Tyrp1 is the Mendelian Determinant of the Axolotl (Ambystoma mexicanum) Copper Mutant

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Several dozen Mendelian mutants have been discovered in axolotl (Ambystoma mexicanum) populations, including several that affect pigmentation. For recessive mutants have been described in the scientific literature and genes for three of these have been identified. Here we describe and genetically dissect copper, a mutant with an albino-like phenotype known only from the pet trade. We performed a cross segregating copper and wildtype color phenotypes and used bulked segregant RNA-Seq to identify a region on chromosome 6 that was enriched for single-nucleotide polymorphisms (SNPs) between the color phenotypes. This region included Tyrosinase-like Protein 1 (Tyrp1), a melanin synthesis protein that when mutated, is associated with lighter than black melanin coloration in animal models and oculocutaneous albinism in humans. Inspection of RNA-Seq reads identified a single nucleotide deletion that is predicted to change the coding frame, introducing a premature stop codon in exon 6 and yield a truncated Tyrp1 protein in copper individuals. Using CRISPR-Cas9 editing, we show that wildtype Tyrp1 crispants exhibit copper pigmentation, thus confirming Tyrp1 as the copper locus. Our results suggest that commercial and hobbyist axolotl populations may harbor useful mutants for biological research.
Full text 68,134 characters · extracted from preprint-html · click to expand
Tyrp1 is the Mendelian Determinant of the Axolotl (Ambystoma mexicanum) Copper Mutant | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Tyrp1 is the Mendelian Determinant of the Axolotl (Ambystoma mexicanum) Copper Mutant Raissa F. Cecil, Lloyd Strohl, Maddie K. Thomas, James L. Schwartz, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4536099/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Several dozen Mendelian mutants have been discovered in axolotl ( Ambystoma mexicanum ) populations, including several that affect pigmentation. For recessive mutants have been described in the scientific literature and genes for three of these have been identified. Here we describe and genetically dissect copper , a mutant with an albino-like phenotype known only from the pet trade. We performed a cross segregating copper and wildtype color phenotypes and used bulked segregant RNA-Seq to identify a region on chromosome 6 that was enriched for single-nucleotide polymorphisms (SNPs) between the color phenotypes. This region included Tyrosinase-like Protein 1 ( Tyrp1 ), a melanin synthesis protein that when mutated, is associated with lighter than black melanin coloration in animal models and oculocutaneous albinism in humans. Inspection of RNA-Seq reads identified a single nucleotide deletion that is predicted to change the coding frame, introducing a premature stop codon in exon 6 and yield a truncated Tyrp1 protein in copper individuals. Using CRISPR-Cas9 editing, we show that wildtype Tyrp1 crispants exhibit copper pigmentation, thus confirming Tyrp1 as the copper locus. Our results suggest that commercial and hobbyist axolotl populations may harbor useful mutants for biological research. Figures Figure 1 Figure 2 Figure 3 Introduction The axolotl ( Ambystoma mexicanum ) has a long and storied history in biological research. Axolotls provide models for studies of embryonic and post-embryonic development, including most famously the study of whole organ regeneration 1 . The primary stock center for axolotl research is a captive bred population that has been maintained for almost 100 years 2 , 3 . Many mutants have been maintained in this population over time, including four different color mutants that are determined by single genes: white, melanoid, albino , and axanthic . Each of these mutants has an interesting history. The white mutant was presumably collected from Mexico in 1862 along with 33 wildtype individuals 4 . These axolotls were transported to Paris to establish the first laboratory axolotl population. The white mutant is caused by a Edn3 splicing defect 3 . The melanoid mutant was originally identified from laboratory crosses made using wild-caught axolotls from Mexico, and like white, melanoid is presumably also a natural color variant 5 . Subsequent analyses revealed that melanoid is genetically associated with Ltk 6 . Similarly, albino was originally identified in a wild captured tiger salamander and crossed into axolotl stocks 7 . In contract axanthic appears to have arisen spontaneously within a laboratory axolotl strain 8 . Although the gene for axanthic has not been identified, Woodcock et al 3 showed that albino is caused by a deletion in the Tyr coding sequence. For as long as axolotls have been studied in research, they have also been highly prized as aquarium pets. All axolotl color mutants known to biological research, and even transgenic axolotls, are available in the pet trade. Additionally, pet breeders have identified color variants that have not received biological study, including a Mendelian mutant called copper . Pet breeders describe copper axolotls as having copper-colored bodies with yellow xanthophores, brownish melanophores, and iridescent iridophores. The brownish and not black color of melanophores suggests copper is a form of albinism, perhaps involving mutation of a melanin synthesis protein. Given the importance of animal models in the study of albinism diseases, we used bulked segregant RNA-Seq (BSR-Seq) 9 and CRISPR-Cas9 10 to identify Tyrp1 as the copper locus. Our results suggest that commercial and private axolotl collections may harbor genetic variants that may prove useful as animal models in biological research. Results Bulk segregant RNA-Seq identified a candidate gene for copper BSR-Seq 9 was used to identify SNPs linked to the copper locus. Embryos from a cross that segregated copper and wildtype individuals were used to create two copper and two wildtype RNA pools (N = 36 and 27 for copper and wildtype respectively, per pool) that were each subjected to Illumina short-read RNA sequencing to identify single nucleotide polymorphisms (SNPs). Analysis of SNPs across the axolotl genome revealed a region on chromosome 6p with dissimilar frequencies between the pools (Fig. 1 a; Supplementary File 1). Examination of genes within this region identified Tyrosinase-like protein 1 ( Tyrp1 ) as a candidate gene. Tyrp1 encodes an enzyme that functions in melanin synthesis. Tyrp1 mutations generate lighter than black melanin shades of color in animal models 11 – 13 and Oculocutaneous Albinism 3 (OCA3) in humans 14 . Additionally, approximately 4x more Tyrp1 transcripts were identified from the wild-type vs copper RNA-Seq pools, suggestive of an expression difference (Fig. 1 b). The axolotl Tyrp1 locus (AMEX60DD301043361.1) is distributed across 8 exons and the 1663 bp coding sequence encodes a 524 amino acid protein. A single nucleotide deletion (chr6p:1,225,541,490) was identified in RNA-Seq reads generated for the copper RNA pool (Fig. 1 c; Supplementary File 2). This deletion, in exon 6, was confirmed by sequencing genomic DNA isolated from two copper and two wildtype individuals that were used to construct the RNA BSR-Seq pools (Fig. 1 c). The deletion in the copper Tyrp1 sequence is predicted to change the reading frame and introduce a premature stop codon at amino acid position 416 (Supplementary File 3). CRISPR-Cas9 disruption of Tyrp1 phenocopies copper CRISPR-CAS9 10 was performed to determine if disruption of the Tyrp1 coding sequence would yield individuals that presented copper pigmentation. Two guide RNAs targeting exons 2 and 6 of the Tyrp1 coding sequence were injected into 100, one-cell stage wildtype embryos and visually assessed for color at developmental stage 42 15 . Crispant individuals were characterized by having fewer melanophores than non-injected controls and presented a yellowish overall color, as is typical of copper larvae in the pet trade. PCR and DNA sequencing of Tyrp1 regions targeted by CRISPR-Cas9 confirmed that crispant embryos (N = 12) were edited at either one or both gRNA-target sites (Fig. 2 ). Five Tyrp1 crispants were reared to approximately 17 cM total body length (1.2 years old) and photographed to document pigmentation. Relative to the yellowish color observed during the larval stage, all five Tyrp1 crispants presented a darker copper skin color that was very similar to the color of adult copper axolotls (Fig. 3 ). The pigmentation phenotypes resulting from CRISPR-Cas9 genome editing strongly implicate Tyrp1 as the gene for copper. Discussion Several different axolotl pigmentation variants are present in laboratories and households around the world. Several of these variants, including white, albino and melanoid , have received considerable attention in biological research. Previously, we identified genes for these variants to increase their value as research models 3 , 5 . In this study we identified a new gene in an axolotl pigmentation variant known only from the pet trade. Specifically, we show that copper , an axolotl mutant with copper coloration, is likely determined by a single nucleotide deletion in the Tyrp1 coding sequence. Tyrp1 encodes an enzyme that functions in melanophores to produce a black pigment called melanin. Mutations in Tyrp1 are associated with decreased production of melanin and structural alterations that result in lighter than expected coloration, for example brown coat color in mice 11 and blonde hair in Melanesian humans 16 . copper axolotls in the larval stage have fewer dark pigmented melanophores than those observed in wildtype animals, and in absence of melanophores pigmentation is primarily determined by yellow xanthophores. As copper axolotls age, a brownish pigment emerges and individuals developed a uniform copper skin color, as is typical of animal models with Tyrp1 mutations. To functionally validate Tyrp1 for copper , we generated copper- like pigmentation in wildtype individuals using CRISPR-Cas9 genome editing of Tyrp1 . The combination of SNP genome association data with CRISPR-Cas9 functional genomics results strongly implicates Tyrp1 as the copper locus. The copper deletion is predicted to alter the Tyrp1 coding sequence and introduce a premature stop codon in exon 6, yielding a truncated protein with an altered function. We note that the exon 6 deletion in copper Tyrp1 parallels an exon 6 deletion identified in the first human case report of OCA3 14 , with both deletions leading to a premature stop codon. No Tyrp1 mRNA or protein was detected in the human case while Tyrp1 transcripts were recovered by BSR-Seq in copper axolotls, albeit at lower transcript abundances. It remains to be determined if a copper Tyrp1 protein is generated in axolotl and if the truncated product retains functional properties. Domestic plant and animal populations have long served as reservoirs for phenotypes of commercial, biological, and biomedical relevance 17 – 19 . While the pet trade has gained access to axolotls from research labs, including for example GFP transgenics, axolotl researchers have not assessed commercial and domestic populations for new research models. Now that Tyrp1 has been identified as the causative gene for copper , this new axolotl model can be used to study molecular functions underlying OCA3 phenotypes. As is observed in humans with OCA3, copper is characterized by a reduction in melanin. A reduction in melanin could trace to many different cellular mechanisms as Tyrp1 functions in multiple pathways that directly or indirectly regulate melanin biosynthesis, as well as affecting melanophore cell division and death 20 . In addition to copper , other axolotl pigment variants in the pet trade include hypomelanistic, which is characterized by a reduction in melanin and UV-light excitable face/cranium fluorescence, and “starburst” which presents increased numbers of iridophores in albino axolotls. These and other phenotypic variants in the axolotl pet trade may provide useful models for biological research. Materials and Methods Approval for Animal Experiments Animal care procedures were approved under University of Kentucky IACUC protocol 2017–2580 and performed in accordance with ARRIVE 21 (Percie du Sert et al 2020) and AAALAC 22 (National Research Council 2011) guidelines and standards. Animal Procedures Axolotls used in this study were obtained from a commercial population (Strohls Herptiles: wildtype and copper sibling larvae) and the Ambystoma Genetic Stock Center (AGSC RRID:SCR_006372; wildtype axolotl embryos RRID:AGSC_100E). All experiments were performed using either 50% (pre-hatching) or 100% (post-hatching) axolotl rearing water (ARW: 1.75 g NaCl, 100 mg MgSO4, 50 mg CaCl2, and 25 mg KCl per liter, buffered with NaHCO3 to pH 7.3–7.5) in a room maintained at 17–18°C. Larvae were housed in glass or polypropylene bowls at either low density (8–10 per bowl) or one per container. After larvae reached 5 cM they were transferred to 9 liter boxes on an Aquatic Enterprises recirculating system. Larvae were initially fed newly hatched brine shrimp until 3 cM total body length and then transitioned to California Black worms (J&R Enterprises) until large enough to be fed fish pellets (Rangen). Animals were anesthetized using a 0.02% benzocaine solution. Benzocaine was first dissolved in 4 ml 100% EtOH and then the chemical and solvent were diluted in 1 liter of ARW. Bulked Segregant RNA-Seq A total of 36 copper and 27 wildtype sibs were sampled from a cross between a homozygous copper male and a heterozygous female carrier and reared to approximately 3 cM. Tail tissue was collected from each while under benzocaine anesthesia. The resulting tail tips were pooled into separate 1.7 ml plastic tubes and flash frozen with dry ice to create copper and wildtype bulk segregant pools for RNA isolation. Tail tissue samples were dissociated with 23- and 26-gauge needles, and RNA was isolated with TRIzol and then further purified using a QIAGEN RNeasy Mini Kit with DNase treatment. The resulting RNA pools were used to generate outsourced Poly(A) RNA-seq libraries that were sequenced on an Illumina NovaSeq X Plus (150 bp paired end reads) by Novogene. Reads from each pool of copper or wildtype individuals were mapped to the axolotl genome assembly 23 using HiSat2 24 (Kim et al 2019). SNPs were identified using BCFtools 25 and significantly different SNP frequencies at polymorphic sites were identified using Popoolation2 26 , and then further assessed for association with the copper phenotype using Fishers-Exact tests 27 . RNA sequence data will be published in the Short Read Archive at the National Center for Biotechnology Information. CRISPR-Cas9 disruption of Tyrp1 Two guide RNAs (gRNAs) (CTGGCCACTGCGGAGAGCCT, TTTGTCCTCCAGTTCCATTC) were designed to target the 2nd and 6th exons, respectively, of axolotl Tyrp1 (TYRP1|AMEX60DD301043361.1). To generate targeted mutations, gRNAs were first duplexed with Alt-R tracrRNA, aliquoted and stored at -80⁰ C. All RNA products were synthesized by Integrated DNA Technologies. Guide RNAs and Alt-R tracrRNA were mixed with Cas9 ribonucleoprotein and injected into 100, 1-cell stage wildtype AGSC embryos as described previously 28 . A total of 12 injected embryos were reared to approximately 3 cM and tail tissue was collected from each while under benzocaine anesthesia. During animal rearing, larvae were fed brine shrimp. The resulting tail tips were placed into separate 1.7 ml plastic tubes and placed on ice for DNA isolation. DNA isolations were performed using a New England Biolabs (NEB) Monarch genomic DNA isolation kit. DNA concentrations were determined using a Nanodrop (Thermo Scientific) and all samples were diluted to 30 ng /ul for PCR. PCR primers were designed to amplify DNA amplicons spanning gRNA target sites. PCR amplicons were treated with NEB Exo-CIP and shipped to Eurofins for Sanger sequencing. The resulting sequences were compared using Geneious Prime software to evaluate CRISPR editing. Tyrp1 PCR and DNA Sequencing Homozygous copper and wildtype (axolotls not carrying copper alleles) larvae were sampled from two separate spawns. PCR was performed to amplify Tyrp1 exon 6 genomic sequence from 4 individuals (2 copper , 2, wildtype ) and the resulting amplicons were sequenced as described above. The resulting sequences were aligned using Geneious Prime software and searched for polymorphisms. Declarations Acknowledgements This work was funded by the Office of Infrastructure Programs at the National Institutes of Health (R24OD010435, P40OD019794). Author Contributions R.F.C. performed animal care procedures, collected tissues for RNA and DNA isolation, isolated RNA and DNA, designed PCR primers and gRNAs for CRISPR-CAS9, performed PCR, prepared samples for RNA and DNA sequencing, analyzed and summarized results from PCR and DNA sequencing, and contributed to writing of the manuscript. L.S. contributed to study design, supplied copper and wildtype larvae for RNA-Seq, provided information about axolotl stocks in the pet trade, assessed candidate genes for association to copper, and contributed to writing of the manuscript. M.T. and J.S. performed animal care procedures and took pictures of salamanders. N.T. developed and applied methods and pipelines for bioinformatic analyses and contributed to writing of the manuscript. J.J.S. contributed to study design, developed and applied methods and pipelines for bioinformatic analyses, summarized results from bioinformatic analyses, and contributed to writing of the manuscript. S.R.V. contributed to study design, performed animal care procedures, collected tissues for RNA and DNA isolation, performed embryo microinjections, photographed salamanders, analyzed, and summarized results from the study, and drafted the original manuscript. Competing Interests The authors have no competing interests. Data Availability Raw DNA sequence reads and transcript abundance estimates may be found under GEO GSE269079. References Voss, S.R., Epperlein, H.H. & Tanaka, E.M. Ambystoma mexica­num , the axolotl: A versatile amphibian model for regeneration, development, and evolution studies. Cold Spring Harbor Protocols 8, art. pdb.emo128 (2009). Voss, S. R., Woodcock, M. R. & Zambrano, L. A tale of two axolotls. Bioscience 65 , 1134–1140 (2015). Woodcock, M.R., et al. Identification of mutant genes and introgressed tiger salamander DNA in the laboratory axolotl, Ambystoma mexicanum. Sci. Rep. 7 , 6 (2017) . Smith HM. 1989. Discovery of the axolotl and its early history in biological research. In: Developmental Biology of the Axolotl (eds Armstrong, J.B., Malacinski, G.M.) 3-12 (Oxford University Press 1989). Humphrey RR, Bagnara JT. A Color Variant in the Mexican Axolotl. J. Hered. 58 , 251–256 (1967). Kabangu, M., et al. Leukocyte tyrosine kinase ( Ltk ) is the mendelian determinant of the axolotl melanoid color variant. Genes (Basil) 14 , 904 (2023). Humphrey, R.R. 1967. Albino axolotls from an albino tiger salamander through hybridization. J. Hered. 58 , 95-101 (1967). Lyerla, T.A. & Dalton, H.C. 1971. Genetic and developmental characteristics of a new color variant, axanthic , in the Mexican axolotl, Ambystoma mexicanum Shaw. Dev. Biol . 24, 1-18 (1971). Liu, S., Yeh, C-T, Tang, H.M., Nettleton, D. & Schnable, P.S. Gene mapping via bulked segregant RNA-Seq (BSR-Seq). PLoS ONE 7 , e36406 (2012). Doudna, J.A. & Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346 , 1258096 (2014). Jackson, I.J. A cDNA encoding tyrosinase-related protein maps to the brown locus in mouse. Proc. Nat. Acad. Sci. U.S.A. 85 , 4392–4396 (1988). Schmidt-Küntzel, A., Eizirik, E., O'Brien, S.J. & Menotti-Raymond, M. Tyrosinase and tyrosinase related protein 1 alleles specify domestic cat coat color phenotypes of the albino and brown loci. J. Hered. 96 , 289-301 (2005). Peterson, S.M., et al. Genetic variants in melanogenesis proteins TYRP1 and TYR are associated with the golden rhesus macaque phenotype. G3 (Bethesda) 13, jkad168 (2023). Boissy, R.E. et al. Mutation in and lack of expression of tyrosinase-related protein-1 (TRP-1) in melanocytes from an individual with brown oculocutaneous albinism: a new subtype of albinism classified as "OCA3". Am. J. Hum. Genet. 58 , 1145-56 (1996). Bordzilovskaya, N. P., Dettlaff, T. A., Duhon, S. T. & Malacinski, G. M. Developmental stage series of axolotl embryos. In: Developmental Biology of the Axolotl (eds Armstrong, J.B., Malacinski, G.M.) 201-209 (Oxford University Press 1989). Kenny, E.E. et al. Melanesian blond hair is caused by an amino acid change in TYRP1. Science 336 , 554 (2012). Bennett, D.C. & Lamoreux, M.L. The color loci of mice--a genetic century. Pigment Cell Res. 16 , 333-44 (2003). Andersson, L. 2016. Domestic animals as models for biomedical research. Upsala J. Med. Sci. 121 , 1–11 (2016). Kantar ,M.B., Nashoba, A.R., Anderson, J.E., Blackman, B.K. & Rieseberg, L.H. The genetics and genomics of plant domestication. BioScience 67 , 971–982 (2017). Kamaraj, B., Purohit, R. 2014. Mutational analysis of oculocutaneous albinism: a compact review. Biomed. Res. Int. 2014, 905472 (2014). Percie du Sert, N. et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol 18 , e3000410 (2020). National Research Council. 2011. Guide for the Care and Use of Laboratory Animals: Eighth Edition . The National Academies Press, https://doi.org/10.17226/12910 (2011). Schloissnig. S. et al. The giant axolotl genome uncovers the evolution, scaling and transcriptional control of complex gene loci. Proc. Nat. Acad. Sci. U.S.A. 118 , e2017176118 (2021). Kim, D. et al. 2019. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37 , 907–915 (2019). Li, H. 2011. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 27 , 2987-93 (2011). Kofler, R., Pandey, R.V., Schlötterer, C. 2011. PoPoolation2: Identifying differentiation between populations using sequencing of pooled DNA samples (Pool-Seq). Bioinformatics 27 , 3435-6 (2011). Fisher, R.A. Statistical methods for research workers , 5th ed. Oliver & Boyd, Edinburgh (1934). Trofka, A. et al. Genetic basis for an evolutionary shift from ancestral preaxial to postaxial limb polarity in non-urodele vertebrates. Curr. Biol. 31 , 4923-4934 (2021). Additional Declarations No competing interests reported. Supplementary Files Supp1.pdf Supplementary File 1. Manhattan plot showing the degree of association of segregating genotypes with copper phenotype vs wildtype in BSR-Seq pools. Values shown are -log10(p-values) from Fisher's exact tests. Supp2.pdf Supplementary File 2. Nucleotide sequences generated from RNA copper and wildtype BSA-RNA-Seq pools. Supp3.pdf Supplementary File 3. Predicted amino acid sequences for RNA copper and wildtype BSA-RNA-Seq pools. Cite Share Download PDF Status: Published Journal Publication published 27 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 20 Aug, 2024 Reviews received at journal 16 Aug, 2024 Reviewers agreed at journal 15 Aug, 2024 Reviews received at journal 25 Jun, 2024 Reviewers agreed at journal 22 Jun, 2024 Reviewers invited by journal 21 Jun, 2024 Editor assigned by journal 21 Jun, 2024 Editor invited by journal 11 Jun, 2024 Submission checks completed at journal 10 Jun, 2024 First submitted to journal 05 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4536099","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":317917430,"identity":"5819002f-16f5-47ce-8190-9804780b1636","order_by":0,"name":"Raissa F. Cecil","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Raissa","middleName":"F.","lastName":"Cecil","suffix":""},{"id":317917432,"identity":"f230aa63-2cb0-40d8-a4cc-49d96eeb737d","order_by":1,"name":"Lloyd Strohl","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Lloyd","middleName":"","lastName":"Strohl","suffix":""},{"id":317917433,"identity":"d4318712-6450-4478-bb59-a5c8e0a49a8d","order_by":2,"name":"Maddie K. Thomas","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Maddie","middleName":"K.","lastName":"Thomas","suffix":""},{"id":317917434,"identity":"2d69bd22-e41c-44d6-8782-3f1dd18defb2","order_by":3,"name":"James L. Schwartz","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"James","middleName":"L.","lastName":"Schwartz","suffix":""},{"id":317917435,"identity":"c46a8c40-7d9f-4203-99eb-177817cf3f25","order_by":4,"name":"Nataliya Timoshevskaya","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Nataliya","middleName":"","lastName":"Timoshevskaya","suffix":""},{"id":317917437,"identity":"658f5ddb-4e43-484b-8c35-8e563b36a58c","order_by":5,"name":"Jeramiah J. Smith","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Jeramiah","middleName":"J.","lastName":"Smith","suffix":""},{"id":317917438,"identity":"5339ae71-2334-484f-9341-dfc212a0e60c","order_by":6,"name":"S. Randal Voss","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAq0lEQVRIiWNgGAWjYPACGwYJEMVDgpY00rUcJkGL/Owzhg9//DmfOHNGAuODt21EaDE4l2NszNt2O3G2RAKz4VyitPCwpUkzNtxOnCeRwCbNS4wW+R62NMkff86BtLD/JkoLwxnmYxI8bAdADmNjJkqLwRnmw0C/JBvP7HnYLDnnHFEOY2wEhpid7IzjyQc/vCkjxmFwIJDYQJJ6IOA/QKqOUTAKRsEoGCkAAKF3M28x8P10AAAAAElFTkSuQmCC","orcid":"","institution":"University of Kentucky","correspondingAuthor":true,"prefix":"","firstName":"S.","middleName":"Randal","lastName":"Voss","suffix":""}],"badges":[],"createdAt":"2024-06-05 20:23:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4536099/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4536099/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-73283-1","type":"published","date":"2024-09-27T15:58:01+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59283669,"identity":"9e992dfd-f961-475f-be64-e5972ae8e970","added_by":"auto","created_at":"2024-06-28 16:00:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":626720,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of \u003cem\u003eTyrp1 \u003c/em\u003eas a candidate gene for \u003cem\u003ecopper\u003c/em\u003e. A) Plot showing genome wide SNP (allele) frequency differences between \u003cem\u003ecopper \u003c/em\u003eand wildtype BSA-RNA-Seq pools. B) Transcript counts identified for \u003cem\u003eTyrp1 \u003c/em\u003ebetween \u003cem\u003ecopper \u003c/em\u003eand wildtype BSA-RNA-Seq pools. C) Genomic map of the axolotl \u003cem\u003eTyrp1 \u003c/em\u003elocus and deletion detected in exon 6 between \u003cem\u003ecopper \u003c/em\u003eand wildtype alleles.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/f2e37d12325d76a5b19c2863.png"},{"id":59283665,"identity":"551a8394-9675-4000-bcb2-b84330a94c81","added_by":"auto","created_at":"2024-06-28 16:00:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":933085,"visible":true,"origin":"","legend":"\u003cp\u003eCRISPR-CAS9 knockdown of \u003cem\u003eTyrp1\u003c/em\u003e. Melanin pigmentation was greatly reduced in F0 \u003cem\u003eTyrp1 \u003c/em\u003ecrispant larvae relative to F0 non-injected control siblings. F0 \u003cem\u003eTyrp1 \u003c/em\u003ecrispant electropherograms showed overlapping sequence traces at the gRNA target site for forward and reverse DNA sequencing reactions, consistent with genome editing. F0 non-injected control DNA sequence does not show evidence of genome editing. The gRNA target sequence (underlined) overlaps the deleted nucleotide in the \u003cem\u003ecopper Tyrp1 \u003c/em\u003eallele.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/bfde47dad5c559ca15cd373f.png"},{"id":59283667,"identity":"54d3ebda-c280-456d-9fa9-2055615c6703","added_by":"auto","created_at":"2024-06-28 16:00:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1934015,"visible":true,"origin":"","legend":"\u003cp\u003eImages of\u003cstrong\u003e \u003c/strong\u003eF0 \u003cem\u003eTyrp1 \u003c/em\u003ecrispants relative to a wildtype axolotl and \u003cem\u003ecopper \u003c/em\u003emutant. Salamanders are 15-18 cM total body length and 1-1.2 years old.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/19f92468150e7ac72e7af7f6.png"},{"id":65627359,"identity":"a425b4af-9acd-4aa8-9a1f-f9a9528af274","added_by":"auto","created_at":"2024-09-30 16:15:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3944228,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/adc60fb5-4876-4109-8778-cc0cf886d122.pdf"},{"id":59283671,"identity":"db948f6b-7d62-404f-ab2a-806022d37c73","added_by":"auto","created_at":"2024-06-28 16:00:55","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":36305,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary File 1. \u003c/strong\u003eManhattan plot showing the degree of association of segregating genotypes with \u003cem\u003ecopper \u003c/em\u003ephenotype\u003cem\u003e \u003c/em\u003evs wildtype in BSR-Seq pools. Values shown are -log10(p-values) from Fisher's exact tests.\u003c/p\u003e","description":"","filename":"Supp1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/39aa67249196b5beb9a20439.pdf"},{"id":59283670,"identity":"33d5ee7e-074c-4341-9316-7c41703a2396","added_by":"auto","created_at":"2024-06-28 16:00:55","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":35626,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary File 2. \u003c/strong\u003eNucleotide sequences generated from RNA \u003cem\u003ecopper \u003c/em\u003eand wildtype BSA-RNA-Seq pools.\u003c/p\u003e","description":"","filename":"Supp2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/52f800c9aa9cd422f0326aaa.pdf"},{"id":59283666,"identity":"42835edb-92b9-4d78-9910-1f64ab106988","added_by":"auto","created_at":"2024-06-28 16:00:54","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":218892,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary File 3. \u003c/strong\u003ePredicted amino acid sequences for RNA \u003cem\u003ecopper \u003c/em\u003eand wildtype BSA-RNA-Seq pools.\u003c/p\u003e","description":"","filename":"Supp3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4536099/v1/ff55c460cc36c4d64394cdbc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tyrp1 is the Mendelian Determinant of the Axolotl (Ambystoma mexicanum) Copper Mutant","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe axolotl (\u003cem\u003eAmbystoma mexicanum\u003c/em\u003e) has a long and storied history in biological research. Axolotls provide models for studies of embryonic and post-embryonic development, including most famously the study of whole organ regeneration\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The primary stock center for axolotl research is a captive bred population that has been maintained for almost 100 years\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Many mutants have been maintained in this population over time, including four different color mutants that are determined by single genes: \u003cem\u003ewhite, melanoid, albino\u003c/em\u003e, and \u003cem\u003eaxanthic\u003c/em\u003e. Each of these mutants has an interesting history. The \u003cem\u003ewhite\u003c/em\u003e mutant was presumably collected from Mexico in 1862 along with 33 wildtype individuals\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. These axolotls were transported to Paris to establish the first laboratory axolotl population. The \u003cem\u003ewhite\u003c/em\u003e mutant is caused by a \u003cem\u003eEdn3\u003c/em\u003e splicing defect\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003emelanoid\u003c/em\u003e mutant was originally identified from laboratory crosses made using wild-caught axolotls from Mexico, and like \u003cem\u003ewhite, melanoid\u003c/em\u003e is presumably also a natural color variant\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Subsequent analyses revealed that \u003cem\u003emelanoid\u003c/em\u003e is genetically associated with \u003cem\u003eLtk\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Similarly, \u003cem\u003ealbino\u003c/em\u003e was originally identified in a wild captured tiger salamander and crossed into axolotl stocks\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In contract axanthic appears to have arisen spontaneously within a laboratory axolotl strain\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Although the gene for \u003cem\u003eaxanthic\u003c/em\u003e has not been identified, Woodcock et al\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e showed that \u003cem\u003ealbino\u003c/em\u003e is caused by a deletion in the \u003cem\u003eTyr\u003c/em\u003e coding sequence.\u003c/p\u003e \u003cp\u003eFor as long as axolotls have been studied in research, they have also been highly prized as aquarium pets. All axolotl color mutants known to biological research, and even transgenic axolotls, are available in the pet trade. Additionally, pet breeders have identified color variants that have not received biological study, including a Mendelian mutant called \u003cem\u003ecopper\u003c/em\u003e. Pet breeders describe \u003cem\u003ecopper\u003c/em\u003e axolotls as having copper-colored bodies with yellow xanthophores, brownish melanophores, and iridescent iridophores. The brownish and not black color of melanophores suggests \u003cem\u003ecopper\u003c/em\u003e is a form of albinism, perhaps involving mutation of a melanin synthesis protein. Given the importance of animal models in the study of albinism diseases, we used bulked segregant RNA-Seq (BSR-Seq)\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e and CRISPR-Cas9\u003csup\u003e10\u003c/sup\u003e to identify \u003cem\u003eTyrp1\u003c/em\u003eas the \u003cem\u003ecopper\u003c/em\u003e locus. Our results suggest that commercial and private axolotl collections may harbor genetic variants that may prove useful as animal models in biological research.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eBulk segregant RNA-Seq identified a candidate gene for\u003c/b\u003e \u003cb\u003ecopper\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBSR-Seq\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e was used to identify SNPs linked to the \u003cem\u003ecopper\u003c/em\u003e locus. Embryos from a cross that segregated \u003cem\u003ecopper\u003c/em\u003e and wildtype individuals were used to create two \u003cem\u003ecopper\u003c/em\u003e and two wildtype RNA pools (N\u0026thinsp;=\u0026thinsp;36 and 27 for \u003cem\u003ecopper\u003c/em\u003e and \u003cem\u003ewildtype\u003c/em\u003e respectively, per pool) that were each subjected to Illumina short-read RNA sequencing to identify single nucleotide polymorphisms (SNPs). Analysis of SNPs across the axolotl genome revealed a region on chromosome 6p with dissimilar frequencies between the pools (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea; Supplementary File 1). Examination of genes within this region identified \u003cem\u003eTyrosinase-like protein 1\u003c/em\u003e (\u003cem\u003eTyrp1\u003c/em\u003e) as a candidate gene. \u003cem\u003eTyrp1\u003c/em\u003e encodes an enzyme that functions in melanin synthesis. \u003cem\u003eTyrp1\u003c/em\u003e mutations generate lighter than black melanin shades of color in animal models\u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e and Oculocutaneous Albinism 3 (OCA3) in humans\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Additionally, approximately 4x more \u003cem\u003eTyrp1\u003c/em\u003e transcripts were identified from the wild-type vs \u003cem\u003ecopper\u003c/em\u003e RNA-Seq pools, suggestive of an expression difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). The axolotl \u003cem\u003eTyrp1\u003c/em\u003e locus (AMEX60DD301043361.1) is distributed across 8 exons and the 1663 bp coding sequence encodes a 524 amino acid protein. A single nucleotide deletion (chr6p:1,225,541,490) was identified in RNA-Seq reads generated for the \u003cem\u003ecopper\u003c/em\u003e RNA pool (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec; Supplementary File 2). This deletion, in exon 6, was confirmed by sequencing genomic DNA isolated from two \u003cem\u003ecopper\u003c/em\u003e and two wildtype individuals that were used to construct the RNA BSR-Seq pools (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). The deletion in the \u003cem\u003ecopper Tyrp1\u003c/em\u003e sequence is predicted to change the reading frame and introduce a premature stop codon at amino acid position 416 (Supplementary File 3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCRISPR-Cas9 disruption of\u003c/b\u003e \u003cb\u003eTyrp1\u003c/b\u003e \u003cb\u003ephenocopies\u003c/b\u003e \u003cb\u003ecopper\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCRISPR-CAS9\u003csup\u003e10\u003c/sup\u003e was performed to determine if disruption of the \u003cem\u003eTyrp1\u003c/em\u003e coding sequence would yield individuals that presented \u003cem\u003ecopper\u003c/em\u003e pigmentation. Two guide RNAs targeting exons 2 and 6 of the \u003cem\u003eTyrp1\u003c/em\u003e coding sequence were injected into 100, one-cell stage wildtype embryos and visually assessed for color at developmental stage 42\u003csup\u003e15\u003c/sup\u003e. Crispant individuals were characterized by having fewer melanophores than non-injected controls and presented a yellowish overall color, as is typical of \u003cem\u003ecopper\u003c/em\u003e larvae in the pet trade. PCR and DNA sequencing of \u003cem\u003eTyrp1\u003c/em\u003e regions targeted by CRISPR-Cas9 confirmed that crispant embryos (N\u0026thinsp;=\u0026thinsp;12) were edited at either one or both gRNA-target sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Five \u003cem\u003eTyrp1\u003c/em\u003e crispants were reared to approximately 17 cM total body length (1.2 years old) and photographed to document pigmentation. Relative to the yellowish color observed during the larval stage, all five \u003cem\u003eTyrp1\u003c/em\u003e crispants presented a darker copper skin color that was very similar to the color of adult \u003cem\u003ecopper\u003c/em\u003e axolotls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The pigmentation phenotypes resulting from CRISPR-Cas9 genome editing strongly implicate \u003cem\u003eTyrp1\u003c/em\u003e as the gene for \u003cem\u003ecopper.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSeveral different axolotl pigmentation variants are present in laboratories and households around the world. Several of these variants, including \u003cem\u003ewhite, albino\u003c/em\u003e and \u003cem\u003emelanoid\u003c/em\u003e, have received considerable attention in biological research. Previously, we identified genes for these variants to increase their value as research models\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. In this study we identified a new gene in an axolotl pigmentation variant known only from the pet trade. Specifically, we show that \u003cem\u003ecopper\u003c/em\u003e, an axolotl mutant with copper coloration, is likely determined by a single nucleotide deletion in the \u003cem\u003eTyrp1\u003c/em\u003e coding sequence. \u003cem\u003eTyrp1\u003c/em\u003e encodes an enzyme that functions in melanophores to produce a black pigment called melanin. Mutations in \u003cem\u003eTyrp1\u003c/em\u003e are associated with decreased production of melanin and structural alterations that result in lighter than expected coloration, for example brown coat color in mice\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e and blonde hair in Melanesian humans\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003ecopper\u003c/em\u003e axolotls in the larval stage have fewer dark pigmented melanophores than those observed in wildtype animals, and in absence of melanophores pigmentation is primarily determined by yellow xanthophores. As \u003cem\u003ecopper\u003c/em\u003e axolotls age, a brownish pigment emerges and individuals developed a uniform copper skin color, as is typical of animal models with \u003cem\u003eTyrp1\u003c/em\u003e mutations. To functionally validate \u003cem\u003eTyrp1\u003c/em\u003e for \u003cem\u003ecopper\u003c/em\u003e, we generated \u003cem\u003ecopper-\u003c/em\u003elike pigmentation in wildtype individuals using CRISPR-Cas9 genome editing of \u003cem\u003eTyrp1\u003c/em\u003e. The combination of SNP genome association data with CRISPR-Cas9 functional genomics results strongly implicates \u003cem\u003eTyrp1\u003c/em\u003e as the \u003cem\u003ecopper\u003c/em\u003e locus.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ecopper\u003c/em\u003e deletion is predicted to alter the \u003cem\u003eTyrp1\u003c/em\u003e coding sequence and introduce a premature stop codon in exon 6, yielding a truncated protein with an altered function. We note that the exon 6 deletion in \u003cem\u003ecopper Tyrp1\u003c/em\u003e parallels an exon 6 deletion identified in the first human case report of OCA3\u003csup\u003e14\u003c/sup\u003e, with both deletions leading to a premature stop codon. No \u003cem\u003eTyrp1\u003c/em\u003e mRNA or protein was detected in the human case while \u003cem\u003eTyrp1\u003c/em\u003e transcripts were recovered by BSR-Seq in \u003cem\u003ecopper\u003c/em\u003e axolotls, albeit at lower transcript abundances. It remains to be determined if a \u003cem\u003ecopper Tyrp1\u003c/em\u003e protein is generated in axolotl and if the truncated product retains functional properties.\u003c/p\u003e \u003cp\u003eDomestic plant and animal populations have long served as reservoirs for phenotypes of commercial, biological, and biomedical relevance\u003csup\u003e\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. While the pet trade has gained access to axolotls from research labs, including for example GFP transgenics, axolotl researchers have not assessed commercial and domestic populations for new research models. Now that \u003cem\u003eTyrp1\u003c/em\u003e has been identified as the causative gene for \u003cem\u003ecopper\u003c/em\u003e, this new axolotl model can be used to study molecular functions underlying OCA3 phenotypes. As is observed in humans with OCA3, \u003cem\u003ecopper\u003c/em\u003e is characterized by a reduction in melanin. A reduction in melanin could trace to many different cellular mechanisms as \u003cem\u003eTyrp1\u003c/em\u003e functions in multiple pathways that directly or indirectly regulate melanin biosynthesis, as well as affecting melanophore cell division and death\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. In addition to \u003cem\u003ecopper\u003c/em\u003e, other axolotl pigment variants in the pet trade include hypomelanistic, which is characterized by a reduction in melanin and UV-light excitable face/cranium fluorescence, and \u0026ldquo;starburst\u0026rdquo; which presents increased numbers of iridophores in \u003cem\u003ealbino\u003c/em\u003e axolotls. These and other phenotypic variants in the axolotl pet trade may provide useful models for biological research.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eApproval for Animal Experiments\u003c/h2\u003e \u003cp\u003eAnimal care procedures were approved under University of Kentucky IACUC protocol 2017\u0026ndash;2580 and performed in accordance with ARRIVE\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e (Percie du Sert et al 2020) and AAALAC\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e (National Research Council 2011) guidelines and standards.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAnimal Procedures\u003c/h2\u003e \u003cp\u003eAxolotls used in this study were obtained from a commercial population (Strohls Herptiles: wildtype and \u003cem\u003ecopper\u003c/em\u003e sibling larvae) and the Ambystoma Genetic Stock Center (AGSC RRID:SCR_006372; wildtype axolotl embryos RRID:AGSC_100E). All experiments were performed using either 50% (pre-hatching) or 100% (post-hatching) axolotl rearing water (ARW: 1.75 g NaCl, 100 mg MgSO4, 50 mg CaCl2, and 25 mg KCl per liter, buffered with NaHCO3 to pH 7.3\u0026ndash;7.5) in a room maintained at 17\u0026ndash;18\u0026deg;C. Larvae were housed in glass or polypropylene bowls at either low density (8\u0026ndash;10 per bowl) or one per container. After larvae reached 5 cM they were transferred to 9 liter boxes on an Aquatic Enterprises recirculating system. Larvae were initially fed newly hatched brine shrimp until 3 cM total body length and then transitioned to California Black worms (J\u0026amp;R Enterprises) until large enough to be fed fish pellets (Rangen). Animals were anesthetized using a 0.02% benzocaine solution. Benzocaine was first dissolved in 4 ml 100% EtOH and then the chemical and solvent were diluted in 1 liter of ARW.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBulked Segregant RNA-Seq\u003c/h2\u003e \u003cp\u003eA total of 36 \u003cem\u003ecopper\u003c/em\u003e and 27 wildtype sibs were sampled from a cross between a homozygous \u003cem\u003ecopper\u003c/em\u003e male and a heterozygous female carrier and reared to approximately 3 cM. Tail tissue was collected from each while under benzocaine anesthesia. The resulting tail tips were pooled into separate 1.7 ml plastic tubes and flash frozen with dry ice to create \u003cem\u003ecopper\u003c/em\u003e and wildtype bulk segregant pools for RNA isolation. Tail tissue samples were dissociated with 23- and 26-gauge needles, and RNA was isolated with TRIzol and then further purified using a QIAGEN RNeasy Mini Kit with DNase treatment. The resulting RNA pools were used to generate outsourced Poly(A) RNA-seq libraries that were sequenced on an Illumina NovaSeq X Plus (150 bp paired end reads) by Novogene. Reads from each pool of \u003cem\u003ecopper\u003c/em\u003e or wildtype individuals were mapped to the axolotl genome assembly\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e using HiSat2\u003csup\u003e24\u003c/sup\u003e (Kim et al 2019). SNPs were identified using BCFtools\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e and significantly different SNP frequencies at polymorphic sites were identified using Popoolation2\u003csup\u003e26\u003c/sup\u003e, and then further assessed for association with the copper phenotype using Fishers-Exact tests\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. RNA sequence data will be published in the Short Read Archive at the National Center for Biotechnology Information.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCRISPR-Cas9 disruption of\u003c/b\u003e \u003cb\u003eTyrp1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTwo guide RNAs (gRNAs) (CTGGCCACTGCGGAGAGCCT, TTTGTCCTCCAGTTCCATTC) were designed to target the 2nd and 6th exons, respectively, of axolotl \u003cem\u003eTyrp1\u003c/em\u003e (TYRP1|AMEX60DD301043361.1). To generate targeted mutations, gRNAs were first duplexed with Alt-R tracrRNA, aliquoted and stored at -80⁰ C. All RNA products were synthesized by Integrated DNA Technologies. Guide RNAs and Alt-R tracrRNA were mixed with Cas9 ribonucleoprotein and injected into 100, 1-cell stage wildtype AGSC embryos as described previously\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. A total of 12 injected embryos were reared to approximately 3 cM and tail tissue was collected from each while under benzocaine anesthesia. During animal rearing, larvae were fed brine shrimp. The resulting tail tips were placed into separate 1.7 ml plastic tubes and placed on ice for DNA isolation. DNA isolations were performed using a New England Biolabs (NEB) Monarch genomic DNA isolation kit. DNA concentrations were determined using a Nanodrop (Thermo Scientific) and all samples were diluted to 30 ng /ul for PCR. PCR primers were designed to amplify DNA amplicons spanning gRNA target sites. PCR amplicons were treated with NEB Exo-CIP and shipped to Eurofins for Sanger sequencing. The resulting sequences were compared using Geneious Prime software to evaluate CRISPR editing.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTyrp1\u003c/b\u003e \u003cb\u003ePCR and DNA Sequencing\u003c/b\u003e\u003c/p\u003e \u003cp\u003eHomozygous \u003cem\u003ecopper\u003c/em\u003e and wildtype (axolotls not carrying \u003cem\u003ecopper\u003c/em\u003e alleles) larvae were sampled from two separate spawns. PCR was performed to amplify \u003cem\u003eTyrp1\u003c/em\u003e exon 6 genomic sequence from 4 individuals (2 \u003cem\u003ecopper\u003c/em\u003e, 2, \u003cem\u003ewildtype\u003c/em\u003e) and the resulting amplicons were sequenced as described above. The resulting sequences were aligned using Geneious Prime software and searched for polymorphisms.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the Office of Infrastructure Programs at the National Institutes of Health (R24OD010435, P40OD019794).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eR.F.C. performed animal care procedures, collected tissues for RNA and DNA isolation, isolated RNA and DNA, designed PCR primers and gRNAs for CRISPR-CAS9, performed PCR, prepared samples for RNA and DNA sequencing, analyzed and summarized results from PCR and DNA sequencing, and contributed to writing of the manuscript. L.S. contributed to study design, supplied \u003cem\u003ecopper\u0026nbsp;\u003c/em\u003eand wildtype larvae for RNA-Seq, provided information about axolotl stocks in the pet trade, assessed candidate genes for association to \u003cem\u003ecopper,\u0026nbsp;\u003c/em\u003eand contributed to writing of the manuscript. M.T. and J.S. performed animal care procedures and took pictures of salamanders. N.T. developed and applied methods and pipelines for bioinformatic analyses and contributed to writing of the manuscript. J.J.S. contributed to study design, developed and applied methods and pipelines for bioinformatic analyses, summarized results from bioinformatic analyses, and contributed to writing of the manuscript. S.R.V. contributed to study design, performed animal care procedures, collected tissues for RNA and DNA isolation, performed embryo microinjections, photographed salamanders, analyzed, and summarized results from the study, and drafted the original manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaw DNA sequence reads and transcript abundance estimates may be found under GEO GSE269079.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVoss, S.R., Epperlein, H.H. \u0026amp; Tanaka, E.M. \u003cem\u003eAmbystoma mexica\u0026shy;num\u003c/em\u003e, the axolotl: A versatile amphibian model for regeneration, development, and evolution studies. Cold Spring Harbor Protocols 8, art. pdb.emo128 (2009).\u003c/li\u003e\n\u003cli\u003eVoss, S. R., Woodcock, M. R. \u0026amp; Zambrano, L. A tale of two axolotls. \u003cem\u003eBioscience\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 1134\u0026ndash;1140 (2015).\u003c/li\u003e\n\u003cli\u003eWoodcock, M.R., et al. Identification of mutant genes and introgressed tiger salamander DNA in the laboratory axolotl, \u003cem\u003eAmbystoma mexicanum. Sci. Rep. \u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, 6 (2017)\u003cem\u003e.\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eSmith HM. 1989. Discovery of the axolotl and its early history in biological research. In: \u003cem\u003eDevelopmental Biology of the Axolotl \u003c/em\u003e(eds Armstrong, J.B., Malacinski, G.M.) 3-12 (Oxford University Press 1989).\u003c/li\u003e\n\u003cli\u003eHumphrey RR, Bagnara JT. A Color Variant in the Mexican Axolotl. \u003cem\u003eJ. Hered.\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 251\u0026ndash;256 (1967).\u003c/li\u003e\n\u003cli\u003eKabangu, M., et al. \u003cem\u003eLeukocyte tyrosine kinase\u003c/em\u003e (\u003cem\u003eLtk\u003c/em\u003e) is the mendelian determinant of the axolotl melanoid color variant. \u003cem\u003eGenes\u003c/em\u003e (Basil) \u003cstrong\u003e14\u003c/strong\u003e, 904 (2023). \u003c/li\u003e\n\u003cli\u003eHumphrey, R.R. 1967. Albino axolotls from an albino tiger salamander through hybridization. \u003cem\u003eJ. Hered.\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 95-101 (1967).\u003c/li\u003e\n\u003cli\u003eLyerla, T.A. \u0026amp; Dalton, H.C. 1971. Genetic and developmental characteristics of a new color variant, \u003cem\u003eaxanthic\u003c/em\u003e, in the Mexican axolotl, \u003cem\u003eAmbystoma mexicanum\u003c/em\u003e Shaw. \u003cem\u003eDev. Biol\u003c/em\u003e. 24, 1-18 (1971).\u003c/li\u003e\n\u003cli\u003eLiu, S., Yeh, C-T, Tang, H.M., Nettleton, D. \u0026amp; Schnable, P.S. Gene mapping via bulked segregant RNA-Seq (BSR-Seq). \u003cem\u003ePLoS ONE\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e36406 (2012).\u003c/li\u003e\n\u003cli\u003eDoudna, J.A. \u0026amp; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e346\u003c/strong\u003e, 1258096 (2014).\u003c/li\u003e\n\u003cli\u003eJackson, I.J. A cDNA encoding tyrosinase-related protein maps to the brown locus in mouse. \u003cem\u003eProc. Nat. Acad. Sci. U.S.A.\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 4392\u0026ndash;4396 (1988).\u003c/li\u003e\n\u003cli\u003eSchmidt-K\u0026uuml;ntzel, A., Eizirik, E., O\u0026apos;Brien, S.J. \u0026amp; Menotti-Raymond, M. Tyrosinase and tyrosinase related protein 1 alleles specify domestic cat coat color phenotypes of the albino and brown loci. \u003cem\u003eJ. Hered.\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 289-301 (2005).\u003c/li\u003e\n\u003cli\u003ePeterson, S.M., et al. Genetic variants in melanogenesis proteins TYRP1 and TYR are associated with the golden rhesus macaque phenotype. \u003cem\u003eG3 \u003c/em\u003e(Bethesda) 13, jkad168 (2023).\u003c/li\u003e\n\u003cli\u003eBoissy, R.E. et al. Mutation in and lack of expression of tyrosinase-related protein-1 (TRP-1) in melanocytes from an individual with brown oculocutaneous albinism: a new subtype of albinism classified as \u0026quot;OCA3\u0026quot;. \u003cem\u003eAm. J. Hum. Genet.\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 1145-56 (1996).\u003c/li\u003e\n\u003cli\u003eBordzilovskaya, N. P., Dettlaff, T. A., Duhon, S. T. \u0026amp; Malacinski, G. M. Developmental stage series of axolotl embryos. In: \u003cem\u003eDevelopmental Biology of the Axolotl \u003c/em\u003e(eds Armstrong, J.B., Malacinski, G.M.) 201-209 (Oxford University Press 1989).\u003c/li\u003e\n\u003cli\u003eKenny, E.E. et al. Melanesian blond hair is caused by an amino acid change in TYRP1. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e336\u003c/strong\u003e, 554 (2012).\u003c/li\u003e\n\u003cli\u003eBennett, D.C. \u0026amp; Lamoreux, M.L. The color loci of mice--a genetic century. \u003cem\u003ePigment Cell Res. \u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e, 333-44 (2003).\u003c/li\u003e\n\u003cli\u003eAndersson, L. 2016. Domestic animals as models for biomedical research. \u003cem\u003eUpsala J. Med. Sci. \u003c/em\u003e\u003cstrong\u003e121\u003c/strong\u003e, 1\u0026ndash;11 (2016). \u003c/li\u003e\n\u003cli\u003eKantar ,M.B., Nashoba, A.R., Anderson, J.E., Blackman, B.K. \u0026amp; Rieseberg, L.H. The genetics and genomics of plant domestication. \u003cem\u003eBioScience\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 971\u0026ndash;982 (2017).\u003c/li\u003e\n\u003cli\u003eKamaraj, B., Purohit, R. 2014. Mutational analysis of oculocutaneous albinism: a compact review. \u003cem\u003eBiomed. Res. Int.\u003c/em\u003e 2014, 905472 (2014).\u003c/li\u003e\n\u003cli\u003ePercie du Sert, N. et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. \u003cem\u003ePLoS Biol\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, e3000410 (2020). \u003c/li\u003e\n\u003cli\u003eNational Research Council. 2011. \u003cem\u003eGuide for the Care and Use of Laboratory Animals: Eighth Edition\u003c/em\u003e. The National Academies Press, https://doi.org/10.17226/12910 (2011). \u003c/li\u003e\n\u003cli\u003eSchloissnig.\u003csup\u003e \u003c/sup\u003eS. et al. The giant axolotl genome uncovers the evolution, scaling and transcriptional control of complex gene loci.\u003cem\u003e Proc. Nat. Acad. Sci. U.S.A.\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u003cstrong\u003e118\u003c/strong\u003e, e2017176118 (2021).\u003c/li\u003e\n\u003cli\u003eKim, D. et al. 2019. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. \u003cem\u003eNat. Biotechnol.\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 907\u0026ndash;915 (2019).\u003c/li\u003e\n\u003cli\u003eLi, H. 2011. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. \u003cem\u003eBioinformatics \u003c/em\u003e\u003cstrong\u003e27\u003c/strong\u003e, 2987-93 (2011).\u003c/li\u003e\n\u003cli\u003eKofler, R., Pandey, R.V., Schl\u0026ouml;tterer, C. 2011. PoPoolation2: Identifying differentiation between populations using sequencing of pooled DNA samples (Pool-Seq). \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 3435-6 (2011).\u003c/li\u003e\n\u003cli\u003eFisher, R.A. \u003cem\u003eStatistical methods for research workers\u003c/em\u003e, 5th ed. Oliver \u0026amp; Boyd, Edinburgh (1934).\u003c/li\u003e\n\u003cli\u003eTrofka, A. et al. Genetic basis for an evolutionary shift from ancestral preaxial to postaxial limb polarity in non-urodele vertebrates. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 4923-4934 (2021). \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4536099/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4536099/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSeveral dozen Mendelian mutants have been discovered in axolotl (\u003cem\u003eAmbystoma mexicanum\u003c/em\u003e) populations, including several that affect pigmentation. For recessive mutants have been described in the scientific literature and genes for three of these have been identified. Here we describe and genetically dissect \u003cem\u003ecopper\u003c/em\u003e, a mutant with an albino-like phenotype known only from the pet trade. We performed a cross segregating \u003cem\u003ecopper\u003c/em\u003e and wildtype color phenotypes and used bulked segregant RNA-Seq to identify a region on chromosome 6 that was enriched for single-nucleotide polymorphisms (SNPs) between the color phenotypes. This region included \u003cem\u003eTyrosinase-like Protein 1\u003c/em\u003e (\u003cem\u003eTyrp1\u003c/em\u003e), a melanin synthesis protein that when mutated, is associated with lighter than black melanin coloration in animal models and oculocutaneous albinism in humans. Inspection of RNA-Seq reads identified a single nucleotide deletion that is predicted to change the coding frame, introducing a premature stop codon in exon 6 and yield a truncated \u003cem\u003eTyrp1\u003c/em\u003e protein in \u003cem\u003ecopper\u003c/em\u003e individuals. Using CRISPR-Cas9 editing, we show that wildtype \u003cem\u003eTyrp1\u003c/em\u003e crispants exhibit \u003cem\u003ecopper\u003c/em\u003e pigmentation, thus confirming \u003cem\u003eTyrp1\u003c/em\u003e as the \u003cem\u003ecopper\u003c/em\u003e locus. Our results suggest that commercial and hobbyist axolotl populations may harbor useful mutants for biological research.\u003c/p\u003e","manuscriptTitle":"Tyrp1 is the Mendelian Determinant of the Axolotl (Ambystoma mexicanum) Copper Mutant","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-28 16:00:48","doi":"10.21203/rs.3.rs-4536099/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-20T06:12:26+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-16T18:32:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"243939770335351921794324598544992164589","date":"2024-08-15T20:43:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-25T09:53:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93986132452455951644021174050263586715","date":"2024-06-22T14:07:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-21T14:30:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-21T14:17:14+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-11T04:20:46+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-10T04:08:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-06-05T20:13:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"38cdcc43-381f-4900-ba8a-ddfa5a7f6082","owner":[],"postedDate":"June 28th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-30T16:06:16+00:00","versionOfRecord":{"articleIdentity":"rs-4536099","link":"https://doi.org/10.1038/s41598-024-73283-1","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-09-27 15:58:01","publishedOnDateReadable":"September 27th, 2024"},"versionCreatedAt":"2024-06-28 16:00:48","video":"","vorDoi":"10.1038/s41598-024-73283-1","vorDoiUrl":"https://doi.org/10.1038/s41598-024-73283-1","workflowStages":[]},"version":"v1","identity":"rs-4536099","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4536099","identity":"rs-4536099","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-04T02:00:05.705006+00:00
License: CC-BY-4.0