Snrnp25 is a candidate for the peri-implantation lethal phenotype of the Hba deletions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Snrnp25 is a candidate for the peri-implantation lethal phenotype of the Hba deletions Ana María Velásquez-Escobar, Andrew Hillhouse, Terry Magnuson, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6335781/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 May, 2025 Read the published version in Mammalian Genome → Version 1 posted 9 You are reading this latest preprint version Abstract Mutations in adult hemoglobin alpha genes in humans lead to blood disorders commonly known as α-thalassemia. In search of a mouse model for this disease, mutagenesis screens have identified several deletions that resemble these phenotypes. The Hba b2(th) deletion, in particular, replicates the characteristics of alpha-thalassemia minor in heterozygous mice but presents a homozygous embryonic lethal phenotype. Previous analyses of Hba b2(th) mice suggested that the deletion affects both Hba genes ( Hba-a1 and Hba-a2 ) and considered epidermal growth factor receptor ( Egfr ) or rhomboid 5 homolog 1 ( Rhbdf1 ) to be responsible for the embryonic lethality. Molecular analysis of Hba b2(th) revealed a deletion spanning a 1cM region of mouse chromosome 11. Importantly, the Hba b2(th) deletion does not extend to Egfr , indicating that the observed lethality of homozygous embryos is not due to the loss of Egfr . Sequence analysis of the Hba b2(th) deletion showed that the Hba-a2 gene is not deleted, but the lack of expression is likely due to the disruption of upstream regulatory regions. Furthermore, we identify Snrnp2 5, which codes for the small nuclear ribonucleoprotein 25 (U11/U12), as the candidate gene most likely responsible for the peri-implantation lethality of Hba b2(th) homozygous mice. These findings enhance the understanding of the genetic mechanisms underlying α-thalassemia and provide insights into novel genes essential for early mammalian development. embryonic lethal deletion complex mouse model thalassemia Figures Figure 1 Figure 2 Figure 3 Introduction Alpha-thalassemia is a genetic disorder produced by low or absent expression of the α-globin chain subunit of hemoglobin (Weatherall and Clegg 1972 ). In both humans and mice, there are two adjacent adult hemoglobin alpha genes ( HBA1 and HBA2 in humans; Hba-a1 and Hba-a2 in mice), along with an embryonic version (Whitney and Russell 1980 ), all tightly linked on human chromosome 16 (HAS16) and mouse chromosome 11 (MMU11), respectively. Humans who are heterozygous for α-globin mutations have α-thalassemia, presenting with mild histological defects of the erythrocytes (Nathan and Gunn 1966 ). Homozygosity for mutations in HBA1 and HBA2 can result in α-thalassemia major, which leads to a complete loss of α-globins and is lethal between 30 to 40 weeks of gestation (Taylor et al. 1974 ). Affected individuals exhibit the fatal congenital disorder known as hydrops fetalis. Hematologic defects associated with alpha-thalassemia minor arise from a reduction in the normal 1:1 subunit ratio of α-globin to β-globin, the latter being encoded by a separate unlinked gene cluster, due to mutations in two of the four alleles of the HBA genes. With the goal of identifying a mouse model for α-thalassemia, radiation and chemical mutagenesis screens were undertaken. Two x-ray-induced, Hba b2(th) and Hba b3(th) (Russell et al. 1976a ), and one triethylenemelamine-induced, Hba th−J (Hendrey, Lin and Dziadek 1995 ; Whitney and Russell 1978 ), mutations were recovered. Molecular characterization of these animals revealed that they were heterozygous for deletions of the Hba gene cluster (Whitney et al. 1981 ). Matings between heterozygous animals produced no homozygous pups, indicating that homozygosity for any of the three deletions is embryonic lethal. However, closer examination of earlier embryonic stages revealed some unexpected results. A retrospective analysis of embryos from Hba b 2 (th) /+ crosses showed that the putative homozygous embryos were dying shortly after initiating implantation at embryonic day (E) 5.5 to 6.5(Popp, Bradshaw and Skow 1980 ). Since hemoglobins are not necessary until E8.0 when the blood islands of the yolk sac begin producing red cells (de Aberle 1927 ), this observation suggested that the deletions around the Hba complex not only removed the Hba genes but also deleted or impacted other genes involved in peri-implantation development. Attempts to create homozygous mutant ES lines were unsuccessful, further supporting the notion that the deletions have removed or affected other loci (Behzadian, Whitney and McCool 1993 ). A subsequent study implicated N-methylpurine-DNA glycosylase ( Mpg ) and rhomboid 5 homolog 1 ( Rhbdf1 , previously called Dist 1 ) as candidate genes for the peri-implantation lethality of the Hba deletion homozygotes, based on their expression during peri-implantation and their loss in the Hba th− J deletion (Hendrey, Lin and Dziadek 1995 ). In another study, liver preparations from Hba b 3 (th) deletion heterozygous mice were found to bind half the epidermal growth factor (EGF) compared to preparations from their normal littermates, partly due to lower levels of epidermal growth factor receptor ( Egfr) mRNA (Behzadian et al. 1990 ). Based on these data, it was hypothesized that the deletions also affected Egfr , which maps only six centimorgans (cM) proximal to Hba ( Silver et al. 1985 ). Furthermore, similar to Hba deletion homozygotes, embryos homozygous for Egfr tm1Mag , a targeted null allele for Egfr , can die during peri-implantation, depending on genetic background (Threadgill et al. 1994 ). Since x-rays can produce deletions covering several centimorgans, the phenotype originally reported for the Hba deletions could be attributed to a loss of Mpg , Rhbdf 1 , or Egfr . Our study performed a molecular analysis of the deletions and identified the gene coding for small nuclear ribonucleoprotein 25 (U11/U12) ( Snrnp25 ) as most likely responsible for the peri-implantation lethality of Hba deletion homozygotes. Materials and Methods Animals DNA samples from mice carrying Hba b3(th) and mice carrying Hba b2(th) were obtained from the Oak Ridge National Laboratory and DNA samples from mice carrying Hba th−J from Medical College of Georgia. Hba b2(th) mice were crossed to CAST/EiJ (CAST) to generate an F1 hybrid for increased polymorphisms between the wildtype and Hba b2(th) carrying MMU11. Animals were maintained in accordance with the Institution Animal Care and Use Committee (IACUC). They were housed at 22°C under a 12-h light cycle. α-thalassemia phenotypic typing using blood from Hba b2(th) mice was performed as described in (Russell et al. 1976b ). PCR assays and amplicon sequencing PCR-based SSLP assays were carried out using primers publicly available in The Jackson Laboratory’s Mouse Genome Informatics database (MGI, https://www.informatics.jax.org/ ) (Baldarelli et al. 2024 ). PCR assays aimed at narrowing deletion edges were designed using the NCBI Primer Blast tool ( https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi ), and the primers were synthesized by Integrated DNA Technologies (Table 1 ). Premium PCR sequencing of amplicons from potentially deleted genes was conducted by Plasmidsaurus using Oxford Nanopore Technology, accompanied by custom analysis and annotation. To establish whether a gene was deleted, a FASTA file for each amplicon was generated based on data from the per-base file provided by Plasmidsaurus. If a single base had approximately 50% of reads indicating two different nucleotides, the FASTA file would contain the IUPAC Ambiguity letter corresponding to that combination. Amplicon sequences from C57BL6/J (B6) (GRCm39) and CAST (from the MGI Multi-Genome Viewer) reference sequences, as well as from (B6.SEC- Hba b2(th) x CAST)F1 mice, were aligned on Benchling ( https://www.benchling.com/ ) using MAFFT (Katoh and Standley 2013 ). The region was classified as deleted if the (B6.SEC- Hba b2(th) x CAST)F1 was found to be hemizygous in loci where the (B6.SEC- Hba wt x CAST)F1 amplicon was heterozygous (Supplementary Data). Table 1 PCR primers used for analysis of Hba deletions. Marker/Gene F Primer R Primer MGI ID D11Mit53 GTGGATACAGAGTGGATACAGGG GTAACCAAGATGCAAGGGGA 89133 D11Mit172 TGCCTAATTTAATTTGGATGGG TGAGGTGTGTGTCTTGCCTC 89058 D11Mit173 AAGTGACATATGGATTCCTGGG TCAAAGTGGGTATGTGTCATCC 89059 D11Mit186 AAAACACATTTACATGCATGGTG TGTGTGCACTTAAGCCCTGA 89072 D11Mit171 AAAGCATATGTCAAAAAACAAAACA CACAGTCCTACCAGTCCATAAGC 89057 D11Mit77 GTATTCAAATGACTTCTGCCTGG TTGAAATGGTCTTCAAGTGGC 89156 D11Mit215 CATTGGGGGATATGAAGTGG CTTGTAAGCAGGACAAAATTTGG 101276 D11Mit268 CCCCAGAACTCACATCAGGT ATTCATTGTTGCCAGCAGG 101223 D11Mit135 GCATCTGCAGAGGAGGTTTC AAATGGAATTTAGTAAATGGGAAGG 89018 D11Mit205 GGCAGAGTCTAGTCTGATATCTTGG CAGTGCACAGCCAGGTTG 89094 Egfr tm1Mag CTCAGCCAGATGATGTTGAC CCTCGTCTGTGGAAGAACTA 95294 Cpeb4 CCAGCAAGTTGGCTCAGCAGGT AGGACTGTCCAGGAGCCAGTGA 1914829 Bod1 TGGCTCATGGCCACTGAAAT CTGTGGCCTGAAGATGTGGT 1916806 Hba-a2 CATGGTGCTCTCTGGGGAAG AGAGGTACAGGTGCAAGGGA 96016 Hbq1b ATGTCGGAATCTACGCGACC TACTGGACGCGGGGAGTAT 3613460 Whole genome sequencing and bioinformatics analyses Tail samples from (B6.SEC- Hba b2(th) x CAST)F1 mice were collected and snap-frozen. DNA extraction, sequencing library preparation using an Illumina TruSeq DNA library prep kit, and whole genome sequencing on an Illumina HiSeq 2500 was performed by the Texas A&M AgriLife Research Genomics and Bioinformatics Service. All bioinformatic analyses were conducted using the computing resources provided by Texas A&M High-Performance Research Computing. Fastq files were trimmed using trimmomatic (Bolger, Lohse and Usadel 2014 ), and read quality was evaluated with FastQC (Andrews 2010 ). Filtered reads were mapped to the soft-masked GRCm39 mouse reference genome using Burrows-Wheeler Alignment (Li 2013 ). Mapped reads were then pre-processed following the GATK Best Practices workflow (DePristo et al. 2011 ). Genetic variants between B6 and CAST mouse strains were accounted for during this process. Finally, LUMPY (Layer et al. 2014 ) was used to call structural variant differences between the samples. Results The Hba b2(th) deletion does not include Egfr Since homozygosity for the Hba b2(th) deletion and the genetic deletion of Egfr , which are syntenic on MMU11, can result in peri-implantation lethality depending on the genetic background, a genetic cross between Hba b2(th) /+ and Egfr tm1Mag /+ mice was performed to test for complementation. DNA from the resulting progeny was screened using PCR for Egfr alleles (Threadgill et al. 1994 ) and the simple sequence length polymorphism (SSLP) D11Mit53. Animal three inherited the maternally derived Egfr tm1Mag null allele along with a paternally derived wild-type (wt) Egfr allele, in addition to the paternally derived Hba b2(th) deletion chromosome (Fig. 1 ). This conclusion stems from the fact that animal three only possesses the smaller maternal allele and lacks the D11Mit53 paternal allele. Animals eight and nine also inherited the Hba b2(th) deletion chromosome but possess the larger maternal allele and two wild-type Egfr alleles. Had Hba b2(th) encompassed the EGFR locus, animal three would not have survived fetal development, as Egfr null animals are lethal. Therefore, Egfr is not part of the Hba b2(th) deletion. Mapping Hba deletions on Chromosome 11 To better estimate the genetic length of the Hba deletions, SSLP markers mapping to this region (Copeland et al. 1993 ; Dietrich et al. 1996 ) were screened by PCR. Markers spanning a 20 cM region around Hba indicated that the Hba b2(th) deletion spans less than 1.04 cM on the genetic map, while the other two deletions ( Hba b3(th) and Hba th−J ) are much larger (approximately 8.2 cM and 2.9 cM, respectively). For Hba b3(th) and Hba th−J , all tested markers proximal to D11Mit172 are present (D11Mit172, D11Mit171, and D11Mit77), while the next distal marker, D11Mit215, is absent. This contrasts with Hba b2(th) , in which D11Mit215 is not deleted (Fig. 2 ). Markers distal to D11Mit268 in Hba b3(th) , and D11Mit135 and D11Mit205 in Hba th−J are present on the deletion chromosomes. Other markers at these two loci were uninformative due to a lack of polymorphism between the two parental strains. To estimate the length of the Hba b2(th) deletion, which is the shortest of the Hba deletions, and to confirm the previous estimate of the deletion size, offspring from interspecific crosses between the M. m. musculus (B6.SEC) deletion and M. m. castaneous (CAST) were generated to increase genetic differences. For the Hba b2(th) deletion, marker D11Mit53 (mapping to 18.86 cM on GRCm39) is deleted, while D11Mit172 (16.32 cM), D11Mit173 (19.32 cM), and D11Mit186 (20.262 cM) are present on the deletion chromosome (Figs. 1 and 2 ). Physical length estimation of Hba b2(th) Whole-genome sequencing of DNA from (B6.SEC- Hba b2(th) x CAST)F1 mice allowed for further estimation of the Hba b2(th) deletion boundaries. Haplotype analysis by Lumpy provided four candidate deletion edges at mm39-MMU11:31’690,316 or 31’836,857 (upstream), and mm39-MMU11:32’243,280 or 32’286,351 (Fig. 3 , blue lines) surrounding the hemoglobin alpha complex. In-depth PCR-based analysis and sequencing of potentially deleted genes revealed that the upstream edge of the deletion lies between biorientation of chromosomes in cell division 1 ( Bod1 ) and cytoplasmic polyadenylation element binding protein 4 ( Cpeb4 ), while the downstream edge lies between hemoglobin, theta 1B ( Hbq1b ) and Hba-a2 (Fig. 3 , purple and red lines). This shows that the Hba b2(th) deletion is between 31.7Mb and 32.2Mb, encompassing eleven known protein-coding genes. Discussion The alpha-thalassemia phenotype in Hba b2(th) mice is not due to deletion of both Hba genes Previous studies analyzing DNA using Southern blots and amino acid sequences of Hba b2(th) heterozygous mice concluded that the deletion spans both the Hba-a1 and Hba-a2 genes (Popp et al. 1979 ; Whitney et al. 1981 ). The methods used in the earlier analysis have sensitivity limitations in amino acid detection and lack DNA loading controls. Phenotypic analysis of Hba b2(th) heterozygous mice shows similar hematological alterations to those in humans with α-thalassemia minor (Popp and Enlow 1977 ; Whitney et al. 1981 ), which is a result of deletions or other mutations in two of the four alpha-globin alleles (either in cis or trans ) (Tesio and Bauer 2023 ). We demonstrate here that the coding sequence of Hba-a2 is not deleted. Therefore, the lack of expression of this gene is likely due to a disruption in its regulation. Considering the closest gene upstream of Hba-a2 , Hbq1b , is deleted, it is reasonable to hypothesize that the deletion of the Hba-a2 promoter region causes the lack of expression. The deletion edges indicated by Lumpy analysis suggest a boundary approximately 3 kilobases (kb) upstream of the first exon of Hba-a2 . This region contains histone modifications and transcription factor binding sites that are likely important regulators of the expression of this gene (Oudelaar et al. 2021 ). Furthermore, the expression of alpha globin genes is highly regulated by a super-enhancer region within an intron of Nprl3 (Hay et al. 2016 ), which lies within the deletion boundaries. Our results suggest that the phenotype observed in Hba b2(th) mice resembles more closely that of human α-thalassemia cases involving mutations in the regulatory region rather than mutations in the alpha globin genes themselves (Hatton et al. 1990 ; Kalle Kwaifa, Lai and Md Noor 2020 ; Sollaino et al. 2010 ). Gene(s) responsible for Hba deletion homozygous peri-implantation lethality After confirming that Egfr is not deleted and is therefore not responsible for peri-implantation lethality, we created a list of all protein-coding genes within the Hba b2(th) deletion using resources available from the MGI database ( https://www.informatics.jax.org/ ). Gene-specific knockout phenotypes annotated by the International Mouse Phenotyping Consortium (IMPC, www.mousephenotype.org)(Groza et al. 2022) , along with other phenotypes reported in the literature, indicated that Snrnp25 is the most likely candidate gene for the peri-implantation lethal phenotype observed in Hba b2(th) homozygous embryos (Table 2 ). Table 2 Protein-coding genes deleted in the Hba b2(th) chromosome. Start End Symbol Name IMPC report Other phenotypes 31822211 31885634 Cpeb4 Cytoplasmic polyadenylation element binding protein 4 Early adult lethality 31915592 31929651 4930524B15Rik RIKEN cdna 4930524B15 gene Not significant 31950463 32009202 Nsg2 Neuron specific gene family member 2 Not significant 32137541 32150279 Il9r Interleukin 9 receptor Not significant 32155415 32158984 Snrnp25 Small nuclear ribonucleoprotein 25 (U11/U12) Not phenotyped 32159585 32172300 Rhbdf1 Rhomboid 5 homolog 1 Early adult lethality 32176505 32182700 Mpg N-methylpurine-DNA glycosylase Not significant 32181963 32217707 Nprl3 Nitrogen permease regulator-like 3 Not phenotyped E15.5-18.5 lethality (Kowalczyk et al. 2012 ) 32226600 32228116 Hba-x Hemoglobin X, alpha-like embryonic chain in Hba complex Not phenotyped Embryonic lethal in some genetic backgrounds, viable in others (Leder et al. 1997 ) 32233672 32234486 Hba-a1 Hemoglobin alpha, adult chain 1 Not phenotyped Homozygous knockout viable (Leder et al. 1997 ) 32236965 32237784 Hbq1b Hemoglobin, theta 1B Not phenotyped Of all the genes within the deleted region, only two lack previously reported knockout phenotypes: Hbq1b and Snrnp25 . The role and expression pattern of Hbq1b are not well studied in mouse models. Expression analysis indicates this gene is first expressed during mouse gastrulation (Baldarelli et al. 2021 ). Similarly, human analyses show that this gene begins to be expressed during embryonic development after the expression of the fetal HBA subunit, HBZ (ortholog to mouse Hba-x ), starts to decrease. The gradual switch from fetal to adult hemoglobin occurs during E10-14 of mouse development (Albitar et al. 1992 ; Fantoni, de la Chapelle and Marks 1969 ), long after the lethality of Hba b2(th) homozygous embryos. Snrnp25 codes for a core protein in the U12-dependent (minor) spliceosomal complex (Will et al. 2004 ). While only found in a very small proportion of genes in the mouse genome, U11/12-type introns are enriched in genes involved in genetic information processing (Turunen et al. 2013 ). Additionally, mutations in components of the minor spliceosome have been shown to be involved in disease and cancer progression (Verma et al. 2018 ). In the active spliceosome, SNRNP25 heterodimerizes with other proteins in the complex, like SNRNP35 and programmed cell death 7 (PDCD7) (Zhao et al. 2025 ). According to the IMPC, homozygous knockout of Pdcd7 results in an embryonic lethal phenotype before embryonic day 9.5 (Baldarelli et al. 2021 ). Although there are no reported mammalian knockouts, Snrnp25 , like Snrnp35 and Pdcd7 , is expressed as early as the one-cell stage (Baldarelli et al. 2021 ), and knockdown of the gene in zebrafish, as well as knockdown of U12 splicing, leads to early embryonic death (König et al. 2007 ; Pei et al. 2018 ). In conclusion, we have defined the boundaries that encompass the Hba b2(th) deletion and confirmed that the coding sequence for Hba-a2 is not deleted, thus demonstrating that the alpha-thalassemic phenotype observed in these mice is likely due to disruptions in regulatory sequences. Furthermore, we have identified Snrnp25 as the likely gene essential for mammalian peri-implantation embryonic development within the Hba deletions. Declarations Author Contribution D.W.T and T.M generated the crosses and performed the molecular analyses, A.E.H. sequenced the DNA samples, A.M.V-E. analyzed the sequence data., and D.W.T and W.M.V-E. wrote the main manuscript text. All authors reviewed the manuscript. Acknowledgement We thank the Texas A&M AgriLife Research Genomics and Bioinformatics Service for generating the genome sequences, Dr. Barry Whitney (Medical College of Georgia) for the Hbath-J samples, and Dr. Ray Popp (Oak Ridge National Laboratory) for the Hbab2(th) and Hbab3(th) samples. Data Availability Data is provided within the manuscript or supplementary information files. References Albitar M, Care A, Peschle C, Liebhaber SA (1992) Developmental Switching of Messenger RNA Expression From the Human α-Globin Cluster: Fetal/Adult Pattern of θ-Globin Gene Expression. Blood 80:1586–1591 Andrews S (2010) A quality control tool for high throughput sequence data Baldarelli RM, Smith CL, Ringwald M, Richardson JE, Bult CJ (2024) Mouse Genome Informatics: an integrated knowledgebase system for the laboratory mouse. Genetics 227 Baldarelli RM, Smith CM, Finger JH, Hayamizu TF, McCright IJ, Xu J, Shaw DR, Beal JS, Blodgett O, Campbell J, Corbani LE, Frost PJ, Giannatto SC, Miers DB, Kadin JA, Richardson JE, Ringwald M (2021) The mouse Gene Expression Database (GXD): 2021 update. Nucleic Acids Res 49:D924–d931 Behzadian MA, Whitney JB, Black M, Maghsoudlou S (1990) EGF receptor expression in a mouse model with a homozygous lethal. J Cell Biochem suppl 14E:69 Behzadian MA, Whitney JB, McCool D (1993) Establishment and characterization of embryonic stem cells from an a-thalassemic mouse model with a homozygous lethal deletion. 252a Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120 Copeland NG, Jenkins NA, Gilbert DJ, Eppig JT, Maltais LJ, Miller JC, Dietrich WF, Weaver A, Lincoln SE, Steen RG, Stein LD, Nadeau JH, Lander ES (1993) A Genetic Linkage Map of the Mouse: Current Applications and Future Prospects. Science 262:57–66 de Aberle SB (1927) A study of the hereditary anaemia of mice. Am J Anat 40:219–249 DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ (2011) A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 43:491–498 Dietrich WF, Miller J, Steen R, Merchant MA, Damron-Boles D, Husain Z, Dredge R, Daly MJ, Ingalls KA, O'Connor TJ (1996) A comprehensive genetic map of the mouse genome. Nature 380:149–152 Fantoni A, de la Chapelle A, Marks PA (1969) Synthesis of Embryonic Hemoglobins during Erythroid Cell Development in Fetal Mice. J Biol Chem 244:675–681 Groza T, Gomez FL, Mashhadi HH, Muñoz-Fuentes V, Gunes O, Wilson R, Cacheiro P, Frost A, Keskivali-Bond P, Vardal B, McCoy A, Cheng TK, Santos L, Wells S, Smedley D, Mallon A-M, Parkinson H (2022) The International Mouse Phenotyping Consortium: comprehensive knockout phenotyping underpinning the study of human disease. Nucleic Acids Res 51:D1038–D1045 Hatton CS, Wilkie AO, Drysdale HC, Wood WG, Vickers MA, Sharpe J, Ayyub H, Pretorius IM, Buckle VJ, Higgs DR (1990) Alpha-thalassemia caused by a large (62 kb) deletion upstream of the human alpha globin gene cluster. Blood 76:221–227 Hay D, Hughes JR, Babbs C, Davies JOJ, Graham BJ, Hanssen LLP, Kassouf MT, Oudelaar AM, Sharpe JA, Suciu MC, Telenius J, Williams R, Rode C, Li P-S, Pennacchio LA, Sloane-Stanley JA, Ayyub H, Butler S, Sauka-Spengler T, Gibbons RJ, Smith AJH, Wood WG, Higgs DR (2016) Genetic dissection of the α-globin super-enhancer in vivo. Nat Genet 48:895–903 Hendrey J, Lin D, Dziadek M (1995) Developmental analysis of the Hba(th-J) mouse mutation: effects on mouse peri-implantation development and identification of two candidate genes. Dev Biol 172:253–263 Kalle Kwaifa I, Lai MI, Md Noor S (2020) Non-deletional alpha thalassaemia: a review. Orphanet J Rare Dis 15:166 Katoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol 30:772–780 König H, Matter N, Bader R, Thiele W, Müller F (2007) Splicing Segregation: The Minor Spliceosome Acts outside the Nucleus and Controls Cell Proliferation. Cell 131:718–729 Kowalczyk MS, Hughes JR, Babbs C, Sanchez-Pulido L, Szumska D, Sharpe JA, Sloane-Stanley JA, Morriss-Kay GM, Smoot LB, Roberts AE, Watkins H, Bhattacharya S, Gibbons RJ, Ponting CP, Wood WG, Higgs DR (2012) Nprl3 is required for normal development of the cardiovascular system. Mamm Genome 23:404–415 Layer RM, Chiang C, Quinlan AR, Hall IM (2014) LUMPY: a probabilistic framework for structural variant discovery. Genome Biol 15:R84 Leder A, Daugherty C, Whitney B, Leder P (1997) Mouse ζ- and α-Globin Genes: Embryonic Survival, α-Thalassemia, and Genetic Background Effects. Blood 90:1275–1282 Li H (2013) Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv Nathan DG, Gunn RB (1966) Thalassemia: the consequences of unbalanced hemoglobin synthesis. Am J Med 41:815–830 Oudelaar AM, Beagrie RA, Kassouf MT, Higgs DR (2021) The mouse alpha-globin cluster: a paradigm for studying genome regulation and organization. Curr Opin Genet Dev 67:18–24 Pei W, Xu L, Huang SC, Pettie K, Idol J, Rissone A, Jimenez E, Sinclair JW, Slevin C, Varshney GK, Jones M, Carrington B, Bishop K, Huang H, Sood R, Lin S, Burgess SM (2018) Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues. npj Regenerative Med 3:11 Popp RA, Bradshaw BS, Skow LC (1980) Effects of Alpha Thalassemia on Mouse Development. Differentiation 17:205–210 Popp RA, Enlow MK (1977) Radiation-Induced a-Thalassemia in Mice. Am J Vet Res 38:569–572 Popp RA, Stratton LP, Hawley DK, Effron K (1979) Hemoglobin of mice with radiation-induced mutations at the hemoglobin loci. J Mol Biol 127:141–148 Routman E, Cheverud J (1994) A rapid method of scoring simple sequence repeat polymorphisms with agarose gel electrophoresis. Mamm Genome 5:187–188 Russell LB, Russell WL, Popp RA, Vaughan C, Jacobson KB (1976a) Radiation-induced mutations at mouse hemoglobin loci. Proceedings of the National Academy of Sciences 73, 2843–2846 Russell LB, Russell WL, Popp RA, Vaughan CM, Jacobson KB (1976b) Radiation-induced mutations at mouse hemoglobin loci. Proc Natl Acad Sci USA 73:2843–2846 Silver J, Whitney JB 3rd, Kozak C, Hollis G, Kirsch I (1985) Erbb is linked to the alpha-globin locus on mouse chromosome 11. Mol Cell Biol 5:1784–1786 Sollaino MC, Paglietti ME, Loi D, Congiu R, Podda R, Galanello R (2010) Homozygous deletion of the major alpha-globin regulatory element (MCS-R2) responsible for a severe case of hemoglobin H disease. Blood 116:2193–2194 Taylor JM, Dozy A, Kan YW, Varmus HE, Lei-Injo LE, Ganesan J, Todd D (1974) Genetic lesion in homozygous a-thalassemia (hydrops fetalis). Nature 251:392–393 Tesio N, Bauer DE (2023) Molecular Basis and Genetic Modifiers of Thalassemia. Hematol Oncol Clin N Am 37:273–299 Threadgill DW, Yee D, Thompson C, Magnuson T (1994) Epidermal Growth Factor Receptor Is Required for Survival of the Peri-implantation Mouse Embryo. Submitted Turunen JJ, Niemelä EH, Verma B, Frilander MJ (2013) The significant other: splicing by the minor spliceosome. Wiley Interdiscip Rev RNA 4:61–76 Verma B, Akinyi MV, Norppa AJ, Frilander MJ (2018) Minor spliceosome and disease. Semin Cell Dev Biol 79:103–112 Weatherall DJ, Clegg JB (1972) The thalassemia syndromes, 2nd edn. Blackwell Scientific Publishers Ltd, Oxford, England Whitney JB, Martinell J, Popp RA, Russell LB, Anderson WF (1981) Deletions in the a-Globin Gene Complex in a-Thalassemic Mice. Proc. Natl. Acad. Sci. USA 78, 7644–7647 Whitney JB, Russell ES (1978) Mouse News Letter 58:47 Whitney JB, Russell ES (1980) Linkage of genes for adult a-globin and embryonic a-like globin chains. Proc Natl Acad Sci USA 77:1087–1090 Will CL, Schneider C, Hossbach M, Urlaub H, Rauhut R, Elbashir S, Tuschl T, Lührmann R (2004) The human 18S U11/U12 snRNP contains a set of novel proteins not found in the U2-dependent spliceosome. RNA 10:929–941 Zhao J, Peter D, Brandina I, Liu X, Galej WP (2025) Structural basis of 5′ splice site recognition by the minor spliceosome. Mol Cell 85:652–664e654 Additional Declarations No competing interests reported. Supplementary Files HbadelSupplementaryData.docx Cite Share Download PDF Status: Published Journal Publication published 21 May, 2025 Read the published version in Mammalian Genome → Version 1 posted Editorial decision: Revision requested 22 Apr, 2025 Reviews received at journal 21 Apr, 2025 Reviews received at journal 17 Apr, 2025 Reviewers agreed at journal 03 Apr, 2025 Reviewers agreed at journal 02 Apr, 2025 Reviewers invited by journal 01 Apr, 2025 Editor assigned by journal 01 Apr, 2025 Submission checks completed at journal 01 Apr, 2025 First submitted to journal 29 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6335781","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":444290582,"identity":"a52ff7f5-9ad8-4641-97e5-0955b111f092","order_by":0,"name":"Ana María Velásquez-Escobar","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"María","lastName":"Velásquez-Escobar","suffix":""},{"id":444290583,"identity":"cdc15ca7-fde6-4bf0-808b-eca64922ac21","order_by":1,"name":"Andrew Hillhouse","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"","lastName":"Hillhouse","suffix":""},{"id":444290585,"identity":"0f05b47e-dbc0-4361-b02f-66f8d529dfc5","order_by":2,"name":"Terry Magnuson","email":"","orcid":"","institution":"University of North Carolina","correspondingAuthor":false,"prefix":"","firstName":"Terry","middleName":"","lastName":"Magnuson","suffix":""},{"id":444290586,"identity":"8e33a2d0-41dc-4c37-8814-c0d5175df0a5","order_by":3,"name":"David Threadgill","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAlUlEQVRIiWNgGAWjYDCCAwyMD6BMA2K1MDMbHCBVC5sEaVr4buQfq/5Qsy2xgb15mwRRWiRvJLPdOHDsdmIDz7Ey4rQY3AZpYQNqkcgxI15LwYF/QC3yb0jQwnCwDWQLD5FaJO8/NpY423fbuI0nrdiCKC18Zw4+/FDx7bZsP/vhjTeI0gIHbKQpHwWjYBSMglGAFwAAQXMzevEQ78cAAAAASUVORK5CYII=","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":true,"prefix":"","firstName":"David","middleName":"","lastName":"Threadgill","suffix":""}],"badges":[],"createdAt":"2025-03-29 20:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6335781/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6335781/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00335-025-10133-z","type":"published","date":"2025-05-21T15:57:46+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81124206,"identity":"976c321e-2240-4e34-a3bc-ed44f8116288","added_by":"auto","created_at":"2025-04-22 13:34:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":135339,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic cross and ethidium bromide-stained gels used for complementation analysis. The individual relationships are shown at the top along with the genotypes of the parents. Individuals with their left half shaded carry the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion, while those with their right half shaded carry the \u003cem\u003eEgfr\u003c/em\u003e\u003csup\u003e\u003cem\u003etm1Mag\u003c/em\u003e\u003c/sup\u003e null-allele. Individual progeny are numbered. The locus names are on the left. Mice heterozygous at some SSLP loci, like D1Mit173 and D11Mit186, often show anomalous heteroduplex structures after PCR (Routman and Cheverud 1994).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6335781/v1/3dd1708afcd3c8f45207c704.png"},{"id":81124205,"identity":"6a3dc854-3fea-41cd-a62d-cf9a090e43ff","added_by":"auto","created_at":"2025-04-22 13:34:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":32507,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic map of the \u003cem\u003eHba\u003c/em\u003eregion of MMU 11. Genetic distances (in cM) from the centromere are on the left, and individual loci tested are on the right. The regions covered by each \u003cem\u003eHba\u003c/em\u003edeletion are shown on the left.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6335781/v1/f857630798539fd76a2c6979.png"},{"id":81124197,"identity":"fea8a50d-6a67-4c8b-88ed-1c769f27c9f2","added_by":"auto","created_at":"2025-04-22 13:34:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":29455,"visible":true,"origin":"","legend":"\u003cp\u003eChromosome visualization of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003edeletion. Screenshot from the UCSC Genome Browser mm39. Blue lines: Lumpy output candidate deletion edges at MMU11:31’690,316 or 31’836,857 (upstream), and chr11:32’243,280 or 32’286,351 (downstream). Red lines: regions confirmed deleted through amplicon sequencing, \u003cem\u003eCpeb4\u003c/em\u003e intron 1, and \u003cem\u003eHbq1b\u003c/em\u003e. Green line: regions confirmed deleted through SSLP analysis, D11Mit53, \u003cem\u003eHba-x\u003c/em\u003e. Purple lines: Regions confirmed not deleted through amplicon sequencing, \u003cem\u003eBod1\u003c/em\u003e intron2/exon3, and \u003cem\u003eHba-a2\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6335781/v1/d1dcdb153cb7740e03bbcc31.png"},{"id":83460037,"identity":"f0655d78-a962-49e1-93bc-02d1e069c885","added_by":"auto","created_at":"2025-05-26 16:09:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":958517,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6335781/v1/dba79854-c828-4253-a190-ed9ff1b76d1d.pdf"},{"id":81124196,"identity":"e8cf7168-5c79-4ac4-b331-82ec8757b874","added_by":"auto","created_at":"2025-04-22 13:34:31","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":19398,"visible":true,"origin":"","legend":"","description":"","filename":"HbadelSupplementaryData.docx","url":"https://assets-eu.researchsquare.com/files/rs-6335781/v1/7ec6609aab3744c542917a38.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Snrnp25 is a candidate for the peri-implantation lethal phenotype of the Hba deletions","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlpha-thalassemia is a genetic disorder produced by low or absent expression of the α-globin chain subunit of hemoglobin (Weatherall and Clegg \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1972\u003c/span\u003e). In both humans and mice, there are two adjacent adult hemoglobin alpha genes (\u003cem\u003eHBA1\u003c/em\u003e and \u003cem\u003eHBA2\u003c/em\u003e in humans; \u003cem\u003eHba-a1\u003c/em\u003e and \u003cem\u003eHba-a2\u003c/em\u003e in mice), along with an embryonic version (Whitney and Russell \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1980\u003c/span\u003e), all tightly linked on human chromosome 16 (HAS16) and mouse chromosome 11 (MMU11), respectively. Humans who are heterozygous for α-globin mutations have α-thalassemia, presenting with mild histological defects of the erythrocytes (Nathan and Gunn \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1966\u003c/span\u003e). Homozygosity for mutations in \u003cem\u003eHBA1\u003c/em\u003e and \u003cem\u003eHBA2\u003c/em\u003e can result in α-thalassemia major, which leads to a complete loss of α-globins and is lethal between 30 to 40 weeks of gestation (Taylor et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e1974\u003c/span\u003e). Affected individuals exhibit the fatal congenital disorder known as hydrops fetalis. Hematologic defects associated with alpha-thalassemia minor arise from a reduction in the normal 1:1 subunit ratio of α-globin to β-globin, the latter being encoded by a separate unlinked gene cluster, due to mutations in two of the four alleles of the \u003cem\u003eHBA\u003c/em\u003e genes.\u003c/p\u003e \u003cp\u003eWith the goal of identifying a mouse model for α-thalassemia, radiation and chemical mutagenesis screens were undertaken. Two x-ray-induced, \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb3(th)\u003c/em\u003e\u003c/sup\u003e (Russell et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1976a\u003c/span\u003e), and one triethylenemelamine-induced, \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eth\u0026minus;J\u003c/em\u003e\u003c/sup\u003e(Hendrey, Lin and Dziadek \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Whitney and Russell \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1978\u003c/span\u003e), mutations were recovered. Molecular characterization of these animals revealed that they were heterozygous for deletions of the \u003cem\u003eHba\u003c/em\u003e gene cluster (Whitney et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e1981\u003c/span\u003e). Matings between heterozygous animals produced no homozygous pups, indicating that homozygosity for any of the three deletions is embryonic lethal. However, closer examination of earlier embryonic stages revealed some unexpected results. A retrospective analysis of embryos from \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb 2 (th)\u003c/em\u003e\u003c/sup\u003e/+ crosses showed that the putative homozygous embryos were dying shortly after initiating implantation at embryonic day (E) 5.5 to 6.5(Popp, Bradshaw and Skow \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1980\u003c/span\u003e). Since hemoglobins are not necessary until E8.0 when the blood islands of the yolk sac begin producing red cells (de Aberle \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1927\u003c/span\u003e), this observation suggested that the deletions around the \u003cem\u003eHba\u003c/em\u003e complex not only removed the \u003cem\u003eHba\u003c/em\u003e genes but also deleted or impacted other genes involved in peri-implantation development. Attempts to create homozygous mutant ES lines were unsuccessful, further supporting the notion that the deletions have removed or affected other loci (Behzadian, Whitney and McCool \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). A subsequent study implicated N-methylpurine-DNA glycosylase (\u003cem\u003eMpg\u003c/em\u003e) and rhomboid 5 homolog 1 (\u003cem\u003eRhbdf1\u003c/em\u003e, previously called \u003cem\u003eDist 1\u003c/em\u003e) as candidate genes for the peri-implantation lethality of the \u003cem\u003eHba\u003c/em\u003e deletion homozygotes, based on their expression during peri-implantation and their loss in the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eth\u0026minus; J\u003c/em\u003e\u003c/sup\u003e deletion (Hendrey, Lin and Dziadek \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). In another study, liver preparations from \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb 3 (th)\u003c/em\u003e\u003c/sup\u003e deletion heterozygous mice were found to bind half the epidermal growth factor (EGF) compared to preparations from their normal littermates, partly due to lower levels of epidermal growth factor receptor (\u003cem\u003eEgfr)\u003c/em\u003e mRNA (Behzadian et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1990\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBased on these data, it was hypothesized that the deletions also affected \u003cem\u003eEgfr\u003c/em\u003e, which maps only six centimorgans (cM) proximal to \u003cem\u003eHba (\u003c/em\u003eSilver et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1985\u003c/span\u003e). Furthermore, similar to \u003cem\u003eHba\u003c/em\u003e deletion homozygotes, embryos homozygous for \u003cem\u003eEgfr\u003c/em\u003e\u003csup\u003e\u003cem\u003etm1Mag\u003c/em\u003e\u003c/sup\u003e, a targeted null allele for \u003cem\u003eEgfr\u003c/em\u003e, can die during peri-implantation, depending on genetic background (Threadgill et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Since x-rays can produce deletions covering several centimorgans, the phenotype originally reported for the \u003cem\u003eHba\u003c/em\u003e deletions could be attributed to a loss of \u003cem\u003eMpg\u003c/em\u003e, \u003cem\u003eRhbdf 1\u003c/em\u003e, or \u003cem\u003eEgfr\u003c/em\u003e. Our study performed a molecular analysis of the deletions and identified the gene coding for small nuclear ribonucleoprotein 25 (U11/U12) (\u003cem\u003eSnrnp25\u003c/em\u003e) as most likely responsible for the peri-implantation lethality of \u003cem\u003eHba\u003c/em\u003e deletion homozygotes.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eDNA samples from mice carrying \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb3(th)\u003c/em\u003e\u003c/sup\u003e and mice carrying \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e were obtained from the Oak Ridge National Laboratory and DNA samples from mice carrying \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eth\u0026minus;J\u003c/em\u003e\u003c/sup\u003e from Medical College of Georgia. \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e mice were crossed to CAST/EiJ (CAST) to generate an F1 hybrid for increased polymorphisms between the wildtype and \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e carrying MMU11.\u003c/p\u003e \u003cp\u003eAnimals were maintained in accordance with the Institution Animal Care and Use Committee (IACUC). They were housed at 22\u0026deg;C under a 12-h light cycle. α-thalassemia phenotypic typing using blood from \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e mice was performed as described in (Russell et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1976b\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePCR assays and amplicon sequencing\u003c/h3\u003e\n\u003cp\u003ePCR-based SSLP assays were carried out using primers publicly available in The Jackson Laboratory\u0026rsquo;s Mouse Genome Informatics database (MGI, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.informatics.jax.org/\u003c/span\u003e\u003cspan address=\"https://www.informatics.jax.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Baldarelli et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). PCR assays aimed at narrowing deletion edges were designed using the NCBI Primer Blast tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the primers were synthesized by Integrated DNA Technologies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Premium PCR sequencing of amplicons from potentially deleted genes was conducted by Plasmidsaurus using Oxford Nanopore Technology, accompanied by custom analysis and annotation. To establish whether a gene was deleted, a FASTA file for each amplicon was generated based on data from the per-base file provided by Plasmidsaurus. If a single base had approximately 50% of reads indicating two different nucleotides, the FASTA file would contain the IUPAC Ambiguity letter corresponding to that combination. Amplicon sequences from C57BL6/J (B6) (GRCm39) and CAST (from the MGI Multi-Genome Viewer) reference sequences, as well as from (B6.SEC-\u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e x CAST)F1 mice, were aligned on Benchling (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.benchling.com/\u003c/span\u003e\u003cspan address=\"https://www.benchling.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using MAFFT (Katoh and Standley \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The region was classified as deleted if the (B6.SEC-\u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e x CAST)F1 was found to be hemizygous in loci where the (B6.SEC-\u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003ewt\u003c/em\u003e\u003c/sup\u003e x CAST)F1 amplicon was heterozygous (Supplementary Data).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR primers used for analysis of \u003cem\u003eHba\u003c/em\u003e deletions.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker/Gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMGI ID\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGATACAGAGTGGATACAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAACCAAGATGCAAGGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit172\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCTAATTTAATTTGGATGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGGTGTGTGTCTTGCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89058\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit173\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGTGACATATGGATTCCTGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAAAGTGGGTATGTGTCATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89059\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit186\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAACACATTTACATGCATGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGTGCACTTAAGCCCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89072\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGCATATGTCAAAAAACAAAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACAGTCCTACCAGTCCATAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89057\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTATTCAAATGACTTCTGCCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGAAATGGTCTTCAAGTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89156\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit215\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTGGGGGATATGAAGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGTAAGCAGGACAAAATTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e101276\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit268\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCCAGAACTCACATCAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTCATTGTTGCCAGCAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e101223\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATCTGCAGAGGAGGTTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAATGGAATTTAGTAAATGGGAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89018\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD11Mit205\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCAGAGTCTAGTCTGATATCTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGTGCACAGCCAGGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89094\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEgfr\u003c/em\u003e\u003csup\u003e\u003cem\u003etm1Mag\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCAGCCAGATGATGTTGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCGTCTGTGGAAGAACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e95294\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCpeb4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGCAAGTTGGCTCAGCAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGACTGTCCAGGAGCCAGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1914829\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBod1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGCTCATGGCCACTGAAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTGGCCTGAAGATGTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1916806\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHba-a2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGGTGCTCTCTGGGGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAGGTACAGGTGCAAGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e96016\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHbq1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGTCGGAATCTACGCGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACTGGACGCGGGGAGTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3613460\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eWhole genome sequencing and bioinformatics analyses\u003c/h3\u003e\n\u003cp\u003eTail samples from (B6.SEC-\u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e x CAST)F1 mice were collected and snap-frozen. DNA extraction, sequencing library preparation using an Illumina TruSeq DNA library prep kit, and whole genome sequencing on an Illumina HiSeq 2500 was performed by the Texas A\u0026amp;M AgriLife Research Genomics and Bioinformatics Service. All bioinformatic analyses were conducted using the computing resources provided by Texas A\u0026amp;M High-Performance Research Computing. Fastq files were trimmed using trimmomatic (Bolger, Lohse and Usadel \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and read quality was evaluated with FastQC (Andrews \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Filtered reads were mapped to the soft-masked GRCm39 mouse reference genome using Burrows-Wheeler Alignment (Li \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Mapped reads were then pre-processed following the GATK Best Practices workflow (DePristo et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Genetic variants between B6 and CAST mouse strains were accounted for during this process. Finally, LUMPY (Layer et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) was used to call structural variant differences between the samples.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThe\u003c/b\u003e \u003cb\u003eHba\u003c/b\u003e\u003csup\u003e\u003cb\u003eb2(th)\u003c/b\u003e\u003c/sup\u003e \u003cb\u003edeletion does not include\u003c/b\u003e \u003cb\u003eEgfr\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSince homozygosity for the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion and the genetic deletion of \u003cem\u003eEgfr\u003c/em\u003e, which are syntenic on MMU11, can result in peri-implantation lethality depending on the genetic background, a genetic cross between \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e/+ and \u003cem\u003eEgfr\u003c/em\u003e\u003csup\u003e\u003cem\u003etm1Mag\u003c/em\u003e\u003c/sup\u003e/+ mice was performed to test for complementation. DNA from the resulting progeny was screened using PCR for \u003cem\u003eEgfr\u003c/em\u003e alleles (Threadgill et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1994\u003c/span\u003e) and the simple sequence length polymorphism (SSLP) D11Mit53. Animal three inherited the maternally derived \u003cem\u003eEgfr\u003c/em\u003e\u003csup\u003e\u003cem\u003etm1Mag\u003c/em\u003e\u003c/sup\u003e null allele along with a paternally derived wild-type (wt) \u003cem\u003eEgfr\u003c/em\u003e allele, in addition to the paternally derived \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion chromosome (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This conclusion stems from the fact that animal three only possesses the smaller maternal allele and lacks the D11Mit53 paternal allele. Animals eight and nine also inherited the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion chromosome but possess the larger maternal allele and two wild-type \u003cem\u003eEgfr\u003c/em\u003e alleles. Had \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e encompassed the EGFR locus, animal three would not have survived fetal development, as \u003cem\u003eEgfr\u003c/em\u003e null animals are lethal. Therefore, \u003cem\u003eEgfr\u003c/em\u003e is not part of the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMapping\u003c/b\u003e \u003cb\u003eHba\u003c/b\u003e \u003cb\u003edeletions on Chromosome 11\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo better estimate the genetic length of the \u003cem\u003eHba\u003c/em\u003e deletions, SSLP markers mapping to this region (Copeland et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Dietrich et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1996\u003c/span\u003e) were screened by PCR. Markers spanning a 20 cM region around \u003cem\u003eHba\u003c/em\u003e indicated that the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion spans less than 1.04 cM on the genetic map, while the other two deletions (\u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb3(th)\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eth\u0026minus;J\u003c/em\u003e\u003c/sup\u003e) are much larger (approximately 8.2 cM and 2.9 cM, respectively). For \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb3(th)\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eth\u0026minus;J\u003c/em\u003e\u003c/sup\u003e, all tested markers proximal to D11Mit172 are present (D11Mit172, D11Mit171, and D11Mit77), while the next distal marker, D11Mit215, is absent. This contrasts with \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e,\u003c/sup\u003e in which D11Mit215 is not deleted (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Markers distal to D11Mit268 in \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb3(th)\u003c/em\u003e\u003c/sup\u003e, and D11Mit135 and D11Mit205 in \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eth\u0026minus;J\u003c/em\u003e\u003c/sup\u003e are present on the deletion chromosomes. Other markers at these two loci were uninformative due to a lack of polymorphism between the two parental strains.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo estimate the length of the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion, which is the shortest of the \u003cem\u003eHba\u003c/em\u003e deletions, and to confirm the previous estimate of the deletion size, offspring from interspecific crosses between the \u003cem\u003eM. m. musculus\u003c/em\u003e (B6.SEC) deletion and \u003cem\u003eM. m. castaneous\u003c/em\u003e (CAST) were generated to increase genetic differences. For the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion, marker D11Mit53 (mapping to 18.86 cM on GRCm39) is deleted, while D11Mit172 (16.32 cM), D11Mit173 (19.32 cM), and D11Mit186 (20.262 cM) are present on the deletion chromosome (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhysical length estimation of\u003c/b\u003e \u003cb\u003eHba\u003c/b\u003e\u003csup\u003e\u003cb\u003eb2(th)\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eWhole-genome sequencing of DNA from (B6.SEC-\u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e x CAST)F1 mice allowed for further estimation of the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion boundaries. Haplotype analysis by Lumpy provided four candidate deletion edges at mm39-MMU11:31\u0026rsquo;690,316 or 31\u0026rsquo;836,857 (upstream), and mm39-MMU11:32\u0026rsquo;243,280 or 32\u0026rsquo;286,351 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, blue lines) surrounding the hemoglobin alpha complex. In-depth PCR-based analysis and sequencing of potentially deleted genes revealed that the upstream edge of the deletion lies between biorientation of chromosomes in cell division 1 (\u003cem\u003eBod1\u003c/em\u003e) and cytoplasmic polyadenylation element binding protein 4 (\u003cem\u003eCpeb4\u003c/em\u003e), while the downstream edge lies between hemoglobin, theta 1B (\u003cem\u003eHbq1b\u003c/em\u003e) and \u003cem\u003eHba-a2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, purple and red lines). This shows that the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion is between 31.7Mb and 32.2Mb, encompassing eleven known protein-coding genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003eThe alpha-thalassemia phenotype in\u003c/strong\u003e \u003cstrong\u003eHba\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eb2(th)\u003c/strong\u003e\u003c/sup\u003e \u003cstrong\u003emice is not due to deletion of both\u003c/strong\u003e \u003cstrong\u003eHba\u003c/strong\u003e \u003cstrong\u003egenes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevious studies analyzing DNA using Southern blots and amino acid sequences of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e heterozygous mice concluded that the deletion spans both the \u003cem\u003eHba-a1\u003c/em\u003e and \u003cem\u003eHba-a2\u003c/em\u003e genes (Popp et al. \u003cspan class=\"CitationRef\"\u003e1979\u003c/span\u003e; Whitney et al. \u003cspan class=\"CitationRef\"\u003e1981\u003c/span\u003e). The methods used in the earlier analysis have sensitivity limitations in amino acid detection and lack DNA loading controls. Phenotypic analysis of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e heterozygous mice shows similar hematological alterations to those in humans with \u0026alpha;-thalassemia minor (Popp and Enlow \u003cspan class=\"CitationRef\"\u003e1977\u003c/span\u003e; Whitney et al. \u003cspan class=\"CitationRef\"\u003e1981\u003c/span\u003e), which is a result of deletions or other mutations in two of the four alpha-globin alleles (either in \u003cem\u003ecis\u003c/em\u003e or \u003cem\u003etrans\u003c/em\u003e) (Tesio and Bauer \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). We demonstrate here that the coding sequence of \u003cem\u003eHba-a2\u003c/em\u003e is not deleted. Therefore, the lack of expression of this gene is likely due to a disruption in its regulation. Considering the closest gene upstream of \u003cem\u003eHba-a2\u003c/em\u003e, \u003cem\u003eHbq1b\u003c/em\u003e, is deleted, it is reasonable to hypothesize that the deletion of the \u003cem\u003eHba-a2\u003c/em\u003e promoter region causes the lack of expression. The deletion edges indicated by Lumpy analysis suggest a boundary approximately 3 kilobases (kb) upstream of the first exon of \u003cem\u003eHba-a2\u003c/em\u003e. This region contains histone modifications and transcription factor binding sites that are likely important regulators of the expression of this gene (Oudelaar et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Furthermore, the expression of alpha globin genes is highly regulated by a super-enhancer region within an intron of \u003cem\u003eNprl3\u003c/em\u003e (Hay et al. \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e), which lies within the deletion boundaries. Our results suggest that the phenotype observed in \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e mice resembles more closely that of human \u0026alpha;-thalassemia cases involving mutations in the regulatory region rather than mutations in the alpha globin genes themselves (Hatton et al. \u003cspan class=\"CitationRef\"\u003e1990\u003c/span\u003e; Kalle Kwaifa, Lai and Md Noor \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sollaino et al. \u003cspan class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene(s) responsible for\u003c/strong\u003e \u003cstrong\u003eHba\u003c/strong\u003e \u003cstrong\u003edeletion homozygous peri-implantation lethality\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter confirming that \u003cem\u003eEgfr\u003c/em\u003e is not deleted and is therefore not responsible for peri-implantation lethality, we created a list of all protein-coding genes within the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion using resources available from the MGI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.informatics.jax.org/\u003c/span\u003e\u003c/span\u003e). Gene-specific knockout phenotypes annotated by the International Mouse Phenotyping Consortium (IMPC, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.mousephenotype.org)(Groza et al. 2022)\u003c/span\u003e\u003c/span\u003e, along with other phenotypes reported in the literature, indicated that \u003cem\u003eSnrnp25\u003c/em\u003e is the most likely candidate gene for the peri-implantation lethal phenotype observed in \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e homozygous embryos (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eProtein-coding genes deleted in the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e chromosome.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"6\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eStart\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eEnd\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSymbol\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eIMPC report\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eOther phenotypes\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e31822211\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e31885634\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCpeb4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCytoplasmic polyadenylation element binding protein 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEarly adult lethality\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e31915592\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e31929651\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e4930524B15Rik\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRIKEN cdna 4930524B15 gene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot significant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e31950463\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32009202\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eNsg2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNeuron specific gene family member 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot significant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32137541\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32150279\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eIl9r\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInterleukin 9 receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot significant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" class=\"fr-cell-handler \" style=\"background-color: rgb(209, 213, 216);\"\u003e\n \u003cp\u003e32155415\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"background-color: rgb(209, 213, 216);\"\u003e\n \u003cp\u003e32158984\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"background-color: rgb(209, 213, 216);\"\u003e\n \u003cp\u003e\u003cem\u003eSnrnp25\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"background-color: rgb(209, 213, 216);\"\u003e\n \u003cp\u003eSmall nuclear ribonucleoprotein 25 (U11/U12)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"background-color: rgb(209, 213, 216);\"\u003e\n \u003cp\u003eNot phenotyped\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" class=\"fr-cell-fixed \" style=\"background-color: rgb(209, 213, 216);\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32159585\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32172300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eRhbdf1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRhomboid 5 homolog 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEarly adult lethality\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32176505\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32182700\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMpg\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN-methylpurine-DNA glycosylase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot significant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32181963\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32217707\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eNprl3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNitrogen permease regulator-like 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot phenotyped\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eE15.5-18.5 lethality (Kowalczyk et al. \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32226600\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32228116\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHba-x\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHemoglobin X, alpha-like embryonic chain in Hba complex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot phenotyped\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEmbryonic lethal in some genetic backgrounds, viable in others (Leder et al. \u003cspan class=\"CitationRef\"\u003e1997\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32233672\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32234486\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHba-a1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHemoglobin alpha, adult chain 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot phenotyped\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHomozygous knockout viable (Leder et al. \u003cspan class=\"CitationRef\"\u003e1997\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32236965\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32237784\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHbq1b\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHemoglobin, theta 1B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNot phenotyped\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eOf all the genes within the deleted region, only two lack previously reported knockout phenotypes: \u003cem\u003eHbq1b\u003c/em\u003e and \u003cem\u003eSnrnp25\u003c/em\u003e. The role and expression pattern of \u003cem\u003eHbq1b\u003c/em\u003e are not well studied in mouse models. Expression analysis indicates this gene is first expressed during mouse gastrulation (Baldarelli et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Similarly, human analyses show that this gene begins to be expressed during embryonic development after the expression of the fetal HBA subunit, HBZ (ortholog to mouse \u003cem\u003eHba-x\u003c/em\u003e), starts to decrease. The gradual switch from fetal to adult hemoglobin occurs during E10-14 of mouse development (Albitar et al. \u003cspan class=\"CitationRef\"\u003e1992\u003c/span\u003e; Fantoni, de la Chapelle and Marks \u003cspan class=\"CitationRef\"\u003e1969\u003c/span\u003e), long after the lethality of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e homozygous embryos.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSnrnp25\u003c/em\u003e codes for a core protein in the U12-dependent (minor) spliceosomal complex (Will et al. \u003cspan class=\"CitationRef\"\u003e2004\u003c/span\u003e). While only found in a very small proportion of genes in the mouse genome, U11/12-type introns are enriched in genes involved in genetic information processing (Turunen et al. \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). Additionally, mutations in components of the minor spliceosome have been shown to be involved in disease and cancer progression (Verma et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). In the active spliceosome, SNRNP25 heterodimerizes with other proteins in the complex, like SNRNP35 and programmed cell death 7 (PDCD7) (Zhao et al. \u003cspan class=\"CitationRef\"\u003e2025\u003c/span\u003e). According to the IMPC, homozygous knockout of \u003cem\u003ePdcd7\u003c/em\u003e results in an embryonic lethal phenotype before embryonic day 9.5 (Baldarelli et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although there are no reported mammalian knockouts, \u003cem\u003eSnrnp25\u003c/em\u003e, like \u003cem\u003eSnrnp35\u003c/em\u003e and \u003cem\u003ePdcd7\u003c/em\u003e, is expressed as early as the one-cell stage (Baldarelli et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e), and knockdown of the gene in zebrafish, as well as knockdown of U12 splicing, leads to early embryonic death (K\u0026ouml;nig et al. \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e; Pei et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eIn conclusion, we have defined the boundaries that encompass the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion and confirmed that the coding sequence for \u003cem\u003eHba-a2\u003c/em\u003e is not deleted, thus demonstrating that the alpha-thalassemic phenotype observed in these mice is likely due to disruptions in regulatory sequences. Furthermore, we have identified \u003cem\u003eSnrnp25\u003c/em\u003e as the likely gene essential for mammalian peri-implantation embryonic development within the \u003cem\u003eHba\u003c/em\u003e deletions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eD.W.T and T.M generated the crosses and performed the molecular analyses, A.E.H. sequenced the DNA samples, A.M.V-E. analyzed the sequence data., and D.W.T and W.M.V-E. wrote the main manuscript text. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank the Texas A\u0026amp;M AgriLife Research Genomics and Bioinformatics Service for generating the genome sequences, Dr. Barry Whitney (Medical College of Georgia) for the Hbath-J samples, and Dr. Ray Popp (Oak Ridge National Laboratory) for the Hbab2(th) and Hbab3(th) samples.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData is provided within the manuscript or supplementary information files.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlbitar M, Care A, Peschle C, Liebhaber SA (1992) Developmental Switching of Messenger RNA Expression From the Human α-Globin Cluster: Fetal/Adult Pattern of θ-Globin Gene Expression. Blood 80:1586\u0026ndash;1591\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrews S (2010) A quality control tool for high throughput sequence data\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldarelli RM, Smith CL, Ringwald M, Richardson JE, Bult CJ (2024) Mouse Genome Informatics: an integrated knowledgebase system for the laboratory mouse. Genetics 227\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldarelli RM, Smith CM, Finger JH, Hayamizu TF, McCright IJ, Xu J, Shaw DR, Beal JS, Blodgett O, Campbell J, Corbani LE, Frost PJ, Giannatto SC, Miers DB, Kadin JA, Richardson JE, Ringwald M (2021) The mouse Gene Expression Database (GXD): 2021 update. Nucleic Acids Res 49:D924\u0026ndash;d931\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehzadian MA, Whitney JB, Black M, Maghsoudlou S (1990) EGF receptor expression in a mouse model with a homozygous lethal. J Cell Biochem suppl 14E:69\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehzadian MA, Whitney JB, McCool D (1993) Establishment and characterization of embryonic stem cells from an a-thalassemic mouse model with a homozygous lethal deletion. 252a\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114\u0026ndash;2120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCopeland NG, Jenkins NA, Gilbert DJ, Eppig JT, Maltais LJ, Miller JC, Dietrich WF, Weaver A, Lincoln SE, Steen RG, Stein LD, Nadeau JH, Lander ES (1993) A Genetic Linkage Map of the Mouse: Current Applications and Future Prospects. Science 262:57\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Aberle SB (1927) A study of the hereditary anaemia of mice. Am J Anat 40:219\u0026ndash;249\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ (2011) A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 43:491\u0026ndash;498\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDietrich WF, Miller J, Steen R, Merchant MA, Damron-Boles D, Husain Z, Dredge R, Daly MJ, Ingalls KA, O'Connor TJ (1996) A comprehensive genetic map of the mouse genome. Nature 380:149\u0026ndash;152\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFantoni A, de la Chapelle A, Marks PA (1969) Synthesis of Embryonic Hemoglobins during Erythroid Cell Development in Fetal Mice. J Biol Chem 244:675\u0026ndash;681\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGroza T, Gomez FL, Mashhadi HH, Mu\u0026ntilde;oz-Fuentes V, Gunes O, Wilson R, Cacheiro P, Frost A, Keskivali-Bond P, Vardal B, McCoy A, Cheng TK, Santos L, Wells S, Smedley D, Mallon A-M, Parkinson H (2022) The International Mouse Phenotyping Consortium: comprehensive knockout phenotyping underpinning the study of human disease. Nucleic Acids Res 51:D1038\u0026ndash;D1045\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHatton CS, Wilkie AO, Drysdale HC, Wood WG, Vickers MA, Sharpe J, Ayyub H, Pretorius IM, Buckle VJ, Higgs DR (1990) Alpha-thalassemia caused by a large (62 kb) deletion upstream of the human alpha globin gene cluster. Blood 76:221\u0026ndash;227\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHay D, Hughes JR, Babbs C, Davies JOJ, Graham BJ, Hanssen LLP, Kassouf MT, Oudelaar AM, Sharpe JA, Suciu MC, Telenius J, Williams R, Rode C, Li P-S, Pennacchio LA, Sloane-Stanley JA, Ayyub H, Butler S, Sauka-Spengler T, Gibbons RJ, Smith AJH, Wood WG, Higgs DR (2016) Genetic dissection of the α-globin super-enhancer in vivo. Nat Genet 48:895\u0026ndash;903\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHendrey J, Lin D, Dziadek M (1995) Developmental analysis of the Hba(th-J) mouse mutation: effects on mouse peri-implantation development and identification of two candidate genes. Dev Biol 172:253\u0026ndash;263\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalle Kwaifa I, Lai MI, Md Noor S (2020) Non-deletional alpha thalassaemia: a review. Orphanet J Rare Dis 15:166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol 30:772\u0026ndash;780\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026ouml;nig H, Matter N, Bader R, Thiele W, M\u0026uuml;ller F (2007) Splicing Segregation: The Minor Spliceosome Acts outside the Nucleus and Controls Cell Proliferation. Cell 131:718\u0026ndash;729\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKowalczyk MS, Hughes JR, Babbs C, Sanchez-Pulido L, Szumska D, Sharpe JA, Sloane-Stanley JA, Morriss-Kay GM, Smoot LB, Roberts AE, Watkins H, Bhattacharya S, Gibbons RJ, Ponting CP, Wood WG, Higgs DR (2012) Nprl3 is required for normal development of the cardiovascular system. Mamm Genome 23:404\u0026ndash;415\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLayer RM, Chiang C, Quinlan AR, Hall IM (2014) LUMPY: a probabilistic framework for structural variant discovery. Genome Biol 15:R84\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeder A, Daugherty C, Whitney B, Leder P (1997) Mouse ζ- and α-Globin Genes: Embryonic Survival, α-Thalassemia, and Genetic Background Effects. Blood 90:1275\u0026ndash;1282\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H (2013) Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNathan DG, Gunn RB (1966) Thalassemia: the consequences of unbalanced hemoglobin synthesis. Am J Med 41:815\u0026ndash;830\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOudelaar AM, Beagrie RA, Kassouf MT, Higgs DR (2021) The mouse alpha-globin cluster: a paradigm for studying genome regulation and organization. Curr Opin Genet Dev 67:18\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePei W, Xu L, Huang SC, Pettie K, Idol J, Rissone A, Jimenez E, Sinclair JW, Slevin C, Varshney GK, Jones M, Carrington B, Bishop K, Huang H, Sood R, Lin S, Burgess SM (2018) Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues. npj Regenerative Med 3:11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePopp RA, Bradshaw BS, Skow LC (1980) Effects of Alpha Thalassemia on Mouse Development. Differentiation 17:205\u0026ndash;210\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePopp RA, Enlow MK (1977) Radiation-Induced a-Thalassemia in Mice. Am J Vet Res 38:569\u0026ndash;572\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePopp RA, Stratton LP, Hawley DK, Effron K (1979) Hemoglobin of mice with radiation-induced mutations at the hemoglobin loci. J Mol Biol 127:141\u0026ndash;148\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoutman E, Cheverud J (1994) A rapid method of scoring simple sequence repeat polymorphisms with agarose gel electrophoresis. Mamm Genome 5:187\u0026ndash;188\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell LB, Russell WL, Popp RA, Vaughan C, Jacobson KB (1976a) Radiation-induced mutations at mouse hemoglobin loci. Proceedings of the National Academy of Sciences 73, 2843\u0026ndash;2846\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell LB, Russell WL, Popp RA, Vaughan CM, Jacobson KB (1976b) Radiation-induced mutations at mouse hemoglobin loci. Proc Natl Acad Sci USA 73:2843\u0026ndash;2846\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilver J, Whitney JB 3rd, Kozak C, Hollis G, Kirsch I (1985) Erbb is linked to the alpha-globin locus on mouse chromosome 11. Mol Cell Biol 5:1784\u0026ndash;1786\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSollaino MC, Paglietti ME, Loi D, Congiu R, Podda R, Galanello R (2010) Homozygous deletion of the major alpha-globin regulatory element (MCS-R2) responsible for a severe case of hemoglobin H disease. Blood 116:2193\u0026ndash;2194\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor JM, Dozy A, Kan YW, Varmus HE, Lei-Injo LE, Ganesan J, Todd D (1974) Genetic lesion in homozygous a-thalassemia (hydrops fetalis). Nature 251:392\u0026ndash;393\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTesio N, Bauer DE (2023) Molecular Basis and Genetic Modifiers of Thalassemia. Hematol Oncol Clin N Am 37:273\u0026ndash;299\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThreadgill DW, Yee D, Thompson C, Magnuson T (1994) Epidermal Growth Factor Receptor Is Required for Survival of the Peri-implantation Mouse Embryo. Submitted\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurunen JJ, Niemel\u0026auml; EH, Verma B, Frilander MJ (2013) The significant other: splicing by the minor spliceosome. Wiley Interdiscip Rev RNA 4:61\u0026ndash;76\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerma B, Akinyi MV, Norppa AJ, Frilander MJ (2018) Minor spliceosome and disease. Semin Cell Dev Biol 79:103\u0026ndash;112\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeatherall DJ, Clegg JB (1972) The thalassemia syndromes, 2nd edn. Blackwell Scientific Publishers Ltd, Oxford, England\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitney JB, Martinell J, Popp RA, Russell LB, Anderson WF (1981) Deletions in the a-Globin Gene Complex in a-Thalassemic Mice. Proc. Natl. Acad. Sci. USA 78, 7644\u0026ndash;7647\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitney JB, Russell ES (1978) Mouse News Letter 58:47\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitney JB, Russell ES (1980) Linkage of genes for adult a-globin and embryonic a-like globin chains. Proc Natl Acad Sci USA 77:1087\u0026ndash;1090\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWill CL, Schneider C, Hossbach M, Urlaub H, Rauhut R, Elbashir S, Tuschl T, L\u0026uuml;hrmann R (2004) The human 18S U11/U12 snRNP contains a set of novel proteins not found in the U2-dependent spliceosome. RNA 10:929\u0026ndash;941\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Peter D, Brandina I, Liu X, Galej WP (2025) Structural basis of 5\u0026prime; splice site recognition by the minor spliceosome. Mol Cell 85:652\u0026ndash;664e654\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"mammalian-genome","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mage","sideBox":"Learn more about [Mammalian Genome](http://link.springer.com/journal/335)","snPcode":"335","submissionUrl":"https://submission.nature.com/new-submission/335/3","title":"Mammalian Genome","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"embryonic lethal, deletion complex, mouse model, thalassemia","lastPublishedDoi":"10.21203/rs.3.rs-6335781/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6335781/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMutations in adult hemoglobin alpha genes in humans lead to blood disorders commonly known as α-thalassemia. In search of a mouse model for this disease, mutagenesis screens have identified several deletions that resemble these phenotypes. The \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion, in particular, replicates the characteristics of alpha-thalassemia minor in heterozygous mice but presents a homozygous embryonic lethal phenotype. Previous analyses of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e mice suggested that the deletion affects both \u003cem\u003eHba\u003c/em\u003e genes (\u003cem\u003eHba-a1\u003c/em\u003e and \u003cem\u003eHba-a2\u003c/em\u003e) and considered epidermal growth factor receptor (\u003cem\u003eEgfr\u003c/em\u003e) or rhomboid 5 homolog 1 (\u003cem\u003eRhbdf1\u003c/em\u003e) to be responsible for the embryonic lethality. Molecular analysis of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e revealed a deletion spanning a 1cM region of mouse chromosome 11. Importantly, the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion does not extend to \u003cem\u003eEgfr\u003c/em\u003e, indicating that the observed lethality of homozygous embryos is not due to the loss of \u003cem\u003eEgfr\u003c/em\u003e. Sequence analysis of the \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e deletion showed that the \u003cem\u003eHba-a2\u003c/em\u003e gene is not deleted, but the lack of expression is likely due to the disruption of upstream regulatory regions. Furthermore, we identify \u003cem\u003eSnrnp2\u003c/em\u003e5, which codes for the small nuclear ribonucleoprotein 25 (U11/U12), as the candidate gene most likely responsible for the peri-implantation lethality of \u003cem\u003eHba\u003c/em\u003e\u003csup\u003e\u003cem\u003eb2(th)\u003c/em\u003e\u003c/sup\u003e homozygous mice. These findings enhance the understanding of the genetic mechanisms underlying α-thalassemia and provide insights into novel genes essential for early mammalian development.\u003c/p\u003e","manuscriptTitle":"Snrnp25 is a candidate for the peri-implantation lethal phenotype of the Hba deletions","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-22 13:34:26","doi":"10.21203/rs.3.rs-6335781/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-22T14:06:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-22T02:02:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-17T09:08:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"135582486104235598254783069037453651698","date":"2025-04-03T14:49:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"15531284394548446833605741130116028327","date":"2025-04-02T13:51:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-01T12:38:28+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-01T07:40:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-01T05:02:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Mammalian Genome","date":"2025-03-29T20:00:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"mammalian-genome","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mage","sideBox":"Learn more about [Mammalian Genome](http://link.springer.com/journal/335)","snPcode":"335","submissionUrl":"https://submission.nature.com/new-submission/335/3","title":"Mammalian Genome","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9e2f5ae8-e135-47f1-abfc-a98540048e94","owner":[],"postedDate":"April 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-05-26T16:01:51+00:00","versionOfRecord":{"articleIdentity":"rs-6335781","link":"https://doi.org/10.1007/s00335-025-10133-z","journal":{"identity":"mammalian-genome","isVorOnly":false,"title":"Mammalian Genome"},"publishedOn":"2025-05-21 15:57:46","publishedOnDateReadable":"May 21st, 2025"},"versionCreatedAt":"2025-04-22 13:34:26","video":"","vorDoi":"10.1007/s00335-025-10133-z","vorDoiUrl":"https://doi.org/10.1007/s00335-025-10133-z","workflowStages":[]},"version":"v1","identity":"rs-6335781","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6335781","identity":"rs-6335781","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.