from the FADU cell line, we found a significant decrease of \u003cem\u003eNOTCH3\u003c/em\u003e following \u003cem\u003eNRF2\u003c/em\u003e knockout (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D and Supplementary Fig.\u0026nbsp;7). The cohort analysis of the TCGA database demonstrated a strong association between the mRNA expression of \u003cem\u003eNOTCH3\u003c/em\u003e and \u003cem\u003eGPX2\u003c/em\u003e (r = 0.33, \u003cem\u003ep\u003c/em\u003e \u0026lt; 6.1e-15) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-F and Supplementary Fig.\u0026nbsp;8). High levels of \u003cem\u003eNOTCH3\u003c/em\u003e are also correlated with a decreased overall survival rate in patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG).\u003c/p\u003e\u003ch2\u003eNOTCH3 is critical for HNSCC progression\u003c/h2\u003e\u003cp\u003eTo determine whether activation of NOTCH3 is responsible for promoting the CSC phenotype of HNSCC, we performed lentivirus-mediated shRNA knockdown of \u003cem\u003eNOTCH3\u003c/em\u003e in FADU cells. The knockdown efficiency was confirmed by RT-qPCR and western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and B). Inhibition of NOTCH3 caused a significant reduction in cell proliferation, as measured by growth rate and colony formation assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and D). \u003cem\u003eNOTCH3\u003c/em\u003e knockdown reduced the size of the tumor spheres formed in the 3D culture system (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Additionally, FADU cells exhibited decreased migrating and invasive capability following \u003cem\u003eNOTCH3\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF and G). \u003cem\u003eNOTCH3\u003c/em\u003e knockdown significantly increased the cellular level of ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). An increase in the proportion of apoptotic cells was also observed in \u003cem\u003eNOTCH3\u003c/em\u003e knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI). Moreover, \u003cem\u003eNOTCH3\u003c/em\u003e knockdown in FADU cells led to smaller xenograft tumors and reduced proliferation than in controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ). Consistently, high expression of GPX2 markedly enhanced NOTCH3 levels in HNSCC patients(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eK). Therefore, these results suggest that NOTCH signaling affects HNSCC progression mediated by NOTCH3.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe role of NRF2 in the malignant progression of cancers has emerged as a focal point of contemporary oncological research. Notably, activation of NRF2 has been associated with a poorer overall survival rate in various cancers, suggesting that NRF2 may play a critical role in cancer pathogenesis[45]. Yet the molecular mechanisms of NRF2 regulating cancer progression remain unexplored. In this study, we elucidated that GPX2 functions as a downstream target of NRF2 in HNSCC. The patients exhibiting elevated activation of NRF2 experience an upregulation of \u003cem\u003eGPX2\u003c/em\u003e mRNA, correlating with decreased overall survival rates. We demonstrate that GPX2 regulates HNSCC cell proliferation, migration, and metastasis by regulating CSC phenotype. Analysis of TCGA database revealed that mRNA expression of \u003cem\u003eNOTCH3\u003c/em\u003e was significantly higher in patients with increased \u003cem\u003eGPX2\u003c/em\u003e expression. We further revealed that the inhibition of GPX2 notably reduced the expression of NOTCH3 in both FADU and Detroit 562 cells These findings suggest a pivotal role for the NRF2-GPX2-NOTCH3 axis in NOTCH3-mediated regulation of CSCs in HNSCC.\u003c/p\u003e \u003cp\u003e \u003cem\u003eNRF2\u003c/em\u003e mutation is specifically frequent in multiple squamous cell carcinomas (SCC) of the lung, skin, esophagus, and larynx, et al.[31,46,47]. Most of these SCC-associated \u003cem\u003eNRF2\u003c/em\u003e mutations harbor gain-of-function activity[48]. Numerous studies have highlighted that activation of \u003cem\u003eNRF2\u003c/em\u003e contributes to cancer progression and metastasis, while also endowing resistance to chemotherapy and radiotherapy[12\u0026ndash;16]. Our analysis of a cohort of HNSCC cases has elucidated the clinical relevance of \u003cem\u003eNRF2\u003c/em\u003e mutation. We identified that approximately 12% of patients exhibited mutations in the NRF2 complex. These mutations were strong correlated with tumor progression and emerged as a significant prognostic factor. Recenet studies have revealed that NRF2 directly regulates the expression of gene groups that are related to cellular metabolism, in addition to the detoxification response[49]. Upon depleting NRF2, we revealed that the most significantly altered genes were predominantly linked to cellular metabolism. We further found that GPX2 was significantly reduced in \u003cem\u003eNRF2\u003c/em\u003e knockout cells.\u003c/p\u003e \u003cp\u003eGPX2 is a glutathione peroxidase, playing a crucial role in maintaining cellular redox balance by regulating the levels of reactive oxygen and nitrogen species. It functions within the antioxidant system, leveraging the GSH (reduced glutathione) and GSSG (oxidized glutathione) cycle to protect cells against oxidative damage[50]. The antioxidant function of GPX2 is evident not only by its enzymatic activity but also by its upregulation in response to oxidative stress. A prominent pathway for the induction of GPX2 expression involves the p62/KEAP1/\u003cem\u003eNRF2\u003c/em\u003e complex[51]. Kleeburger\u0026rsquo;s group further identified potential NRF2 activation sites within the \u003cem\u003eGPX2\u003c/em\u003e gene, suggesting a direct regulatory mechanism by NRF2 on GPX2 expression[52]. An increasing number of studies indicate that GPX2 is also involved in the development of cancers[27,28]. Many studies have shown that high level of GPX2 promotes tumor growth, metastasis, and drug resistance, while reducing its expression helps inhibit tumor development[27,53]. When we depletion of GPX2 in HNSCC, the growth of tumor cells was significantly inhibited, while the proportion of apoptotic cells substantially increased. Indeed, GPX2 was demonstrated to play contrasting roles across various cancers. Loss of GPX2 reduces oxidative phosphorylation (OXPHOS) and enhances aerobic glycolysis to promote malignant progression in breast cancer[23]. This controversial function of GPX2 could be attributed to tissue-specific factors.\u003c/p\u003e \u003cp\u003eWe observed increased apoptosis caused by the absence of GPX2 in HNSCC. Considering a susceptibility of stem cells to apoptotic stimuli[42,54], the emerging evidence following GPX2 depletion prompts us to test whether GPX2 promotes tumor progression by affecting CSCs. By performing CD44 staining on \u003cem\u003eGPX2\u003c/em\u003e knockdown cells, we observed a significant reduction in the CSC population, indicating that \u003cem\u003eGPX2\u003c/em\u003e plays a role in the maintenance of CSCs. Aberrant activation of pathways regulating stem cell self-renewal, such as Notch, Hedgehog (HH), and Wnt, are also pivotal in the tumorigenic potential of CSCs[44]. Dysregulation of these pathways contributes to drive tumor progression[55]. We examined all three signaling pathways and found that Notch signaling was disrupted in GPX2 depletion HNSCC cells, especially NOTCH3. The NOTCH signaling has been reported to associate with CSCs[56]. NOTCH1 and NOTCH2 facilitates cancer metastasis and contributing to a poor prognosis[57\u0026ndash;59]. NOTCH3 promotes tumor development in various cancers, although it has been shown to inhibit tumor growth in breast cancer through the activation of PTEN and subsequent inhibition of the AKT-mTOR pathway[60]. Kondratyev et al. have also verified the oncogenic role of NOTCH3 in HNSCC[61]. Of note, NRF2 is a direct activator of the \u003cem\u003eNOTCH3\u003c/em\u003e enhancer, and the co-expression of NRF2 and NOTCH3 is associated with a poor prognosis in lung adenocarcinoma[62]. We further showed that loss of NOTCH3 dramatically reduced CSC population, subsequently preventing tumor growth and metastasis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, our findings illustrate that aberrant activation of NRF2 contributes to acquisition of malignant features and poor prognosis through NRF2-GPX2-NOTCH3 axis. Therefore, targeting the involvement of NRF2-GPX2-NOTCH3 axis holds potential as a therapeutic strategy for treating HNSCC characterized by NRF2 activation.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHNSCC: Head and neck squamous cell cancer\u003c/p\u003e\n\u003cp\u003eNRF2: The activation of nuclear factor erythroid 2\u0026ndash;related factor 2\u003c/p\u003e\n\u003cp\u003eTCGA: The Cancer Genome Atlas\u003c/p\u003e\n\u003cp\u003eIHC: Immunohistochemistry\u003c/p\u003e\n\u003cp\u003eKEGG: Kyoto Encyclopedia of Genes and Genomes\u003c/p\u003e\n\u003cp\u003eRT-qPCR: Quantitative Real-time PCR\u003c/p\u003e\n\u003cp\u003eWB: Western Blot\u003c/p\u003e\n\u003cp\u003eshRNA: short hairpin RNA\u003c/p\u003e\n\u003cp\u003eCSC: cancer stem cell\u003c/p\u003e\n\u003cp\u003eHH: Hedgehog\u003c/p\u003e\n\u003cp\u003eROS: Reactive oxygen species\u003c/p\u003e\n\u003cp\u003ePVDF: Polyvinylidene fluoride\u003c/p\u003e\n\u003cp\u003eDMEM: Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium\u003c/p\u003e\n\u003cp\u003eFBS: Fetal bovine serum\u003c/p\u003e\n\u003cp\u003eCCK-8: Cell Counting Kit-8\u003c/p\u003e\n\u003cp\u003eECL: Enhanced chemiluminescence\u003c/p\u003e\n\u003cp\u003eBSA:Bovine serum albumin\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman HNSCC tissues were obtained from patients who received curative surgery at Jiangxi Cancer Hospital (Jiangxi, China). The research was conducted in accordance with the applicable national ethical standards. This study was approved by the Research Ethics Committee of Jiangxi Cancer Hospital (approval number (2024ky008)).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnimal experiments were approved by the Institutional Animal Care and Use Committee of Zhejiang University (approval number:20221576).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (No. 32270863) and the National Key Research and Development Program of China (2021YFC2501800).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare their consent for this publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJXY and JM conceived and supervised the study. JXY, LXY, ZC and RJ contributed to data interpretation, manuscript writing, and performed experiments. QHX, LB, SWXR, ZA and LQL contributed to the data collection and analysis. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding authors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Ming Jiang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCenter for Genetic Medicine, the Fourth Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInstitute of Genetics, Zhejiang University International School of Medicine, Hangzhou, Zhejiang, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eZhejiang Provincial Key Laboratory of Genetic \u0026amp; Developmental Disorders, Hangzhou, Zhejiang, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eXiaoye Jin, Xiayuan Lou, Chao Zheng, Bo Li, Xuerong Siwu, Ming Jiang\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSchool of Pharmacy and Department of Hepatology, the Affiliated Hospital of Hangzhou Normal University, Hangzhou Normal University, Hangzhou, China.\u003c/p\u003e\n\u003cp\u003eKey Laboratory of Elemene Class Anti-Cancer Chinese Medicines; Engineering Laboratory of Development and Application of Traditional Chinese Medicines; Collaborative Innovation Center of Traditional Chinese Medicines of Zhejiang Province, School of Pharmacy, Hangzhou Normal University, Hangzhou , China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHaoxiang Qi\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDepartment of Medical Oncology, The First Affiliated Hospital, School of Medicine, Zhejiang University and Key Laboratory of Cancer Prevention and Intervention, Ministry of Education, Hangzhou, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eJian Ruan\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInstitute of Cancer Research, Zhejiang Cancer Hospital, Hangzhou, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAn Zhao\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInstitute of Cancer Research, Jiangxi Cancer Hospital, Nanchang, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQiaoli Lv\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eJohnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers. 2020;6:1\u0026ndash;22. \u003c/li\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209\u0026ndash;49. \u003c/li\u003e\n\u003cli\u003eLi Q, Tie Y, Alu A, Ma X, Shi H. Targeted therapy for head and neck cancer: signaling pathways and clinical studies. Sig Transduct Target Ther. 2023;8:1\u0026ndash;28. \u003c/li\u003e\n\u003cli\u003eZhou G, Liu Z, Myers JN. TP53 Mutations in Head and Neck Squamous Cell Carcinoma and Their Impact on Disease Progression and Treatment Response. Journal of Cellular Biochemistry. 2016;117:2682\u0026ndash;92. \u003c/li\u003e\n\u003cli\u003eChung CH, Ely K, McGavran L, Varella-Garcia M, Parker J, Parker N, et al. Increased epidermal growth factor receptor gene copy number is associated with poor prognosis in head and neck squamous cell carcinomas. J Clin Oncol. 2006;24:4170\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eIglesias-Bartolome R, Martin D, Gutkind JS. Exploiting the Head and Neck Cancer Oncogenome: Widespread PI3K-mTOR Pathway Alterations and Novel Molecular Targets. Cancer Discovery. 2013;3:722\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eLeemans CR, Braakhuis BJM, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer. 2011;11:9\u0026ndash;22. \u003c/li\u003e\n\u003cli\u003eFurukawa M, Xiong Y. BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol. 2005;25:162\u0026ndash;71. \u003c/li\u003e\n\u003cli\u003eKansanen E, Kuosmanen SM, Leinonen H, Levonen A-L. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox Biol. 2013;1:45\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eRamos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, Talalay P, et al. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient mice. Proc Natl Acad Sci U S A. 2001;98:3410\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eRamos-Gomez M, Dolan PM, Itoh K, Yamamoto M, Kensler TW. Interactive effects of nrf2 genotype and oltipraz on benzo[a]pyrene-DNA adducts and tumor yield in mice. Carcinogenesis. 2003;24:461\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eChio IIC, Jafarnejad SM, Ponz-Sarvise M, Park Y, Rivera K, Palm W, et al. NRF2 Promotes Tumor Maintenance by Modulating mRNA Translation in Pancreatic Cancer. Cell. 2016;166:963\u0026ndash;76. \u003c/li\u003e\n\u003cli\u003eLignitto L, LeBoeuf SE, Homer H, Jiang S, Askenazi M, Karakousi TR, et al. Nrf2 Activation Promotes Lung Cancer Metastasis by Inhibiting the Degradation of Bach1. Cell. 2019;178:316-329.e18. \u003c/li\u003e\n\u003cli\u003eFox DB, Garcia NMG, McKinney BJ, Lupo R, Noteware LC, Newcomb R, et al. NRF2 activation promotes the recurrence of dormant tumour cells through regulation of redox and nucleotide metabolism. Nat Metab. 2020;2:318\u0026ndash;34. \u003c/li\u003e\n\u003cli\u003eTaniguchi S, Elhance A, Van Duzer A, Kumar S, Leitenberger JJ, Oshimori N. Tumor-initiating cells establish an IL-33\u0026ndash;TGF-\u0026beta; niche signaling loop to promote cancer progression. Science. 2020;369:eaay1813. \u003c/li\u003e\n\u003cli\u003eFeng L, Zhao K, Sun L, Yin X, Zhang J, Liu C, et al. SLC7A11 regulated by NRF2 modulates esophageal squamous cell carcinoma radiosensitivity by inhibiting ferroptosis. Journal of Translational Medicine. 2021;19:367. \u003c/li\u003e\n\u003cli\u003eSingh A, Daemen A, Nickles D, Jeon S-M, Foreman O, Sudini K, et al. NRF2 Activation Promotes Aggressive Lung Cancer and Associates with Poor Clinical Outcomes. Clin Cancer Res. 2021;27:877\u0026ndash;88. \u003c/li\u003e\n\u003cli\u003eForstrom JW, Zakowski JJ, Tappel AL. Identification of the catalytic site of rat liver glutathione peroxidase as selenocysteine. Biochemistry. 1978;17:2639\u0026ndash;44. \u003c/li\u003e\n\u003cli\u003eSchwarz M, L\u0026ouml;ser A, Cheng Q, Wichmann-Costaganna M, Sch\u0026auml;del P, Werz O, et al. Side-by-side comparison of recombinant human glutathione peroxidases identifies overlapping substrate specificities for soluble hydroperoxides. Redox Biol. 2023;59:102593. \u003c/li\u003e\n\u003cli\u003eEsworthy RS, Doroshow JH, Chu F-F. The beginning of GPX2 and 30 years later. Free Radical Biology and Medicine. 2022;188:419\u0026ndash;33. \u003c/li\u003e\n\u003cli\u003eLee E, Choi A, Jun Y, Kim N, Yook JI, Kim SY, et al. Glutathione peroxidase-1 regulates adhesion and metastasis of triple-negative breast cancer cells via FAK signaling. Redox Biology. 2020;29:101391. \u003c/li\u003e\n\u003cli\u003eCheng L, He Q, Liu B, Chen L, Lv F, Li X, et al. SGK2 promotes prostate cancer metastasis by inhibiting ferroptosis via up-regulating GPX4. Cell Death and Disease. 2023;14:1\u0026ndash;14. \u003c/li\u003e\n\u003cli\u003eRen Z, Liang H, Galbo PM, Dharmaratne M, Kulkarni AS, Fard AT, et al. Redox signaling by glutathione peroxidase 2 links vascular modulation to metabolic plasticity of breast cancer. Proc Natl Acad Sci U S A. 2022;119:e2107266119. \u003c/li\u003e\n\u003cli\u003eDing Y, Chen X, Liu C, Ge W, Wang Q, Hao X, et al. Identification of a small molecule as inducer of ferroptosis and apoptosis through ubiquitination of GPX4 in triple\u0026ensp;negative\u0026ensp;breast\u0026ensp;cancer cells. J Hematol Oncol. 2021;14:19. \u003c/li\u003e\n\u003cli\u003ePeng D, Hu T, Soutto M, Belkhiri A, Zaika A, El-Rifai W. Glutathione peroxidase 7 has potential tumour suppressor functions that are silenced by location-specific methylation in oesophageal adenocarcinoma. Gut. 2014;63:540\u0026ndash;51. \u003c/li\u003e\n\u003cli\u003eNguyen TTM, Nguyen TH, Kim HS, Dao TTP, Moon Y, Seo M, et al. GPX8 regulates clear cell renal cell carcinoma tumorigenesis through promoting lipogenesis by NNMT. J Exp Clin Cancer Res. 2023;42:42. \u003c/li\u003e\n\u003cli\u003eYang M, Zhu X, Shen Y, He Q, Qin Y, Shao Y, et al. GPX2 predicts recurrence-free survival and triggers the Wnt/\u0026beta;-catenin/EMT pathway in prostate cancer. PeerJ. 2022;10:e14263. \u003c/li\u003e\n\u003cli\u003eLei Z, Tian D, Zhang C, Zhao S, Su M. Clinicopathological and prognostic significance of GPX2 protein expression in esophageal squamous cell carcinoma. BMC Cancer. 2016;16:410. \u003c/li\u003e\n\u003cli\u003eAhmed KM, Veeramachaneni R, Deng D, Putluri N, Putluri V, Cardenas MF, et al. Glutathione peroxidase 2 is a metabolic driver of the tumor immune microenvironment and immune checkpoint inhibitor response. J Immunother Cancer. 2022;10:e004752. \u003c/li\u003e\n\u003cli\u003eBialk P, Wang Y, Banas K, Kmiec EB. Functional Gene Knockout of NRF2 Increases Chemosensitivity of Human Lung Cancer A549 Cells In Vitro and in a Xenograft Mouse Model. Mol Ther Oncolytics. 2018;11:75\u0026ndash;89. \u003c/li\u003e\n\u003cli\u003eCancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature. 2015;517:576\u0026ndash;82. \u003c/li\u003e\n\u003cli\u003eTorrente L, DeNicola GM. Targeting NRF2 and Its Downstream Processes: Opportunities and Challenges. Annu Rev Pharmacol Toxicol. 2022;62:279\u0026ndash;300. \u003c/li\u003e\n\u003cli\u003eTang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019;47:W556\u0026ndash;60. \u003c/li\u003e\n\u003cli\u003eKensler TW, Wakabayashi N, Biswal S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol. 2007;47:89\u0026ndash;116. \u003c/li\u003e\n\u003cli\u003eIida K, Itoh K, Kumagai Y, Oyasu R, Hattori K, Kawai K, et al. Nrf2 is essential for the chemopreventive efficacy of oltipraz against urinary bladder carcinogenesis. Cancer Research. 2004;64:6424\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eKim T-H, Hur E, Kang S-J, Kim J-A, Thapa D, Lee YM, et al. NRF2 blockade suppresses colon tumor angiogenesis by inhibiting hypoxia-induced activation of HIF-1\u0026alpha;. Cancer Res. 2011;71:2260\u0026ndash;75. \u003c/li\u003e\n\u003cli\u003ePillai R, Hayashi M, Zavitsanou A-M, Papagiannakopoulos T. NRF2: KEAPing Tumors Protected. Cancer Discov. 2022;12:625\u0026ndash;43. \u003c/li\u003e\n\u003cli\u003eGe W, Zhao K, Wang X, Li H, Yu M, He M, et al. iASPP Is an Antioxidative Factor and Drives Cancer Growth and Drug Resistance by Competing with Nrf2 for Keap1 Binding. Cancer Cell. 2017;32:561-573.e6. \u003c/li\u003e\n\u003cli\u003eZhou Y, Chen Y, Shi Y, Wu L, Tan Y, Li T, et al. FAM117B promotes gastric cancer growth and drug resistance by targeting the KEAP1/NRF2 signaling pathway. J Clin Invest [Internet]. 2023 [cited 2024 Jan 22];133. Available from: https://www.jci.org/articles/view/158705\u003c/li\u003e\n\u003cli\u003eTan W, Zhang K, Chen X, Yang L, Zhu S, Wei Y, et al. GPX2 is a potential therapeutic target to induce cell apoptosis in lenvatinib against hepatocellular carcinoma. Journal of Advanced Research [Internet]. 2022 [cited 2022 May 9]; Available from: https://www.sciencedirect.com/science/article/pii/S2090123222000741\u003c/li\u003e\n\u003cli\u003eLu X, Liu R, Liao Y, Cui L, Sun H, Zhang D, et al. ACVRL1 drives resistance to multitarget tyrosine kinase inhibitors in colorectal cancer by promoting USP15-mediated GPX2 stabilization. BMC Med. 2023;21:366. \u003c/li\u003e\n\u003cli\u003eDannenmann B, Lehle S, Hildebrand DG, K\u0026uuml;bler A, Grondona P, Schmid V, et al. High glutathione and glutathione peroxidase-2 levels mediate cell-type-specific DNA damage protection in human induced pluripotent stem cells. Stem Cell Reports. 2015;4:886\u0026ndash;98. \u003c/li\u003e\n\u003cli\u003eLudwig N, Szczepanski MJ, Gluszko A, Szafarowski T, Azambuja JH, Dolg L, et al. CD44(+) tumor cells promote early angiogenesis in head and neck squamous cell carcinoma. Cancer Letters. 2019;467:85\u0026ndash;95. \u003c/li\u003e\n\u003cli\u003eLu J, Ye X, Fan F, Xia L, Bhattacharya R, Bellister S, et al. Endothelial Cells Promote the Colorectal Cancer Stem Cell Phenotype Through a Soluble Form of Jagged-1. Cancer Cell. 2013;23:171\u0026ndash;85. \u003c/li\u003e\n\u003cli\u003eCui Y, Chen H, Xi R, Cui H, Zhao Y, Xu E, et al. Whole-genome sequencing of 508 patients identifies key molecular features associated with poor prognosis in esophageal squamous cell carcinoma. Cell Res. 2020;30:902\u0026ndash;13. \u003c/li\u003e\n\u003cli\u003eCancer Genome Atlas Research Network. Comprehensive genomic characterization of squamous cell lung cancers. Nature. 2012;489:519\u0026ndash;25. \u003c/li\u003e\n\u003cli\u003eChang D, Shain AH. The landscape of driver mutations in cutaneous squamous cell carcinoma. npj Genom Med. 2021;6:1\u0026ndash;10. \u003c/li\u003e\n\u003cli\u003eKerins MJ, Ooi A. A catalogue of somatic NRF2 gain-of-function mutations in cancer. Sci Rep. 2018;8:12846. \u003c/li\u003e\n\u003cli\u003eHayes JD, Dinkova-Kostova AT. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem Sci. 2014;39:199\u0026ndash;218. \u003c/li\u003e\n\u003cli\u003ePanday S, Talreja R, Kavdia M. The role of glutathione and glutathione peroxidase in regulating cellular level of reactive oxygen and nitrogen species. Microvasc Res. 2020;131:104010. \u003c/li\u003e\n\u003cli\u003eBanning A, Deubel S, Kluth D, Zhou Z, Brigelius-Floh\u0026eacute; R. The GI-GPx gene is a target for Nrf2. Mol Cell Biol. 2005;25:4914\u0026ndash;23. \u003c/li\u003e\n\u003cli\u003eCho H-Y, van Houten B, Wang X, Miller-DeGraff L, Fostel J, Gladwell W, et al. Targeted deletion of nrf2 impairs lung development and oxidant injury in neonatal mice. Antioxid Redox Signal. 2012;17:1066\u0026ndash;82. \u003c/li\u003e\n\u003cli\u003eXu H, Hu C, Wang Y, Shi Y, Yuan L, Xu J, et al. Glutathione peroxidase 2 knockdown suppresses gastric cancer progression and metastasis via regulation of kynurenine metabolism. Oncogene. 2023; \u003c/li\u003e\n\u003cli\u003eHuang T, Song X, Xu D, Tiek D, Goenka A, Wu B, et al. Stem cell programs in cancer initiation, progression, and therapy resistance. Theranostics. 2020;10:8721\u0026ndash;43. \u003c/li\u003e\n\u003cli\u003eManni W, Min W. Signaling pathways in the regulation of cancer stem cells and associated targeted therapy. MedComm (2020). 2022;3:e176. \u003c/li\u003e\n\u003cli\u003eFendler A, Bauer D, Busch J, Jung K, Wulf-Goldenberg A, Kunz S, et al. Inhibiting WNT and NOTCH in renal cancer stem cells and the implications for human patients. Nat Commun. 2020;11:929. \u003c/li\u003e\n\u003cli\u003eLiu L, Tao T, Liu S, Yang X, Chen X, Liang J, et al. An RFC4/Notch1 signaling feedback loop promotes NSCLC metastasis and stemness. Nat Commun. 2021;12:2693. \u003c/li\u003e\n\u003cli\u003eJackstadt R, van Hooff SR, Leach JD, Cortes-Lavaud X, Lohuis JO, Ridgway RA, et al. Epithelial NOTCH Signaling Rewires the Tumor Microenvironment of Colorectal Cancer to Drive Poor-Prognosis Subtypes and Metastasis. Cancer Cell. 2019;36:319-336.e7. \u003c/li\u003e\n\u003cli\u003eWang F, Zhang J, Tang H, Pang Y, Ke X, Peng W, et al. Nup54-induced CARM1 nuclear importation promotes gastric cancer cell proliferation and tumorigenesis through transcriptional activation and methylation of Notch2. Oncogene. 2022;41:246\u0026ndash;59. \u003c/li\u003e\n\u003cli\u003eZhang Y-Q, Liang Y-K, Wu Y, Chen M, Chen W-L, Li R-H, et al. Notch3 inhibits cell proliferation and tumorigenesis and predicts better prognosis in breast cancer through transactivating PTEN. Cell Death Dis. 2021;12:1\u0026ndash;16. \u003c/li\u003e\n\u003cli\u003eKondratyev M, Pesic A, Ketela T, Stickle N, Beswick C, Shalev Z, et al. Identification of acquired Notch3 dependency in metastatic Head and Neck Cancer. Commun Biol. 2023;6:538. \u003c/li\u003e\n\u003cli\u003eOkazaki K, Anzawa H, Liu Z, Ota N, Kitamura H, Onodera Y, et al. Enhancer remodeling promotes tumor-initiating activity in NRF2-activated non-small cell lung cancers. Nat Commun. 2020;11:5911. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"NRF2, GPX2, NOTCH3, Head and neck squamous cell carcinoma","lastPublishedDoi":"10.21203/rs.3.rs-4132275/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4132275/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The activation of nuclear factor erythroid 2–related factor 2 (NRF2) has been observed in various cancers. Yet its exact contribution to the development of head and neck squamous cell carcinoma (HNSCC) remains undetermined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e We systematically investigated the role of NRF2 in HNSCC, ultimately selecting \u003cem\u003eGPX2\u003c/em\u003e, which exhibited a marked downregulation, for a detailed mechanistic analysis. Firstly, we knocked out \u003cem\u003eNRF2\u003c/em\u003e by CRISPR-Cas9, and subsequently confirmed by RT-qPCR and Western Blot. The role of NRF2was evaluated through various assays, including cell growth assays, colony formation assays, 3D cultures, cell migration and invasion assessments, ROS detection, and xenograft tumor models. Furthermore, we performed RNA sequencing on \u003cem\u003eNRF2\u003c/em\u003e-KO cells compared to \u003cem\u003eNRF2\u003c/em\u003e-WT cells identified\u003cem\u003e \u003c/em\u003eGPX2 as a downstream target of NRF2. This finding led us to examine the role of GPX2 in the maintenance of cancer stem cells (CSCs). Notably, CSC analysis indicated the involvement of the NOTCH signaling pathway in HNSCC progression, and the critical role of NOTCH3 was confirmed using the serious experimental approaches mentioned earlier.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e We previously found that NRF2 signaling is critical for the differentiation of squamous basal progenitor cells, while disruption of NRF2 causes basal cell hyperplasia. In this study, we revealed a correlation between elevated NRF2 activity and poor outcomes in HNSCC patients. We demonstrated that NRF2 facilitates tumor proliferation, migration, and invasion, as evidenced by both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies. Significantly, NRF2 augments the expression of the antioxidant enzyme GPX2, thereby enhancing the proliferative, migratory, and invasive properties of HNSCC cells. Activation of GPX2 is critical for sustaining CSCs by up-regulating NOTCH3, a key driver of cancer progression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e NRF2 regulates HNSCC progression through the NRF2-GPX2-NOTCH3 axis. Our findings proposed that pharmacological targeting of the NRF2-GPX2-NOTCH3 axis could be a potential therapeutic approach against HNSCC.\u003c/p\u003e","manuscriptTitle":"NRF2 signaling plays an essential role in cancer progression through the NRF2-GPX2-NOTCH3 axis in head and neck squamous cell carcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-29 18:39:49","doi":"10.21203/rs.3.rs-4132275/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"181a53e4-c20d-410c-a231-68d3c4fe2ede","owner":[],"postedDate":"March 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-22T06:25:34+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-29 18:39:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4132275","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4132275","identity":"rs-4132275","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}