LncRNA-H19 Promotes Adipogenic Differentiation Disorder by Regulating miR-130b-3p/PPARγ Axis in Steroid-induced Osteonecrosis of Femoral Head

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Steroid-induced osteonecrosis of the femoral head (SONFH) represents a frequent and debilitating orthopedic condition. It is widely believed that the adipogenic/osteogenic differentiation disorder of bone marrow mesenchymal stem cells (BMSCs) contributes to the development of SONFH. However, the regulatory mechanism of long non-coding RNAs (lncRNAs) in the differentiation disorder of BMSCs remains elusive. The expression levels of H19 were detected in both femoral head tissues and BMSCs from patients with SONFH. The role of the lncRNA H19 in SONFH was explored through bioinformatics analysis complemented by relevant validation experiments. Our findings revealed that H19 was significantly up-regulated in SONFH tissues as well as BMSCs. Silencing H19 suppressed BMSC adipogenic differentiation in SONFH and the expression of peroxisome proliferator-activated receptor γ (PPARγ). Furthermore, we found that H19 could interact with miR-130b-3p, and miR-130b-3p could directly inhibit PPARγ expression. In conclusion, this study uncovered that abnormally up-regulated H19 leads to abnormal lipogenic differentiation in SONFH by acting as a sponge for miR-130b-3p and upregulating PPARγ.
Full text 95,768 characters · extracted from preprint-html · click to expand
LncRNA-H19 Promotes Adipogenic Differentiation Disorder by Regulating miR-130b-3p/PPARγ Axis in Steroid-induced Osteonecrosis of Femoral Head | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncRNA-H19 Promotes Adipogenic Differentiation Disorder by Regulating miR-130b-3p/PPARγ Axis in Steroid-induced Osteonecrosis of Femoral Head Feifei Lin, Min Yi, Shicheng Zhou, Qingyu Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4085453/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Steroid-induced osteonecrosis of the femoral head (SONFH) represents a frequent and debilitating orthopedic condition. It is widely believed that the adipogenic/osteogenic differentiation disorder of bone marrow mesenchymal stem cells (BMSCs) contributes to the development of SONFH. However, the regulatory mechanism of long non-coding RNAs (lncRNAs) in the differentiation disorder of BMSCs remains elusive. The expression levels of H19 were detected in both femoral head tissues and BMSCs from patients with SONFH. The role of the lncRNA H19 in SONFH was explored through bioinformatics analysis complemented by relevant validation experiments. Our findings revealed that H19 was significantly up-regulated in SONFH tissues as well as BMSCs. Silencing H19 suppressed BMSC adipogenic differentiation in SONFH and the expression of peroxisome proliferator-activated receptor γ (PPARγ). Furthermore, we found that H19 could interact with miR-130b-3p, and miR-130b-3p could directly inhibit PPARγ expression. In conclusion, this study uncovered that abnormally up-regulated H19 leads to abnormal lipogenic differentiation in SONFH by acting as a sponge for miR-130b-3p and upregulating PPARγ. Steroid-induced osteonecrosis of the femoral head H19 miR-130b-3p PPARγ Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Steroid-induced osteonecrosis of the femoral head (SONFH) represents a progressive and destructive orthopaedic disorder that is induced by long-term and high-dose administration of glucocorticoids (GCs) (Li et al. 2018 ; Fu et al. 2019 ; Xu et al. 2023 ). Within the collapsed femoral head, there is a notable replacement of bone tissue with adipose tissue, leading to the formation of cystic changes. BMSCs with augmented adipogenic potential not only forfeit their reparative capacity, but this also culminates in the catastrophic accumulation of adipocytes and an increased intraosseous pressure within the femoral head, further exacerbating the progression of SONFH(Chen et al. 2016 ; Jiang et al. 2023 ). Our previous research has revealed that the disorder in adipogenic and osteogenic differentiation of BMSCs plays a crucial role in the occurrence and development of SONFH (Wang et al. 2018a ). However, the detailed molecular regulatory mechanisms remain unclear. LncRNAs play a pivotal role in the epigenetic regulation, employing mechanisms such as signal transduction, decoy, guidance, and scaffolding (Zhang et al. 2018 ; Mirzadeh Azad et al. 2021 ). H19 was the pioneering lncRNA to be discovered and possesses a multitude of diverse biological functions, participating in the regulation of cellular proliferation, differentiation, and metabolism (Wang et al. 2018b ). H19 plays significant functional roles in regulating osteogenic differentiation. The expression levels of H19 fluctuate throughout the various stages of osteogenic differentiation. The osteogenic differentiation of human adipose-derived stem cells (hASCs) is facilitated by the suppression of H19 expression, which consequently leads to the increased expression of pro-osteogenic genes (Zhou et al. 2021 ). Moreover, the overexpression of H19 contributes to the downregulation of pro-osteogenic genes (Huang et al. 2017 ) and promotes steatosis, as well as augmenting lipid accumulation (Liu et al. 2018 ). This scenario seems akin to the diminished osteogenic differentiation and augmented adipogenic dysregulation of BMSCs in SONFH, yet the regulatory role of H19 in this context remains to be elucidated. In our current research, we conducted a systematic investigation to explore the functional significance of H19 in SONFH. Our research discovered that H19 was significantly overexpressed in both BMSCs and the lesion tissues of SONFH patients. Suppression of H19 inhibits PPARγ expression and reduces adipogenic differentiation by directly up-regulating miR-130b-3p. Additionally, our data offer an innovative perspective on the regulatory role of H19 in SONFH, suggesting that H19 could be a potential therapeutic target for the treatment of SONFH. Materials and Methods Patient Specimens Eight patients with SONFH (1 males and 7 females, with the age of 50 to 74 years old and the mean age of 59.6 ± 7.5 years old) and eight patients with femoral neck fracture (FNF) (2 males and 6 females, with the age of 57 to 84 years old and the mean age of 75.0 ± 8.0 years old) were enrolled from the Department of Orthopedics, the Second Hospital of Jilin University, China from January 2023 to October 2023. Specimens from patients with SONFH and control subjects with FNF were all obtained from patients undergoing total hip arthroplasty (THA). The diagnosis of SONFH was confirmed preoperatively using radiographs and magnetic resonance imaging (MRI), adhering to the ARCO classification system (Moya-Angeler et al. 2015 ). Steroid-induced osteonecrosis was defined by a history of taking a mean daily dose of 16.6mg or an equivalent maximum daily dose of 80mg of prednisolone within 1 year (Koo et al. 2002 ; Zhang et al. 2014 ). Patients with concomitant congenital diseases, those who consumed alcohol, or had tumor-related illnesses were excluded from the study. Additionally, none of the patients were on any medications known to affect bone metabolism. The demographic and clinical characteristics of the patients included in this study are summarized in Table 1 . The study was approved by the ethics committee of the Second Hospital of Jilin University, China [(2018)291]. Written informed consent was obtained from all participants for the use of their specimens, and all methods involved were conducted in accordance with the guidelines approved by the Ethics Committee of the Second Hospital of Jilin University. Table 1 Characteristics of the patients in this study SONFH (n = 8) FNF (n = 8) P Age (years) 62.1 ± 7.2 70.0 ± 7.6 0.067 Gender (M/F) 1/7 2/6 ----- CRP (mg/dL) 2.1 ± 1.3 29.6 ± 32.8 0.044 ESR (mm/h) 13.9 ± 18.45 30.25 ± 21.5 0.072 BMI (kg/m 2 ) 25.5 ± 2.8 23.1 ± 2.1 0.096 ARCO (III/IV) 2/ 6 ----- ----- Femoral head collapse (mm) 9.6 ± 2.6 ----- ----- Harris score 59.2 ± 4.6 ----- ----- CRP, C-reaction protein; ESR, erythrocyte sedimentation rate; BMI, Body Mass Index;ARCO, Association Research Circulation Osseous. BMSC isolation and culture BMSCs were isolated from the bone marrow of patients' proximal femurs using density gradient centrifugation (Colter et al. 2000 ). The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; GIBCO, NY, USA), supplemented with 10% fetal bovine serum (GIBCO), and incubated at 37°C with 5% CO2. The culture medium was replenished every three days. Upon reaching 90% confluence, the BMSCs were trypsinized and subcultured into new plates. The cells were expanded and utilized for experiments at passage 3. RNA extraction Total RNA was extracted using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer's instructions. The concentration of RNA was then quantified using the Agilent ND-1000. Cell transfection The human H19 shRNA vector (sh-H19), overexpression vector (ov-H19), miR-130b-3p mimic and inhibitor were purchased from GenePharma (Shanghai, China). Lipofectamine 3000 (Thermo Fisher Scientific) was used for cell transfection in accordance with the manufacturer's instructions. Cells were harvested 48 hours post-transfection for RT-qPCR analysis, with each experiment being conducted in triplicate. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan), following the manufacturer’s guidelines. qRT-PCR was s performed using FastStart Universal SYBR Green Master (ROX) (Roche, Basel, Germany) on an Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems), adhering to the provided protocol. Data were normalized against the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the relative expression levels of each gene were calculated using the 2 −ΔΔCt method. All experiments were conducted in triplicate. The primer sequences utilized in this study are listed in the Table 2 . Table 2 Primers used for real-time RT-PCR analysis Gene Primer sequences H19-F 5’- TCTGGCAGGAGTGATGACGG − 3’ H19-R 5’- CAGGAGAGTTAGCAAAGGTG − 3’ PPARγ-F 5’- GAGCCCAAGTTTGAGTTTGC-3’ PPARγ-R 5’- CTGTGAGGACTCAGGGTGGT-3’ GAPDH-F 5’- CGGACCAATACGACCAAATCCG-3’ GAPDH-R 5’- AGCCACATCGCTCAGACACC-3’ miR-130b-3p-F 5’- GGGCAGTGCAATGATGAAA − 3’ miR-130b-3p-R 5’- ACAGACCCAGCCAACAAATA − 3’ U6-F 5’- GCTTCGGCAGCACATATACTAAAAT − 3’ U6-R 5’- CGCTTCACGAATTTGCGTGTCAT − 3’ GAPDH, glyceraldehyde-3-phosphate dehydrogenase Osteogenic and adipogenic differentiation Osteogenic differentiation was induced by culturing BMSCs in an osteogenic medium supplemented with 10% FBS, 0.1 µmol/L dexamethasone, 10 µmol/L β-glycerophosphate, 10 µmol/L glutamine, and 50 µg/mL ascorbate (Cyagen Biosciences, Guangzhou, China). For adipogenic differentiation, BMSCs were cultured in an adipogenic medium containing 10% FBS, 1 µmol/L dexamethasone, 100 µg/mL 3-isobutyl-1-methylxanthine, 2µg/L insulin, 1 µmol/L rosiglitazone, and 10 µmol/L glutamine (Cyagen). Oil Red O staining and quantification Oil Red O (Beyotime) staining was used to evaluate intracellular lipid accumulation following adipogenic differentiation. Cells were fixed in 4% neutral buffered formalin for 30 minutes and subsequently washed with 3% isopropanol, incubated with freshly filtered Oil Red O staining solution for 1 hour, and then rinsed with double-distilled H2O. For quantitative analysis, isopropyl alcohol was added to the stained culture dishes, and the optical density (OD) values were measured at 490nm. ImageJ software was utilized to enumerate the cells exhibiting Oil Red O staining. Bioinformatics analysis The lncRNA-miRNA interactions were predicted using Diana tools (Karagkouni et al. 2020 ) and StarBase (Li et al. 2014 ). miRNA interaction with mRNAs was predicted using miRWalk (Sticht et al. 2018 ) and StarBase. The regulatory pattern diagram was crafted utilizing Figdraw. Statistical analysis The data were presented as the mean ± standard deviation. All statistical analyses were performed using SPSS version 20.0 software (SPSS, Inc., Chicago, IL, USA). Comparisons between groups were performed using unpaired Student’s t-test. Statistical significance was set at P < 0.05. Results H19 are upregulated in the lesions of the femoral head and BMSCs from SONFH patients The X-ray imaging of SONFH patient at ARCO stage V revealed alterations in the morphology of the femoral head, characterized by collapse and flattening, as well as radiographic signs indicative of hip osteoarthritis (Fig. 1A). During THA, we meticulously harvested the femoral head from SONFH patients, carefully extracting tissue from osteonecrosis zone (Fig. 1B). The femoral head bone tissue of FNF patients served as the control group for our study. During surgeries for SONFH and FNF, bone marrow was collected and BMSCs were subsequently extracted and cultured. The morphological appearance of BMSCs derived from SONFH patients is depicted in Fig. 1C. Furthermore, the expression levels of H19 and PPARγ were found to be abnormally and significantly upregulated in the femoral head tissues (Fig. 1D) and BMSCs (Fig. 1E) of SONFH patients. H19 participates in increased adipogenic of BMSCs and positively regulates PPARγ expression in SONFH To investigate the regulatory role of H19, we performed H19 knockdown using H19-specific shRNA in BMSCs isolated from SONFH patients. Following transfection with the H19 shRNA vector, there was a significant downregulation of H19 expression (Fig. 2A), and the adipogenic capacity of BMSCs derived from SONFH patients was reduced (Fig. 2B). This trend was further corroborated by quantitative analysis of Oil Red O staining, revealing that on days 10 and 14 post-adipogenic induction, the staining intensity in the SONFH group was notably less than that of the control group. (Fig. 2C, D). The expression levels of both H19 and PPARγ were concurrently reduced within a week subsequent to the knockdown of H19 (Fig. 2E). H19 can act as a miR-130b-3p sponger and PPARγ can be directly targeted by miR-130b-3p As is well-established, lncRNAs can serve as miRNA “sponges” that inhibit interaction with their miRNA targets in post-transcriptional regulation. Utilizing the StarBase and DIANA tools, we predicted the binding microRNAs of H19, while the binding microRNAs of PPARγ were forecasted using StarBase and miRWalk. The ultimate intersecting set included miR-301b-3p, miR-130b-3p, and miR-130a-3p (Fig. 3A). To confirm whether H19 regulates the expression of these candidates, we carried out qRT-PCR analysis in H19-silenced BMSCs. The results revealed that only miR-130b-3p exhibited a significant upregulation subsequent to the reduced expression of H19 (Fig. 3B). The binding site of miR-130b-3p with H19 and PPARγ was shown in Fig. 3C. In order to validate the molecular sponging effect of H19, we conducted rescue experiments. The expression of PPARγ was significantly diminished when H19 was knocked down. This decrease in PPARγ expression could be effectively reversed by co-transfection with an inhibitor of miR-130b-3p (Fig. 3D). The expression of PPARγ was significantly increased when H19 was overexpressed. This rise in PPARγ expression could be counteracted by co-transfecting with miR-130b-3p mimics (Fig. 3E). The regulatory effect of H19 in SONFH-BMSCs was shown in Fig. 4. Discussion The misuse of steroid hormones is one of the primary factors contributing to femoral head necrosis (Wang et al. 2018c; Huang et al. 2021). Steroid-induced endothelial dysfunction leads to the disruption of blood supply to the femoral head, which progressively results in the robust upregulation of osteoclast-related proteins and localized bone tissue ischemia and necrosis (Maruyama et al. 2018; Chen et al. 2020). The destruction of bone cells, coupled with the imbalance between osteogenesis and osteoclasis activities, ultimately leads to the degradation and collapse of the bone structure (Piuzzi et al. 2019). During this process, the disruption of the differentiation equilibrium in BMSCs represents a substantial pathological change (Powell et al. 2011; Chang et al. 2020). BMSCs with enhanced adipogenic potential not only forfeit their reparative capacity but also culminate in the catastrophic accumulation of adipocytes and increased intraosseous pressure within the femoral head, further exacerbating the progression of SONFH. In-depth investigations into the mechanisms underlying the differentiation disorder of SONFH-BMSCs are pivotal for a more comprehensive understanding of the pathogenesis of SONFH. LncRNAs play an essential role in epigenetic regulation, employing mechanisms such as signal transduction, decoy, guidance, and scaffolding (Wang and Chang 2011; Mirzadeh Azad et al. 2021). In recent years, numerous efforts have been directed toward elucidating the differential expression profiles of various non-coding RNAs (ncRNAs), including lncRNAs and miRNAs, in SONFH-BMSCs (Table 3). Furthermore, a majority of studies have discovered that lncRNAs influence the differentiation lineage of BMSCs by modulating post-transcriptional mRNA levels via the competing endogenous RNA (ceRNA) mechanism. Our previous research conducted a screening of the lncRNA expression profile in human SONFH-BMSCs and hypothesized that the lncRNA MALAT1 could modulate the expression of DKK1, thereby influencing the osteogenic and adipogenic differentiation of BMSCs (Wang et al. 2018a). Wu et al. reported that lncRNA FGD5-AS1 regulates BMSCs proliferation and apoptosis by impacting the miR-296-5p/STAT3 axis in SONFH (Wu et al. 2022). Han et al. demonstrated that H19- hsa-miR-519b-3p/hsa-miR-296-5p-ANKH and lncRNA c9orf163- hsa-miR-424-5p-CCNT1 might play important roles in osteonecrosis of the femoral head development (Han and Li 2021). Our study shows H19 promotes the adipogenic differentiation of BMSCs and aggravates the progression of SONFH by miR-130b-3p/PPARγ Axis. As PPARγ is recognized as a transcription factor that facilitates adipogenic differentiation while inhibiting osteogenic differentiation (Cao 2011; Berhouma et al. 2013), our findings substantiated that the dysregulation of H19 contributes to the disruption of the equilibrium between adipogenic and osteogenic differentiation in ONFH, as well as illuminating its regulatory role. These newly identified SONFH-associated lncRNAs offer new insights not only for further elucidating the molecular regulatory mechanisms of SONFH but also for providing novel molecular markers and therapeutic targets for the diagnosis and treatment of femoral head necrosis. Table 3 . Functional characterization of the ncRNAs in SONFH non-coding RNAs Name Expression Functional role Target miRNAs Target genes Sample Reference circRNA circHGF Up suppress proliferation and osteogenic differentiation of BMSCs miR-25-3p SMAD7 hBMSCs (7 Male and 3 Female) (Pan et al. 2021) circRNA circ_0058122 Up increase dex-mediated HUVEC apoptosis miR-7974 IGFBP5 Femoral head tissues (3 Male and 7 Female);HUVECs cells (Yao et al. 2022) LncRNA LINC00473 Down promote osteogenesis and suppress the adipogenesis of BMSCs miR-23a-3p LRP5 hBMSCs (Xu et al. 2022) LncRNA FGD5-AS1 Up promote cell proliferation and restrain apoptosis miR-296-5p/ STAT3 hBMSCs (Wu et al. 2022) LncRNA NORAD Down promotion of proliferation and differentiation, and inhibition of apoptosis miR-26a-5p —— hBMSCs (20 patients) (Fu et al. 2021) LncRNA RP11‐154D6 Down promote BMSCs osteogenic differentiation and inhibit adipogenic differentiation miR‐30a —— hBMSCs (7 patients) (Fu et al. 2021) H19 was the first lncRNA to be identified and possesses a multitude of diverse biological functions, participating in the regulation of cellular proliferation, differentiation, and metabolism (Zhu et al. 2024). Previous studies have shown that H19 is involved in fat accumulation and regulation. The expression of H19 is augmented by fatty acids in hepatocytes and in diet-induced fatty liver, with the overexpression of H19 capable of promoting steatosis and enhancing lipid accumulation (Liu et al. 2018). Although Han et al. proposed a ceRNA network suggesting that H19 could act as a ceRNA for hsa-miR-519b-3p and hsa-miR-296-5p in ANKH (Han and Li 2021), this has yet to be substantiated by relevant experimental validation. In our study, H19 has been found to be aberrantly upregulated in both femoral head tissues and BMSCs. The relationship between H19 and miR-130b has been reported in the regulation of keratinocyte differentiation (Li et al. 2017) and in potentiating the effect of praziquantel on liver function (Ma et al. 2023); however, this relationship has not yet been explored in the context of SONFH. Motivated by these findings, we hypothesized that H19 could exert a regulatory influence on the progression of SONFH by functioning as a sponge for miR-130b-3p. Our investigations revealed that miR-130b-3p expression was increased following H19 knockdown. Additionally, we found an inverse correlation between PPARγ expression and miR-130b-3p levels. Through bioinformatics analysis and rescue experiments, we substantiated that miR-130b-3p could interact with both H19 and PPARγ. Collectively, our results suggest that H19 may modulate PPARγ expression by targeting miR-130b-3p. Previous research has demonstrated that steroids have the capacity to upregulate the expression of PPARγ in both rodent and human BMSCs, thereby fostering adipogenic differentiation (Sheng et al. 2007). Our previous research also identified an association between gene variants of the transcription factor PPARγ and the development of osteonecrosis of the femoral head in the Chinese population. Our previous study found that association of gene variants of transcription factors PPARγ with the development of the femoral head osteonecrosis (Song et al. 2017). Several studies have also reported the abnormal expression and related regulatory effects of PPARγ in osteonecrosis of the femoral head (Zhao et al. 2019; Cui et al. 2022) (Fu et al. 2016). In the current study, discovered that PPARγ expression was notably elevated in both the femoral head tissues and BMSCs of patients with SONFH. Additionally, we found that miR-130b-3p regulates adipogenic differentiation by targeting PPARγ in the context of SONFH. In summary, our findings reveal that elevated H19 expression is a characteristic molecular alteration in SONFH, and that H19 fosters BMSC adipogenic differentiation by enhancing PPARγ activity through the suppression of miR-130b-3p. Collectively, our study substantiates the regulatory function of lncRNAs in the progression of SONFH, positioning H19 as a pivotal and novel molecular target in the disease. There were some limitations of our study. For instance, the number SONFH patients were small, which may have affected the lncRNA and mRNA expression results, more samples are needed to verify. Furthermore, luciferase reporter assays and animal experiments should be performed. Conclusion This study confirmed that the aberrant upregulation of H19 contributes to abnormal adipogenic differentiation in SONFH by functioning as a molecular sponge for miR-130b-3p and subsequently upregulating PPARγ. These findings offer an innovative perspective for the treatment of SONFH. Declarations Acknowledgements Not applicable. Funding This work was financially supported by grants from Department of Science and Technology of Jilin Province (No. YDZJ202201ZYTS278) and Education Department of Jilin Province (No.JJKH20221070KJ). Data Availability The data used to support these findings of this study are included in this study. Competing interests The authors declare that they have no competing interests. References Berhouma R, Kouidhi S, Ammar M, Abid H, Ennafaa H, Benammar-Elgaaied A (2013) Correlation of peroxisome proliferator-activated receptor (PPAR-γ) mRNA expression with Pro12Ala polymorphism in obesity. Biochem Genet 51:256-263. https://doi.org/10.1007/s10528-012-9560-y Cao JJ (2011) Effects of obesity on bone metabolism. J Orthop Surg Res 6:30. https://doi.org/10.1186/1749-799X-6-30 Chang C, Greenspan A, Gershwin ME (2020) The pathogenesis, diagnosis and clinical manifestations of steroid-induced osteonecrosis. J Autoimmun 110:102460. https://doi.org/10.1016/j.jaut.2020.102460 Chen K, Liu Y, He J et al (2020) Steroid-induced osteonecrosis of the femoral head reveals enhanced reactive oxygen species and hyperactive osteoclasts. Int J Biol Sci 16:1888-1900. https://doi.org/10.7150/ijbs.40917 Chen Q, Shou P, Zheng C et al (2016) Fate decision of mesenchymal stem cells: adipocytes or osteoblasts. Cell Death Differ 23:1128-1139. https://doi.org/10.1038/cdd.2015.168 Colter DC, Class R, DiGirolamo CM, Prockop DJ (2000) Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci U S A 97:3213-3218. https://doi.org/10.1073/pnas.97.7.3213 Cui Y, Huang T, Zhang Z et al (2022) The potential effect of BMSCs with miR-27a in improving steroid-induced osteonecrosis of the femoral head. Sci Rep 12:21051. https://doi.org/10.1038/s41598-022-25407-8 Fu Q, Tang NN, Zhang Q et al (2016) Preclinical Study of Cell Therapy for Osteonecrosis of the Femoral Head with Allogenic Peripheral Blood-Derived Mesenchymal Stem Cells. Yonsei Med J 57:1006-1015. https://doi.org/10.3349/ymj.2016.57.4.1006 Fu W, Liu B, Wang B, Zhao D (2019) Early diagnosis and treatment of steroid-induced osteonecrosis of the femoral head. Int Orthop 43:1083-1087. https://doi.org/10.1007/s00264-018-4011-y Han N, Li Z (2021) Non-coding RNA Identification in Osteonecrosis of the Femoral Head Using Competitive Endogenous RNA Network Analysis. Orthop Surg 13:1067-1076. https://doi.org/10.1111/os.12834 Huang C, Wen Z, Niu J, Lin S, Wang W (2021) Steroid-Induced Osteonecrosis of the Femoral Head: Novel Insight Into the Roles of Bone Endothelial Cells in Pathogenesis and Treatment. Front Cell Dev Biol 9:777697. https://doi.org/10.3389/fcell.2021.777697 Huang G, Kang Y, Huang Z et al (2017) Identification and Characterization of Long Non-Coding RNAs in Osteogenic Differentiation of Human Adipose-Derived Stem Cells. Cell Physiol Biochem 42:1037-1050. https://doi.org/10.1159/000478751 Jiang W, Chen Y, Sun M et al (2023) LncRNA DGCR5-encoded polypeptide RIP aggravates SONFH by repressing nuclear localization of β-catenin in BMSCs. Cell Rep 42:112969. https://doi.org/10.1016/j.celrep.2023.112969 Karagkouni D, Paraskevopoulou MD, Tastsoglou S et al (2020) DIANA-LncBase v3: indexing experimentally supported miRNA targets on non-coding transcripts. Nucleic Acids Res 48:D101-D110. https://doi.org/10.1093/nar/gkz1036 Koo KH, Kim R, Kim YS et al (2002) Risk period for developing osteonecrosis of the femoral head in patients on steroid treatment. Clin Rheumatol 21:299-303. https://doi.org/10.1007/s100670200078 Li CX, Li HG, Huang LT et al (2017) H19 lncRNA regulates keratinocyte differentiation by targeting miR-130b-3p. Cell Death Dis 8:e3174. https://doi.org/10.1038/cddis.2017.516 Li JH, Liu S, Zhou H, Qu LH, Yang JH (2014) starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res 42:D92-97. https://doi.org/10.1093/nar/gkt1248 Li Z, Jiang C, Li X et al (2018) Circulating microRNA signature of steroid-induced osteonecrosis of the femoral head. Cell Prolif 51:e12418. https://doi.org/10.1111/cpr.12418 Liu C, Yang Z, Wu J et al (2018) Long noncoding RNA H19 interacts with polypyrimidine tract-binding protein 1 to reprogram hepatic lipid homeostasis. Hepatology 67:1768-1783. https://doi.org/10.1002/hep.29654 Ma R, Liu Q, Liu Z et al (2023) H19/Mir-130b-3p/Cyp4a14 potentiate the effect of praziquantel on liver in the treatment of Schistosoma japonicum infection. Acta Trop 247:107012. https://doi.org/10.1016/j.actatropica.2023.107012 Maruyama M, Nabeshima A, Pan CC et al (2018) The effects of a functionally-graded scaffold and bone marrow-derived mononuclear cells on steroid-induced femoral head osteonecrosis. Biomaterials 187:39-46. https://doi.org/10.1016/j.biomaterials.2018.09.030 Mirzadeh Azad F, Polignano IL, Proserpio V, Oliviero S (2021) Long Noncoding RNAs in Human Stemness and Differentiation. Trends Cell Biol 31:542-555. https://doi.org/10.1016/j.tcb.2021.02.002 Moya-Angeler J, Gianakos AL, Villa JC, Ni A, Lane JM (2015) Current concepts on osteonecrosis of the femoral head. World J Orthop 6:590-601. https://doi.org/10.5312/wjo.v6.i8.590 Piuzzi NS, Anis HK, Muschler GF (2019) Osteonecrosis of the femoral head with subchondral collapse. Cleve Clin J Med 86:511-512. https://doi.org/10.3949/ccjm.86a.19004 Powell C, Chang C, Gershwin ME (2011) Current concepts on the pathogenesis and natural history of steroid-induced osteonecrosis. Clin Rev Allergy Immunol 41:102-113. https://doi.org/10.1007/s12016-010-8217-z Sheng HH, Zhang GG, Cheung WH et al (2007) Elevated adipogenesis of marrow mesenchymal stem cells during early steroid-associated osteonecrosis development. J Orthop Surg Res 2:15. https://doi.org/10.1186/1749-799X-2-15 Song Y, Du Z, Ren M et al (2017) Association of gene variants of transcription factors PPARγ, RUNX2, Osterix genes and COL2A1, IGFBP3 genes with the development of osteonecrosis of the femoral head in Chinese population. Bone 101:104-112. https://doi.org/10.1016/j.bone.2017.05.002 Sticht C, De La Torre C, Parveen A, Gretz N (2018) miRWalk: An online resource for prediction of microRNA binding sites. PLoS One 13:e0206239. https://doi.org/10.1371/journal.pone.0206239 Wang A, Ren M, Wang J (2018c) The pathogenesis of steroid-induced osteonecrosis of the femoral head: A systematic review of the literature. Gene 671:103-109. https://doi.org/10.1016/j.gene.2018.05.091 Wang KC, Chang HY (2011) Molecular mechanisms of long noncoding RNAs. Mol Cell 43:904-914. https://doi.org/10.1016/j.molcel.2011.08.018 Wang Q, Yang Q, Chen G et al (2018a) LncRNA expression profiling of BMSCs in osteonecrosis of the femoral head associated with increased adipogenic and decreased osteogenic differentiation. Sci Rep 8:9127. https://doi.org/10.1038/s41598-018-27501-2 Wang X, Zou M, Li J et al (2018b) LncRNA H19 targets miR-22 to modulate H(2) O(2) -induced deregulation in nucleus pulposus cell senescence, proliferation, and ECM synthesis through Wnt signaling. J Cell Biochem 119:4990-5002. https://doi.org/10.1002/jcb.26738 Wu Y, Fang L, Gao Y, Zhao Z, Zhou L, Zhang G (2022) lncRNA FGD5-AS1 Regulates Bone Marrow Stem Cell Proliferation and Apoptosis by Affecting miR-296-5p/STAT3 Axis in Steroid-Induced Osteonecrosis of the Femoral Head. J Healthc Eng 2022:9364467. https://doi.org/10.1155/2022/9364467 Xu H, Fang L, Zeng Q et al (2023) Glycyrrhizic acid alters the hyperoxidative stress-induced differentiation commitment of MSCs by activating the Wnt/β-catenin pathway to prevent SONFH. Food Funct 14:946-960. https://doi.org/10.1039/d2fo02337g Zhang Y, Kong X, Wang R et al (2014) Genetic association of the P-glycoprotein gene ABCB1 polymorphisms with the risk for steroid-induced osteonecrosis of the femoral head in Chinese population. Mol Biol Rep 41:3135-3146. https://doi.org/10.1007/s11033-014-3173-y Zhang Y, Tao Y, Liao Q (2018) Long noncoding RNA: a crosslink in biological regulatory network. Brief Bioinform 19:930-945. https://doi.org/10.1093/bib/bbx042 Zhao X, Wei Z, Li D, Yang Z, Tian M, Kang P (2019) Glucocorticoid Enhanced the Expression of Ski in Osteonecrosis of Femoral Head: The Effect on Adipogenesis of Rabbit BMSCs. Calcif Tissue Int 105:506-517. https://doi.org/10.1007/s00223-019-00592-3 Zhou Z, Hossain MS, Liu D (2021) Involvement of the long noncoding RNA H19 in osteogenic differentiation and bone regeneration. Stem Cell Res Ther 12:74. https://doi.org/10.1186/s13287-021-02149-4 Zhu M, Yu R, Liu Y et al (2024) LncRNA H19 Participates in Leukemia Inhibitory Factor Mediated Stemness Promotion in Colorectal Cancer Cells. Biochem Genet . https://doi.org/10.1007/s10528-023-10627-y Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4085453","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":280400473,"identity":"54518f34-50fa-4f91-bbcd-5ec64b7adf27","order_by":0,"name":"Feifei Lin","email":"","orcid":"","institution":"Second Affiliated Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Feifei","middleName":"","lastName":"Lin","suffix":""},{"id":280400474,"identity":"42e0b1a7-dbc4-4c26-a4a7-e75b47a1f01d","order_by":1,"name":"Min Yi","email":"","orcid":"","institution":"Second Affiliated Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Yi","suffix":""},{"id":280400475,"identity":"ba3303a9-45a4-494b-8707-6af3f6243adc","order_by":2,"name":"Shicheng Zhou","email":"","orcid":"","institution":"Second Affiliated Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Shicheng","middleName":"","lastName":"Zhou","suffix":""},{"id":280400476,"identity":"44b77176-6e35-4993-98c9-9d6b4ae495ab","order_by":3,"name":"Qingyu Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYBADxgb2xsaHH0jTwnO42ViCNC0S6W0CPMQoNTh+9vCLt202shtuPmxjkGCwk9NtIKTlTF6a5dy2NOMNtxPbHhQwJBubHSCgxexAjpkxb9vhRKCWdgMJhgOJ2whqOf8GpOV/4oabB9skeIjSciPH+DFv24HEDTcYidRif+ONGeOcc8nGM88kAgPZgAi/SPbnGH94U2Yn23f8+MOHHyrs5AhqAQI2CV42GNuAsHIQYP7A84c4laNgFIyCUTBCAQBtFUqnoNNRBQAAAABJRU5ErkJggg==","orcid":"","institution":"Second Affiliated Hospital of Jilin University","correspondingAuthor":true,"prefix":"","firstName":"Qingyu","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-03-12 16:15:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4085453/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4085453/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53013364,"identity":"2d441d8c-41cb-4ff1-a6ba-15bc83001cc0","added_by":"auto","created_at":"2024-03-19 15:48:07","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":684136,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eH19 and PPARγ are up-regulated in femoral head and BMSCs of SONFH.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA and B\u003c/strong\u003e The X-ray photo (A) and pathological structure (B) of SONFH patient.\u003cstrong\u003e C \u003c/strong\u003eThe morphologies of BMSCs from SONFH. \u003cstrong\u003eDand E\u003c/strong\u003e The expression level of H19 and PPARγ in femoral head (\u003cstrong\u003eD\u003c/strong\u003e) and BMSCs (\u003cstrong\u003eE)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4085453/v1/d9c3d10f707cc1b3835c6436.jpeg"},{"id":53012225,"identity":"9e2ec45b-cf57-4ab8-a125-e86ac52f7d97","added_by":"auto","created_at":"2024-03-19 15:40:07","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":592649,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eH19 participates in increased adipogenic of BMSCs and positively regulates PPARγ expression in SONFH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e The expression level of H19 in BMSCs after transfected with shH19.\u003cstrong\u003e B\u003c/strong\u003e The Oil Red O staining (200×) of BMSCs after transfected with shH19. \u003cstrong\u003eC and D\u003c/strong\u003e The Oil Red O quantifcation and the number of cells with Oil Red O staining (200×) of BMSCs after transfected with shH19. \u003cstrong\u003eE \u003c/strong\u003eThe expression levels of H19 and PPARγ within a week following the knockdown of H19.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4085453/v1/2d8f46647a0cfc864fdc9fb2.jpeg"},{"id":53012227,"identity":"54db6b00-a716-45cb-99ba-c5be1745a865","added_by":"auto","created_at":"2024-03-19 15:40:08","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":371786,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eH19 modulates PPARγ Expression through miR-130b-3p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eThree databases, StarBase, DIANA tools and miRWalk, were used to predict candidate miRNAs, as shown in the Venn diagram.\u003cstrong\u003e B\u003c/strong\u003e The expression level of three candidate miRNAs (miR-301b-3p, miR-130b-3p and miR-130a-3p) after knockdown of H19. \u003cstrong\u003eC\u003c/strong\u003e The binding site of miR-130b-3p with H19 and PPARγ. \u003cstrong\u003eD \u003c/strong\u003eThe expression of PPARγ was significantly decreased upon knocking down H19. This reduction in PPARγ expression could be reversed through co-transfection with miR-130b-3p inhibitor. \u003cstrong\u003eE \u003c/strong\u003eThe expression of PPARγ was significantly augmented when H19 was up-regulated. This elevation in PPARγ expression could be counteracted by co-transfecting with miR-130b-3p mimics.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4085453/v1/3016d6ba8952616796ea2120.jpeg"},{"id":53012223,"identity":"05aea9da-a810-4171-9aa0-92211b959469","added_by":"auto","created_at":"2024-03-19 15:40:07","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":368057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe regulatory effect of H19 in SONFH-BMSCs\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4085453/v1/04946d4229f8982c1bcd4289.jpeg"},{"id":53016063,"identity":"94bac942-601c-4c04-96e7-11b3db789432","added_by":"auto","created_at":"2024-03-19 16:04:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":721699,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4085453/v1/de5f11ce-236f-4bc2-b313-75932a24f521.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncRNA-H19 Promotes Adipogenic Differentiation Disorder by Regulating miR-130b-3p/PPARγ Axis in Steroid-induced Osteonecrosis of Femoral Head","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSteroid-induced osteonecrosis of the femoral head (SONFH) represents a progressive and destructive orthopaedic disorder that is induced by long-term and high-dose administration of glucocorticoids (GCs) (Li et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Fu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Xu et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Within the collapsed femoral head, there is a notable replacement of bone tissue with adipose tissue, leading to the formation of cystic changes. BMSCs with augmented adipogenic potential not only forfeit their reparative capacity, but this also culminates in the catastrophic accumulation of adipocytes and an increased intraosseous pressure within the femoral head, further exacerbating the progression of SONFH(Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Jiang et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our previous research has revealed that the disorder in adipogenic and osteogenic differentiation of BMSCs plays a crucial role in the occurrence and development of SONFH (Wang et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). However, the detailed molecular regulatory mechanisms remain unclear.\u003c/p\u003e \u003cp\u003eLncRNAs play a pivotal role in the epigenetic regulation, employing mechanisms such as signal transduction, decoy, guidance, and scaffolding (Zhang et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Mirzadeh Azad et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). H19 was the pioneering lncRNA to be discovered and possesses a multitude of diverse biological functions, participating in the regulation of cellular proliferation, differentiation, and metabolism (Wang et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e). H19 plays significant functional roles in regulating osteogenic differentiation. The expression levels of H19 fluctuate throughout the various stages of osteogenic differentiation. The osteogenic differentiation of human adipose-derived stem cells (hASCs) is facilitated by the suppression of H19 expression, which consequently leads to the increased expression of pro-osteogenic genes (Zhou et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Moreover, the overexpression of H19 contributes to the downregulation of pro-osteogenic genes (Huang et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and promotes steatosis, as well as augmenting lipid accumulation (Liu et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). This scenario seems akin to the diminished osteogenic differentiation and augmented adipogenic dysregulation of BMSCs in SONFH, yet the regulatory role of H19 in this context remains to be elucidated.\u003c/p\u003e \u003cp\u003eIn our current research, we conducted a systematic investigation to explore the functional significance of H19 in SONFH. Our research discovered that H19 was significantly overexpressed in both BMSCs and the lesion tissues of SONFH patients. Suppression of H19 inhibits PPARγ expression and reduces adipogenic differentiation by directly up-regulating miR-130b-3p. Additionally, our data offer an innovative perspective on the regulatory role of H19 in SONFH, suggesting that H19 could be a potential therapeutic target for the treatment of SONFH.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatient Specimens\u003c/h2\u003e \u003cp\u003eEight patients with SONFH (1 males and 7 females, with the age of 50 to 74 years old and the mean age of 59.6\u0026thinsp;\u0026plusmn;\u0026thinsp;7.5 years old) and eight patients with femoral neck fracture (FNF) (2 males and 6 females, with the age of 57 to 84 years old and the mean age of 75.0\u0026thinsp;\u0026plusmn;\u0026thinsp;8.0 years old) were enrolled from the Department of Orthopedics, the Second Hospital of Jilin University, China from January 2023 to October 2023. Specimens from patients with SONFH and control subjects with FNF were all obtained from patients undergoing total hip arthroplasty (THA). The diagnosis of SONFH was confirmed preoperatively using radiographs and magnetic resonance imaging (MRI), adhering to the ARCO classification system (Moya-Angeler et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Steroid-induced osteonecrosis was defined by a history of taking a mean daily dose of 16.6mg or an equivalent maximum daily dose of 80mg of prednisolone within 1 year (Koo et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Patients with concomitant congenital diseases, those who consumed alcohol, or had tumor-related illnesses were excluded from the study. Additionally, none of the patients were on any medications known to affect bone metabolism. The demographic and clinical characteristics of the patients included in this study are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The study was approved by the ethics committee of the Second Hospital of Jilin University, China [(2018)291]. Written informed consent was obtained from all participants for the use of their specimens, and all methods involved were conducted in accordance with the guidelines approved by the Ethics Committee of the Second Hospital of Jilin University.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of the patients in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eSONFH (n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eFNF (n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAge (years)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e62.1\u0026thinsp;\u0026plusmn;\u0026thinsp;7.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e70.0\u0026thinsp;\u0026plusmn;\u0026thinsp;7.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.067\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGender (M/F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e2/6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCRP (mg/dL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e29.6\u0026thinsp;\u0026plusmn;\u0026thinsp;32.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e0.044\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eESR (mm/h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.9\u0026thinsp;\u0026plusmn;\u0026thinsp;18.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e30.25\u0026thinsp;\u0026plusmn;\u0026thinsp;21.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.072\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eBMI (kg/m\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e23.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.096\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eARCO (III/IV)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2/ 6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eFemoral head collapse (mm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.6\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHarris score\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e59.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-----\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCRP, C-reaction protein; ESR, erythrocyte sedimentation rate; BMI, Body Mass Index;ARCO, Association Research Circulation Osseous.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eBMSC isolation and culture\u003c/h2\u003e \u003cp\u003eBMSCs were isolated from the bone marrow of patients' proximal femurs using density gradient centrifugation (Colter et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; GIBCO, NY, USA), supplemented with 10% fetal bovine serum (GIBCO), and incubated at 37\u0026deg;C with 5% CO2. The culture medium was replenished every three days. Upon reaching 90% confluence, the BMSCs were trypsinized and subcultured into new plates. The cells were expanded and utilized for experiments at passage 3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer's instructions. The concentration of RNA was then quantified using the Agilent ND-1000.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell transfection\u003c/h2\u003e \u003cp\u003eThe human H19 shRNA vector (sh-H19), overexpression vector (ov-H19), miR-130b-3p mimic and inhibitor were purchased from GenePharma (Shanghai, China). Lipofectamine 3000 (Thermo Fisher Scientific) was used for cell transfection in accordance with the manufacturer's instructions. Cells were harvested 48 hours post-transfection for RT-qPCR analysis, with each experiment being conducted in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003e Total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan), following the manufacturer\u0026rsquo;s guidelines. qRT-PCR was s performed using FastStart Universal SYBR Green Master (ROX) (Roche, Basel, Germany) on an Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems), adhering to the provided protocol. Data were normalized against the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the relative expression levels of each gene were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. All experiments were conducted in triplicate. The primer sequences utilized in this study are listed in the Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for real-time RT-PCR analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c3\" namest=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH19-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- TCTGGCAGGAGTGATGACGG \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH19-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- CAGGAGAGTTAGCAAAGGTG \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPARγ-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- GAGCCCAAGTTTGAGTTTGC-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPARγ-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- CTGTGAGGACTCAGGGTGGT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- CGGACCAATACGACCAAATCCG-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- AGCCACATCGCTCAGACACC-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-130b-3p-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- GGGCAGTGCAATGATGAAA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-130b-3p-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- ACAGACCCAGCCAACAAATA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- GCTTCGGCAGCACATATACTAAAAT \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;- CGCTTCACGAATTTGCGTGTCAT \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eGAPDH, glyceraldehyde-3-phosphate dehydrogenase\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eOsteogenic and adipogenic differentiation\u003c/h2\u003e \u003cp\u003eOsteogenic differentiation was induced by culturing BMSCs in an osteogenic medium supplemented with 10% FBS, 0.1 \u0026micro;mol/L dexamethasone, 10 \u0026micro;mol/L β-glycerophosphate, 10 \u0026micro;mol/L glutamine, and 50 \u0026micro;g/mL ascorbate (Cyagen Biosciences, Guangzhou, China). For adipogenic differentiation, BMSCs were cultured in an adipogenic medium containing 10% FBS, 1 \u0026micro;mol/L dexamethasone, 100 \u0026micro;g/mL 3-isobutyl-1-methylxanthine, 2\u0026micro;g/L insulin, 1 \u0026micro;mol/L rosiglitazone, and 10 \u0026micro;mol/L glutamine (Cyagen).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eOil Red O staining and quantification\u003c/h2\u003e \u003cp\u003eOil Red O (Beyotime) staining was used to evaluate intracellular lipid accumulation following adipogenic differentiation. Cells were fixed in 4% neutral buffered formalin for 30 minutes and subsequently washed with 3% isopropanol, incubated with freshly filtered Oil Red O staining solution for 1 hour, and then rinsed with double-distilled H2O. For quantitative analysis, isopropyl alcohol was added to the stained culture dishes, and the optical density (OD) values were measured at 490nm. ImageJ software was utilized to enumerate the cells exhibiting Oil Red O staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003eThe lncRNA-miRNA interactions were predicted using Diana tools (Karagkouni et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and StarBase (Li et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). miRNA interaction with mRNAs was predicted using miRWalk (Sticht et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and StarBase. The regulatory pattern diagram was crafted utilizing Figdraw.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data were presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. All statistical analyses were performed using SPSS version 20.0 software (SPSS, Inc., Chicago, IL, USA). Comparisons between groups were performed using unpaired Student\u0026rsquo;s t-test. Statistical significance was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eH19 are upregulated in the lesions of the femoral head and BMSCs from SONFH patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe X-ray imaging of SONFH patient at ARCO stage V revealed alterations in the morphology of the femoral head, characterized by collapse and flattening, as well as radiographic signs indicative of hip osteoarthritis (Fig. 1A). During THA, we meticulously harvested the femoral head from SONFH patients, carefully extracting tissue from osteonecrosis zone (Fig. 1B). The femoral head bone tissue of FNF patients served as the control group for our study. During surgeries for SONFH and FNF, bone marrow was collected and BMSCs were subsequently extracted and cultured. The morphological appearance of BMSCs derived from SONFH patients is depicted in Fig. 1C. Furthermore, the expression levels of H19 and PPAR\u0026gamma; were found to be abnormally and significantly upregulated in the femoral head tissues (Fig. 1D) and BMSCs (Fig. 1E) of SONFH patients.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eH19 participates in increased adipogenic of BMSCs and positively regulates PPAR\u0026gamma; expression in SONFH\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the regulatory role of H19, we performed H19 knockdown using H19-specific shRNA in BMSCs isolated from SONFH patients. Following transfection with the H19 shRNA vector, there was a significant downregulation of H19 expression (Fig. 2A), and the adipogenic capacity of BMSCs derived from SONFH patients was reduced (Fig. 2B). This trend was further corroborated by quantitative analysis of Oil Red O staining, revealing that on days 10 and 14 post-adipogenic induction, the staining intensity in the SONFH group was notably less than that of the control group. (Fig. 2C, D). The expression levels of both H19 and PPAR\u0026gamma; were concurrently reduced within a week subsequent to the knockdown of H19 (Fig. 2E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eH19 can act as a miR-130b-3p sponger\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePPAR\u0026gamma;\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ecan be directly targeted by miR-130b-3p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs is well-established, lncRNAs can serve as miRNA \u0026ldquo;sponges\u0026rdquo; that inhibit interaction with their miRNA targets in post-transcriptional regulation. Utilizing the StarBase and DIANA tools, we predicted the binding microRNAs of H19, while the binding microRNAs of PPAR\u0026gamma; were forecasted using StarBase and miRWalk. The ultimate intersecting set included miR-301b-3p, miR-130b-3p, and miR-130a-3p (Fig. 3A). To confirm whether H19 regulates the expression of these candidates, we carried out qRT-PCR analysis in H19-silenced BMSCs. The results revealed that only miR-130b-3p exhibited a significant upregulation subsequent to the reduced expression of H19 (Fig. 3B). The binding site of miR-130b-3p with H19 and PPAR\u0026gamma; was shown in Fig. 3C. In order to validate the molecular sponging effect of H19, we conducted rescue experiments. The expression of PPAR\u0026gamma; was significantly diminished when H19 was knocked down. This decrease in PPAR\u0026gamma; expression could be effectively reversed by co-transfection with an inhibitor of miR-130b-3p (Fig. 3D). The expression of PPAR\u0026gamma; was significantly increased when H19 was overexpressed. This rise in PPAR\u0026gamma; expression could be counteracted by co-transfecting with miR-130b-3p mimics (Fig. 3E). The regulatory effect of H19 in SONFH-BMSCs was shown in Fig. 4.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe misuse of steroid hormones is one of the primary factors contributing to femoral head necrosis\u0026nbsp;(Wang et al. 2018c; Huang et al. 2021). Steroid-induced endothelial dysfunction leads to the disruption of blood supply to the femoral head, which progressively results in the robust upregulation of osteoclast-related proteins and localized bone tissue ischemia and necrosis\u0026nbsp;(Maruyama et al. 2018; Chen et al. 2020).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe destruction of bone cells, coupled with the imbalance between osteogenesis and osteoclasis activities, ultimately leads to the degradation and collapse of the bone structure\u0026nbsp;(Piuzzi et al. 2019). During this process, the disruption of the differentiation equilibrium in BMSCs represents a substantial pathological change\u0026nbsp;(Powell et al. 2011; Chang et al. 2020). BMSCs with enhanced adipogenic potential not only forfeit their reparative capacity but also culminate in the catastrophic accumulation of adipocytes and increased intraosseous pressure within the femoral head, further exacerbating the progression of SONFH. In-depth investigations into the mechanisms underlying the differentiation disorder of SONFH-BMSCs are pivotal for a more comprehensive understanding of the pathogenesis of SONFH.\u003c/p\u003e\n\u003cp\u003eLncRNAs play an essential role in epigenetic regulation, employing mechanisms such as signal transduction, decoy, guidance, and scaffolding\u0026nbsp;(Wang and Chang 2011; Mirzadeh Azad et al. 2021). In recent years, numerous efforts have been directed toward elucidating the differential expression profiles of various non-coding RNAs (ncRNAs), including lncRNAs and miRNAs, in SONFH-BMSCs (Table 3). Furthermore, a majority of studies have discovered that lncRNAs influence the differentiation lineage of BMSCs by modulating post-transcriptional mRNA levels via the competing endogenous RNA (ceRNA) mechanism. Our previous research conducted a screening of the lncRNA expression profile in human SONFH-BMSCs and hypothesized that the lncRNA MALAT1 could modulate the expression of DKK1, thereby influencing the osteogenic and adipogenic differentiation of BMSCs\u0026nbsp;(Wang et al. 2018a). Wu et al. reported that lncRNA FGD5-AS1 regulates BMSCs proliferation and apoptosis by impacting the miR-296-5p/STAT3 axis in SONFH\u0026nbsp;(Wu et al. 2022). Han et al. demonstrated that H19- hsa-miR-519b-3p/hsa-miR-296-5p-ANKH and lncRNA c9orf163- hsa-miR-424-5p-CCNT1 might play important roles in osteonecrosis of the femoral head development\u0026nbsp;(Han and Li 2021). Our study shows H19 promotes the adipogenic differentiation of BMSCs and aggravates the progression of SONFH by miR-130b-3p/PPAR\u0026gamma; Axis. As PPAR\u0026gamma; is recognized as a transcription factor that facilitates adipogenic differentiation while inhibiting osteogenic differentiation\u0026nbsp;(Cao 2011; Berhouma et al. 2013), our findings substantiated that the dysregulation of H19 contributes to the disruption of the equilibrium between adipogenic and osteogenic differentiation in ONFH, as well as illuminating its regulatory role. These newly identified SONFH-associated lncRNAs offer new insights not only for further elucidating the molecular regulatory mechanisms of SONFH but also for providing novel molecular markers and therapeutic targets for the diagnosis and treatment of femoral head necrosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e. Functional characterization of the ncRNAs in SONFH\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003enon-coding RNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eExpression\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003eFunctional role\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003eTarget miRNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003eTarget genes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003eSample\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003ecircRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003ecircHGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eUp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003esuppress\u003c/p\u003e\n \u003cp\u003eproliferation and osteogenic differentiation of BMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003emiR-25-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003eSMAD7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003ehBMSCs\u003c/p\u003e\n \u003cp\u003e(7 Male and 3 Female)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cspan style=\"color: rgb(226, 80, 65);\"\u003e(Pan et al. 2021)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003ecircRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003ecirc_0058122\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eUp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003eincrease dex-mediated HUVEC apoptosis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003emiR-7974\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003eIGFBP5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003eFemoral head tissues (3 Male and 7 Female);HUVECs cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cspan style=\"color: rgb(226, 80, 65);\"\u003e(Yao et al. 2022)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003eLncRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003eLINC00473\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eDown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003epromote osteogenesis and suppress\u003c/p\u003e\n \u003cp\u003ethe adipogenesis of BMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003emiR-23a-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003eLRP5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003ehBMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cspan style=\"color: rgb(226, 80, 65);\"\u003e(Xu et al. 2022)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003eLncRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003eFGD5-AS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eUp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003epromote cell proliferation and restrain apoptosis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003emiR-296-5p/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003eSTAT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003ehBMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cspan style=\"color: rgb(226, 80, 65);\"\u003e(Wu et al. 2022)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003eLncRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003eNORAD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eDown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003epromotion of proliferation and differentiation, and inhibition of apoptosis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003emiR-26a-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026mdash;\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003ehBMSCs (20 patients)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cspan style=\"color: rgb(226, 80, 65);\"\u003e(Fu et al. 2021)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.467116357504215%\" valign=\"top\"\u003e\n \u003cp\u003eLncRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.816188870151771%\" valign=\"top\"\u003e\n \u003cp\u003eRP11‐154D6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.129848229342327%\" valign=\"top\"\u003e\n \u003cp\u003eDown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.05564924114671%\" valign=\"top\"\u003e\n \u003cp\u003epromote BMSCs osteogenic differentiation and inhibit adipogenic differentiation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.141652613827993%\" valign=\"top\"\u003e\n \u003cp\u003emiR‐30a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.600337268128161%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026mdash;\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.85160202360877%\" valign=\"top\"\u003e\n \u003cp\u003ehBMSCs (7 patients)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.937605396290051%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cspan style=\"color: rgb(226, 80, 65);\"\u003e(Fu et al. 2021)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eH19 was the first lncRNA to be identified and possesses a multitude of diverse biological functions, participating in the regulation of cellular proliferation, differentiation, and metabolism\u0026nbsp;(Zhu et al. 2024). Previous studies have shown that H19 is involved in fat accumulation and regulation. The expression of H19 is augmented by fatty acids in hepatocytes and in diet-induced fatty liver, with the overexpression of H19 capable of promoting steatosis and enhancing lipid accumulation\u0026nbsp;(Liu et al. 2018). Although Han et al. proposed a ceRNA network suggesting that H19 could act as a ceRNA for hsa-miR-519b-3p and hsa-miR-296-5p in ANKH\u0026nbsp;(Han and Li 2021), this has yet to be substantiated by relevant experimental validation. In our study, H19 has been found to be aberrantly upregulated in both femoral head tissues and BMSCs. The relationship between H19 and miR-130b has been reported in the regulation of keratinocyte differentiation\u0026nbsp;(Li et al. 2017)\u0026nbsp;and in potentiating the effect of praziquantel on liver function\u0026nbsp;(Ma et al. 2023); however, this relationship has not yet been explored in the context of SONFH. Motivated by these findings, we hypothesized that H19 could exert a regulatory influence on the progression of SONFH by functioning as a sponge for miR-130b-3p. Our investigations revealed that miR-130b-3p expression was increased following H19 knockdown. Additionally, we found an inverse correlation between PPAR\u0026gamma; expression and miR-130b-3p levels. Through bioinformatics analysis and rescue experiments, we substantiated that miR-130b-3p could interact with both H19 and PPAR\u0026gamma;. Collectively, our results suggest that H19 may modulate PPAR\u0026gamma; expression by targeting miR-130b-3p.\u003c/p\u003e\n\u003cp\u003ePrevious research has demonstrated that steroids have the capacity to upregulate the expression of PPAR\u0026gamma; in both rodent and human BMSCs, thereby fostering adipogenic differentiation\u0026nbsp;(Sheng et al. 2007). Our previous research also identified an association between gene variants of the transcription factor PPAR\u0026gamma; and the development of osteonecrosis of the femoral head in the Chinese population. Our previous study found that association of gene variants of transcription factors PPAR\u0026gamma; with the development of the femoral head osteonecrosis\u0026nbsp;(Song et al. 2017). Several studies have also reported the abnormal expression and related regulatory effects of PPAR\u0026gamma; in osteonecrosis of the femoral head\u0026nbsp;(Zhao et al. 2019; Cui et al. 2022)\u0026nbsp;(Fu et al. 2016).\u0026nbsp;In the current study, discovered that PPAR\u0026gamma; expression was notably elevated in both the femoral head tissues and BMSCs of patients with SONFH. Additionally, we found that miR-130b-3p regulates adipogenic differentiation by targeting PPAR\u0026gamma; in the context of SONFH.\u003c/p\u003e\n\u003cp\u003eIn summary, our findings reveal that elevated H19 expression is a characteristic molecular alteration in SONFH, and that H19 fosters BMSC adipogenic differentiation by enhancing PPAR\u0026gamma; activity through the suppression of miR-130b-3p. Collectively, our study substantiates the regulatory function of lncRNAs in the progression of SONFH, positioning H19 as a pivotal and novel molecular target in the disease.\u003c/p\u003e\n\u003cp\u003eThere were some limitations of our study. For instance, the number SONFH patients were small, which may have affected the lncRNA and mRNA expression results, more samples are needed to verify. Furthermore, luciferase reporter assays and animal experiments should be performed.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study confirmed that the aberrant upregulation of H19 contributes to abnormal adipogenic differentiation in SONFH by functioning as a molecular sponge for miR-130b-3p and subsequently upregulating PPARγ. These findings offer an innovative perspective for the treatment of SONFH.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThis work was financially supported by grants from Department of Science and Technology of Jilin Province (No. YDZJ202201ZYTS278) and Education Department of Jilin Province (No.JJKH20221070KJ).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e The data used to support these findings of this study are included in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBerhouma R, Kouidhi S, Ammar M, Abid H, Ennafaa H, Benammar-Elgaaied A (2013) Correlation of peroxisome proliferator-activated receptor (PPAR-\u0026gamma;) mRNA expression with Pro12Ala polymorphism in obesity. Biochem Genet 51:256-263. https://doi.org/10.1007/s10528-012-9560-y\u003c/li\u003e\n \u003cli\u003eCao JJ (2011) Effects of obesity on bone metabolism. J Orthop Surg Res 6:30. https://doi.org/10.1186/1749-799X-6-30\u003c/li\u003e\n \u003cli\u003eChang C, Greenspan A, Gershwin ME (2020) The pathogenesis, diagnosis and clinical manifestations of steroid-induced osteonecrosis. J Autoimmun 110:102460. https://doi.org/10.1016/j.jaut.2020.102460\u003c/li\u003e\n \u003cli\u003eChen K, Liu Y, He J et al (2020) Steroid-induced osteonecrosis of the femoral head reveals enhanced reactive oxygen species and hyperactive osteoclasts. Int J Biol Sci 16:1888-1900. https://doi.org/10.7150/ijbs.40917\u003c/li\u003e\n \u003cli\u003eChen Q, Shou P, Zheng C et al (2016) Fate decision of mesenchymal stem cells: adipocytes or osteoblasts. Cell Death Differ 23:1128-1139. https://doi.org/10.1038/cdd.2015.168\u003c/li\u003e\n \u003cli\u003eColter DC, Class R, DiGirolamo CM, Prockop DJ (2000) Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci U S A 97:3213-3218. https://doi.org/10.1073/pnas.97.7.3213\u003c/li\u003e\n \u003cli\u003eCui Y, Huang T, Zhang Z et al (2022) The potential effect of BMSCs with miR-27a in improving steroid-induced osteonecrosis of the femoral head. Sci Rep 12:21051. https://doi.org/10.1038/s41598-022-25407-8\u003c/li\u003e\n \u003cli\u003eFu Q, Tang NN, Zhang Q et al (2016) Preclinical Study of Cell Therapy for Osteonecrosis of the Femoral Head with Allogenic Peripheral Blood-Derived Mesenchymal Stem Cells. Yonsei Med J 57:1006-1015. https://doi.org/10.3349/ymj.2016.57.4.1006\u003c/li\u003e\n \u003cli\u003eFu W, Liu B, Wang B, Zhao D (2019) Early diagnosis and treatment of steroid-induced osteonecrosis of the femoral head. Int Orthop 43:1083-1087. https://doi.org/10.1007/s00264-018-4011-y\u003c/li\u003e\n \u003cli\u003eHan N, Li Z (2021) Non-coding RNA Identification in Osteonecrosis of the Femoral Head Using Competitive Endogenous RNA Network Analysis. Orthop Surg 13:1067-1076. https://doi.org/10.1111/os.12834\u003c/li\u003e\n \u003cli\u003eHuang C, Wen Z, Niu J, Lin S, Wang W (2021) Steroid-Induced Osteonecrosis of the Femoral Head: Novel Insight Into the Roles of Bone Endothelial Cells in Pathogenesis and Treatment. Front Cell Dev Biol 9:777697. https://doi.org/10.3389/fcell.2021.777697\u003c/li\u003e\n \u003cli\u003eHuang G, Kang Y, Huang Z et al (2017) Identification and Characterization of Long Non-Coding RNAs in Osteogenic Differentiation of Human Adipose-Derived Stem Cells. Cell Physiol Biochem 42:1037-1050. https://doi.org/10.1159/000478751\u003c/li\u003e\n \u003cli\u003eJiang W, Chen Y, Sun M et al (2023) LncRNA DGCR5-encoded polypeptide RIP aggravates SONFH by repressing nuclear localization of \u0026beta;-catenin in BMSCs. Cell Rep 42:112969. https://doi.org/10.1016/j.celrep.2023.112969\u003c/li\u003e\n \u003cli\u003eKaragkouni D, Paraskevopoulou MD, Tastsoglou S et al (2020) DIANA-LncBase v3: indexing experimentally supported miRNA targets on non-coding transcripts. Nucleic Acids Res 48:D101-D110. https://doi.org/10.1093/nar/gkz1036\u003c/li\u003e\n \u003cli\u003eKoo KH, Kim R, Kim YS et al (2002) Risk period for developing osteonecrosis of the femoral head in patients on steroid treatment. Clin Rheumatol 21:299-303. https://doi.org/10.1007/s100670200078\u003c/li\u003e\n \u003cli\u003eLi CX, Li HG, Huang LT et al (2017) H19 lncRNA regulates keratinocyte differentiation by targeting miR-130b-3p. Cell Death Dis 8:e3174. https://doi.org/10.1038/cddis.2017.516\u003c/li\u003e\n \u003cli\u003eLi JH, Liu S, Zhou H, Qu LH, Yang JH (2014) starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res 42:D92-97. https://doi.org/10.1093/nar/gkt1248\u003c/li\u003e\n \u003cli\u003eLi Z, Jiang C, Li X et al (2018) Circulating microRNA signature of steroid-induced osteonecrosis of the femoral head. Cell Prolif 51:e12418. https://doi.org/10.1111/cpr.12418\u003c/li\u003e\n \u003cli\u003eLiu C, Yang Z, Wu J et al (2018) Long noncoding RNA H19 interacts with polypyrimidine tract-binding protein 1 to reprogram hepatic lipid homeostasis. Hepatology 67:1768-1783. https://doi.org/10.1002/hep.29654\u003c/li\u003e\n \u003cli\u003eMa R, Liu Q, Liu Z et al (2023) H19/Mir-130b-3p/Cyp4a14 potentiate the effect of praziquantel on liver in the treatment of Schistosoma japonicum infection. Acta Trop 247:107012. https://doi.org/10.1016/j.actatropica.2023.107012\u003c/li\u003e\n \u003cli\u003eMaruyama M, Nabeshima A, Pan CC et al (2018) The effects of a functionally-graded scaffold and bone marrow-derived mononuclear cells on steroid-induced femoral head osteonecrosis. Biomaterials 187:39-46. https://doi.org/10.1016/j.biomaterials.2018.09.030\u003c/li\u003e\n \u003cli\u003eMirzadeh Azad F, Polignano IL, Proserpio V, Oliviero S (2021) Long Noncoding RNAs in Human Stemness and Differentiation. Trends Cell Biol 31:542-555. https://doi.org/10.1016/j.tcb.2021.02.002\u003c/li\u003e\n \u003cli\u003eMoya-Angeler J, Gianakos AL, Villa JC, Ni A, Lane JM (2015) Current concepts on osteonecrosis of the femoral head. World J Orthop 6:590-601. https://doi.org/10.5312/wjo.v6.i8.590\u003c/li\u003e\n \u003cli\u003ePiuzzi NS, Anis HK, Muschler GF (2019) Osteonecrosis of the femoral head with subchondral collapse. Cleve Clin J Med 86:511-512. https://doi.org/10.3949/ccjm.86a.19004\u003c/li\u003e\n \u003cli\u003ePowell C, Chang C, Gershwin ME (2011) Current concepts on the pathogenesis and natural history of steroid-induced osteonecrosis. Clin Rev Allergy Immunol 41:102-113. https://doi.org/10.1007/s12016-010-8217-z\u003c/li\u003e\n \u003cli\u003eSheng HH, Zhang GG, Cheung WH et al (2007) Elevated adipogenesis of marrow mesenchymal stem cells during early steroid-associated osteonecrosis development. J Orthop Surg Res 2:15. https://doi.org/10.1186/1749-799X-2-15\u003c/li\u003e\n \u003cli\u003eSong Y, Du Z, Ren M et al (2017) Association of gene variants of transcription factors PPAR\u0026gamma;, RUNX2, Osterix genes and COL2A1, IGFBP3 genes with the development of osteonecrosis of the femoral head in Chinese population. Bone 101:104-112. https://doi.org/10.1016/j.bone.2017.05.002\u003c/li\u003e\n \u003cli\u003eSticht C, De La Torre C, Parveen A, Gretz N (2018) miRWalk: An online resource for prediction of microRNA binding sites. PLoS One 13:e0206239. https://doi.org/10.1371/journal.pone.0206239\u003c/li\u003e\n \u003cli\u003eWang A, Ren M, Wang J (2018c) The pathogenesis of steroid-induced osteonecrosis of the femoral head: A systematic review of the literature. Gene 671:103-109. https://doi.org/10.1016/j.gene.2018.05.091\u003c/li\u003e\n \u003cli\u003eWang KC, Chang HY (2011) Molecular mechanisms of long noncoding RNAs. Mol Cell 43:904-914. https://doi.org/10.1016/j.molcel.2011.08.018\u003c/li\u003e\n \u003cli\u003eWang Q, Yang Q, Chen G et al (2018a) LncRNA expression profiling of BMSCs in osteonecrosis of the femoral head associated with increased adipogenic and decreased osteogenic differentiation. Sci Rep 8:9127. https://doi.org/10.1038/s41598-018-27501-2\u003c/li\u003e\n \u003cli\u003eWang X, Zou M, Li J et al (2018b) LncRNA H19 targets miR-22 to modulate H(2) O(2) -induced deregulation in nucleus pulposus cell senescence, proliferation, and ECM synthesis through Wnt signaling. J Cell Biochem 119:4990-5002. https://doi.org/10.1002/jcb.26738\u003c/li\u003e\n \u003cli\u003eWu Y, Fang L, Gao Y, Zhao Z, Zhou L, Zhang G (2022) lncRNA FGD5-AS1 Regulates Bone Marrow Stem Cell Proliferation and Apoptosis by Affecting miR-296-5p/STAT3 Axis in Steroid-Induced Osteonecrosis of the Femoral Head. J Healthc Eng 2022:9364467. https://doi.org/10.1155/2022/9364467\u003c/li\u003e\n \u003cli\u003eXu H, Fang L, Zeng Q et al (2023) Glycyrrhizic acid alters the hyperoxidative stress-induced differentiation commitment of MSCs by activating the Wnt/\u0026beta;-catenin pathway to prevent SONFH. Food Funct 14:946-960. https://doi.org/10.1039/d2fo02337g\u003c/li\u003e\n \u003cli\u003eZhang Y, Kong X, Wang R et al (2014) Genetic association of the P-glycoprotein gene ABCB1 polymorphisms with the risk for steroid-induced osteonecrosis of the femoral head in Chinese population. Mol Biol Rep 41:3135-3146. https://doi.org/10.1007/s11033-014-3173-y\u003c/li\u003e\n \u003cli\u003eZhang Y, Tao Y, Liao Q (2018) Long noncoding RNA: a crosslink in biological regulatory network. Brief Bioinform 19:930-945. https://doi.org/10.1093/bib/bbx042\u003c/li\u003e\n \u003cli\u003eZhao X, Wei Z, Li D, Yang Z, Tian M, Kang P (2019) Glucocorticoid Enhanced the Expression of Ski in Osteonecrosis of Femoral Head: The Effect on Adipogenesis of Rabbit BMSCs. Calcif Tissue Int 105:506-517. https://doi.org/10.1007/s00223-019-00592-3\u003c/li\u003e\n \u003cli\u003eZhou Z, Hossain MS, Liu D (2021) Involvement of the long noncoding RNA H19 in osteogenic differentiation and bone regeneration. Stem Cell Res Ther 12:74. https://doi.org/10.1186/s13287-021-02149-4\u003c/li\u003e\n \u003cli\u003eZhu M, Yu R, Liu Y et al (2024) LncRNA H19 Participates in Leukemia Inhibitory Factor Mediated Stemness Promotion in Colorectal Cancer Cells. Biochem Genet . https://doi.org/10.1007/s10528-023-10627-y\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Steroid-induced osteonecrosis of the femoral head, H19, miR-130b-3p, PPARγ","lastPublishedDoi":"10.21203/rs.3.rs-4085453/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4085453/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSteroid-induced osteonecrosis of the femoral head (SONFH) represents a frequent and debilitating orthopedic condition. It is widely believed that the adipogenic/osteogenic differentiation disorder of bone marrow mesenchymal stem cells (BMSCs) contributes to the development of SONFH. However, the regulatory mechanism of long non-coding RNAs (lncRNAs) in the differentiation disorder of BMSCs remains elusive. The expression levels of H19 were detected in both femoral head tissues and BMSCs from patients with SONFH. The role of the lncRNA H19 in SONFH was explored through bioinformatics analysis complemented by relevant validation experiments. Our findings revealed that H19 was significantly up-regulated in SONFH tissues as well as BMSCs. Silencing H19 suppressed BMSC adipogenic differentiation in SONFH and the expression of peroxisome proliferator-activated receptor γ (PPARγ). Furthermore, we found that H19 could interact with miR-130b-3p, and miR-130b-3p could directly inhibit PPARγ expression. In conclusion, this study uncovered that abnormally up-regulated H19 leads to abnormal lipogenic differentiation in SONFH by acting as a sponge for miR-130b-3p and upregulating PPARγ.\u003c/p\u003e","manuscriptTitle":"LncRNA-H19 Promotes Adipogenic Differentiation Disorder by Regulating miR-130b-3p/PPARγ Axis in Steroid-induced Osteonecrosis of Femoral Head","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-19 15:40:03","doi":"10.21203/rs.3.rs-4085453/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3ddd8770-2abe-410f-8a21-a20b12ed5c46","owner":[],"postedDate":"March 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-19T15:40:05+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-19 15:40:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4085453","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4085453","identity":"rs-4085453","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-04T02:00:05.705006+00:00
License: CC-BY-4.0