Shaoyang Xibi Decoction improves cholesterol accumulation to delay the progression of knee osteoarthritis by regulating the LXRα-ABCA1/ABCG1 signaling pathway

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Objective Our study focuses on observing the therapeutic effects of Shaoyang Xibi Decoction on a rat model of knee osteoarthritis and exploring its underlying mechanisms. Methods (1) A rat model of osteoarthritis was established using the modified HULTH method. The experiment was divided into the following groups for intervention: sham operation group, model group, meloxicam group, Shaoyang Xibi decoction low-dose group, Shaoyang Xibi decoction medium-dose group, and Shaoyang Xibi decoction high-dose group. Rats' pain sensation and motor function were evaluated by gait analysis. Cartilage tissue morphology was observed with toluidine blue and safranin O/fast green staining. The levels of inflammatory factors in rat serum were detected by ELISA, and the cholesterol content in rats' knee cartilage was measured by the total cholesterol assay. (2) Rat knee cartilage cells were isolated and cultured in vitro. They were identified using toluidine blue staining. A chondrocyte cholesterol accumulation model was prepared using a cholesterol-β-cyclodextrin complex, and FILIPIN fluorescent staining was employed for identification. Interventions were then carried out using rat medicated serum, LXR-α agonists, and LXR-α inhibitors. The groups included the following: blank group, model group, Shaoyang Xibi group, inhibitor group, agonist group, Shaoyang Xibi + inhibitor group, and Shaoyang Xibi + agonist group. The levels of inflammatory cytokines in the supernatants of the cartilage cells were measured by ELISA, and the total cholesterol content in the cartilage cells was determined using a total cholesterol detection method. (3) Preparation of rat knee osteoarthritis models and chondrocyte cholesterol accumulation models was conducted. Rats were divided into the following groups: sham surgery group, model group, meloxicam group, Shaoyang Xibi Decoction low dose group, Shaoyang Xibi Decoction medium dose group, and Shaoyang Xibi Decoction high dose group. Cells were divided into the following groups: blank group, model group, Shaoyang Xibi Decoction group, inhibitor group, agonist group, Shaoyang Xibi Decoction + inhibitor group, and Shaoyang Xibi Decoction + agonist group. Immunohistochemistry was used to detect the expression of type II collagen in knee joint cartilage, and Western blot and qPCR were used to detect the expression of LXR-α, ABCA1, ABCG1, and chondrogenic matrix synthesis-related molecules COL10, ACAN, SOX9, COL2 in cartilage tissue and chondrocytes. Results (1) Gait analysis results show that after intervention with Shaoyang Xibi Decoction, there is alleviation of pain in rats, enhancement of motor function recovery ( P  < 0.05), and toluidine blue and safranin-fast green staining suggests that Shaoyang Xibi Decoction can protect the cartilage structure. ELISA and cholesterol tests indicate that Shaoyang Xibi Decoction can reduce the expression of inflammatory factors in rats with knee osteoarthritis and improve the cholesterol accumulation in rat knee cartilage ( P  < 0.05). (2) Successful isolation and in vitro culturing of chondrocytes from SD rat knee joints were achieved. FILIPIN fluorescence staining results indicate that the construction of a cholesterol accumulation model in rat chondrocytes was successful. ELISA and cholesterol detection results show that Shaoyang Xibi Decoction can reduce the release of inflammatory factors in chondrocytes and alleviate the accumulation of cholesterol in chondrocytes ( P  < 0.05). (3) Immunohistochemistry, Western blot, and qPCR results demonstrate that Shaoyang Xibi Decoction can promote the expression of cartilage matrix synthesis molecules such as COL10, ACAN, SOX9, and COL2 ( P  < 0.05). Western blot and qPCR results show that Shaoyang Xibi Decoction can enhance the expression of LXR-α and increase the expression of cholesterol reverse transport-related molecules ABCA1 and ABCG1 ( P  < 0.05). Conclusion The Shaoyang Xibi Decoction can activate the LXR-α-ABCA1/ABCG1 Signaling Pathway to promote cholesterol efflux from chondrocytes. This, in turn, enhances the expression of matrix synthesis-related molecules, thereby delaying the progression of knee osteoarthritis in rats. It effectively alleviates pain and improves the motor function of rats with knee osteoarthritis.
Full text 171,127 characters · extracted from preprint-html · click to expand
Shaoyang Xibi Decoction improves cholesterol accumulation to delay the progression of knee osteoarthritis by regulating the LXRα-ABCA1/ABCG1 signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Shaoyang Xibi Decoction improves cholesterol accumulation to delay the progression of knee osteoarthritis by regulating the LXRα-ABCA1/ABCG1 signaling pathway Chaoran Lu, Yuhao Si, Yalan Pan, Lining Wang, Mengmin Liu, Sixian Chen, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7556233/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective Our study focuses on observing the therapeutic effects of Shaoyang Xibi Decoction on a rat model of knee osteoarthritis and exploring its underlying mechanisms. Methods (1) A rat model of osteoarthritis was established using the modified HULTH method. The experiment was divided into the following groups for intervention: sham operation group, model group, meloxicam group, Shaoyang Xibi decoction low-dose group, Shaoyang Xibi decoction medium-dose group, and Shaoyang Xibi decoction high-dose group. Rats' pain sensation and motor function were evaluated by gait analysis. Cartilage tissue morphology was observed with toluidine blue and safranin O/fast green staining. The levels of inflammatory factors in rat serum were detected by ELISA, and the cholesterol content in rats' knee cartilage was measured by the total cholesterol assay. ( 2 ) Rat knee cartilage cells were isolated and cultured in vitro. They were identified using toluidine blue staining. A chondrocyte cholesterol accumulation model was prepared using a cholesterol-β-cyclodextrin complex, and FILIPIN fluorescent staining was employed for identification. Interventions were then carried out using rat medicated serum, LXR-α agonists, and LXR-α inhibitors. The groups included the following: blank group, model group, Shaoyang Xibi group, inhibitor group, agonist group, Shaoyang Xibi + inhibitor group, and Shaoyang Xibi + agonist group. The levels of inflammatory cytokines in the supernatants of the cartilage cells were measured by ELISA, and the total cholesterol content in the cartilage cells was determined using a total cholesterol detection method. ( 3 ) Preparation of rat knee osteoarthritis models and chondrocyte cholesterol accumulation models was conducted. Rats were divided into the following groups: sham surgery group, model group, meloxicam group, Shaoyang Xibi Decoction low dose group, Shaoyang Xibi Decoction medium dose group, and Shaoyang Xibi Decoction high dose group. Cells were divided into the following groups: blank group, model group, Shaoyang Xibi Decoction group, inhibitor group, agonist group, Shaoyang Xibi Decoction + inhibitor group, and Shaoyang Xibi Decoction + agonist group. Immunohistochemistry was used to detect the expression of type II collagen in knee joint cartilage, and Western blot and qPCR were used to detect the expression of LXR-α, ABCA1, ABCG1, and chondrogenic matrix synthesis-related molecules COL10, ACAN, SOX9, COL2 in cartilage tissue and chondrocytes. Results (1) Gait analysis results show that after intervention with Shaoyang Xibi Decoction, there is alleviation of pain in rats, enhancement of motor function recovery ( P < 0.05), and toluidine blue and safranin-fast green staining suggests that Shaoyang Xibi Decoction can protect the cartilage structure. ELISA and cholesterol tests indicate that Shaoyang Xibi Decoction can reduce the expression of inflammatory factors in rats with knee osteoarthritis and improve the cholesterol accumulation in rat knee cartilage ( P < 0.05). ( 2 ) Successful isolation and in vitro culturing of chondrocytes from SD rat knee joints were achieved. FILIPIN fluorescence staining results indicate that the construction of a cholesterol accumulation model in rat chondrocytes was successful. ELISA and cholesterol detection results show that Shaoyang Xibi Decoction can reduce the release of inflammatory factors in chondrocytes and alleviate the accumulation of cholesterol in chondrocytes ( P < 0.05). ( 3 ) Immunohistochemistry, Western blot, and qPCR results demonstrate that Shaoyang Xibi Decoction can promote the expression of cartilage matrix synthesis molecules such as COL10, ACAN, SOX9, and COL2 ( P < 0.05). Western blot and qPCR results show that Shaoyang Xibi Decoction can enhance the expression of LXR-α and increase the expression of cholesterol reverse transport-related molecules ABCA1 and ABCG1 ( P < 0.05). Conclusion The Shaoyang Xibi Decoction can activate the LXR-α-ABCA1/ABCG1 Signaling Pathway to promote cholesterol efflux from chondrocytes. This, in turn, enhances the expression of matrix synthesis-related molecules, thereby delaying the progression of knee osteoarthritis in rats. It effectively alleviates pain and improves the motor function of rats with knee osteoarthritis. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Osteoarthritis (OA) is a globally prevalent degenerative joint disease characterized by chronic degenerative changes in the articular cartilage, including destruction, degeneration, and osteophyte formation (Jang et al. , 2021, Schafer and Grassel, 2022). The incidence of KOA has been steadily increasing due to the rising prevalence of aging and obesity(Abramoff and Caldera, 2020). In the United States alone, arthritis-related activity limitations affect over 22.7 million people, making it a leading cause of disability among the elderly population(2013, Murphy and Helmick, 2012). Current treatment options for KOA, such as oral analgesics including nonsteroidal anti-inflammatory drugs and cyclooxygenase-2 inhibitors, often lead to adverse gastrointestinal reactions(Shorrock and Rees, 1988, Sostres et al. , 2010, Hooper et al. , 2004). Additionally, the safety, economic burden, and risk of failure associated with surgical interventions for knee osteoarthritis have led some patients to refuse surgery. These approaches only provide pain relief and do not have significant clinical effects in terms of preventing or altering the progression of osteoarthritis. Given the risks associated with the aforementioned treatment methods, there is a need to develop alternative therapies for knee osteoarthritis that have lower risks and reduced toxicity. The primary manifestation of osteoarthritis is pain and restricted movement caused by cartilage destruction. Cartilage degradation often results from an imbalance in the synthesis and breakdown metabolism of chondrocytes, the only cells within cartilage. Chondrocytes have a crucial role in synthesizing the cartilage matrix, maintaining its homeostasis, participating in partial injury repair, and regulating local metabolic activity. These cells can adjust their synthetic and degradative activities by modulating the expression of genes involved in synthesis and breakdown metabolism(Aigner et al. , 2002), thus preserving the delicate equilibrium of cartilage tissue. However, exposure to external stimuli can induce chondrocytes to favor degradative metabolism. Consequently, many studies have focused on mitigating inflammatory responses, reducing the expression of genes associated with cartilage breakdown (such as matrix metalloproteinases), alleviating chondrocyte oxidative stress, and inhibiting chondrocyte apoptosis. The goal of these efforts is to decrease cartilage matrix destruction and slow down the progression of osteoarthritis. However, there is limited research on the synthetic aspect. In recent years, osteoarthritis has been linked to metabolic syndrome (Niu et al. , 2017), particularly cholesterol metabolism. A study by Courties A(Courties et al. , 2017) suggests that dysregulation of cholesterol efflux in chondrocytes of KOA can lead to cholesterol accumulation in the articular cartilage(Tsezou et al. , 2010). Radiological studies in some patients with hypercholesterolemia have found a correlation between high serum cholesterol levels and systemic osteoarthritis(Masuko et al. , 2009, Katz et al. , 2021). Evidence of lipid metabolism and cholesterol imbalance has also been found in chondrocytes of osteoarthritic cartilage(Tsezou et al., 2010, Villalvilla et al. , 2013), and both chondrocyte-specific cholesterol accumulation and high-fat feeding have been shown to worsen the severity of osteoarthritis in mouse models(Ali et al. , 2016, Griffin et al. , 2012, Wu et al. , 2015). These findings indicate that cholesterol may be a contributing factor in the pathogenesis of cartilage degradation, and cholesterol metabolism in chondrocytes appears to play a role in regulating cartilage homeostasis(Masuko et al., 2009, Papathanasiou et al. , 2021). In the field of pharmaceuticals, no drug has yet been developed to inhibit the progression of cartilage degeneration by improving cholesterol accumulation in the articular cartilage. Therefore, drugs that improve cholesterol accumulation in the articular cartilage may offer a new treatment option for patients with osteoarthritis SYXBF is a traditional Chinese medicine formula composed of the following herbs: Chaihu (Bupleurum), Huangqin (Scutellaria baicalensis), Baishao (Paeonia lactiflora), Dangshen (Codonopsis pilosula), Niuxi (Achyranthes bidentata), Duzhong (Eucommia ulmoides), Yiyiren (Coix seed), Fuling (Poria cocos), Muxiang (Saussurea costus), Chuanxiong (Ligusticum chuanxiong), Gancao (Glycyrrhiza uralensis), and Zexie (Alisma orientale). It is a traditional Chinese medicine formula used for knee-related conditions. The formula has been granted a patent with the patent number: ZL201810399052.9. As a traditional Chinese medicine formula for treating knee osteoarthritis(Si et al. , 2018), SYXBF has been shown to activate LXRα to reduce the expression of inflammatory factors and matrix metalloproteinases, thereby alleviating osteoarthritis(Zhang et al. , 2023). However, to date, there have been no reports on its efficacy and mechanism in regulating cholesterol metabolism to protect cartilage for the treatment of knee osteoarthritis. In addition to its potent anti-inflammatory properties(Zelcer and Tontonoz, 2006), LXRα plays a crucial role in controlling cellular and systemic cholesterol homeostasis. Furthermore, the study by Ratneswaran A (Ratneswaran et al. , 2017)also demonstrated that nuclear receptors regulate genes involved in lipid metabolism as well as genes related to cartilage matrix turnover. In this study, we observed that SYXBF can activate LXRα, increase the expression of ABCA1 and ABCG1 to reduce intracellular cholesterol levels in chondrocytes, and downregulate inflammatory factors such as TNF-α and IL-1β in the serum. These findings suggest that SYXBF has therapeutic potential for knee osteoarthritis. Additionally, SYXBF also upregulates the expression of genes involved in cartilage synthesis metabolism, such as SOX9, ACAN, COL2, and COL10, promoting cartilage matrix synthesis and improving cartilage homeostasis to alleviate the progression of knee osteoarthritis. This study evaluated the therapeutic effects of SYXBF in a rat model of knee osteoarthritis, providing evidence for its role in improving knee osteoarthritis and preliminary insights into its mechanisms of action in reducing cholesterol accumulation. 2. Materials and Methods 2.1 SYXBF preparation Shaoyang Xibi Decoction (Patent Number: ZL201810399052.9) is composed of herbs such as Chaihu (Bupleurum) and Huangqin (Scutellaria baicalensis). The herbal ingredients were purchased from the Pharmacy Department of Nanjing University of Chinese Medicine Affiliated Hospital. The herbs were mixed together and decocted with pure water at 100°C. After 45 minutes, the filtrate was obtained and concentrated under reduced pressure at 60°C to obtain concentrations of 0.55g/ml, 1.1g/ml, and 2.2g/ml of the crude medicine solution. The quality control of SYXBF was conducted using LC-MS/MS analysis to analyze its components. 2.2 Animal A total of 42 SPF-grade SD rats, aged 3 months, with an equal number of males and females, weighing (220 ± 10)g, were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The production license number is SCXK (Jing) 2021-0011. The animal experiments related to this study have been approved by the Experimental Animal Center of Nanjing University of Chinese Medicine, with approval number 202203A075. All rats were housed under a 12-hour light/dark cycle at a temperature of 20 ± 5℃ and a humidity of 55 ± 15%. After a one-week adaptation period, the rats were divided into the following groups: Sham-operated group (S group), Model group (M group), M + MELO (Meloxicam) group, M + S0.55 group, M + S1.1 group, and M + S2.2 group (n = 6). In the S group, the knee joint was opened without detaching the ligaments or removing the medial meniscus. For all other rats, except for the sham-operated group, a modified Hulth method was used to induce the knee osteoarthritis model. Anesthesia was induced using isoflurane(He et al. , 2021), and the modified Hulth method described by J N Rogart(Rogart et al. , 1999) was used for modeling. Within 3 days after surgery, penicillin was administered intramuscularly at a dose of 400,000 units per day to prevent infection. Starting from 1 week post-surgery, the rats were subjected to forced exercise on a treadmill at a speed of 18m/min and a current of 0.6mA for 30 minutes per day, for a duration of 4 weeks. After successful modeling, the following interventions were administered: the S group and M group received normal saline (10mL/(kg·d)); the M + MELO group received a solution of meloxicam (7.8mg/(kg·d)); the M + S0.55 group received SYXBF at a dose of 5.5g/(kg·d); the M + S1.1 group received SYXBF at a dose of 11g/(kg·d); and the M + S2.2 group received SYXBF at a dose of 22g/(kg·d). The dosage of SYXBF was calculated based on the equivalent clinical dose for adults, taking into account the conversion factor between rat and adult body weight (6.25). SYXBF was administered as a decoction, starting from 1 week post-surgery and continued for 4 weeks. 2.3cell Rat chondrocyte extraction and identification: four rats were euthanized to obtain the samples. Under sterile conditions, the articular cartilage of the bilateral femoral condyles and tibial plateaus was scraped. The collected cartilage was washed three times with PBS buffer containing 3% penicillin-streptomycin. Then, the cartilage was cut into 1mm^3 pieces and placed in 0.2% collagenase type II solution prepared in LG-DMEM. The digestion was carried out in a cell culture incubator for 8 hours, and the digestion solution was collected after digestion was terminated. The collected solution was centrifuged at 1000rpm for 5 minutes, and the supernatant was discarded. The cell pellet was resuspended in LG-DMEM supplemented with 10% FBS and 1% penicillin-streptomycin, and then seeded in a φ100mm culture dish. The dish was placed in a 37℃, 5% CO2 incubator. The culture medium was changed every 2–3 days, and regular observations and photographs were taken using an inverted microscope. When the cells covered more than 90% of the dish bottom, they were passaged at a ratio of 1:2. After three passages, toluidine blue staining was performed to identify the chondrocytes(Chen et al. , 2020). When the normal cells reached the fourth passage, the culture dish was supplemented with 0.5% FBS starvation medium and incubated for 48 hours. After that, the culture dish was further supplemented with 10% FBS medium containing 50ug/ml of water-soluble cholesterol. The dish was placed in a 37℃, 5% CO2 incubator and cultured for an additional 48 hours. During the modeling period, the culture medium was not changed. After modeling, the cells were stained using the Filipin fluorescence staining method to identify the modeling results. The Cell Total Free Cholesterol Filipin Fluorescence Staining Kit (Product No: GMS80059.1, Company: Shanghai Jiemai Gene Pharmaceutical Technology Co., Ltd.) was used for the staining. The cholesterol accumulation model chondrocytes were intervened as follows: M group: Regular replacement of culture medium. M + S group: Treated with serum containing 10% SYXBF.M + Y group: Treated with LXRα inhibitor GSK2033.M + SY group: Treated with both SYXBF and LXRα inhibitor GSK2033.M + J group: Treated with LXRα agonist GW3965.M + SJ group: Treated with both SYXBF and LXRα agonist GW3965. Additionally, a blank control group was set using normal rat chondrocytes. The interventions were carried out for 72 hours according to the respective groups. 2.4 Behavioral analysis of rats After four weeks of administration, three rats were randomly selected from each group for gait analysis. The rats were placed on a gait analysis apparatus and started accelerating from a speed of 0m/s. The speed at which the rats could start running normally, as well as the speed range where they could no longer maintain stable running was observed. A speed at which all tested rats could maintain stable and continuous running was selected as the standard speed. Subsequently, the rats in each group were filmed using a gait analysis system while running at the standard speed for 5–10 seconds. The videos were analyzed using Digigait image analysis software to evaluate the hindlimb motor ability and pain sensation in the rats. 2.5Histology At the end of the experiment, the left and right knee joints of each group of rats were dissected, and the muscles were removed. The gross appearance of the knee joints was photographed. After photographing the cartilage and completing the cartilage scoring, the samples were fixed in 10% paraformaldehyde for 24 hours and decalcified in a decalcification solution for four weeks. The decalcified specimens were dehydrated and embedded in paraffin. The paraffin blocks were sectioned into 7µm tissue sections, which were then stained with Safranin O-Fast Green and toluidine blue to observe the structure of the cartilage in knee osteoarthritis. The stained tissues were observed using Leica Application Suite (LAS) microscope software (Leica Biosystems). Subsequently, the left and right knee joints were blindly assessed by three different experts (n = 6) using the modified Mankin's score for cartilage improvement, ranging from 0 to 14 points. 2.6Immunohistochemistry After dewaxing the paraffin sections with xylene and rehydrating them in a series of graded alcohol, a circle was drawn around the tissue using a hydrophobic pen. The tissue within the circle was covered with gastric enzyme, ensuring complete coverage, and then incubated at 37°C for 30 minutes in an oven. The sections were then rinsed and washed clean, followed by incubation in a 3% hydrogen peroxide solution at room temperature in the dark for 25 minutes. The slides were placed in PBS (pH 7.4) and washed on a decolorization shaker three times, each for 5 minutes. Subsequently, 3% BSA was added within the circle to evenly cover the tissue, and the slides were sealed at room temperature for 30 minutes. The excess blocking solution was gently shaken off, and the slides were then incubated overnight at 4°C with the primary antibody, which was added onto the tissue within the circle. The next day, the slides were washed in PBS (pH 7.4) on a decolorization shaker three times, each for 5 minutes. After slightly drying the slides, the corresponding secondary antibody (HRP-labeled) from the same species as the primary antibody was added within the circle to cover the tissue, and incubated at room temperature for 50 minutes. The slides were washed in PBS (pH 7.4) on a decolorization shaker three times, each for 5 minutes. After slightly drying the slides, freshly prepared DAB chromogenic solution was added within the circle, and the staining time was controlled under a microscope. Positive staining appeared as a brownish-yellow color, and the reaction was stopped by rinsing the slides with tap water. Immunohistochemically stained sections were reviewed and photographed for quantitative analysis using a Leica DM6B microscope (Leica Microsystems). 2.7 Detection of total cholesterol level The total cholesterol content in the knee joint cartilage of each group of rats, as well as in the cartilage cells after intervention, was measured according to the instructions provided by the manufacturer. The procedure is as follows: 20mg of knee joint cartilage was taken and mixed with 100µl of isopropanol, then ground and homogenized on ice. The mixture was then centrifuged at 8000g for 10 minutes at 4°C, and the supernatant was collected for further analysis. A 96-well plate was prepared, with wells designated for measurement and blank. In the measurement wells, 20µl of the sample was added along with 180µl of the working solution (provided in the kit). In the blank wells, 20µl of isopropanol and 180µl of the working solution were added. After adding the samples, the plate was incubated at 37°C for 1 hour. Once the spectrophotometer had been preheated for 30 minutes, the absorbance of each well was measured at a wavelength of 500nm. The cholesterol concentration in the samples was calculated based on the regression equation. (Testing kit: Total cholesterol (TC) content testing kit, Product No. TC-1-W, Company: Comin, Suzhou, China) 2.8 ELISA assay After four weeks of administration to the rats, anesthesia was induced using isoflurane. Blood samples were collected from the abdominal aorta using a syringe treated with an anticoagulant. The collected blood was then placed in a 4°C refrigerator for 1 hour and subsequently centrifuged at 3500rpm for 10 minutes using a high-speed refrigerated centrifuge. The resulting serum was carefully collected and stored at -80°C in an ultra-low temperature freezer for further ELISA analysis of the extracellular environment. For the cholesterol accumulation model, after 72 hours of intervention, the supernatant from each group of cells was collected and stored at -80°C in an ultra-low temperature freezer for ELISA analysis of the extracellular environment. The levels of IL-1β and TNF-α in the serum and cell supernatant were measured according to the manufacturer's instructions using the Rat Interleukin-1 (IL-1) ELISA Research Kit and Rat Tumor Necrosis Factor-alpha (TNF-α) ELISA Research Kit (Product No. AF2922-A, AF3056-A, Company: Hunan Aifang Biotechnology Co., Ltd., Hunan, China). 2.9RT-PCR Three rats were randomly selected from each group. The left knee joint cartilage was collected and thoroughly ground in liquid nitrogen. Total RNA was extracted from the tissue samples using the NuoWeiZan RNA extraction kit. The extracted RNA was reverse transcribed into cDNA using the NuoWeiZan reverse transcription kit. Real-time fluorescent quantitative qPCR was performed using the NuoWeiZan qPCR kit. The qPCR conditions were set as follows: initial denaturation at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, annealing and extension at 60°C for 30 seconds, for a total of 40 cycles. Primer sequences were obtained from GenBank and synthesized by Shanghai Biotechnology Co., Ltd. GAPDH was used as the reference gene. Ct values for each group of samples were obtained, and the data were analyzed using the 2 −△△Ct method for relative quantification. For cell samples, the culture medium was aspirated, and the cells were washed twice with pre-chilled PBS. The final PBS wash was thoroughly removed, and the subsequent extraction and detection methods were the same as described above. Primer sequences Primer name (5’ to 3’) COL2 Forward TCCTTCGGTCGGTGTCTGTCTG Reverse CCACGGCATCCCAAACCATCTC COL10 Forward ATGGTGAGGCAGGTCCAAGAGG Reverse GGTTAGCACTGACAAGAGGCATCC ACAN Forward TTAGACTCAGGGTGGGTGGACTTG Reverse AGAGCACGGATGAATGAACGGATG SOX9 Forward GCGGAGGAAGTCGGTGAAGAATG Reverse CTTAGAAGTCTGAGTTGGCGGTGTG LXRα Forward CTTCCAGCCAGCGTTAGCAGAC Reverse CACACCAGAAGAGGGCATCAATCC ABCA1 Forward TCGCTTAGAGGTGAGGCTGATGG Reverse GTGTGGATGCTGGGAACTGAACTC ABCG1 Forward ACCTTGGAGTGGAAGCAGCATTAAG Reverse GGACAACGATGATGACACAGGAGAG GAPDH Forward GTCCATGCCATCACTGCCACTC Reverse CGCCTGCTTCACCACCTTCTTG 2.10 Western Blot Three rats were randomly selected from each group. The left knee joint cartilage was collected and thoroughly ground in liquid nitrogen. The ground cartilage was then transferred into EP tubes. RIPA lysis buffer was added to the tubes and placed on ice for 10 minutes for lysis. The total protein was collected by centrifugation, and the protein concentration was quantified using the bicinchoninic acid (BCA) assay. Equal amounts of protein were mixed with loading buffer, boiled for 10 minutes, and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The gel was initially run at a constant voltage of 120V for 15 minutes, followed by a constant voltage of 160V for 25 minutes. After electrophoresis, the proteins were transferred onto a membrane for 40 minutes at a constant current of 400mA. The membrane was then blocked with 5% skim milk at room temperature for 2 hours, incubated with the primary antibody (1:1000) overnight at 4°C, and incubated with the secondary antibody (1:10000) for 2 hours at room temperature. The protein expression was visualized using an enhanced chemiluminescence (ECL) substrate, and the bands were detected using an imaging system. The band intensity was quantified using Image J software. For cell samples, the culture medium was aspirated, and the cells were washed twice with pre-chilled PBS. The final PBS wash was thoroughly removed, and the subsequent extraction and detection methods were the same as described above. 2.11 Statistical analysis All data will be presented as mean ± standard deviation (x̄±s). One-way analysis of variance (ANOVA) and SNK-q test will be used for statistical analysis, with P < 0.05 considered statistically significant. Statistical analysis will be performed using SPSS 26.0 software, and Graphpad Prism 8.0 software will be used for data visualization. 3. Results 3.1 Identification of chemical components in the extract of SYXBF using LC-MS/MS analysis The chromatographic peaks with high abundance in the positive and negative ion peak chromatograms of traditional Chinese medicine were confirmed by peak shape and inspected by MS/MS spectra. These chromatographic peaks were then sequentially labeled with numbers in the positive and negative ion spectra, as shown in Figure A and B. The main compound components in the water decoction of SYXBF include valylphenylalanine, isovaleryl carnitine, rosmarinic acid, paeoniflorin, baicalin, baicalein, and saikosaponin d. The analysis revealed that the compounds are mainly classified as flavonoids, small peptides, sesquiterpenoids, and triterpenoids. The corresponding compound information can be found in Appendix 1. 3.2 SYXBF improves and ameliorates the motor function and pain symptoms induced by the HULTH method in rats with knee osteoarthritis, and delays the progression of osteoarthritis. To evaluate the therapeutic effects of SYXBF on rats with knee osteoarthritis induced by the modified HULTH method, macroscopic scoring was performed on the knee joints, and toluidine blue and safranin O-fast green staining techniques were used to examine the articular cartilage tissues. Gait analysis was also conducted for each group of rats. The graph depicting the morphological changes in the knee joint showed a smooth and intact surface in the normal joint, with a glossy appearance (Figure 2A). In contrast, severe damage to the articular cartilage was observed in the MODEL group of rats. The femoral condyle surface in the MODEL group appeared rough, with erosion of both anterior and posterior articular cartilage, spot formation, extensive soft tissue proliferation, bone spur formation, and subchondral bone sclerosis. Following treatment, the joint cartilage structure in the M+MELO group was restored to normal. Similar to the positive control results obtained with meloxicam, the SYXBF-treated cartilage displayed glossy and smooth surfaces on both the anterior and posterior aspects of the condyle. The damaged cartilage induced by the modified HULTH method exhibited significant recovery following SYXBF treatment. The macroscopic scores of the M+MELO group and M+S1.1 group rats were notably lower compared to the M group (Figure 2C). Safranin O-fast green and toluidine blue staining (Figure 2B) revealed that the articular cartilage surface in the MODEL group appeared rougher than that of the SHAM group, with indistinct tide lines, a reduced chondrocyte count, and a disorganized arrangement. Additionally, subchondral bone collapse was observed. In contrast, the superficial layer of cartilage in the M+MELO group and M+S1.1 group appeared smoother than that of the MODEL group, with well-organized chondrocytes and clear tide lines. The modified Mankin's score also exhibited a significant decrease in the M+MELO group and M+S1.1 group compared to the MODEL group (Figure 2D), indicating that SYXBF can protect knee joint cartilage and slow down the progression of osteoarthritis. Behavioral analysis of the animals showed that the swing duration percentage and propulsion duration percentage in the MODEL group were significantly higher than those in the SHAM group, and the paw area was reduced. However, the swing duration percentage and propulsion duration percentage were decreased, and the paw area was significantly increased in the M+MELO group and M+S1.1 group compared to the MODEL group (Figure 2EFG). A higher percentage of swing duration and propulsion duration indicates more severe joint mobility impairment and greater pain in the animals. A smaller paw area indicates poorer weight-bearing capacity and more pronounced pain. These data suggest that SYXBF can effectively protect the articular cartilage of rats with knee osteoarthritis, delay the progression of osteoarthritis, restore their motor function, and alleviate pain. 3.3 SYXBF improves inflammation and cholesterol accumulation in the knee articular cartilage of rats with knee osteoarthritis induced by the modified HULTH method. The results of total cholesterol content measurement (Figure 3A) indicated a significant increase in cholesterol accumulation within the knee articular cartilage of rats induced by the modified HULTH method. However, intervention with meloxicam and SYXBF led to a reduction in cholesterol content compared to the M group, with a more pronounced decrease observed in the M+S1.1 group compared to the M+MELO group. Enzyme-linked immunosorbent assay (ELISA) results for arterial serum in rats (Figure 3C, D) demonstrated elevated levels of the inflammatory factors IL-1β and TNF-α in the MODEL group compared to the SHAM group. Both the M+MELO group and M+S1.1 group exhibited a reduction in IL-1β and TNF-α levels compared to the MODEL group. RT-qPCR results (Figure 3B) revealed a significant increase in the expression of the inflammatory factor PGE2 in the knee articular cartilage of the MODEL group compared to the SHAM group, while both the M+MELO group and M+S1.1 group showed a decrease in PGE2 expression compared to the MODEL group. These findings suggest that SYXBF can ameliorate cholesterol accumulation in osteoarthritic cartilage and alleviate inflammation. 3.4 The serum containing SYXBF can alleviate the expression of inflammatory factors and cholesterol accumulation in rat knee articular cartilage cells induced by cholesterol-cyclodextrin complex. Chondrocytes are the only cells present in knee articular cartilage. In order to investigate the impact of SYXBF on delaying the progression of osteoarthritis, we developed a model to induce cholesterol accumulation in chondrocytes. We isolated primary chondrocytes from rats (Figure 4A, B) and used toluidine blue staining for identification (Figure 4C). FILIPIN staining (Figure 4F, G) demonstrated that the blue fluorescence intensity emitted by chondrocytes induced by the cholesterol-cyclodextrin complex was significantly higher than that of normal chondrocytes, indicating cholesterol accumulation in chondrocytes. Total cholesterol measurement (Figure 4H) confirmed a significant increase in cholesterol content in the M group compared to the NC group. This increase was reversed after SYXBF intervention, although the S+I group still had higher cholesterol content compared to the S group. Furthermore, enzyme-linked immunosorbent assay (ELISA) results (Figure 4I, J) revealed elevated concentrations of inflammatory factors IL-1β and TNF-α in the cell supernatant of the M group compared to the NC group, while the S group exhibited a decrease compared to the M group. These findings suggest that SYXBF can reduce cholesterol accumulation in chondrocytes and suppress the expression of inflammatory factors. 3.5 SYXBF can increase the expression of synthesis-related genes and proteins in chondrocytes. Chondrocytes play a crucial role in synthesizing and metabolizing the cartilage matrix. In osteoarthritis, both matrix proteinases induced by inflammation and synthesis-related genes and proteins in chondrocytes influence the quantity and quality of the cartilage matrix. Thus, we examined the expression of COL2, ACAN, COL10, and SOX9 in the knee articular cartilage of rats treated with SYXBF, as well as in chondrocytes with cholesterol accumulation intervened by SYXBF. Immunohistochemistry results (Figure 5A, D) indicated that the protein content of COL2 was lower in the MODEL group than in the SHAM group, while the M+MELO group and M+S1.1 group exhibited higher levels of COL2 compared to the MODEL group. Additionally, RT-qPCR results (Figure 5H) supported the immunohistochemistry data. Western blot results (Figure 5B, E, F, G) showed reduced expression levels of chondrocyte synthesis-related proteins COL10, ACAN, and SOX9 in the MODEL group compared to the SHAM group. However, the M+S1.1 group treated with SYXBF showed some improvement in these proteins compared to the MODEL group. Furthermore, RT-qPCR results (Figure 5I, J, K) were consistent with the Western blot findings, confirming the enhancing effect of SYXBF on the secretion of chondrocyte synthesis-related molecules. In cell experiments, Western blot results (Figure 5C, L, M, N) revealed decreased expression levels of chondrocyte synthesis-related proteins COL2, COL10, ACAN, and SOX9 in the M group compared to the NC group. Conversely, the S group treated with SYXBF exhibited some improvement in these proteins compared to the M group. Notably, the A group treated with agonists showed significant improvement in ACAN and COL10 compared to the M group. The RT-qPCR results (Figure 5O, P, Q, R) were consistent with the Western blot findings, and the S+I group demonstrated an inhibitory effect on the increase in ACAN expression induced by SYXBF in the S group at the gene level. These results confirm the promoting effect of SYXBF on the secretion of chondrocyte synthesis-related molecules. 3.6 SYXBF's effects on the protein and gene expression of LXRα-ABCA1/ABCG1 pathway. More and more studies have shown that cholesterol metabolism may play a role in the development and progression of osteoarthritis. Our previous research has indicated that SYXBF might target LXRα to improve cholesterol accumulation and slow down the progression of osteoarthritis. To investigate whether SYXBF can regulate the expression of cholesterol efflux-related molecules by activating LXRα, we examined the expression of LXRα, ABCA1, and ABCG1 after intervention with SYXBF, an LXR agonist, and an LXR inhibitor. The Western blot results (Figure 6A, B, C, D) showed that the expression levels of intracellular cholesterol homeostasis protein LXR-α and cholesterol efflux key proteins ABCA1 and ABCG1 were lower in the MODEL group compared to the SHAM group, while the M+S1.1 group, which received SYXBF intervention, showed some improvement in these proteins compared to the MODEL group. Moreover, the results of RT-qPCR were consistent with the Western blot results (Figure 6E, F, G). In the cell experiments, the Western blot results (Figure 6H, I, J, K) demonstrated decreased expression levels of intracellular cholesterol homeostasis protein LXR-α and cholesterol efflux key proteins ABCA1 and ABCG1 in the M group compared to the NC group, while the S group, which received SYXBF intervention, and the A group, which received agonists, showed some improvement in these proteins compared to the M group. Additionally, the S+I group significantly suppressed the increase in LXR-α and ABCG1 protein expression in the S group. Furthermore, the results of RT-qPCR were consistent with the Western blot results (Figure 6L, M, N), suggesting that SYXBF may activate LXRα and increase the expression of ABCA1 and ABCG1. 4. Discussion SYXBF is a traditional Chinese herbal formula used to treat knee osteoarthritis in China. Previous studies have shown that SYXBF can significantly improve symptoms such as physical pain, stiffness, knee joint dysfunction, and physical function in patients(Si et al., 2018). In terms of basic research, SYXBF has been found to inhibit the degradation of extracellular matrix in chondrocytes and activate LXRα, which in turn inhibits the NF-κB signaling pathway and reduces the expression of inflammatory factors, thereby alleviating the severity of knee osteoarthritis lesions (Zhang et al., 2023). This study confirms previous findings that standardized dosages of SYXBF can alleviate inflammation and cartilage degeneration induced by the modified HULTH method and inhibit the further progression of knee osteoarthritis. Moreover, SYXBF is effective in relieving pain in the lower limbs of rats and improving their mobility. Importantly, in the knee osteoarthritis model rats induced by the modified HULTH method, cholesterol levels were significantly elevated in addition to inflammation and cartilage degeneration. However, intervention with SYXBF effectively reversed this situation. It is widely recognized that the imbalance between inflammation and the synthesis and degradation of cartilage matrix, driven by chondrocytes, is a significant factor in the development of osteoarthritis (Shen et al. , 2017, Peng et al. , 2021). As research on osteoarthritis progresses, there is increasing recognition that metabolic abnormalities, particularly disturbances in cholesterol metabolism, are closely associated with the occurrence and progression of osteoarthritis(Masuko et al., 2009, Chadha, 2016). Cholesterol serves as an essential substance for maintaining cellular activity and function, including in chondrocytes. However, high levels of cholesterol may not be advantageous for cells. Excessive cholesterol accumulation in chondrocytes can impede matrix synthesis and secretion, disrupt the function and structure of cell membranes, and even result in cell damage and death(Tabas, 2002). The aforementioned observations, supported by related studies, suggest that the mechanism by which SYXBF alleviates osteoarthritis may be closely linked to its capability to reduce cholesterol accumulation in cartilage and regulate the expression of genes associated with cartilage matrix synthesis. As a well-known fact, LXRα belongs to the nuclear receptor superfamily and plays a pivotal role in regulating cholesterol, lipid metabolism, and inflammatory responses. Activation of LXRα triggers the expression of genes associated with cholesterol efflux, such as ABCA1 and ABCG1, thereby reducing intracellular cholesterol levels (Jun et al. , 2013). Both ABCA1 and ABCG1, belonging to the ABC superfamily, act as major transport proteins responsible for cholesterol efflux. Specifically, ABCA1 facilitates the efflux of cholesterol to lipid-poor apolipoproteins, leading to the generation of nascent or pre-β-HDL particles. These particles subsequently function as substrates for cholesterol transport facilitated by ABCG1. Mutations occurring in the ABCA1 gene can result in Tangier disease, a disorder characterized by cellular cholesterol accumulation, underscoring the critical importance of ABCA1 and ABCG1 in cellular cholesterol efflux(Gelissen et al. , 2006, Bodzioch et al. , 1999). As mammals, humans possess the capability to synthesize cholesterol endogenously. However, except for the liver and certain steroidogenic gland cells responsible for producing steroid hormones, only a few cells can degrade cholesterol. Notably, chondrocytes lack the capacity for cholesterol metabolism(Luo et al. , 2020). Consequently, cells devoid of cholesterol degradation ability, such as chondrocytes, heavily rely on ABCA1 and ABCG1 for transporting excess cholesterol out of cells, eventually returning it to the liver in the form of high-density lipoprotein complexes (Tabas, 2002). In situations where intracellular cholesterol levels increase, cholesterol is promptly esterified by acyl-coenzyme A: cholesterol acyltransferase (ACAT) and stored temporarily in cytoplasmic lipid droplets. Nonetheless, this mechanism proves inadequate for long-term management of excess cholesterol. Conversely, when cells experience cholesterol deficiency, low-density lipoprotein receptors (LDLR) are upregulated, leading to heightened cellular uptake of cholesterol from LDL particles and facilitating its utilization or storage. Disruption of these regulatory mechanisms disturbs cholesterol homeostasis within cells, culminating in the accumulation of excess free cholesterol, which in turn can cause cellular damage and drive disease progression. Gierman's study(Gierman et al. , 2014) demonstrated that with an increase in the proportion of a high-fat diet, the severity of osteoarthritis in mice worsened. In the clinical treatment process, Oliviero's research(Oliviero et al. , 2012) discovered high concentrations of cholesterol and cholesterol crystals in the synovial fluid of osteoarthritis patients(Tsezou et al., 2010). Decreased expression of ABCA1, LXRα, and LXRβ was also found in chondrocyte samples from osteoarthritis patients(Farnaghi et al. , 2017). Primary cultures of human articular chondrocytes treated with high cholesterol exhibited mitochondrial dysfunction and increased generation of reactive oxygen species (ROS), potentially linked to elevated expression of matrix metalloproteinase-13 (MMP13) and RUNX2, as well as reduced expression of SOX9(Lefebvre et al. , 2019). Moreover, in Haj-Mirzaian's clinical trial(Haj-Mirzaian et al. , 2019), statin drugs demonstrated protective effects against osteoarthritis. These findings collectively offer insights into how cholesterol accumulation impacts chondrocytes and contributes to the progression of osteoarthritis. In our previous studies, we have demonstrated that SYXBF can inhibit MMP13 expression, promote relative TIMP1 expression, and suppress cartilage degradation in knee osteoarthritis. In this study, we also investigated the molecular factors involved in chondrocyte matrix synthesis that may be influenced by cholesterol homeostasis. SOX9 is widely recognized as a key regulatory factor in chondrocyte differentiation and cartilage matrix synthesis. It can activate genes in chondrocytes that are considered to be involved in cartilage matrix synthesis, such as ACAN, COL2, and COL10. ACAN, which has the highest content of proteoglycans in cartilage, provides the ability to withstand compressive loads in articular cartilage(Kiani et al. , 2002, Hardingham and Muir, 1974). COL2 is the major structural collagen protein in knee joint cartilage, and its loss and disruption can lead to alterations in the fibrous structure of cartilage and affect the interactions with other extracellular matrix components, destabilizing cartilage structure and accelerating cartilage wear(Li et al. , 2021). The expression of COL10 is essential for COL2, and the absence of COL10 not only affects COL2 but also other crucial extracellular matrix components necessary for chondrocyte differentiation. When the level of COL10 falls below a certain threshold, not only is the production of extracellular matrix components compromised, but the secretion pattern of its construct is also affected(Knuth et al. , 2019), ultimately leading to cartilage tissue damage, loss of its original function, and accelerated progression of osteoarthritis. This experimental study showed that compared to the MODEL group, the M + S1.1 group of rats exhibited reduced pain, improved motor ability, and improved cartilage defects as indicated by toluidine blue staining and Safranin O-Fast Green staining. The tidemark and arrangement of chondrocytes in the M + S1.1 group appeared relatively regular. In the M + S1.1 group, the expression of SOX9, ACAN, COL2, and COL10 in the cartilage increased compared to the MODEL group. These results suggest that SYXBF can alleviate the damage to connective tissue caused by knee osteoarthritis by enhancing the expression of cartilage matrix synthesis genes. The cholesterol levels and serum inflammatory factors in the MODEL group were higher than those in the SHAM group, while they were significantly reduced in the M + S1.1 group compared to the MODEL group. This indicates that SYXBF can reduce cholesterol accumulation and the expression of inflammatory factors in the cartilage, thereby slowing down the progression of osteoarthritis. Compared to the MODEL group, the expression levels of LXR-α, ABCA1, and ABCG1 were increased in the M + S1.1 group. Based on the above experimental results, it can be inferred that SYXBF may regulate the LXRα-ABCA1/ABCG1 pathway, thus inhibiting the progression of osteoarthritis. To further investigate whether SYXBF improves cholesterol accumulation and delays the progression of osteoarthritis by regulating LXRα, our focus shifted to chondrocytes, the only resident cells in cartilage. We conducted interventions using SYXBF, LXRα agonists, and inhibitors. In the in vitro experiments, FILIPIN fluorescence staining revealed a significantly higher fluorescence intensity in cholesterol-cyclodextrin complex-treated chondrocytes in the M group compared to the NC group. Total cholesterol detection also confirmed elevated cholesterol levels in the M group, indicating significant cholesterol accumulation. Furthermore, the culture supernatant of the M group showed increased expression of inflammatory factors. Inhibiting LXRα reversed the reduction in cholesterol levels induced by SYXBF-containing serum intervention. Remarkably, the S + I group had significantly higher cholesterol levels than the S group, accompanied by reduced expression levels of ABCA1 and ABCG1. Conversely, the A group, which received LXRα agonist intervention, displayed significantly lower cholesterol levels than the M group, along with increased expression levels of ABCA1 and ABCG1. Importantly, expression levels of cartilage matrix synthesis-related factors, including SOX9, ACAN, COL2, and COL10, were higher in the S group than in the M group. However, inhibiting LXRα led to decreased expression of SOX9, ACAN, COL2, and COL10. These findings collectively demonstrate that SYXBF can activate the LXRα-ABCA1/ABCG1 signaling pathway in chondrocytes, regulate cholesterol metabolism in osteoarthritic chondrocytes, and to some extent alleviate the progression of knee osteoarthritis. 5. Conclusion In summary, this experimental study has preliminarily found that SYXBF can improve cholesterol metabolism, inflammation, and the balance of cartilage matrix synthesis and degradation in osteoarthritic chondrocytes. This may be achieved through the regulation of the LXRα-ABCA1/ABCG1 signaling pathway, suggesting that SYXBF can be used as an adjunct or alternative treatment for knee osteoarthritis. However, there are still some issues to be addressed in this study: 1. The mechanism of SYXBF in the intervention of knee osteoarthritis may be related to the activation of the LXRα-ABCA1/ABCG1 signaling pathway, but the specific mechanism of action is the focus of our next research. 2. Traditional Chinese medicine formulas are complex, and their corresponding targets and pathways may not be singular. Further clarification of the mode of action of SYXBF can be achieved through genomics and other methods. 3. In order to further study the mechanism of cholesterol metabolism in knee osteoarthritis, it is not limited to total cholesterol, but can be expanded to include molecules such as free fatty acids, triglycerides, high-density lipoprotein, and low-density lipoprotein. Reverse validation using animals fed a high-fat diet will also be a focus of our research. Declarations Funding This study was supported by grants from the Jiangsu Province Natural Science Foundation Project (BK20211300),the National Natural Science Foundation Project of China (82305268),the NATCM's Project of High-level Construction of Key TCM Disciplines(NATCM's Human Education Letter[2023]No. 85),the Foundation of Jiangsu CM Clinical Innovation Center of Degenerative Bone & Joint Disease(Jiangsu science and education of traditional Chinese medicine〔2021〕No. 4)and the Jiangsu Province Graduate Research and Practice Innovation Program Project (KYCX23_2106). CRediT authorship contribution statement Chaoran Lu: Writing – original draft, Methodology, Investigation, Formal analysis, Data curation. Yuhao Si: Writing – review & editing, Writing – original draft, Methodology, Investigation, Conceptualization. Yalan Pan 、 Lining Wang 、 Mengmin Liu 、 Sixian Chen 、 Lei Shi 、 Ruihua Zhao 、 Zhixin Li : Methodology, Investigation. Yang Guo: Writing – review & editing, Writing – original draft, Supervision, Investigation, Data curation, Conceptualization. Yong Ma: Writing – review & editing, Writing – original draft, Funding acquisition, Conceptualization. Declaration of competing interest The authors declare that there is no commercial or financial relationships that could be construed as a potential conflict of interest regarding this paper. Data availability The authors do not have permission to share data. References "Prevalence of doctor-diagnosed arthritis and arthritis-attributable activity limitation--United States, 2010-2012", MMWR Morb Mortal Wkly Rep, Vol. 62 No. 44, pp. 869-73. ABRAMOFF, B. & CALDERA, F. E. (2020), "Osteoarthritis: Pathology, Diagnosis, and Treatment Options", Med Clin North Am, Vol. 104 No. 2, pp. 293-311. AIGNER, T., KURZ, B., FUKUI, N. & SANDELL, L. (2002), "Roles of chondrocytes in the pathogenesis of osteoarthritis", Curr Opin Rheumatol, Vol. 14 No. 5, pp. 578-84. ALI, S. A., AL-JAZRAWE, M., MA, H., WHETSTONE, H., POON, R., FARR, S., NAPLES, M., ADELI, K. & ALMAN, B. A. (2016), "Regulation of Cholesterol Homeostasis by Hedgehog Signaling in Osteoarthritic Cartilage", Arthritis Rheumatol, Vol. 68 No. 1, pp. 127-37. BODZIOCH, M., ORSO, E., KLUCKEN, J., LANGMANN, T., BOTTCHER, A., DIEDERICH, W., DROBNIK, W., BARLAGE, S., BUCHLER, C., PORSCH-OZCURUMEZ, M., KAMINSKI, W. E., HAHMANN, H. W., OETTE, K., ROTHE, G., ASLANIDIS, C., LACKNER, K. J. & SCHMITZ, G. (1999), "The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease", Nat Genet, Vol. 22 No. 4, pp. 347-51. CHADHA, R. (2016), "Revealed aspect of metabolic osteoarthritis", J Orthop, Vol. 13 No. 4, pp. 347-51. CHEN, P. J., DUTRA, E. H., MEHTA, S., O'BRIEN, M. H. & YADAV, S. (2020), "Age-related changes in the cartilage of the temporomandibular joint", Geroscience, Vol. 42 No. 3, pp. 995-1004. COURTIES, A., SELLAM, J. & BERENBAUM, F. (2017), "Metabolic syndrome-associated osteoarthritis", Curr Opin Rheumatol, Vol. 29 No. 2, pp. 214-222. FARNAGHI, S., PRASADAM, I., CAI, G., FRIIS, T., Du Z, CRAWFORD, R., MAO, X. & XIAO, Y. (2017), "Protective effects of mitochondria-targeted antioxidants and statins on cholesterol-induced osteoarthritis", FASEB J, Vol. 31 No. 1, pp. 356-367. GELISSEN, I. C., HARRIS, M., RYE, K. A., QUINN, C., BROWN, A. J., KOCKX, M., CARTLAND, S., PACKIANATHAN, M., KRITHARIDES, L. & JESSUP, W. (2006), "ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I", Arterioscler Thromb Vasc Biol, Vol. 26 No. 3, pp. 534-40. GIERMAN, L. M., KUHNAST, S., KOUDIJS, A., PIETERMAN, E. J., KLOPPENBURG, M., van OSCH, G. J., STOJANOVIC-SUSULIC, V., HUIZINGA, T. W., PRINCEN, H. M. & ZUURMOND, A. M. (2014), "Osteoarthritis development is induced by increased dietary cholesterol and can be inhibited by atorvastatin in APOE*3Leiden.CETP mice--a translational model for atherosclerosis", Ann Rheum Dis, Vol. 73 No. 5, pp. 921-7. GRIFFIN, T. M., HUEBNER, J. L., KRAUS, V. B., YAN, Z. & GUILAK, F. (2012), "Induction of osteoarthritis and metabolic inflammation by a very high-fat diet in mice: effects of short-term exercise", Arthritis Rheum, Vol. 64 No. 2, pp. 443-53. HAJ-MIRZAIAN, A., MOHAJER, B., GUERMAZI, A., CONAGHAN, P. G., LIMA, J., BLAHA, M. J., BINGHAM, C. O., ROEMER, F. W., CAO, X. & DEMEHRI, S. (2019), "Statin Use and Knee Osteoarthritis Outcome Measures according to the Presence of Heberden Nodes: Results from the Osteoarthritis Initiative", Radiology, Vol. 293 No. 2, pp. 396-404. HARDINGHAM, T. E. & MUIR, H. (1974), "Hyaluronic acid in cartilage and proteoglycan aggregation", Biochem J, Vol. 139 No. 3, pp. 565-81. HE, E., XU, S., DAI, Y., WANG, Y., XIAO, G., XIE, J., XU, S., FAN, P., MO, F., WANG, M., SONG, Y., YIN, H., LI, Y., WANG, Y. & CAI, X. (2021), "SWCNTs/PEDOT:PSS-Modified Microelectrode Arrays for Dual-Mode Detection of Electrophysiological Signals and Dopamine Concentration in the Striatum under Isoflurane Anesthesia", ACS Sens, Vol. 6 No. 9, pp. 3377-3386. HOOPER, L., BROWN, T. J., ELLIOTT, R., PAYNE, K., ROBERTS, C. & SYMMONS, D. (2004), "The effectiveness of five strategies for the prevention of gastrointestinal toxicity induced by non-steroidal anti-inflammatory drugs: systematic review", BMJ, Vol. 329 No. 7472, pp. 948. JANG, S., LEE, K. & JU, J. H. (2021), "Recent Updates of Diagnosis, Pathophysiology, and Treatment on Osteoarthritis of the Knee", Int J Mol Sci, Vol. 22 No. 5, pp. JUN, H. J., HOANG, M. H., YEO, S. K., JIA, Y. & LEE, S. J. (2013), "Induction of ABCA1 and ABCG1 expression by the liver X receptor modulator cineole in macrophages", Bioorg Med Chem Lett, Vol. 23 No. 2, pp. 579-83. KATZ, J. N., ARANT, K. R. & LOESER, R. F. (2021), "Diagnosis and Treatment of Hip and Knee Osteoarthritis: A Review", JAMA, Vol. 325 No. 6, pp. 568-578. KIANI, C., CHEN, L., WU, Y. J., YEE, A. J. & YANG, B. B. (2002), "Structure and function of aggrecan", Cell Res, Vol. 12 No. 1, pp. 19-32. KNUTH, C. A., ANDRES, S. E., FAHY, N. B., WITTE-BOUMA, J., RIDWAN, Y., STRABBING, E. M., KOUDSTAAL, M. J., van de PEPPEL, J., WOLVIUS, E. B., NARCISI, R. & FARRELL, E. (2019), "Collagen type X is essential for successful mesenchymal stem cell-mediated cartilage formation and subsequent endochondral ossification", Eur Cell Mater, Vol. 38106-122. LEFEBVRE, V., ANGELOZZI, M. & HASEEB, A. (2019), "SOX9 in cartilage development and disease", Curr Opin Cell Biol, Vol. 6139-47. LI, P., WANG, A., LI, J., LI, X., SUN, W. & LIU, Q. (2021), "COL2A1 Mutation (c.611G>C) Leads to Early-Onset Osteoarthritis in a Chinese Family", Int J Gen Med, Vol. 142569-2574. LUO, J., YANG, H. & SONG, B. L. (2020), "Mechanisms and regulation of cholesterol homeostasis", Nat Rev Mol Cell Biol, Vol. 21 No. 4, pp. 225-245. MASUKO, K., MURATA, M., SUEMATSU, N., OKAMOTO, K., YUDOH, K., NAKAMURA, H. & KATO, T. (2009), "A metabolic aspect of osteoarthritis: lipid as a possible contributor to the pathogenesis of cartilage degradation", Clin Exp Rheumatol, Vol. 27 No. 2, pp. 347-53. MURPHY, L. & HELMICK, C. G. (2012), "The impact of osteoarthritis in the United States: a population-health perspective", Am J Nurs, Vol. 112 No. 3 Suppl 1, pp. S13-9. NIU, J., CLANCY, M., ALIABADI, P., VASAN, R. & FELSON, D. T. (2017), "Metabolic Syndrome, Its Components, and Knee Osteoarthritis: The Framingham Osteoarthritis Study", Arthritis Rheumatol, Vol. 69 No. 6, pp. 1194-1203. OLIVIERO, F., LO, N. A., BERNARDI, D., GIUNCO, S., BALDO, G., SCANU, A., SFRISO, P., RAMONDA, R., PLEBANI, M. & PUNZI, L. (2012), "A comparative study of serum and synovial fluid lipoprotein levels in patients with various arthritides", Clin Chim Acta, Vol. 413 No. 1-2, pp. 303-7. PAPATHANASIOU, I., ANASTASOPOULOU, L. & TSEZOU, A. (2021), "Cholesterol metabolism related genes in osteoarthritis", Bone, Vol. 152116076. PENG, Z., SUN, H., BUNPETCH, V., KOH, Y., WEN, Y., WU, D. & OUYANG, H. (2021), "The regulation of cartilage extracellular matrix homeostasis in joint cartilage degeneration and regeneration", Biomaterials, Vol. 268120555. RATNESWARAN, A., SUN, M. M., DUPUIS, H., SAWYEZ, C., BORRADAILE, N. & BEIER, F. (2017), "Nuclear receptors regulate lipid metabolism and oxidative stress markers in chondrocytes", J Mol Med (Berl), Vol. 95 No. 4, pp. 431-444. ROGART, J. N., BARRACH, H. J. & CHICHESTER, C. O. (1999), "Articular collagen degradation in the Hulth-Telhag model of osteoarthritis", Osteoarthritis Cartilage, Vol. 7 No. 6, pp. 539-47. SCHAFER, N. & GRASSEL, S. (2022), "Targeted therapy for osteoarthritis: progress and pitfalls", Nat Med, Vol. 28 No. 12, pp. 2473-2475. SHEN, J., ABU-AMER, Y., O'KEEFE, R. J. & MCALINDEN, A. (2017), "Inflammation and epigenetic regulation in osteoarthritis", Connect Tissue Res, Vol. 58 No. 1, pp. 49-63. SHORROCK, C. J. & REES, W. D. (1988), "Overview of gastroduodenal mucosal protection", Am J Med, Vol. 84 No. 2A, pp. 25-34. SI, Y., MA, Y., GUO, Y., PAN, Y., ZHENG, S., XU, G., DA, W. & XU, L. (2018), "Efficacy and safety of Shaoyang Xibi decoction in patients with knee osteoarthritis: a multi-center, single-blind, randomized controlled trial", J Tradit Chin Med, Vol. 38 No. 5, pp. 733-739. SOSTRES, C., GARGALLO, C. J., ARROYO, M. T. & LANAS, A. (2010), "Adverse effects of non-steroidal anti-inflammatory drugs (NSAIDs, aspirin and coxibs) on upper gastrointestinal tract", Best Pract Res Clin Gastroenterol, Vol. 24 No. 2, pp. 121-32. TABAS, I. (2002), "Consequences of cellular cholesterol accumulation: basic concepts and physiological implications", J Clin Invest, Vol. 110 No. 7, pp. 905-11. TSEZOU, A., ILIOPOULOS, D., MALIZOS, K. N. & SIMOPOULOU, T. (2010), "Impaired expression of genes regulating cholesterol efflux in human osteoarthritic chondrocytes", J Orthop Res, Vol. 28 No. 8, pp. 1033-9. VILLALVILLA, A., GOMEZ, R., LARGO, R. & HERRERO-BEAUMONT, G. (2013), "Lipid transport and metabolism in healthy and osteoarthritic cartilage", Int J Mol Sci, Vol. 14 No. 10, pp. 20793-808. WU, C. L., JAIN, D., MCNEILL, J. N., LITTLE, D., ANDERSON, J. A., HUEBNER, J. L., KRAUS, V. B., RODRIGUIZ, R. M., WETSEL, W. C. & GUILAK, F. (2015), "Dietary fatty acid content regulates wound repair and the pathogenesis of osteoarthritis following joint injury", Ann Rheum Dis, Vol. 74 No. 11, pp. 2076-83. ZELCER, N. & TONTONOZ, P. (2006), "Liver X receptors as integrators of metabolic and inflammatory signaling", J Clin Invest, Vol. 116 No. 3, pp. 607-14. ZHANG, X .,GUO, Y .,PAN, Y .,LIU ,M .,TU ,P. ,LU, C. , MA, Y. (2023), "Effects of Shaoyang Xibi Decoction on Knee Osteoarthritis in Rats Based on LXR-α/NF-κB Signaling Pathway ", Chin J Integ Tradit West Med , Vol. 43 No. 12, pp. 1469-1477. Additional Declarations No competing interests reported. Supplementary Files supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7556233","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531181047,"identity":"68521744-c93c-4c06-ae12-c243f2cb604e","order_by":0,"name":"Chaoran Lu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chaoran","middleName":"","lastName":"Lu","suffix":""},{"id":531181048,"identity":"0470ed91-e6ca-407d-8480-c0b7a17a3d76","order_by":1,"name":"Yuhao Si","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuhao","middleName":"","lastName":"Si","suffix":""},{"id":531181049,"identity":"8f42a40b-8cd1-4bc1-b284-20419e4c24d0","order_by":2,"name":"Yalan Pan","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yalan","middleName":"","lastName":"Pan","suffix":""},{"id":531181050,"identity":"cdb51866-9c68-41a7-bf94-fcd6fc6dca4a","order_by":3,"name":"Lining Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lining","middleName":"","lastName":"Wang","suffix":""},{"id":531181051,"identity":"8c5c5a19-4d54-4c75-9441-3bb9ad22d355","order_by":4,"name":"Mengmin Liu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Mengmin","middleName":"","lastName":"Liu","suffix":""},{"id":531181052,"identity":"273a412d-258e-460e-9a4f-0986b3ca5483","order_by":5,"name":"Sixian Chen","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Sixian","middleName":"","lastName":"Chen","suffix":""},{"id":531181053,"identity":"98377a57-3135-4904-93b9-15c37616e864","order_by":6,"name":"Lei Shi","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Shi","suffix":""},{"id":531181057,"identity":"bcb7301b-ed21-42f3-985b-e757e601d9fd","order_by":7,"name":"Ruihua Zhao","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ruihua","middleName":"","lastName":"Zhao","suffix":""},{"id":531181058,"identity":"f5f0cb69-bdf8-494d-9cc5-c681a8b73089","order_by":8,"name":"Zhixin Li","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhixin","middleName":"","lastName":"Li","suffix":""},{"id":531181061,"identity":"3ab45be4-f20e-43a6-9781-102fadaead95","order_by":9,"name":"Yang Guo","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Guo","suffix":""},{"id":531181062,"identity":"b12b8401-9782-466c-9bd1-7e610cc3a91c","order_by":10,"name":"Yong Ma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYDACCSSSgaFCQo6fRC1nLIwlG4jTAgWMbRWJGwhpkZ/dfOzh1zaLaP4ZyUDGPAnGDQzMDx/dwKOFcc6xdGPZNoncGTfSgIxtEszmDGzGxjl4tDBL5JhJSwK1NNwAMbZJsFk28LBJ49PCBtMyH6xljgSPwQECWniAWiQ/ArVsuAFiNEhIENQiIZGWJs1wTiJ345lnQMYxCQPJZgJ+kQcGlOSPsrrcecdBjJq6+n725oeP8WkBAWZeNiApkMDAzAPmElAOAow//gBJ/gNABhGqR8EoGAWjYOQBACjSR8rmXzWMAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yong","middleName":"","lastName":"Ma","suffix":""}],"badges":[],"createdAt":"2025-09-07 12:38:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7556233/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7556233/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93940696,"identity":"08b19335-5867-4bd8-88d4-efc8b0e6fe8e","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3697390,"visible":true,"origin":"","legend":"","description":"","filename":"FigureFigureLegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/c2d4b3b199a57d74d7e3fdfa.docx"},{"id":93942096,"identity":"d1067a86-ef70-4970-a1d6-78ab52c1bd24","added_by":"auto","created_at":"2025-10-20 13:46:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2584697,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/f6fe72956601fb880a3723bd.docx"},{"id":93940688,"identity":"f607f5d2-570c-4f9c-8e9e-14b063c2a0a3","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":787736,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/686099f9cf7c3341377329c7.png"},{"id":93940692,"identity":"107a208d-b468-48f3-9397-f4287a745847","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1590143,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/a72ea7b7e6a3ce7ad96b96d7.png"},{"id":93942098,"identity":"fadbc57f-0849-4ef0-9aaf-baac6d6372d7","added_by":"auto","created_at":"2025-10-20 13:46:14","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15268,"visible":true,"origin":"","legend":"","description":"","filename":"Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/744e61e77f53533ec7b1ce67.docx"},{"id":93940701,"identity":"d18e69f4-98d5-4606-aea5-51224e78bfca","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136167,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/9372d33c0e843957daa97eb1.png"},{"id":93940712,"identity":"fe8f2f49-c565-4eee-bcdc-41395a3f4a75","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":786890,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/764b95744099a8e1b519e4bd.png"},{"id":93940709,"identity":"7cd0fbf4-1e2e-4b8b-be5a-22a407371b47","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":384160,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/64def0883edf3d5b36fba6a7.png"},{"id":93940713,"identity":"837b1c57-04bc-44cb-b813-85155eac1ab5","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":397319,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/560279895d1bcd89668990af.png"},{"id":93940690,"identity":"b8879415-9312-4d9d-a030-53b0bf4e8048","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13950,"visible":true,"origin":"","legend":"","description":"","filename":"526080b80d53432aac556b460d9c6dab.json","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/ab83790b14b8309611a17150.json"},{"id":93940711,"identity":"b3e2637b-9cf0-454b-a2d7-00acff7441a4","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15268,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/f00b68414779ee4d2ba6ce63.docx"},{"id":93940705,"identity":"d7fe9739-606f-497e-8e87-c93e7272629c","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":158540,"visible":true,"origin":"","legend":"","description":"","filename":"526080b80d53432aac556b460d9c6dab1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/45d197dfa6a3d368b74126c6.xml"},{"id":93942099,"identity":"a026ad56-043e-488f-a941-ef1d7fc8c526","added_by":"auto","created_at":"2025-10-20 13:46:14","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":787736,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/97af8347a8b6b5aa534d74b7.png"},{"id":93940715,"identity":"3f410c26-db88-4157-af3e-acd001828153","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1590143,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/853803696617d0a44c7ac45a.png"},{"id":93940691,"identity":"c7417935-ca2c-4abf-a125-2f2f1b01436d","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136167,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/a19cc8f7302b296046dcb5a5.png"},{"id":93942107,"identity":"f27c2c00-85db-4b1b-8e62-3eb54b46887c","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":786890,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/79ace727883f71c0ed3f4f03.png"},{"id":93942103,"identity":"efe8fc0f-529d-4e46-b740-bb47793918c8","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":384160,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/78d979975fe14550cace0e0f.png"},{"id":93940708,"identity":"6289b4e9-096e-48e9-a474-2c45d9ebf2ea","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":397319,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/316b131ffe498127d9491ecd.png"},{"id":93942101,"identity":"21eb38d2-f2eb-4371-8d2f-1cfb1a6aa1b1","added_by":"auto","created_at":"2025-10-20 13:46:14","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206821,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/b249818bc9d4fc686260fa63.png"},{"id":93942097,"identity":"dbb3fc4e-1e0d-4ca4-b898-f0bac0303ffe","added_by":"auto","created_at":"2025-10-20 13:46:14","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":782982,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/a21f4ab26b57ec914f136121.jpeg"},{"id":93940697,"identity":"ceea50a4-a0e1-49ec-999f-27f39175c8b5","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":337090,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/def43821cc7f6df4fa3c29fe.jpeg"},{"id":93940695,"identity":"f20973fe-45ca-4b45-9c4b-ba93a5756964","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"jpeg","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1340670,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/ef2ce4ed7768929596e4915c.jpeg"},{"id":93940741,"identity":"f01313b1-094f-4ec4-92f5-dcf26b52f101","added_by":"auto","created_at":"2025-10-20 13:38:16","extension":"jpeg","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":90398,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/386ba41d759b0cd882457c60.jpeg"},{"id":93940689,"identity":"3b62c747-45a3-468c-92d7-13d6cdece137","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"jpeg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":782982,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/58ee8e23f8ea95088a5ef26f.jpeg"},{"id":93940729,"identity":"8439ccde-c3ad-4274-8c84-163b5d97d86b","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"jpeg","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":439690,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/d171541d561c426d84554c84.jpeg"},{"id":93942102,"identity":"dba508eb-0c45-4c94-9874-dbed65182501","added_by":"auto","created_at":"2025-10-20 13:46:14","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206821,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/fff0dc67bcf5cef77f77909a.png"},{"id":93940739,"identity":"6e4e9a21-19bf-4af0-a345-339f99229f4d","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"jpeg","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1340670,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/88d8e9a54b00229bca3e5ee4.jpeg"},{"id":93942105,"identity":"1d4a3923-dd8c-4255-b46d-3368d314fcb3","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"jpeg","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":90398,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/2ebc57bb9c2087c3194cc4e2.jpeg"},{"id":93940736,"identity":"ac8d6556-13ab-41a5-967a-f2486144bb4d","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"jpeg","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":921186,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/aa29d1f24ac3209dde2d983e.jpeg"},{"id":93940745,"identity":"0776c7dc-7dcc-48a3-b3b8-31ed1515722b","added_by":"auto","created_at":"2025-10-20 13:38:16","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114790,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/f4d2aaf5e0dddd14776ed1da.png"},{"id":93940716,"identity":"3e288674-c22d-45bb-b396-86aeb31688c5","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":232783,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/84cfdf1b32b4e6cc95b0d9ae.png"},{"id":93940732,"identity":"e6d811ed-87cb-4cd9-8dce-9d20fcb86a2c","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28320,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/ec4d948baf2b1fd4f2d904f2.png"},{"id":93940730,"identity":"49615efd-be51-4028-8711-5f4117729f9a","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101295,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/c95c2551c23fde82366c31cb.png"},{"id":93940748,"identity":"d8612ebd-a8bc-49bb-a64e-c40956243b97","added_by":"auto","created_at":"2025-10-20 13:38:16","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66924,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/93f2c404f265a26b04f885c8.png"},{"id":93940754,"identity":"b3eb4184-6cbd-4aef-9a4e-16df45fa1a62","added_by":"auto","created_at":"2025-10-20 13:38:17","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55310,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/0f8dad73accc47705325b42c.png"},{"id":93942106,"identity":"4c822d08-825c-4fbc-a2a2-5fa2fec33622","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37749,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/4c5162490cbd7c2d69960bd0.png"},{"id":93940742,"identity":"c6249cec-5f64-44c1-9ab5-97b3a90a3f67","added_by":"auto","created_at":"2025-10-20 13:38:16","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101169,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/5e9bc78e085bffdd56f491b9.png"},{"id":93940752,"identity":"aed462fb-f19a-4c77-86ba-9b8e5529c264","added_by":"auto","created_at":"2025-10-20 13:38:17","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31366,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/8cee83af3eb69edb8b6500f6.png"},{"id":93940704,"identity":"1c8a5f7a-2ae9-4447-ba57-05c456fa5722","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168369,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/0160226f0a3c611f57668d15.png"},{"id":93942104,"identity":"fe0b0a26-95be-4d63-8daa-70dd22257975","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10690,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/954c9f3aae3f31041dc057c7.png"},{"id":93940746,"identity":"99b55abc-36c0-4e05-afb8-a29b1d82ee79","added_by":"auto","created_at":"2025-10-20 13:38:16","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101169,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/08bdd4fa9e0f9ba5d278dfce.png"},{"id":93940725,"identity":"3f168db8-d2e8-4f0c-8352-72a259478d06","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80412,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/8e9942a6c520a305dda4e354.png"},{"id":93942108,"identity":"09f11456-0aa4-4f84-ac14-d9fa96d9aea1","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37749,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/bff2d4de1d00ef722d30775f.png"},{"id":93942110,"identity":"f3e35571-363e-4178-bbf5-d8661647a96d","added_by":"auto","created_at":"2025-10-20 13:46:15","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168369,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/61d28e22481efa7fefa34de1.png"},{"id":93940727,"identity":"68f199aa-05c3-466d-befd-0d6dd2c6f838","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10690,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/97d515963df5bc8ae3ec68ed.png"},{"id":93940753,"identity":"10f45041-f14f-4cf8-9ae1-313d70362734","added_by":"auto","created_at":"2025-10-20 13:38:17","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83711,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/27c44ba986a4826708a9743d.png"},{"id":93940737,"identity":"1b0292a5-8456-439a-bfb8-88bfb03091a1","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"xml","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150537,"visible":true,"origin":"","legend":"","description":"","filename":"526080b80d53432aac556b460d9c6dab1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/4253fcbf74c26f9af69cba4b.xml"},{"id":93940734,"identity":"3b6afce6-0afd-4c32-865b-60d116e70aee","added_by":"auto","created_at":"2025-10-20 13:38:15","extension":"html","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":170147,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/fa3feffbc0d1ecb6fde7b389.html"},{"id":93940683,"identity":"8c0567d0-0e76-4afb-aaf7-536ee47d1fb1","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":945119,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTotal ion chromatograms of the extract of SYXBF in positive and negative ion modes. \u003c/strong\u003e(A) Positive ion chromatogram of SYXBF. (B) Negative ion chromatogram of SYXBF.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/5ae2fd5d992f5628af50d8b9.png"},{"id":93942100,"identity":"fbe484bb-f54a-4f9f-9aaa-9b5b9d4e0d85","added_by":"auto","created_at":"2025-10-20 13:46:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1770329,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSYXBF improves motor function, pain symptoms, and delays the progression of osteoarthritis in rats induced by the modified HULTH method. \u003c/strong\u003e(A) Images of the knee joints of rats from each group taken after four weeks of treatment. (B) Toluidine blue staining and safranin O-fast green staining of the knee joints in each group. Scale bar=50μm. (C) Macroscopic scores of the knee joints in rats. n=6. (D) Modified Mankin's scores of the knee joints in rats. n=6. (E, F, G) Rats from each group were placed on a treadmill and recorded running at a speed of 18m/min. The swing duration percentage, propulsion duration percentage, and paw area were analyzed and calculated. The provided data are presented as mean ± standard deviation. n=3. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/da936ad3975fdea468d19660.png"},{"id":93940684,"identity":"0275592d-2697-49f4-81b5-0504fa0776f2","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":203172,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSYXBF improves inflammation and cholesterol accumulation in the knee articular cartilage of rats with knee osteoarthritis induced by the modified HULTH method.\u003c/strong\u003e (A) Measurement of total cholesterol content in the knee articular cartilage of rats using a cholesterol detection kit. (B) Expression of PGE2 in the knee articular cartilage of rats detected by real-time fluorescence quantitative PCR. (C, D) Expression of relevant inflammatory factors in the serum of rats detected by enzyme-linked immunosorbent assay. The provided data are presented as mean ± standard deviation. n=3. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/91c042c8e3e2a469f99ce845.png"},{"id":93940685,"identity":"3117d4ba-6987-44fa-bc69-020b73a1e317","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":909412,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe serum containing SYXBF can alleviate the expression of inflammatory factors and cholesterol accumulation in rat knee articular chondrocytes induced by cholesterol-cyclodextrin complex. \u003c/strong\u003e(A) Primary chondrocytes at passage 1. (B) Chondrocytes at passage 3. (C) Identification of chondrocytes at passage 3 using toluidine blue staining. (D) Chondrocytes in the NC group. (E) Chondrocytes in the M group. Scale bar = 100μm. (F, G) Identification of the cholesterol accumulation model using FILIPIN staining. (H) Measurement of cholesterol content in chondrocytes using a total cholesterol detection kit. (I, J) Expression of relevant inflammatory factors in the cell supernatant detected by enzyme-linked immunosorbent assay. The provided data are presented as mean ± standard deviation. n=3. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/0c6ddcb534b2953991bb4a21.png"},{"id":93940703,"identity":"f4206687-027c-402b-9d41-7ac15fad1183","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":493792,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSYXBF can increase the expression of synthesis-related genes and proteins in chondrocytes.\u003c/strong\u003e (A, D) Immunohistochemistry and quantitative analysis were performed to detect changes in the protein expression of COL2 in knee articular cartilage induced by modified HULTH method. (B, E, F, G) Western blot and quantitative analysis were performed to detect changes in the expression of chondrocyte synthesis-related proteins in knee articular cartilage induced by modified HULTH method. (H, I, J, K) Real-time fluorescence quantitative analysis was performed to detect changes in the expression of synthesis-related genes in knee articular cartilage induced by modified HULTH method. (C, L, M, N) Western blot and quantitative analysis were performed to detect changes in the expression of chondrocyte synthesis-related proteins in chondrocytes with cholesterol accumulation induced by cholesterol-cyclodextrin complex. (O, P, Q, R) Real-time fluorescence quantitative analysis was performed to detect changes in the expression of synthesis-related genes in chondrocytes with cholesterol accumulation induced by cholesterol-cyclodextrin complex. The data presented are the means ± standard deviation. n=3. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, #p\u0026lt;0.05, compared to the S group.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/d6aa68c7c5d0d96bd425605b.png"},{"id":93940699,"identity":"1b73e5d1-a2c0-4eb4-aebe-d7fbae675948","added_by":"auto","created_at":"2025-10-20 13:38:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":589877,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of SYXBF on the protein and gene expression of LXRα-ABCA1/ABCG1 pathway. \u003c/strong\u003e(A, B, C, D) Western blot and quantitative analysis were performed to detect changes in the protein expression of LXRα-ABCA1/ABCG1 pathway in knee articular cartilage induced by modified HULTH method. (E, F, G) Real-time fluorescence quantitative analysis was performed to detect changes in the expression of LXRα-ABCA1/ABCG1 pathway-related genes in knee articular cartilage induced by modified HULTH method. (H, I, J, K) Western blot and quantitative analysis were performed to detect changes in the expression of LXRα-ABCA1/ABCG1 pathway-related proteins in chondrocytes with cholesterol accumulation induced by cholesterol-cyclodextrin complex. (L, M, N) Real-time fluorescence quantitative analysis was performed to detect changes in the expression of LXRα-ABCA1/ABCG1 pathway-related genes in chondrocytes with cholesterol accumulation induced by cholesterol-cyclodextrin complex. The data presented are the means ± standard deviation. n=3. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, #p\u0026lt;0.05, compared to the S group.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/e40a4a98e90f461a9387b5a8.png"},{"id":102398339,"identity":"957aac41-3c43-4a51-9499-7114ecd1d42d","added_by":"auto","created_at":"2026-02-11 10:22:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6922610,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/4639461f-e5c9-494f-baf9-df0a486b5b00.pdf"},{"id":93940686,"identity":"71c0df20-c805-43c3-a253-f35a5083aa32","added_by":"auto","created_at":"2025-10-20 13:38:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15268,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-7556233/v1/0ebbb0d785854a14cba724b8.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Shaoyang Xibi Decoction improves cholesterol accumulation to delay the progression of knee osteoarthritis by regulating the LXRα-ABCA1/ABCG1 signaling pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eOsteoarthritis (OA) is a globally prevalent degenerative joint disease characterized by chronic degenerative changes in the articular cartilage, including destruction, degeneration, and osteophyte formation (Jang \u003cem\u003eet al.\u003c/em\u003e, 2021, Schafer and Grassel, 2022). The incidence of KOA has been steadily increasing due to the rising prevalence of aging and obesity(Abramoff and Caldera, 2020). In the United States alone, arthritis-related activity limitations affect over 22.7\u0026nbsp;million people, making it a leading cause of disability among the elderly population(2013, Murphy and Helmick, 2012). Current treatment options for KOA, such as oral analgesics including nonsteroidal anti-inflammatory drugs and cyclooxygenase-2 inhibitors, often lead to adverse gastrointestinal reactions(Shorrock and Rees, 1988, Sostres \u003cem\u003eet al.\u003c/em\u003e, 2010, Hooper \u003cem\u003eet al.\u003c/em\u003e, 2004). Additionally, the safety, economic burden, and risk of failure associated with surgical interventions for knee osteoarthritis have led some patients to refuse surgery. These approaches only provide pain relief and do not have significant clinical effects in terms of preventing or altering the progression of osteoarthritis. Given the risks associated with the aforementioned treatment methods, there is a need to develop alternative therapies for knee osteoarthritis that have lower risks and reduced toxicity.\u003c/p\u003e\u003cp\u003eThe primary manifestation of osteoarthritis is pain and restricted movement caused by cartilage destruction. Cartilage degradation often results from an imbalance in the synthesis and breakdown metabolism of chondrocytes, the only cells within cartilage. Chondrocytes have a crucial role in synthesizing the cartilage matrix, maintaining its homeostasis, participating in partial injury repair, and regulating local metabolic activity. These cells can adjust their synthetic and degradative activities by modulating the expression of genes involved in synthesis and breakdown metabolism(Aigner \u003cem\u003eet al.\u003c/em\u003e, 2002), thus preserving the delicate equilibrium of cartilage tissue. However, exposure to external stimuli can induce chondrocytes to favor degradative metabolism. Consequently, many studies have focused on mitigating inflammatory responses, reducing the expression of genes associated with cartilage breakdown (such as matrix metalloproteinases), alleviating chondrocyte oxidative stress, and inhibiting chondrocyte apoptosis. The goal of these efforts is to decrease cartilage matrix destruction and slow down the progression of osteoarthritis. However, there is limited research on the synthetic aspect.\u003c/p\u003e\u003cp\u003eIn recent years, osteoarthritis has been linked to metabolic syndrome (Niu \u003cem\u003eet al.\u003c/em\u003e, 2017), particularly cholesterol metabolism. A study by Courties A(Courties \u003cem\u003eet al.\u003c/em\u003e, 2017) suggests that dysregulation of cholesterol efflux in chondrocytes of KOA can lead to cholesterol accumulation in the articular cartilage(Tsezou \u003cem\u003eet al.\u003c/em\u003e, 2010). Radiological studies in some patients with hypercholesterolemia have found a correlation between high serum cholesterol levels and systemic osteoarthritis(Masuko \u003cem\u003eet al.\u003c/em\u003e, 2009, Katz \u003cem\u003eet al.\u003c/em\u003e, 2021). Evidence of lipid metabolism and cholesterol imbalance has also been found in chondrocytes of osteoarthritic cartilage(Tsezou et al., 2010, Villalvilla \u003cem\u003eet al.\u003c/em\u003e, 2013), and both chondrocyte-specific cholesterol accumulation and high-fat feeding have been shown to worsen the severity of osteoarthritis in mouse models(Ali \u003cem\u003eet al.\u003c/em\u003e, 2016, Griffin \u003cem\u003eet al.\u003c/em\u003e, 2012, Wu \u003cem\u003eet al.\u003c/em\u003e, 2015). These findings indicate that cholesterol may be a contributing factor in the pathogenesis of cartilage degradation, and cholesterol metabolism in chondrocytes appears to play a role in regulating cartilage homeostasis(Masuko et al., 2009, Papathanasiou \u003cem\u003eet al.\u003c/em\u003e, 2021). In the field of pharmaceuticals, no drug has yet been developed to inhibit the progression of cartilage degeneration by improving cholesterol accumulation in the articular cartilage. Therefore, drugs that improve cholesterol accumulation in the articular cartilage may offer a new treatment option for patients with osteoarthritis\u003c/p\u003e\u003cp\u003eSYXBF is a traditional Chinese medicine formula composed of the following herbs: Chaihu (Bupleurum), Huangqin (Scutellaria baicalensis), Baishao (Paeonia lactiflora), Dangshen (Codonopsis pilosula), Niuxi (Achyranthes bidentata), Duzhong (Eucommia ulmoides), Yiyiren (Coix seed), Fuling (Poria cocos), Muxiang (Saussurea costus), Chuanxiong (Ligusticum chuanxiong), Gancao (Glycyrrhiza uralensis), and Zexie (Alisma orientale). It is a traditional Chinese medicine formula used for knee-related conditions. The formula has been granted a patent with the patent number: ZL201810399052.9. As a traditional Chinese medicine formula for treating knee osteoarthritis(Si \u003cem\u003eet al.\u003c/em\u003e, 2018), SYXBF has been shown to activate LXRα to reduce the expression of inflammatory factors and matrix metalloproteinases, thereby alleviating osteoarthritis(Zhang \u003cem\u003eet al.\u003c/em\u003e, 2023). However, to date, there have been no reports on its efficacy and mechanism in regulating cholesterol metabolism to protect cartilage for the treatment of knee osteoarthritis. In addition to its potent anti-inflammatory properties(Zelcer and Tontonoz, 2006), LXRα plays a crucial role in controlling cellular and systemic cholesterol homeostasis. Furthermore, the study by Ratneswaran A (Ratneswaran \u003cem\u003eet al.\u003c/em\u003e, 2017)also demonstrated that nuclear receptors regulate genes involved in lipid metabolism as well as genes related to cartilage matrix turnover. In this study, we observed that SYXBF can activate LXRα, increase the expression of ABCA1 and ABCG1 to reduce intracellular cholesterol levels in chondrocytes, and downregulate inflammatory factors such as TNF-α and IL-1β in the serum. These findings suggest that SYXBF has therapeutic potential for knee osteoarthritis. Additionally, SYXBF also upregulates the expression of genes involved in cartilage synthesis metabolism, such as SOX9, ACAN, COL2, and COL10, promoting cartilage matrix synthesis and improving cartilage homeostasis to alleviate the progression of knee osteoarthritis. This study evaluated the therapeutic effects of SYXBF in a rat model of knee osteoarthritis, providing evidence for its role in improving knee osteoarthritis and preliminary insights into its mechanisms of action in reducing cholesterol accumulation.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1 SYXBF preparation\u003c/h2\u003e\n \u003cp\u003eShaoyang Xibi Decoction (Patent Number: ZL201810399052.9) is composed of herbs such as Chaihu (Bupleurum) and Huangqin (Scutellaria baicalensis). The herbal ingredients were purchased from the Pharmacy Department of Nanjing University of Chinese Medicine Affiliated Hospital. The herbs were mixed together and decocted with pure water at 100\u0026deg;C. After 45 minutes, the filtrate was obtained and concentrated under reduced pressure at 60\u0026deg;C to obtain concentrations of 0.55g/ml, 1.1g/ml, and 2.2g/ml of the crude medicine solution. The quality control of SYXBF was conducted using LC-MS/MS analysis to analyze its components.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2 Animal\u003c/h2\u003e\n \u003cp\u003eA total of 42 SPF-grade SD rats, aged 3 months, with an equal number of males and females, weighing (220\u0026thinsp;\u0026plusmn;\u0026thinsp;10)g, were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The production license number is SCXK (Jing) 2021-0011. The animal experiments related to this study have been approved by the Experimental Animal Center of Nanjing University of Chinese Medicine, with approval number 202203A075. All rats were housed under a 12-hour light/dark cycle at a temperature of 20\u0026thinsp;\u0026plusmn;\u0026thinsp;5℃ and a humidity of 55\u0026thinsp;\u0026plusmn;\u0026thinsp;15%. After a one-week adaptation period, the rats were divided into the following groups: Sham-operated group (S group), Model group (M group), M\u0026thinsp;+\u0026thinsp;MELO (Meloxicam) group, M\u0026thinsp;+\u0026thinsp;S0.55 group, M\u0026thinsp;+\u0026thinsp;S1.1 group, and M\u0026thinsp;+\u0026thinsp;S2.2 group (n\u0026thinsp;=\u0026thinsp;6). In the S group, the knee joint was opened without detaching the ligaments or removing the medial meniscus. For all other rats, except for the sham-operated group, a modified Hulth method was used to induce the knee osteoarthritis model. Anesthesia was induced using isoflurane(He \u003cem\u003eet al.\u003c/em\u003e, 2021), and the modified Hulth method described by J N Rogart(Rogart \u003cem\u003eet al.\u003c/em\u003e, 1999) was used for modeling. Within 3 days after surgery, penicillin was administered intramuscularly at a dose of 400,000 units per day to prevent infection. Starting from 1 week post-surgery, the rats were subjected to forced exercise on a treadmill at a speed of 18m/min and a current of 0.6mA for 30 minutes per day, for a duration of 4 weeks. After successful modeling, the following interventions were administered: the S group and M group received normal saline (10mL/(kg\u0026middot;d)); the M\u0026thinsp;+\u0026thinsp;MELO group received a solution of meloxicam (7.8mg/(kg\u0026middot;d)); the M\u0026thinsp;+\u0026thinsp;S0.55 group received SYXBF at a dose of 5.5g/(kg\u0026middot;d); the M\u0026thinsp;+\u0026thinsp;S1.1 group received SYXBF at a dose of 11g/(kg\u0026middot;d); and the M\u0026thinsp;+\u0026thinsp;S2.2 group received SYXBF at a dose of 22g/(kg\u0026middot;d). The dosage of SYXBF was calculated based on the equivalent clinical dose for adults, taking into account the conversion factor between rat and adult body weight (6.25). SYXBF was administered as a decoction, starting from 1 week post-surgery and continued for 4 weeks.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3cell\u003c/h2\u003e\n \u003cp\u003eRat chondrocyte extraction and identification: four rats were euthanized to obtain the samples. Under sterile conditions, the articular cartilage of the bilateral femoral condyles and tibial plateaus was scraped. The collected cartilage was washed three times with PBS buffer containing 3% penicillin-streptomycin. Then, the cartilage was cut into 1mm^3 pieces and placed in 0.2% collagenase type II solution prepared in LG-DMEM. The digestion was carried out in a cell culture incubator for 8 hours, and the digestion solution was collected after digestion was terminated. The collected solution was centrifuged at 1000rpm for 5 minutes, and the supernatant was discarded. The cell pellet was resuspended in LG-DMEM supplemented with 10% FBS and 1% penicillin-streptomycin, and then seeded in a \u0026phi;100mm culture dish. The dish was placed in a 37℃, 5% CO2 incubator. The culture medium was changed every 2\u0026ndash;3 days, and regular observations and photographs were taken using an inverted microscope. When the cells covered more than 90% of the dish bottom, they were passaged at a ratio of 1:2. After three passages, toluidine blue staining was performed to identify the chondrocytes(Chen \u003cem\u003eet al.\u003c/em\u003e, 2020). When the normal cells reached the fourth passage, the culture dish was supplemented with 0.5% FBS starvation medium and incubated for 48 hours. After that, the culture dish was further supplemented with 10% FBS medium containing 50ug/ml of water-soluble cholesterol. The dish was placed in a 37℃, 5% CO2 incubator and cultured for an additional 48 hours. During the modeling period, the culture medium was not changed. After modeling, the cells were stained using the Filipin fluorescence staining method to identify the modeling results. The Cell Total Free Cholesterol Filipin Fluorescence Staining Kit (Product No: GMS80059.1, Company: Shanghai Jiemai Gene Pharmaceutical Technology Co., Ltd.) was used for the staining. The cholesterol accumulation model chondrocytes were intervened as follows: M group: Regular replacement of culture medium. M\u0026thinsp;+\u0026thinsp;S group: Treated with serum containing 10% SYXBF.M\u0026thinsp;+\u0026thinsp;Y group: Treated with LXR\u0026alpha; inhibitor GSK2033.M\u0026thinsp;+\u0026thinsp;SY group: Treated with both SYXBF and LXR\u0026alpha; inhibitor GSK2033.M\u0026thinsp;+\u0026thinsp;J group: Treated with LXR\u0026alpha; agonist GW3965.M\u0026thinsp;+\u0026thinsp;SJ group: Treated with both SYXBF and LXR\u0026alpha; agonist GW3965.\u003c/p\u003e\n \u003cp\u003eAdditionally, a blank control group was set using normal rat chondrocytes. The interventions were carried out for 72 hours according to the respective groups.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4 Behavioral analysis of rats\u003c/h2\u003e\n \u003cp\u003eAfter four weeks of administration, three rats were randomly selected from each group for gait analysis. The rats were placed on a gait analysis apparatus and started accelerating from a speed of 0m/s. The speed at which the rats could start running normally, as well as the speed range where they could no longer maintain stable running was observed. A speed at which all tested rats could maintain stable and continuous running was selected as the standard speed. Subsequently, the rats in each group were filmed using a gait analysis system while running at the standard speed for 5\u0026ndash;10 seconds. The videos were analyzed using Digigait image analysis software to evaluate the hindlimb motor ability and pain sensation in the rats.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5Histology\u003c/h2\u003e\n \u003cp\u003eAt the end of the experiment, the left and right knee joints of each group of rats were dissected, and the muscles were removed. The gross appearance of the knee joints was photographed. After photographing the cartilage and completing the cartilage scoring, the samples were fixed in 10% paraformaldehyde for 24 hours and decalcified in a decalcification solution for four weeks. The decalcified specimens were dehydrated and embedded in paraffin. The paraffin blocks were sectioned into 7\u0026micro;m tissue sections, which were then stained with Safranin O-Fast Green and toluidine blue to observe the structure of the cartilage in knee osteoarthritis. The stained tissues were observed using Leica Application Suite (LAS) microscope software (Leica Biosystems). Subsequently, the left and right knee joints were blindly assessed by three different experts (n\u0026thinsp;=\u0026thinsp;6) using the modified Mankin\u0026apos;s score for cartilage improvement, ranging from 0 to 14 points.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6Immunohistochemistry\u003c/h2\u003e\n \u003cp\u003eAfter dewaxing the paraffin sections with xylene and rehydrating them in a series of graded alcohol, a circle was drawn around the tissue using a hydrophobic pen. The tissue within the circle was covered with gastric enzyme, ensuring complete coverage, and then incubated at 37\u0026deg;C for 30 minutes in an oven. The sections were then rinsed and washed clean, followed by incubation in a 3% hydrogen peroxide solution at room temperature in the dark for 25 minutes. The slides were placed in PBS (pH 7.4) and washed on a decolorization shaker three times, each for 5 minutes. Subsequently, 3% BSA was added within the circle to evenly cover the tissue, and the slides were sealed at room temperature for 30 minutes. The excess blocking solution was gently shaken off, and the slides were then incubated overnight at 4\u0026deg;C with the primary antibody, which was added onto the tissue within the circle. The next day, the slides were washed in PBS (pH 7.4) on a decolorization shaker three times, each for 5 minutes. After slightly drying the slides, the corresponding secondary antibody (HRP-labeled) from the same species as the primary antibody was added within the circle to cover the tissue, and incubated at room temperature for 50 minutes. The slides were washed in PBS (pH 7.4) on a decolorization shaker three times, each for 5 minutes. After slightly drying the slides, freshly prepared DAB chromogenic solution was added within the circle, and the staining time was controlled under a microscope. Positive staining appeared as a brownish-yellow color, and the reaction was stopped by rinsing the slides with tap water. Immunohistochemically stained sections were reviewed and photographed for quantitative analysis using a Leica DM6B microscope (Leica Microsystems).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e2.7 Detection of total cholesterol level\u003c/h2\u003e\n \u003cp\u003eThe total cholesterol content in the knee joint cartilage of each group of rats, as well as in the cartilage cells after intervention, was measured according to the instructions provided by the manufacturer. The procedure is as follows: 20mg of knee joint cartilage was taken and mixed with 100\u0026micro;l of isopropanol, then ground and homogenized on ice. The mixture was then centrifuged at 8000g for 10 minutes at 4\u0026deg;C, and the supernatant was collected for further analysis. A 96-well plate was prepared, with wells designated for measurement and blank. In the measurement wells, 20\u0026micro;l of the sample was added along with 180\u0026micro;l of the working solution (provided in the kit). In the blank wells, 20\u0026micro;l of isopropanol and 180\u0026micro;l of the working solution were added. After adding the samples, the plate was incubated at 37\u0026deg;C for 1 hour. Once the spectrophotometer had been preheated for 30 minutes, the absorbance of each well was measured at a wavelength of 500nm. The cholesterol concentration in the samples was calculated based on the regression equation. (Testing kit: Total cholesterol (TC) content testing kit, Product No. TC-1-W, Company: Comin, Suzhou, China)\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e2.8 ELISA assay\u003c/h2\u003e\n \u003cp\u003eAfter four weeks of administration to the rats, anesthesia was induced using isoflurane. Blood samples were collected from the abdominal aorta using a syringe treated with an anticoagulant. The collected blood was then placed in a 4\u0026deg;C refrigerator for 1 hour and subsequently centrifuged at 3500rpm for 10 minutes using a high-speed refrigerated centrifuge. The resulting serum was carefully collected and stored at -80\u0026deg;C in an ultra-low temperature freezer for further ELISA analysis of the extracellular environment. For the cholesterol accumulation model, after 72 hours of intervention, the supernatant from each group of cells was collected and stored at -80\u0026deg;C in an ultra-low temperature freezer for ELISA analysis of the extracellular environment. The levels of IL-1\u0026beta; and TNF-\u0026alpha; in the serum and cell supernatant were measured according to the manufacturer\u0026apos;s instructions using the Rat Interleukin-1 (IL-1) ELISA Research Kit and Rat Tumor Necrosis Factor-alpha (TNF-\u0026alpha;) ELISA Research Kit (Product No. AF2922-A, AF3056-A, Company: Hunan Aifang Biotechnology Co., Ltd., Hunan, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9RT-PCR\u003c/h2\u003e\n \u003cp\u003eThree rats were randomly selected from each group. The left knee joint cartilage was collected and thoroughly ground in liquid nitrogen. Total RNA was extracted from the tissue samples using the NuoWeiZan RNA extraction kit. The extracted RNA was reverse transcribed into cDNA using the NuoWeiZan reverse transcription kit. Real-time fluorescent quantitative qPCR was performed using the NuoWeiZan qPCR kit. The qPCR conditions were set as follows: initial denaturation at 95\u0026deg;C for 30 seconds, denaturation at 95\u0026deg;C for 5 seconds, annealing and extension at 60\u0026deg;C for 30 seconds, for a total of 40 cycles. Primer sequences were obtained from GenBank and synthesized by Shanghai Biotechnology Co., Ltd. GAPDH was used as the reference gene. Ct values for each group of samples were obtained, and the data were analyzed using the 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method for relative quantification. For cell samples, the culture medium was aspirated, and the cells were washed twice with pre-chilled PBS. The final PBS wash was thoroughly removed, and the subsequent extraction and detection methods were the same as described above.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequences\u003c/strong\u003e\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003e(5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCOL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eTCCTTCGGTCGGTGTCTGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eCCACGGCATCCCAAACCATCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCOL10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eATGGTGAGGCAGGTCCAAGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eGGTTAGCACTGACAAGAGGCATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eACAN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eTTAGACTCAGGGTGGGTGGACTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eAGAGCACGGATGAATGAACGGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eSOX9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eGCGGAGGAAGTCGGTGAAGAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eCTTAGAAGTCTGAGTTGGCGGTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eLXR\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eCTTCCAGCCAGCGTTAGCAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eCACACCAGAAGAGGGCATCAATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eABCA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eTCGCTTAGAGGTGAGGCTGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eGTGTGGATGCTGGGAACTGAACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eABCG1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eACCTTGGAGTGGAAGCAGCATTAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eGGACAACGATGATGACACAGGAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eGTCCATGCCATCACTGCCACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 312px;\"\u003e\n \u003cp\u003eCGCCTGCTTCACCACCTTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e2.10 Western Blot\u003c/h2\u003e\n \u003cp\u003eThree rats were randomly selected from each group. The left knee joint cartilage was collected and thoroughly ground in liquid nitrogen. The ground cartilage was then transferred into EP tubes. RIPA lysis buffer was added to the tubes and placed on ice for 10 minutes for lysis. The total protein was collected by centrifugation, and the protein concentration was quantified using the bicinchoninic acid (BCA) assay. Equal amounts of protein were mixed with loading buffer, boiled for 10 minutes, and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The gel was initially run at a constant voltage of 120V for 15 minutes, followed by a constant voltage of 160V for 25 minutes. After electrophoresis, the proteins were transferred onto a membrane for 40 minutes at a constant current of 400mA. The membrane was then blocked with 5% skim milk at room temperature for 2 hours, incubated with the primary antibody (1:1000) overnight at 4\u0026deg;C, and incubated with the secondary antibody (1:10000) for 2 hours at room temperature. The protein expression was visualized using an enhanced chemiluminescence (ECL) substrate, and the bands were detected using an imaging system. The band intensity was quantified using Image J software. For cell samples, the culture medium was aspirated, and the cells were washed twice with pre-chilled PBS. The final PBS wash was thoroughly removed, and the subsequent extraction and detection methods were the same as described above.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e2.11 Statistical analysis\u003c/h2\u003e\n \u003cp\u003eAll data will be presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x̄\u0026plusmn;s). One-way analysis of variance (ANOVA) and SNK-q test will be used for statistical analysis, with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant. Statistical analysis will be performed using SPSS 26.0 software, and Graphpad Prism 8.0 software will be used for data visualization.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003ch2\u003e3.1 Identification of chemical components in the extract of SYXBF using LC-MS/MS analysis\u003c/h2\u003e\n\u003cp\u003eThe chromatographic peaks with high abundance in the positive and negative ion peak chromatograms of traditional Chinese medicine were confirmed by peak shape and inspected by MS/MS spectra. These chromatographic peaks were then sequentially labeled with numbers in the positive and negative ion spectra, as shown in Figure A and B. The main compound components in the water decoction of SYXBF include valylphenylalanine, isovaleryl carnitine, rosmarinic acid, paeoniflorin, baicalin, baicalein, and saikosaponin d. The analysis revealed that the compounds are mainly classified as flavonoids, small peptides, sesquiterpenoids, and triterpenoids. The corresponding compound information can be found in Appendix 1.\u003c/p\u003e\n\u003ch2\u003e3.2 SYXBF improves and ameliorates the motor function and pain symptoms induced by the HULTH method in rats with knee osteoarthritis, and delays the progression of osteoarthritis.\u003c/h2\u003e\n\u003cp\u003eTo evaluate the therapeutic effects of SYXBF on rats with knee osteoarthritis induced by the modified HULTH method, macroscopic scoring was performed on the knee joints, and toluidine blue and safranin O-fast green staining techniques were used to examine the articular cartilage tissues. Gait analysis was also conducted for each group of rats. The graph depicting the morphological changes in the knee joint showed a smooth and intact surface in the normal joint, with a glossy appearance (Figure 2A). In contrast, severe damage to the articular cartilage was observed in the MODEL group of rats. The femoral condyle surface in the MODEL group appeared rough, with erosion of both anterior and posterior articular cartilage, spot formation, extensive soft tissue proliferation, bone spur formation, and subchondral bone sclerosis. Following treatment, the joint cartilage structure in the M+MELO group was restored to normal. Similar to the positive control results obtained with meloxicam, the SYXBF-treated cartilage displayed glossy and smooth surfaces on both the anterior and posterior aspects of the condyle. The damaged cartilage induced by the modified HULTH method exhibited significant recovery following SYXBF treatment. The macroscopic scores of the M+MELO group and M+S1.1 group rats were notably lower compared to the M group (Figure 2C). Safranin O-fast green and toluidine blue staining (Figure 2B) revealed that the articular cartilage surface in the MODEL group appeared rougher than that of the SHAM group, with indistinct tide lines, a reduced chondrocyte count, and a disorganized arrangement. Additionally, subchondral bone collapse was observed. In contrast, the superficial layer of cartilage in the M+MELO group and M+S1.1 group appeared smoother than that of the MODEL group, with well-organized chondrocytes and clear tide lines. The modified Mankin\u0026apos;s score also exhibited a significant decrease in the M+MELO group and M+S1.1 group compared to the MODEL group (Figure 2D), indicating that SYXBF can protect knee joint cartilage and slow down the progression of osteoarthritis. Behavioral analysis of the animals showed that the swing duration percentage and propulsion duration percentage in the MODEL group were significantly higher than those in the SHAM group, and the paw area was reduced. However, the swing duration percentage and propulsion duration percentage were decreased, and the paw area was significantly increased in the M+MELO group and M+S1.1 group compared to the MODEL group (Figure 2EFG). A higher percentage of swing duration and propulsion duration indicates more severe joint mobility impairment and greater pain in the animals. A smaller paw area indicates poorer weight-bearing capacity and more pronounced pain. These data suggest that SYXBF can effectively protect the articular cartilage of rats with knee osteoarthritis, delay the progression of osteoarthritis, restore their motor function, and alleviate pain.\u003c/p\u003e\n\u003ch2\u003e3.3 SYXBF improves inflammation and cholesterol accumulation in the knee articular cartilage of rats with knee osteoarthritis induced by the modified HULTH method.\u003c/h2\u003e\n\u003cp\u003eThe results of total cholesterol content measurement (Figure 3A) indicated a significant increase in cholesterol accumulation within the knee articular cartilage of rats induced by the modified HULTH method. However, intervention with meloxicam and SYXBF led to a reduction in cholesterol content compared to the M group, with a more pronounced decrease observed in the M+S1.1 group compared to the M+MELO group. Enzyme-linked immunosorbent assay (ELISA) results for arterial serum in rats (Figure 3C, D) demonstrated elevated levels of the inflammatory factors IL-1\u0026beta; and TNF-\u0026alpha; in the MODEL group compared to the SHAM group. Both the M+MELO group and M+S1.1 group exhibited a reduction in IL-1\u0026beta; and TNF-\u0026alpha; levels compared to the MODEL group. RT-qPCR results (Figure 3B) revealed a significant increase in the expression of the inflammatory factor PGE2 in the knee articular cartilage of the MODEL group compared to the SHAM group, while both the M+MELO group and M+S1.1 group showed a decrease in PGE2 expression compared to the MODEL group. These findings suggest that SYXBF can ameliorate cholesterol accumulation in osteoarthritic cartilage and alleviate inflammation.\u003c/p\u003e\n\u003ch2\u003e3.4 The serum containing SYXBF can alleviate the expression of inflammatory factors and cholesterol accumulation in rat knee articular cartilage cells induced by cholesterol-cyclodextrin complex.\u003c/h2\u003e\n\u003cp\u003eChondrocytes are the only cells present in knee articular cartilage. In order to investigate the impact of SYXBF on delaying the progression of osteoarthritis, we developed a model to induce cholesterol accumulation in chondrocytes. We isolated primary chondrocytes from rats (Figure 4A, B) and used toluidine blue staining for identification (Figure 4C). FILIPIN staining (Figure 4F, G) demonstrated that the blue fluorescence intensity emitted by chondrocytes induced by the cholesterol-cyclodextrin complex was significantly higher than that of normal chondrocytes, indicating cholesterol accumulation in chondrocytes. Total cholesterol measurement (Figure 4H) confirmed a significant increase in cholesterol content in the M group compared to the NC group. This increase was reversed after SYXBF intervention, although the S+I group still had higher cholesterol content compared to the S group. Furthermore, enzyme-linked immunosorbent assay (ELISA) results (Figure 4I, J) revealed elevated concentrations of inflammatory factors IL-1\u0026beta; and TNF-\u0026alpha; in the cell supernatant of the M group compared to the NC group, while the S group exhibited a decrease compared to the M group. These findings suggest that SYXBF can reduce cholesterol accumulation in chondrocytes and suppress the expression of inflammatory factors.\u003c/p\u003e\n\u003ch2\u003e3.5 SYXBF can increase the expression of synthesis-related genes and proteins in chondrocytes.\u003c/h2\u003e\n\u003cp\u003eChondrocytes play a crucial role in synthesizing and metabolizing the cartilage matrix. In osteoarthritis, both matrix proteinases induced by inflammation and synthesis-related genes and proteins in chondrocytes influence the quantity and quality of the cartilage matrix. Thus, we examined the expression of COL2, ACAN, COL10, and SOX9 in the knee articular cartilage of rats treated with SYXBF, as well as in chondrocytes with cholesterol accumulation intervened by SYXBF. Immunohistochemistry results (Figure 5A, D) indicated that the protein content of COL2 was lower in the MODEL group than in the SHAM group, while the M+MELO group and M+S1.1 group exhibited higher levels of COL2 compared to the MODEL group. Additionally, RT-qPCR results (Figure 5H) supported the immunohistochemistry data. Western blot results (Figure 5B, E, F, G) showed reduced expression levels of chondrocyte synthesis-related proteins COL10, ACAN, and SOX9 in the MODEL group compared to the SHAM group. However, the M+S1.1 group treated with SYXBF showed some improvement in these proteins compared to the MODEL group. Furthermore, RT-qPCR results (Figure 5I, J, K) were consistent with the Western blot findings, confirming the enhancing effect of SYXBF on the secretion of chondrocyte synthesis-related molecules. In cell experiments, Western blot results (Figure 5C, L, M, N) revealed decreased expression levels of chondrocyte synthesis-related proteins COL2, COL10, ACAN, and SOX9 in the M group compared to the NC group. Conversely, the S group treated with SYXBF exhibited some improvement in these proteins compared to the M group. Notably, the A group treated with agonists showed significant improvement in ACAN and COL10 compared to the M group. The RT-qPCR results (Figure 5O, P, Q, R) were consistent with the Western blot findings, and the S+I group demonstrated an inhibitory effect on the increase in ACAN expression induced by SYXBF in the S group at the gene level. These results confirm the promoting effect of SYXBF on the secretion of chondrocyte synthesis-related molecules.\u003c/p\u003e\n\u003ch2\u003e3.6 SYXBF\u0026apos;s effects on the protein and gene expression of LXR\u0026alpha;-ABCA1/ABCG1 pathway.\u003c/h2\u003e\n\u003cp\u003eMore and more studies have shown that cholesterol metabolism may play a role in the development and progression of osteoarthritis. Our previous research has indicated that SYXBF might target LXR\u0026alpha; to improve cholesterol accumulation and slow down the progression of osteoarthritis. To investigate whether SYXBF can regulate the expression of cholesterol efflux-related molecules by activating LXR\u0026alpha;, we examined the expression of LXR\u0026alpha;, ABCA1, and ABCG1 after intervention with SYXBF, an LXR agonist, and an LXR inhibitor. The Western blot results (Figure 6A, B, C, D) showed that the expression levels of intracellular cholesterol homeostasis protein LXR-\u0026alpha; and cholesterol efflux key proteins ABCA1 and ABCG1 were lower in the MODEL group compared to the SHAM group, while the M+S1.1 group, which received SYXBF intervention, showed some improvement in these proteins compared to the MODEL group. Moreover, the results of RT-qPCR were consistent with the Western blot results (Figure 6E, F, G). In the cell experiments, the Western blot results (Figure 6H, I, J, K) demonstrated decreased expression levels of intracellular cholesterol homeostasis protein LXR-\u0026alpha; and cholesterol efflux key proteins ABCA1 and ABCG1 in the M group compared to the NC group, while the S group, which received SYXBF intervention, and the A group, which received agonists, showed some improvement in these proteins compared to the M group. Additionally, the S+I group significantly suppressed the increase in LXR-\u0026alpha; and ABCG1 protein expression in the S group. Furthermore, the results of RT-qPCR were consistent with the Western blot results (Figure 6L, M, N), suggesting that SYXBF may activate LXR\u0026alpha; and increase the expression of ABCA1 and ABCG1.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eSYXBF is a traditional Chinese herbal formula used to treat knee osteoarthritis in China. Previous studies have shown that SYXBF can significantly improve symptoms such as physical pain, stiffness, knee joint dysfunction, and physical function in patients(Si et al., 2018). In terms of basic research, SYXBF has been found to inhibit the degradation of extracellular matrix in chondrocytes and activate LXRα, which in turn inhibits the NF-κB signaling pathway and reduces the expression of inflammatory factors, thereby alleviating the severity of knee osteoarthritis lesions (Zhang et al., 2023).\u003c/p\u003e\u003cp\u003eThis study confirms previous findings that standardized dosages of SYXBF can alleviate inflammation and cartilage degeneration induced by the modified HULTH method and inhibit the further progression of knee osteoarthritis. Moreover, SYXBF is effective in relieving pain in the lower limbs of rats and improving their mobility. Importantly, in the knee osteoarthritis model rats induced by the modified HULTH method, cholesterol levels were significantly elevated in addition to inflammation and cartilage degeneration. However, intervention with SYXBF effectively reversed this situation.\u003c/p\u003e\u003cp\u003eIt is widely recognized that the imbalance between inflammation and the synthesis and degradation of cartilage matrix, driven by chondrocytes, is a significant factor in the development of osteoarthritis (Shen \u003cem\u003eet al.\u003c/em\u003e, 2017, Peng \u003cem\u003eet al.\u003c/em\u003e, 2021). As research on osteoarthritis progresses, there is increasing recognition that metabolic abnormalities, particularly disturbances in cholesterol metabolism, are closely associated with the occurrence and progression of osteoarthritis(Masuko et al., 2009, Chadha, 2016). Cholesterol serves as an essential substance for maintaining cellular activity and function, including in chondrocytes. However, high levels of cholesterol may not be advantageous for cells. Excessive cholesterol accumulation in chondrocytes can impede matrix synthesis and secretion, disrupt the function and structure of cell membranes, and even result in cell damage and death(Tabas, 2002). The aforementioned observations, supported by related studies, suggest that the mechanism by which SYXBF alleviates osteoarthritis may be closely linked to its capability to reduce cholesterol accumulation in cartilage and regulate the expression of genes associated with cartilage matrix synthesis.\u003c/p\u003e\u003cp\u003eAs a well-known fact, LXRα belongs to the nuclear receptor superfamily and plays a pivotal role in regulating cholesterol, lipid metabolism, and inflammatory responses. Activation of LXRα triggers the expression of genes associated with cholesterol efflux, such as ABCA1 and ABCG1, thereby reducing intracellular cholesterol levels (Jun \u003cem\u003eet al.\u003c/em\u003e, 2013). Both ABCA1 and ABCG1, belonging to the ABC superfamily, act as major transport proteins responsible for cholesterol efflux. Specifically, ABCA1 facilitates the efflux of cholesterol to lipid-poor apolipoproteins, leading to the generation of nascent or pre-β-HDL particles. These particles subsequently function as substrates for cholesterol transport facilitated by ABCG1. Mutations occurring in the ABCA1 gene can result in Tangier disease, a disorder characterized by cellular cholesterol accumulation, underscoring the critical importance of ABCA1 and ABCG1 in cellular cholesterol efflux(Gelissen \u003cem\u003eet al.\u003c/em\u003e, 2006, Bodzioch \u003cem\u003eet al.\u003c/em\u003e, 1999). As mammals, humans possess the capability to synthesize cholesterol endogenously. However, except for the liver and certain steroidogenic gland cells responsible for producing steroid hormones, only a few cells can degrade cholesterol. Notably, chondrocytes lack the capacity for cholesterol metabolism(Luo \u003cem\u003eet al.\u003c/em\u003e, 2020). Consequently, cells devoid of cholesterol degradation ability, such as chondrocytes, heavily rely on ABCA1 and ABCG1 for transporting excess cholesterol out of cells, eventually returning it to the liver in the form of high-density lipoprotein complexes (Tabas, 2002). In situations where intracellular cholesterol levels increase, cholesterol is promptly esterified by acyl-coenzyme A: cholesterol acyltransferase (ACAT) and stored temporarily in cytoplasmic lipid droplets. Nonetheless, this mechanism proves inadequate for long-term management of excess cholesterol. Conversely, when cells experience cholesterol deficiency, low-density lipoprotein receptors (LDLR) are upregulated, leading to heightened cellular uptake of cholesterol from LDL particles and facilitating its utilization or storage. Disruption of these regulatory mechanisms disturbs cholesterol homeostasis within cells, culminating in the accumulation of excess free cholesterol, which in turn can cause cellular damage and drive disease progression. Gierman's study(Gierman \u003cem\u003eet al.\u003c/em\u003e, 2014) demonstrated that with an increase in the proportion of a high-fat diet, the severity of osteoarthritis in mice worsened. In the clinical treatment process, Oliviero's research(Oliviero \u003cem\u003eet al.\u003c/em\u003e, 2012) discovered high concentrations of cholesterol and cholesterol crystals in the synovial fluid of osteoarthritis patients(Tsezou et al., 2010). Decreased expression of ABCA1, LXRα, and LXRβ was also found in chondrocyte samples from osteoarthritis patients(Farnaghi \u003cem\u003eet al.\u003c/em\u003e, 2017). Primary cultures of human articular chondrocytes treated with high cholesterol exhibited mitochondrial dysfunction and increased generation of reactive oxygen species (ROS), potentially linked to elevated expression of matrix metalloproteinase-13 (MMP13) and RUNX2, as well as reduced expression of SOX9(Lefebvre \u003cem\u003eet al.\u003c/em\u003e, 2019). Moreover, in Haj-Mirzaian's clinical trial(Haj-Mirzaian \u003cem\u003eet al.\u003c/em\u003e, 2019), statin drugs demonstrated protective effects against osteoarthritis. These findings collectively offer insights into how cholesterol accumulation impacts chondrocytes and contributes to the progression of osteoarthritis.\u003c/p\u003e\u003cp\u003eIn our previous studies, we have demonstrated that SYXBF can inhibit MMP13 expression, promote relative TIMP1 expression, and suppress cartilage degradation in knee osteoarthritis. In this study, we also investigated the molecular factors involved in chondrocyte matrix synthesis that may be influenced by cholesterol homeostasis. SOX9 is widely recognized as a key regulatory factor in chondrocyte differentiation and cartilage matrix synthesis. It can activate genes in chondrocytes that are considered to be involved in cartilage matrix synthesis, such as ACAN, COL2, and COL10. ACAN, which has the highest content of proteoglycans in cartilage, provides the ability to withstand compressive loads in articular cartilage(Kiani \u003cem\u003eet al.\u003c/em\u003e, 2002, Hardingham and Muir, 1974). COL2 is the major structural collagen protein in knee joint cartilage, and its loss and disruption can lead to alterations in the fibrous structure of cartilage and affect the interactions with other extracellular matrix components, destabilizing cartilage structure and accelerating cartilage wear(Li \u003cem\u003eet al.\u003c/em\u003e, 2021). The expression of COL10 is essential for COL2, and the absence of COL10 not only affects COL2 but also other crucial extracellular matrix components necessary for chondrocyte differentiation. When the level of COL10 falls below a certain threshold, not only is the production of extracellular matrix components compromised, but the secretion pattern of its construct is also affected(Knuth \u003cem\u003eet al.\u003c/em\u003e, 2019), ultimately leading to cartilage tissue damage, loss of its original function, and accelerated progression of osteoarthritis.\u003c/p\u003e\u003cp\u003eThis experimental study showed that compared to the MODEL group, the M\u0026thinsp;+\u0026thinsp;S1.1 group of rats exhibited reduced pain, improved motor ability, and improved cartilage defects as indicated by toluidine blue staining and Safranin O-Fast Green staining. The tidemark and arrangement of chondrocytes in the M\u0026thinsp;+\u0026thinsp;S1.1 group appeared relatively regular. In the M\u0026thinsp;+\u0026thinsp;S1.1 group, the expression of SOX9, ACAN, COL2, and COL10 in the cartilage increased compared to the MODEL group. These results suggest that SYXBF can alleviate the damage to connective tissue caused by knee osteoarthritis by enhancing the expression of cartilage matrix synthesis genes. The cholesterol levels and serum inflammatory factors in the MODEL group were higher than those in the SHAM group, while they were significantly reduced in the M\u0026thinsp;+\u0026thinsp;S1.1 group compared to the MODEL group. This indicates that SYXBF can reduce cholesterol accumulation and the expression of inflammatory factors in the cartilage, thereby slowing down the progression of osteoarthritis. Compared to the MODEL group, the expression levels of LXR-α, ABCA1, and ABCG1 were increased in the M\u0026thinsp;+\u0026thinsp;S1.1 group. Based on the above experimental results, it can be inferred that SYXBF may regulate the LXRα-ABCA1/ABCG1 pathway, thus inhibiting the progression of osteoarthritis. To further investigate whether SYXBF improves cholesterol accumulation and delays the progression of osteoarthritis by regulating LXRα, our focus shifted to chondrocytes, the only resident cells in cartilage. We conducted interventions using SYXBF, LXRα agonists, and inhibitors.\u003c/p\u003e\u003cp\u003eIn the in vitro experiments, FILIPIN fluorescence staining revealed a significantly higher fluorescence intensity in cholesterol-cyclodextrin complex-treated chondrocytes in the M group compared to the NC group. Total cholesterol detection also confirmed elevated cholesterol levels in the M group, indicating significant cholesterol accumulation. Furthermore, the culture supernatant of the M group showed increased expression of inflammatory factors. Inhibiting LXRα reversed the reduction in cholesterol levels induced by SYXBF-containing serum intervention. Remarkably, the S\u0026thinsp;+\u0026thinsp;I group had significantly higher cholesterol levels than the S group, accompanied by reduced expression levels of ABCA1 and ABCG1. Conversely, the A group, which received LXRα agonist intervention, displayed significantly lower cholesterol levels than the M group, along with increased expression levels of ABCA1 and ABCG1. Importantly, expression levels of cartilage matrix synthesis-related factors, including SOX9, ACAN, COL2, and COL10, were higher in the S group than in the M group. However, inhibiting LXRα led to decreased expression of SOX9, ACAN, COL2, and COL10. These findings collectively demonstrate that SYXBF can activate the LXRα-ABCA1/ABCG1 signaling pathway in chondrocytes, regulate cholesterol metabolism in osteoarthritic chondrocytes, and to some extent alleviate the progression of knee osteoarthritis.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, this experimental study has preliminarily found that SYXBF can improve cholesterol metabolism, inflammation, and the balance of cartilage matrix synthesis and degradation in osteoarthritic chondrocytes. This may be achieved through the regulation of the LXRα-ABCA1/ABCG1 signaling pathway, suggesting that SYXBF can be used as an adjunct or alternative treatment for knee osteoarthritis. However, there are still some issues to be addressed in this study: 1. The mechanism of SYXBF in the intervention of knee osteoarthritis may be related to the activation of the LXRα-ABCA1/ABCG1 signaling pathway, but the specific mechanism of action is the focus of our next research. 2. Traditional Chinese medicine formulas are complex, and their corresponding targets and pathways may not be singular. Further clarification of the mode of action of SYXBF can be achieved through genomics and other methods. 3. In order to further study the mechanism of cholesterol metabolism in knee osteoarthritis, it is not limited to total cholesterol, but can be expanded to include molecules such as free fatty acids, triglycerides, high-density lipoprotein, and low-density lipoprotein. Reverse validation using animals fed a high-fat diet will also be a focus of our research.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis study was supported by grants from the Jiangsu Province Natural Science Foundation Project (BK20211300),the National Natural Science Foundation Project of China (82305268),the NATCM\u0026apos;s Project of High-level Construction of Key TCM Disciplines(NATCM\u0026apos;s Human Education Letter[2023]No. 85),the Foundation of Jiangsu CM Clinical Innovation Center of Degenerative Bone \u0026amp; Joint Disease(Jiangsu science and education of traditional Chinese medicine〔2021〕No. 4)and the Jiangsu Province Graduate Research and Practice Innovation Program Project (KYCX23_2106).\u003c/p\u003e\n\u003ch2\u003eCRediT authorship contribution statement\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eChaoran\u003c/strong\u003e \u003cstrong\u003eLu:\u0026nbsp;\u003c/strong\u003eWriting \u0026ndash; original\u0026nbsp;draft, Methodology, Investigation, Formal analysis, Data curation. \u003cstrong\u003eYuhao Si:\u003c/strong\u003e Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Methodology, Investigation, Conceptualization. \u003cstrong\u003eYalan Pan\u003c/strong\u003e\u003cstrong\u003e、\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eLining Wang\u003c/strong\u003e\u003cstrong\u003e、\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eMengmin Liu\u003c/strong\u003e\u003cstrong\u003e、\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eSixian Chen\u003c/strong\u003e\u003cstrong\u003e、\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eLei Shi\u003c/strong\u003e\u003cstrong\u003e、\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eRuihua Zhao\u003c/strong\u003e\u003cstrong\u003e、\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eZhixin Li\u003c/strong\u003e:\u0026nbsp;Methodology, Investigation.\u0026nbsp;\u003cstrong\u003eYang Guo:\u003c/strong\u003e Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Supervision, Investigation, Data curation, Conceptualization.\u003cstrong\u003e\u0026nbsp;Yong Ma:\u003c/strong\u003e Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Funding acquisition, Conceptualization.\u003c/p\u003e\n\u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that there is no commercial or financial relationships that could be construed as a potential conflict of interest regarding this paper.\u003c/p\u003e\n\u003ch2\u003eData availability\u003c/h2\u003e\n\u003cp\u003eThe authors do not have permission to share data.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e\u0026quot;Prevalence of doctor-diagnosed arthritis and arthritis-attributable activity limitation--United States, 2010-2012\u0026quot;, \u003cem\u003eMMWR Morb Mortal Wkly Rep,\u003c/em\u003e Vol. 62 No. 44, pp. 869-73.\u003c/li\u003e\n\u003cli\u003eABRAMOFF, B. \u0026amp; CALDERA, F. E. (2020), \u0026quot;Osteoarthritis: Pathology, Diagnosis, and Treatment Options\u0026quot;, \u003cem\u003eMed Clin North Am,\u003c/em\u003e Vol. 104 No. 2, pp. 293-311.\u003c/li\u003e\n\u003cli\u003eAIGNER, T., KURZ, B., FUKUI, N. \u0026amp; SANDELL, L. (2002), \u0026quot;Roles of chondrocytes in the pathogenesis of osteoarthritis\u0026quot;, \u003cem\u003eCurr Opin Rheumatol,\u003c/em\u003e Vol. 14 No. 5, pp. 578-84.\u003c/li\u003e\n\u003cli\u003eALI, S. A., AL-JAZRAWE, M., MA, H., WHETSTONE, H., POON, R., FARR, S., NAPLES, M., ADELI, K. \u0026amp; ALMAN, B. A. (2016), \u0026quot;Regulation of Cholesterol Homeostasis by Hedgehog Signaling in Osteoarthritic Cartilage\u0026quot;, \u003cem\u003eArthritis Rheumatol,\u003c/em\u003e Vol. 68 No. 1, pp. 127-37.\u003c/li\u003e\n\u003cli\u003eBODZIOCH, M., ORSO, E., KLUCKEN, J., LANGMANN, T., BOTTCHER, A., DIEDERICH, W., DROBNIK, W., BARLAGE, S., BUCHLER, C., PORSCH-OZCURUMEZ, M., KAMINSKI, W. E., HAHMANN, H. W., OETTE, K., ROTHE, G., ASLANIDIS, C., LACKNER, K. J. \u0026amp; SCHMITZ, G. (1999), \u0026quot;The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease\u0026quot;, \u003cem\u003eNat Genet,\u003c/em\u003e Vol. 22 No. 4, pp. 347-51.\u003c/li\u003e\n\u003cli\u003eCHADHA, R. (2016), \u0026quot;Revealed aspect of metabolic osteoarthritis\u0026quot;, \u003cem\u003eJ Orthop,\u003c/em\u003e Vol. 13 No. 4, pp. 347-51.\u003c/li\u003e\n\u003cli\u003eCHEN, P. J., DUTRA, E. H., MEHTA, S., O\u0026apos;BRIEN, M. H. \u0026amp; YADAV, S. (2020), \u0026quot;Age-related changes in the cartilage of the temporomandibular joint\u0026quot;, \u003cem\u003eGeroscience,\u003c/em\u003e Vol. 42 No. 3, pp. 995-1004.\u003c/li\u003e\n\u003cli\u003eCOURTIES, A., SELLAM, J. \u0026amp; BERENBAUM, F. (2017), \u0026quot;Metabolic syndrome-associated osteoarthritis\u0026quot;, \u003cem\u003eCurr Opin Rheumatol,\u003c/em\u003e Vol. 29 No. 2, pp. 214-222.\u003c/li\u003e\n\u003cli\u003eFARNAGHI, S., PRASADAM, I., CAI, G., FRIIS, T., Du Z, CRAWFORD, R., MAO, X. \u0026amp; XIAO, Y. (2017), \u0026quot;Protective effects of mitochondria-targeted antioxidants and statins on cholesterol-induced osteoarthritis\u0026quot;, \u003cem\u003eFASEB J,\u003c/em\u003e Vol. 31 No. 1, pp. 356-367.\u003c/li\u003e\n\u003cli\u003eGELISSEN, I. C., HARRIS, M., RYE, K. A., QUINN, C., BROWN, A. J., KOCKX, M., CARTLAND, S., PACKIANATHAN, M., KRITHARIDES, L. \u0026amp; JESSUP, W. (2006), \u0026quot;ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I\u0026quot;, \u003cem\u003eArterioscler Thromb Vasc Biol,\u003c/em\u003e Vol. 26 No. 3, pp. 534-40.\u003c/li\u003e\n\u003cli\u003eGIERMAN, L. M., KUHNAST, S., KOUDIJS, A., PIETERMAN, E. J., KLOPPENBURG, M., van OSCH, G. J., STOJANOVIC-SUSULIC, V., HUIZINGA, T. W., PRINCEN, H. M. \u0026amp; ZUURMOND, A. M. (2014), \u0026quot;Osteoarthritis development is induced by increased dietary cholesterol and can be inhibited by atorvastatin in APOE*3Leiden.CETP mice--a translational model for atherosclerosis\u0026quot;, \u003cem\u003eAnn Rheum Dis,\u003c/em\u003e Vol. 73 No. 5, pp. 921-7.\u003c/li\u003e\n\u003cli\u003eGRIFFIN, T. M., HUEBNER, J. L., KRAUS, V. B., YAN, Z. \u0026amp; GUILAK, F. (2012), \u0026quot;Induction of osteoarthritis and metabolic inflammation by a very high-fat diet in mice: effects of short-term exercise\u0026quot;, \u003cem\u003eArthritis Rheum,\u003c/em\u003e Vol. 64 No. 2, pp. 443-53.\u003c/li\u003e\n\u003cli\u003eHAJ-MIRZAIAN, A., MOHAJER, B., GUERMAZI, A., CONAGHAN, P. G., LIMA, J., BLAHA, M. J., BINGHAM, C. O., ROEMER, F. W., CAO, X. \u0026amp; DEMEHRI, S. (2019), \u0026quot;Statin Use and Knee Osteoarthritis Outcome Measures according to the Presence of Heberden Nodes: Results from the Osteoarthritis Initiative\u0026quot;, \u003cem\u003eRadiology,\u003c/em\u003e Vol. 293 No. 2, pp. 396-404.\u003c/li\u003e\n\u003cli\u003eHARDINGHAM, T. E. \u0026amp; MUIR, H. (1974), \u0026quot;Hyaluronic acid in cartilage and proteoglycan aggregation\u0026quot;, \u003cem\u003eBiochem J,\u003c/em\u003e Vol. 139 No. 3, pp. 565-81.\u003c/li\u003e\n\u003cli\u003eHE, E., XU, S., DAI, Y., WANG, Y., XIAO, G., XIE, J., XU, S., FAN, P., MO, F., WANG, M., SONG, Y., YIN, H., LI, Y., WANG, Y. \u0026amp; CAI, X. (2021), \u0026quot;SWCNTs/PEDOT:PSS-Modified Microelectrode Arrays for Dual-Mode Detection of Electrophysiological Signals and Dopamine Concentration in the Striatum under Isoflurane Anesthesia\u0026quot;, \u003cem\u003eACS Sens,\u003c/em\u003e Vol. 6 No. 9, pp. 3377-3386.\u003c/li\u003e\n\u003cli\u003eHOOPER, L., BROWN, T. J., ELLIOTT, R., PAYNE, K., ROBERTS, C. \u0026amp; SYMMONS, D. (2004), \u0026quot;The effectiveness of five strategies for the prevention of gastrointestinal toxicity induced by non-steroidal anti-inflammatory drugs: systematic review\u0026quot;, \u003cem\u003eBMJ,\u003c/em\u003e Vol. 329 No. 7472, pp. 948.\u003c/li\u003e\n\u003cli\u003eJANG, S., LEE, K. \u0026amp; JU, J. H. (2021), \u0026quot;Recent Updates of Diagnosis, Pathophysiology, and Treatment on Osteoarthritis of the Knee\u0026quot;, \u003cem\u003eInt J Mol Sci,\u003c/em\u003e Vol. 22 No. 5, pp.\u003c/li\u003e\n\u003cli\u003eJUN, H. J., HOANG, M. H., YEO, S. K., JIA, Y. \u0026amp; LEE, S. J. (2013), \u0026quot;Induction of ABCA1 and ABCG1 expression by the liver X receptor modulator cineole in macrophages\u0026quot;, \u003cem\u003eBioorg Med Chem Lett,\u003c/em\u003e Vol. 23 No. 2, pp. 579-83.\u003c/li\u003e\n\u003cli\u003eKATZ, J. N., ARANT, K. R. \u0026amp; LOESER, R. F. (2021), \u0026quot;Diagnosis and Treatment of Hip and Knee Osteoarthritis: A Review\u0026quot;, \u003cem\u003eJAMA,\u003c/em\u003e Vol. 325 No. 6, pp. 568-578.\u003c/li\u003e\n\u003cli\u003eKIANI, C., CHEN, L., WU, Y. J., YEE, A. J. \u0026amp; YANG, B. B. (2002), \u0026quot;Structure and function of aggrecan\u0026quot;, \u003cem\u003eCell Res,\u003c/em\u003e Vol. 12 No. 1, pp. 19-32.\u003c/li\u003e\n\u003cli\u003eKNUTH, C. A., ANDRES, S. E., FAHY, N. B., WITTE-BOUMA, J., RIDWAN, Y., STRABBING, E. M., KOUDSTAAL, M. J., van de PEPPEL, J., WOLVIUS, E. B., NARCISI, R. \u0026amp; FARRELL, E. (2019), \u0026quot;Collagen type X is essential for successful mesenchymal stem cell-mediated cartilage formation and subsequent endochondral ossification\u0026quot;, \u003cem\u003eEur Cell Mater,\u003c/em\u003e Vol. 38106-122.\u003c/li\u003e\n\u003cli\u003eLEFEBVRE, V., ANGELOZZI, M. \u0026amp; HASEEB, A. (2019), \u0026quot;SOX9 in cartilage development and disease\u0026quot;, \u003cem\u003eCurr Opin Cell Biol,\u003c/em\u003e Vol. 6139-47.\u003c/li\u003e\n\u003cli\u003eLI, P., WANG, A., LI, J., LI, X., SUN, W. \u0026amp; LIU, Q. (2021), \u0026quot;COL2A1 Mutation (c.611G\u0026gt;C) Leads to Early-Onset Osteoarthritis in a Chinese Family\u0026quot;, \u003cem\u003eInt J Gen Med,\u003c/em\u003e Vol. 142569-2574.\u003c/li\u003e\n\u003cli\u003eLUO, J., YANG, H. \u0026amp; SONG, B. L. (2020), \u0026quot;Mechanisms and regulation of cholesterol homeostasis\u0026quot;, \u003cem\u003eNat Rev Mol Cell Biol,\u003c/em\u003e Vol. 21 No. 4, pp. 225-245.\u003c/li\u003e\n\u003cli\u003eMASUKO, K., MURATA, M., SUEMATSU, N., OKAMOTO, K., YUDOH, K., NAKAMURA, H. \u0026amp; KATO, T. (2009), \u0026quot;A metabolic aspect of osteoarthritis: lipid as a possible contributor to the pathogenesis of cartilage degradation\u0026quot;, \u003cem\u003eClin Exp Rheumatol,\u003c/em\u003e Vol. 27 No. 2, pp. 347-53.\u003c/li\u003e\n\u003cli\u003eMURPHY, L. \u0026amp; HELMICK, C. G. (2012), \u0026quot;The impact of osteoarthritis in the United States: a population-health perspective\u0026quot;, \u003cem\u003eAm J Nurs,\u003c/em\u003e Vol. 112 No. 3 Suppl 1, pp. S13-9.\u003c/li\u003e\n\u003cli\u003eNIU, J., CLANCY, M., ALIABADI, P., VASAN, R. \u0026amp; FELSON, D. T. (2017), \u0026quot;Metabolic Syndrome, Its Components, and Knee Osteoarthritis: The Framingham Osteoarthritis Study\u0026quot;, \u003cem\u003eArthritis Rheumatol,\u003c/em\u003e Vol. 69 No. 6, pp. 1194-1203.\u003c/li\u003e\n\u003cli\u003eOLIVIERO, F., LO, N. A., BERNARDI, D., GIUNCO, S., BALDO, G., SCANU, A., SFRISO, P., RAMONDA, R., PLEBANI, M. \u0026amp; PUNZI, L. (2012), \u0026quot;A comparative study of serum and synovial fluid lipoprotein levels in patients with various arthritides\u0026quot;, \u003cem\u003eClin Chim Acta,\u003c/em\u003e Vol. 413 No. 1-2, pp. 303-7.\u003c/li\u003e\n\u003cli\u003ePAPATHANASIOU, I., ANASTASOPOULOU, L. \u0026amp; TSEZOU, A. (2021), \u0026quot;Cholesterol metabolism related genes in osteoarthritis\u0026quot;, \u003cem\u003eBone,\u003c/em\u003e Vol. 152116076.\u003c/li\u003e\n\u003cli\u003ePENG, Z., SUN, H., BUNPETCH, V., KOH, Y., WEN, Y., WU, D. \u0026amp; OUYANG, H. (2021), \u0026quot;The regulation of cartilage extracellular matrix homeostasis in joint cartilage degeneration and regeneration\u0026quot;, \u003cem\u003eBiomaterials,\u003c/em\u003e Vol. 268120555.\u003c/li\u003e\n\u003cli\u003eRATNESWARAN, A., SUN, M. M., DUPUIS, H., SAWYEZ, C., BORRADAILE, N. \u0026amp; BEIER, F. (2017), \u0026quot;Nuclear receptors regulate lipid metabolism and oxidative stress markers in chondrocytes\u0026quot;, \u003cem\u003eJ Mol Med (Berl),\u003c/em\u003e Vol. 95 No. 4, pp. 431-444.\u003c/li\u003e\n\u003cli\u003eROGART, J. N., BARRACH, H. J. \u0026amp; CHICHESTER, C. O. (1999), \u0026quot;Articular collagen degradation in the Hulth-Telhag model of osteoarthritis\u0026quot;, \u003cem\u003eOsteoarthritis Cartilage,\u003c/em\u003e Vol. 7 No. 6, pp. 539-47.\u003c/li\u003e\n\u003cli\u003eSCHAFER, N. \u0026amp; GRASSEL, S. (2022), \u0026quot;Targeted therapy for osteoarthritis: progress and pitfalls\u0026quot;, \u003cem\u003eNat Med,\u003c/em\u003e Vol. 28 No. 12, pp. 2473-2475.\u003c/li\u003e\n\u003cli\u003eSHEN, J., ABU-AMER, Y., O\u0026apos;KEEFE, R. J. \u0026amp; MCALINDEN, A. (2017), \u0026quot;Inflammation and epigenetic regulation in osteoarthritis\u0026quot;, \u003cem\u003eConnect Tissue Res,\u003c/em\u003e Vol. 58 No. 1, pp. 49-63.\u003c/li\u003e\n\u003cli\u003eSHORROCK, C. J. \u0026amp; REES, W. D. (1988), \u0026quot;Overview of gastroduodenal mucosal protection\u0026quot;, \u003cem\u003eAm J Med,\u003c/em\u003e Vol. 84 No. 2A, pp. 25-34.\u003c/li\u003e\n\u003cli\u003eSI, Y., MA, Y., GUO, Y., PAN, Y., ZHENG, S., XU, G., DA, W. \u0026amp; XU, L. (2018), \u0026quot;Efficacy and safety of Shaoyang Xibi decoction in patients with knee osteoarthritis: a multi-center, single-blind, randomized controlled trial\u0026quot;, \u003cem\u003eJ Tradit Chin Med,\u003c/em\u003e Vol. 38 No. 5, pp. 733-739.\u003c/li\u003e\n\u003cli\u003eSOSTRES, C., GARGALLO, C. J., ARROYO, M. T. \u0026amp; LANAS, A. (2010), \u0026quot;Adverse effects of non-steroidal anti-inflammatory drugs (NSAIDs, aspirin and coxibs) on upper gastrointestinal tract\u0026quot;, \u003cem\u003eBest Pract Res Clin Gastroenterol,\u003c/em\u003e Vol. 24 No. 2, pp. 121-32.\u003c/li\u003e\n\u003cli\u003eTABAS, I. (2002), \u0026quot;Consequences of cellular cholesterol accumulation: basic concepts and physiological implications\u0026quot;, \u003cem\u003eJ Clin Invest,\u003c/em\u003e Vol. 110 No. 7, pp. 905-11.\u003c/li\u003e\n\u003cli\u003eTSEZOU, A., ILIOPOULOS, D., MALIZOS, K. N. \u0026amp; SIMOPOULOU, T. (2010), \u0026quot;Impaired expression of genes regulating cholesterol efflux in human osteoarthritic chondrocytes\u0026quot;, \u003cem\u003eJ Orthop Res,\u003c/em\u003e Vol. 28 No. 8, pp. 1033-9.\u003c/li\u003e\n\u003cli\u003eVILLALVILLA, A., GOMEZ, R., LARGO, R. \u0026amp; HERRERO-BEAUMONT, G. (2013), \u0026quot;Lipid transport and metabolism in healthy and osteoarthritic cartilage\u0026quot;, \u003cem\u003eInt J Mol Sci,\u003c/em\u003e Vol. 14 No. 10, pp. 20793-808.\u003c/li\u003e\n\u003cli\u003eWU, C. L., JAIN, D., MCNEILL, J. N., LITTLE, D., ANDERSON, J. A., HUEBNER, J. L., KRAUS, V. B., RODRIGUIZ, R. M., WETSEL, W. C. \u0026amp; GUILAK, F. (2015), \u0026quot;Dietary fatty acid content regulates wound repair and the pathogenesis of osteoarthritis following joint injury\u0026quot;, \u003cem\u003eAnn Rheum Dis,\u003c/em\u003e Vol. 74 No. 11, pp. 2076-83.\u003c/li\u003e\n\u003cli\u003eZELCER, N. \u0026amp; TONTONOZ, P. (2006), \u0026quot;Liver X receptors as integrators of metabolic and inflammatory signaling\u0026quot;, \u003cem\u003eJ Clin Invest,\u003c/em\u003e Vol. 116 No. 3, pp. 607-14.\u003c/li\u003e\n\u003cli\u003eZHANG, X .,GUO, Y .,PAN, Y .,LIU ,M .,TU ,P. ,LU, C. , MA, Y. (2023), \u0026quot;Effects of Shaoyang Xibi Decoction on Knee Osteoarthritis in Rats Based on LXR-\u0026alpha;/NF-\u0026kappa;B Signaling Pathway \u0026quot;, \u003cem\u003eChin J Integ Tradit West Med\u003c/em\u003e\u003cem\u003e,\u003c/em\u003e Vol. 43 No. 12, pp. 1469-1477.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7556233/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7556233/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e\u003cp\u003eOur study focuses on observing the therapeutic effects of Shaoyang Xibi Decoction on a rat model of knee osteoarthritis and exploring its underlying mechanisms.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003e(1) A rat model of osteoarthritis was established using the modified HULTH method. The experiment was divided into the following groups for intervention: sham operation group, model group, meloxicam group, Shaoyang Xibi decoction low-dose group, Shaoyang Xibi decoction medium-dose group, and Shaoyang Xibi decoction high-dose group. Rats' pain sensation and motor function were evaluated by gait analysis. Cartilage tissue morphology was observed with toluidine blue and safranin O/fast green staining. The levels of inflammatory factors in rat serum were detected by ELISA, and the cholesterol content in rats' knee cartilage was measured by the total cholesterol assay. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) Rat knee cartilage cells were isolated and cultured in vitro. They were identified using toluidine blue staining. A chondrocyte cholesterol accumulation model was prepared using a cholesterol-β-cyclodextrin complex, and FILIPIN fluorescent staining was employed for identification. Interventions were then carried out using rat medicated serum, LXR-α agonists, and LXR-α inhibitors. The groups included the following: blank group, model group, Shaoyang Xibi group, inhibitor group, agonist group, Shaoyang Xibi\u0026thinsp;+\u0026thinsp;inhibitor group, and Shaoyang Xibi\u0026thinsp;+\u0026thinsp;agonist group. The levels of inflammatory cytokines in the supernatants of the cartilage cells were measured by ELISA, and the total cholesterol content in the cartilage cells was determined using a total cholesterol detection method. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) Preparation of rat knee osteoarthritis models and chondrocyte cholesterol accumulation models was conducted. Rats were divided into the following groups: sham surgery group, model group, meloxicam group, Shaoyang Xibi Decoction low dose group, Shaoyang Xibi Decoction medium dose group, and Shaoyang Xibi Decoction high dose group. Cells were divided into the following groups: blank group, model group, Shaoyang Xibi Decoction group, inhibitor group, agonist group, Shaoyang Xibi Decoction\u0026thinsp;+\u0026thinsp;inhibitor group, and Shaoyang Xibi Decoction\u0026thinsp;+\u0026thinsp;agonist group. Immunohistochemistry was used to detect the expression of type II collagen in knee joint cartilage, and Western blot and qPCR were used to detect the expression of LXR-α, ABCA1, ABCG1, and chondrogenic matrix synthesis-related molecules COL10, ACAN, SOX9, COL2 in cartilage tissue and chondrocytes.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003e(1) Gait analysis results show that after intervention with Shaoyang Xibi Decoction, there is alleviation of pain in rats, enhancement of motor function recovery (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and toluidine blue and safranin-fast green staining suggests that Shaoyang Xibi Decoction can protect the cartilage structure. ELISA and cholesterol tests indicate that Shaoyang Xibi Decoction can reduce the expression of inflammatory factors in rats with knee osteoarthritis and improve the cholesterol accumulation in rat knee cartilage (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) Successful isolation and in vitro culturing of chondrocytes from SD rat knee joints were achieved. FILIPIN fluorescence staining results indicate that the construction of a cholesterol accumulation model in rat chondrocytes was successful. ELISA and cholesterol detection results show that Shaoyang Xibi Decoction can reduce the release of inflammatory factors in chondrocytes and alleviate the accumulation of cholesterol in chondrocytes (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) Immunohistochemistry, Western blot, and qPCR results demonstrate that Shaoyang Xibi Decoction can promote the expression of cartilage matrix synthesis molecules such as COL10, ACAN, SOX9, and COL2 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Western blot and qPCR results show that Shaoyang Xibi Decoction can enhance the expression of LXR-α and increase the expression of cholesterol reverse transport-related molecules ABCA1 and ABCG1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThe Shaoyang Xibi Decoction can activate the LXR-α-ABCA1/ABCG1 Signaling Pathway to promote cholesterol efflux from chondrocytes. This, in turn, enhances the expression of matrix synthesis-related molecules, thereby delaying the progression of knee osteoarthritis in rats. It effectively alleviates pain and improves the motor function of rats with knee osteoarthritis.\u003c/p\u003e","manuscriptTitle":"Shaoyang Xibi Decoction improves cholesterol accumulation to delay the progression of knee osteoarthritis by regulating the LXRα-ABCA1/ABCG1 signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-20 13:38:07","doi":"10.21203/rs.3.rs-7556233/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"70789bf3-82b9-4779-9357-15f8e113f4b1","owner":[],"postedDate":"October 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-10T21:54:10+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-20 13:38:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7556233","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7556233","identity":"rs-7556233","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-04T02:00:05.705006+00:00
License: CC-BY-4.0