Fabrication of fusogenic and magnet-responsive cells for transplantation of an intact mitochondrial network

preprint OA: closed CC-BY-4.0

Abstract

Abstract Background Mitochondrial transplantation is a promising cure for many diseases associated with mitochondrial defects or ageing; however, a reliable method for mitochondria transfer is still in urgent need. Method In this study, we assembled fusogenic and magnet-responsive cells (FMRCs), which were enucleated stem cells loaded with Fe3O4 nanoparticles and further incorporated with fusogenic vesicular stomatitis virus glycoprotein G (VSV-G). Fusion was carried out in the presence of a magnetic force. Results Mitochondrial transplantation in the presence of a magnetic force via fusion from FMRCs restored normal mitotic activity, mitochondrial membrane potential, ROS levels and ATP production in cells containing partial mtDNA depletion, or in cybrids harboring mtDNA with a 4977-bp deletion. SNP tracing and qPCR analysis of the mitochondrial and nuclear genomes unequivocally demonstrated that exogenous mitochondria were able to reside stably and predominately. Mitochondria transplantation stimulated autophgy and thus the clearance of defective endogenous counterparts, resulted in lower mtDNA heteroplasmy. Conclusion The results suggest that FMRCs is an excellent vehicle for mitochondrial transplantation, which could be applied to the treatment of ageing and mitochondria associated diseases.
Full text 129,820 characters · extracted from preprint-html · click to expand
Fabrication of fusogenic and magnet-responsive cells for transplantation of an intact mitochondrial network | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fabrication of fusogenic and magnet-responsive cells for transplantation of an intact mitochondrial network Liqun Xu, Xiao Li, Xing Fan, Wei Yan, Wanfei Wu, Junwei Li, Ronghao Deng, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5579357/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract Background Mitochondrial transplantation is a promising cure for many diseases associated with mitochondrial defects or ageing; however, a reliable method for mitochondria transfer is still in urgent need. Method In this study, we assembled fusogenic and magnet-responsive cells (FMRCs), which were enucleated stem cells loaded with Fe 3 O 4 nanoparticles and further incorporated with fusogenic vesicular stomatitis virus glycoprotein G (VSV-G). Fusion was carried out in the presence of a magnetic force. Results Mitochondrial transplantation in the presence of a magnetic force via fusion from FMRCs restored normal mitotic activity, mitochondrial membrane potential, ROS levels and ATP production in cells containing partial mtDNA depletion, or in cybrids harboring mtDNA with a 4977-bp deletion. SNP tracing and qPCR analysis of the mitochondrial and nuclear genomes unequivocally demonstrated that exogenous mitochondria were able to reside stably and predominately. Mitochondria transplantation stimulated autophgy and thus the clearance of defective endogenous counterparts, resulted in lower mtDNA heteroplasmy. Conclusion The results suggest that FMRCs is an excellent vehicle for mitochondrial transplantation, which could be applied to the treatment of ageing and mitochondria associated diseases. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Mitochondria are semi-autonomous organelles that generate most of the chemical energy needed to power the cell's biochemical reactions. Mitochondria are also involved in many other fundamental cellular processes ( 1 ). Mutations of mitochondrial DNA (mtDNA) could be Mendelian, maternally inherited or sporadic, and occur at various time points during development, leading to mitochondrial dysfunction that plays a major role in ageing, metabolic diseases, neurodegenerative diseases, neuromuscular disorders and cancers ( 2 – 4 ). Consequently, mitochondria are now becoming a strong research interest and a major target for pharmaceutical companies. Mitochondrial transfer offers a potential cure for diseases associated with mitochondrial dysfunction. Mitochondrial transfer has been observed naturally in vivo and in cell culture via open-ended tubular extensions called tunneling nanotubes (TNTs) ( 5 – 7 ). In addition, membrane-bound extracellular vesicles (EVs) occasionally contain mitochondria and transfer them to surrounding cells ( 8 ). Mitochondria transfer via TNTs and EVs are reported to decrease reactive oxygen species (ROS) levels and apoptosis rates ( 9 – 11 ). However, the low efficacy of these approaches limits their therapeutic value. Currently, there are many reports which claim fabulous effects of transplantation of isolated mitochondria in combating mitochondrial dysfunction either in model systems or under clinical settings ( 12 , 13 ). McCully and colleagues reported that ischemic hearts transplanted with healthy mitochondria had reduced infarct size, decreased cardiomyocyte loss, and improved post-ischemic myocardial function ( 14 ). Injection of autologously derived mitochondria from muscle was reported to decrease brain infarct volume and reverse neurological deficits in a stroke model of rat ( 15 ). However, the underlying mechanism has not been elucidated in the above reports and the use of isolated mitochondria has raised uncertainty ( 16 , 17 ). Enucleated cells (cytoplasts) are traditionally used to form cybrids, which are cytoplasmic hybrids created by fusion of cells from patients harboring mtDNA mutation(s) to cells devoid of mtDNA (Rho0 cells) ( 18 ). In a sense, enucleated cells are excellent vehicles for transmission of mitochondria, because mitochondria in this case are protected from the harsh extracellular environment and thus remain almost intact. We previously demonstrated that a type of miniature cytoplasts, plasma membrane vehicles (PMVs) generated by mechanical extrusion, could be exploited for transplantation of functional mitochondria ( 19 ). Rho0 cells or acetaminophen- damaged HepG2 cells transplanted with functional mitochondria from mesenchymal stem cells were protected from cell death and regained mitotic activity ( 19 , 20 ). However, these approaches rely critically on membrane fusion, which is notoriously difficult and often results in cell death. Membrane fusion is a fundamental biological process in cellular life ranging from membrane biogenesis, intracellular traffic, hormone secretion and viral infection. Membrane fusion proceeds through a series of well-defined intermediate steps, characterized as the so called hemifusion model ( 21 , 22 ). These steps are governed by energy barriers, which can be overcome by disparate fusogens, including proteins, peptides, lipids and ions ( 23 ). Energy barriers also can be brought down in vitro by mechanical and chemical techniques, for examples, polyethylene glycol (PEG) induction, electrical stimulation and optically-induced cell fusion ( 24 – 26 ). However, these approaches are flawed either by cytotoxicity or low efficiency. In this manuscript, we reported a breakthrough in VSV-G mediated membrane fusion. Fusogenic and magnet-responsive cells (FMRCs), which were enucleated stem cells loaded with Fe 3 O 4 nanoparticles and further incorporated with fusogenic vesicular stomatitis virus glycoprotein G (VSV-G), were fabricated and used for mitochondria transfer via fusion. A magnetic force was introduced to bring FMRCs into close proximity with target cells, leading to efficient membrane fusion. Consequently, transplantation of functional mitochondrial networks from FMRCs to recipient cells was achieved both in vitro and in the gastrocnemius of mice. Materials and Methods Preparation of VSV-G condition medium Ad293 cells (Agilent, Santa Clara, CA) were seeded in 6-wells overnight and transfected with 0.8 μg/well of pLV-VSVG plasmid using the PolyJet reagent (SignaGen Laboratories, Ijamsville, MD) as per instruction manual. Condition medium (CM) was collected at 48 h. Ad293 cells were harvested and lysed by three freeze/thaw cycles. Lysate and CM were pooled into 2 mL tubes, and cell debris were removed by differential centrifugation at 300, 2000 and 10000 g for10 min at each step. Clear CM was then condensed by super centrifugation (Type 100Ti fixed angle, 344619, Beckman Coulter) at 100000 g for 70 min. About 200 mL of concentrated VSV-G CM were collected from 6 mL of debris free CM. Total protein concentration was then measured using the BCA assay (Thermo Scientific, China). Generation of enucleated BMSCs (eBMSCs) Cell enucleation was carried out according to a previously reported method with modifications (27). About 5x10 5 /well of cells were seeded in an ECM (extracellular matrix) coated 24-well. After 24-48 h cultivation, cells reached about 90% confluency. The 24-well was then fitted upside-down into a 50-mL conical tube containing 10 mL of medium for enucleation: calcium-free DMEM supplemented with calcium chloride (100 ng/mL), cytochalasin B (10 mg/mL), colchicine (5 mg/mL), 2% sucrose (w/v) and N-acetyl-L-cysteine (2 mM, Sigma). The 24-wells were spun in a warm Eppendorf centrifuge at 4500 g and 35°C for 60 min. After enculeation, the medium was replaced with fresh culture medium and the cells were recovered in the incubator for at least 1 h before being used for fusion experiments. Generation of cells with partial mtDNA depletion C2C12 cells (derived from BALB/c mice) or BMSCs of KM mice were treated with ddC (dideoxy-cytotidine, 10 mM) and EB (Ethidium bromide, 5 mM) for 4-7 days, which generated cells with partial mtDNA depletion (PMD). The remaining mitochondria in PMD cells were defective due to ddC and EB treatment. The medium was then replaced with normal culture medium supplemented with Uridine (50 mg/mL) and pyruvate (0.1 mM). Deficiency of mitochondria were verified by TMRE staining (500 nM, Abcam). The content of mtDNA was examined by qPCR. Fabrication and fusion of fusogenic and magnet-responsive cells (FMRCs) To optimize the loading condition and visualize the distribution in the cells, rhodamine conjugated Fe 3 O 4 nanoparticles (Gift from Professor Haibao Zhu) were used. Different amount of the nanoparticles were incubated with cells for 3-24 h on top of a magnet with a strength of 1000-5000 Gs (Gauss). To prepare FMRCs, enucleated cells (Ad293 or BMSCs) were loaded with Fe 3 O 4 nanoparticles (200 ng,Sigma-Aldrich, 747327) in 24-well for 12 h on top of a magnet of 1500 Gs, and then incubated with VSV-G condition medium (5 mg/mL) for 30 min. To increase one to one cell fusion, target cells were seeded in a 24-well overnight at 15% confluency and then labeled with DiI (Red). FMRCs ( 2 x 10 5 ) were labeled with Calcein-AM (Green) and then added and cultivated for 30 min in the presence of a magnetic force (1500 Gs). pH-depend fusion was carried out by adding pre-warmed (45ºC) fusion buffer (pH = 4.5) for 1 min. After a 30 min incubation, cells were stained with Hoechst and examined by confocal microscopy in a glass-bottom dish. Measurement of calcium transient Fluo4-AM (5 mM, Thermo Scientific) in calcium-free HBSS was added into FMRCs. After incubation for 20 min, 1% FBS in HEPES saline buffer was supplemented and incubated for a further 20 min. FMRCs in glass-bottom 24-well were washed with HBSS three times and then examined by confocal microscopy. Six pictures were taken from each well. Relative fluorescence intensity was calculated using the ZEN 2 software. Detection of cytoskeleton formation Formation of cytoskeleton was detected by immunofluorescent staining. FMRCs were fixed in 3.7% of paraformaldehyde at room temperature for 10 min, and then treated with 0.1% of Triton X-100 for 10 min. After washing with PBS three times, the micotubes were revealed by staining with Tubulin-Tracker Green (1:50 dilution in 5% BSA, Beyotime). For actin filament, FMRCs were stained with FITC-conjugated phalloidin (Beyotime, China). For detection of Myosin, FMRCs were incubated with rabbit anti-mouse myosin (Sigma-Aldrich, St. Louis) at room temperature for 2 h, and then stained with Alexa Fluor 555-conjugated anti-rabbit IgG (1:200 dilution; Beyotime) for another 1 h. Cells were washed between the primary and secondary antibodies incubation. Finally, cells were stained with Hoechst 33342 (Solarbio, China) before being anyalyzed by confocal microscopy. Mitochondria transplantation into cells with partial mtDNA depletion To examine mitochondria transplantation via cell fusion, partial mtDNA depleted (PMD) cells (C2C12 cells) were used as the recipient cells, in which the transplanted mitochondria could be easily detected, because endogenous mitochondria are defective and displays faintly after dye staining. After fusion with FRMCs (eBMSCs), PMD cells were cultivated in normal medium without supplementation of uridine and pyruvate. Cells were stained with TMRE and examined by confocal microscopy at day 1. Mitotic activity was evaluated by counting cell numbers at day 2 and 3. The relative amount of mtDNA were determined by qPCR with a pair of mtDNA specific primers at day 3 (28): Forward/mtDNA, CCCAGCTACTACCATCA- TTCAAGT, Reverse/mtDNA, GATGGTTTGGGAGATTGGTTGATGT. The cycle threshold (Ct) was normalized to the reference gene beta-2M: Forward/beta-2M, ATG GGAAGCCGAACATACTG, Reverse/beta-2M, CAGTCTCAGTGGGGGTGAAT. The qPCR was carried out using SYBR Green qPCR Master Mix (TransGen Biotech). Thermocycle parameters were: 95°C for 3 min, followed by 95°C for 10 s, 60-65°C for 30 s and 72°C for 1 min for a total of 30 cycles. Mitochondria transplantation into cells harboring mtDNA common deletion 143B ∆ 4977 and control cells were gifts from Dr. Lei Liu (Institute of Zoology, Chinese Academy of Sciences). Enucleation of Ad293 cells was performed as reported previously (19,20). Cells were mechanically extruded through a filter membrane with pores of 5 mm. After fusion, cell viability was assayed using a CCK8 kit (Beyotime, China) at day 3 and 5. ATP content was measured using an ATP assay kit according to the instruction provided by the company (Beyotime, China). ROS levels, cardiolipin content and SDHA levels in mitochondria was revealed by staining using MitoSOX (Invitrogen, Carlsbad, CA), 10-nonyl acridine orange (NAO, MCE, Monmouth Junction, NJ) and anti-SDHA (GeneTex, Irvine, CA), respectively. Heteroplasmy of mtDNA was evaluated by qPCR of three fragments of mtDNA: The D-loop maintained both in wild-type and mutant mtDNA was used for standardization of mtDNA mass. Nd4 gene included in the deleted region of 4977-bp was used for measurement of wild-type mtDNA. The TRNK-Nd5 region bordering the deletion was used for assay of mutant mtDNA. The specific primers are as following: Forward/D-loop, CACAGGTCTATCACCCTATTAAC, Reverse/D-loop, CAGAGATGTGTTTAAGTGCTGTG. Forward/Nd4, CGCTCATTGCATACTCTT- CAATC, Reverse/Nd4, GTTACTAGCACAGAGAGTTCTCC. Forward/TRNK, CTAGAGCCCACTGTAAAGCTAAC, Reverse/Nd5, GTTGACCTGTTAGGGTG- AGAAG. The cycle threshold (Ct) was normalized to the reference gene beta-2M: Forward/beta-2M, ATGGGAAGCCGAACATACTG, Reverse/beta-2M, CAGTCT- CAGTGGGGGTGAAT. The qPCR was carried out using SYBR Green qPCR Master Mix (TransGen Biotech, China). Thermocycle parameters were: 95°C for 3 min, followed by 95°C for 10 s, 60-65°C for 30 s and 72°C for 1 min for a total of 30 cycles. SNP analysis of mtDNA and nDNA FMRCs (eBMSCs from BALB/c mice) were fused with partial mtDNA deleted cells (BMSCs from KM mice) were use, or were injected into the gastrocnemius of KM mice. After fusion, the mt-tRNA Arg or mt-Nd4 genes were amplified respectively at day 1, 3, 5 and 10 with a pair of primers reported previously (29,30): mt-tRNA Arg , CTACTTCCACTACCATGAGC (F), GTATGGAGCTTATGGAGTTGG (R); mt-Nd4, GGACTTTACTTCACCATCCTCCAAG (F), mt-Nd4, GTTCATTCATATGCTAG- GCCTAGAG (R). PCR products were sequenced for SNP analysis. Since the enucleation efficiency is about 95%, we cloned the cells immediately after fusion. Three clones were generated in about 2 weeks. SNP analysis of mt-tRNA Arg gene was carried out as described above. Further, the SNP site of rs27250976 was chosen to distinguish nDNA of BALB/c or KM mice (31). The SNP site was amplified with the following primer pairs: CATCTTAAGTCCTCAGCACC (F), GGCTACCTGA- AACGTCAAAAT (R). PCR products were sequenced by Sangon Biotech (China). Autophagy detection by Cyto-ID staining To measure autophagy flux, partial mtDNA deleted cells (BMSCs from KM mice) transplanted with or without mitochondria were stained with MitoTracker-Red (200 nM, Beyotime), or LysoTracker-Red (50 nM, Enzo Life Science) together with CYTO-ID Green (Enzo Life Science) in the presence or absence of chloroquine (CQ, 60 μM) at 37ºC for 20 min 48 h post fusion. The R6G group and normal BMSCs were used as controls. After washing, cells were examined by confocal microscopy. Autophagy detection by Western blot analysis The following antibodies were used for Western blot analysis of autophagy: anti-LC3B (ab192890, Abcam), anti-β-actin (AF5003, Beyotime), and anti-Beclin1 (HA721216, HUABIO), anti-p62 (HA721171, HUABIO), anti-p62 (A21020, Abbkine). Western blot analysis was carried out as described previously (32). Protein band intensity was quantified using Image-Pro Plus software (BioImager, Richmond Hill, Canada). Statistical analysis All statistical analyses were performed using GraphPad Prizm 7 (GraphPad Software Inc., San Diego, CA). All data represent the means ± standard deviation. The experiments had been repeated at least twice. The results were subjected to two-tailed Student's t test and one-way ANOVA with Tukey's post hoc test. P values < 0.05 were considered statistically significant. Results Fabrication of fusogenic and magnet-responsive cells (FMRCs) The idea of fabricating FMRCs and using them for cell fusion and mitochondrial transplantation is depicted in Figure 1. Enucleated stem cells were loaded with Fe 3 O 4 nanoparticles while fusogenic VSV-G glycoproteins were incorporated into the plasma membrane (Fig. S1), forming FMRCs, which were fused with target cells in the presence of a magnet. The magnetic force overcame the energy barrier generated during the formation of a hemifusion. Consequently, mitochondria were transferred from FMRCs into recipient cells after the completion of fusion. The mitochondria network remained almost intact without exposure to the harsh environment. Endogenous defective mitochondria were eliminated by autophagy. To examine the loading of nanoparticles, rhodamine conjugated Fe 3 O 4 were added into the culture in the presence of a magnet (Fig. 2A). Fe 3 O 4 nanoparticles appeared in the cytoplasm within 3 h. The intensity of rhodamine was correlated with the incubation time, the strength of magnet and the amount of nanoparticles (Fig. 2A/S2). VSV-G condition media were prepared from Ad293 cells transfected with a VSV-G expression cassette. Cells loaded with Fe 3 O 4 nanoparticles were incubated with VSV-G and then examined for the incorporation by immunofluorescence staining. The result revealed that VSV-G appeared on the surface of cells (Fig. 2B). The intensity of staining increased with the amount of VSV-G added in the culture (Fig. 2B/S2). Magnet responsiveness of FMRCs was assayed by the speed of sedimentation in the presence or absence of a magnet (Fig. 2C). More cells reached the bottom of the well in the presence of a magnet, while only a few cells were detected at a specific point of time when the magnet was absence (Fig. 2C/S2). The magnetic force stimulated fusion of FMRCs It has been reported that mechanical tension at the fusogenic synapse drives cell membrane fusion to overcome energy barriers under physical conditions (33). We took advantage of the static force provided by a magnet and therefore fabricated FMRCs as described above to promote fusion. Indeed, fusion percentage increased from 40% to about 60% (Fig. 3A/B). Notably, the majority of fusion occurred between 2 cells with a diameter between 20-25mm. Decreasing cell density would favor forming two-cell fusion. Furthermore, fusion could be improved by increasing the amount of nanoparticles and strength of magnetic force, reaching a percentage of around 70% (Fig. 3C/D). In addition, we found that fusion of FMRCs was favorable at higher temperature. Actually, temperature dependent cell fusion has been reported (34), showing that HIV envelope glycoprotein mediated syncytium formation is favorable at 37ºC compared to 4ºC. In the present study, FMRCs fusion was induced for 1 min in buffer pre-warmed to 37-55ºC. Highest fusion rate was obtained when induction was performed at 50ºC (Fig. S3A/B). However, FMRCs were prone to form larger aggregates at 50ºC, while more two-cell fusion was found at 45ºC. Similar phenomenon was observed for fusion of FMRCs derived from a variety of cell types (Fig. S3C). Of note, only a few cells showed cytotoxic effect during the induction of fusion. The magnetic force stimulated calcium transient and cytoskeleton formation To understand the mechanism underlying the stimulated fusion by magnetic force, fluorescence imaging of calcium transient was performed. Magnetic force triggered an increase of calcium transient (Fig. 4A/B), which could be dampen by inhibitors of voltage-gated calcium channels (fluoxetine), or selective intracellular or extracellular calcium chelators (BAPTA/EDTA) (Fig. 4C/D). Further, inhibition of calcium transient completely blocked the effect of magnetic force on fusion (Fig. 4E). The results are consistent with early reports of the involvement of calcium transient in various fusion models (35). Next, the effect of magnetic force on the formation of cytoskeleton was examined. Cytoskeleton has been demonstrated to be critical for cell fusion. Indeed, the magnetic force significantly promoted the formation of actin filaments and Myosin II, while microtubule formation was not affected (Fig. S4A/B). The action of magnetic force on cytoskeleton could be abolished by cytochalasin B and/or colchicine (Fig. S4C/D). Moreover, inhibition of actin filaments decreased fusion efficiency. However, inhibition of microtubule had no effect. Mitochondria transplantation restored mitotic activities of cells with partial mtDNA depletion After establishing the optimal conditions, we prepared FMRCs from enucleated BMSCs (Fig. S5), which contained mitochondria networks that were mostly rod shaped. Mitochondria in FMRCs (eBMSCs) had a slightly lower (about 80%) membrane potential as compared to their nucleated counterparts. In contrast, isolated mitochondria were round shape and had reduced the membrane potential to barely above background. FMRCs (eBMSCs) were also able to fused with a variety of target cells, including BMSCs, C2C12 cells, and C2C12 cells with partial mtDNA depletion (PMD). Fusion occurred at high efficiency, leading to transplantation of mitochondria, which displayed a network structure with about normal membrane potential (Fig. 5A-C). A large percentage of C2C12-PMD cells regained proliferation ability even when uridine was withdrew, while cells without mitochondria transplantation started to die (Fig. 5D). A loss of cell number occurred at day 2 but recovered quickly at day 3 (Fig. 5E). Finally, we quantified mtDNA amount in C2C12-PMD cells before and after mitochondria transplantation using qPCR (Fig. 5F). The results showed that mtDNA increased more than 100-fold after transplantation (Fig. 5G). Elimination of endogenous mitochondria in BMSCs-PMD by autophagy No reliable methods exist presently for long-term labeling and tracing of mitochondria. To unequivocally demonstrated the transfer of exogenous mitochondria, we took advantage of an SNP (single nucleotide polymorphism) in the mt-tRNA Arg gene, which has a stretch of different number of adenosine (29). We confirmed this polymorphism by PCR amplification followed by sequencing. Consistent with the previous report, the mt-tRNA Arg gene in BMSCs generated from BALB/c and KM mice harbored 10 and 9 As respectively (Fig. 6A). Subsequently, FMRCs (eBMSCs) derived from BALB/c mice were fused with BMSCs-PMD from KM mice. After fusion, mt-tRNA Arg gene was amplified and sequenced at day 1, 3, 5 and 10. We found that the contribution of transplanted mt-tRNA Arg gene increased from about 20% (T:A ratio) at day 1 to above 90% at day 10 (Fig. 6A). Further, we determined the origin of cells by SNP analysis of the nuclear genome (31). Cells were cloned in 96-wells immediately after fusion. A total of 3 clones were obtained, and used for SNP analysis of mtDNA and nDNA. The results showed that 2 of the clones were hybrids of mtDNA and nDNA derived from BALB/c and KM mice respectively (Fig. S6). The other was contaminated with some BMSCs of BALB/c mice that was not enucleated successfully. Of note, exogenous mitochondria in BMSCs-PMD accounted for about 50-60%, an increase from 20% at day 1, suggesting that some endogenous defective mitochondria might be eliminated. Nonetheless, the results demonstrated that exogenous mitochondria were able to colonize stably in BMSCs-PMD. To confirm that autophagy was responsible to the clearance of some defective mitochondria in BMSCs-PMD, we carried out an autophgy flux test by the staining of Cyto-ID and LysoTracker in the presence of chloroquine (CQ) (Fig. 6B). The result showed that mitochondria transplantation significantly increased the levels of autophgy in BMSCs-PMD (Fig. 6B), suggesting that restored energy production due to mitochondria transplantation was essential to the activation of autophagy process. No significant diffirence was detected if CQ was absence (Data no shown). On the contrary, when FMRCs were pre-treated with rhodamine 6G (R6G), which compromises the normal function of mitochondria, the autophagy levels in BMSCs-PMD did not change after fusion. Further, staining of MitoTracker and Cyto-ID revealed that significantly more mitochondria co-localized with antophagosomes 48 h post fusion (Fig. 6C). In contrast, BMSCs-PMD and the R6G group had only few co-localization. Moreover, we measured the protein levels of LC3, p62 and Beclin in BMSCs-PMD transplanted with or without mitochondria (Fig. 6D). Consistent with the observation reported in the literature (36), LC3-II and Beclin decreased in BMSCs-PMD but increased back to normal levels after fusion. On the other hand, p62 increased in BMSCs-PMD but decreased after fusion. Again, as a control, the R6G group did not showed the same trend as described above. Reduction of oxidative stress and heteroplasmy in 143B cells harboring mtDNA deletion after mitochondrial transplantation To investigate if this technology can be used as a medical technology for the treatment of mitochondrial diseases, we tested the effect of mitochondrial transplantation in cybrids harboring a high percentage of mutant mtDNA with a 4977 bp deletion (143B ∆ 4977 cells) (37). Due to technical reason, enucleation of human kidney embryonic cells (Ad293 cells) were achieved by mechanical extrusion through a filter with 5-mm pores (19,20), thus generating plasma membrane vesicles (PMVs), which are miniature cytoplasts with a diameter of about 5-mm (Fig. S7). Cytoplasts generated via extrusion contained segregated mitochondria, not an intact mitochondrial network. Nonetheless, FMRCs of enucleated Ad293 cells were able to transfer functional mitochondria to 143B ∆ 4977 cells efficiently via fusion. Transplantation of mitochondria restored normal mitochondria membrane potential and the tubular network in 143B ∆ 4977 cells (Fig. 7A/B/S8). In addition, 143B ∆ 4977 cells had increased mitochondrial ROS levels, cardiolipin content and amount of succinate dehydrogenase (SDHA) due to mtDNA deletion. Their levels returned to normal after mitochondrial transplantation (Fig. 7C-E). These effects were not shown if mitochondria in Ad293 cells were damaged by R6G before transplantation. Furthermore, ATP production and cell mitotic activity increased to the levels comparable to that in control 143B cells after mitochondrial transplantation (Fig. 7F/G). Finally, the heteroplasmy was evaluated by qPCR of three fragments of mtDNA (Fig. 7H/I). The D-loop region, which is maintained both in wild-type and mutant mtDNA, was used for standardization of mtDNA mass. Nd4 gene, which is within the deleted region of 4977-bp, was used for measurement of wild-type mtDNA. The TRNK-Nd5 region, which borders the 4977-bp deletion, was used for assay of mutant mtDNA. The results demonstrated that 143B ∆ 4977 cells harbors about 70% of mutant mtDNA. In contrast, 143B cells contain very low level of (about 0.12%?) mutant mtDNA. In any event, the heteroplasmy in 143B ∆ 4977 cells reduced to about 19% 5 d post mitochondrial transplantation (Fig. 7J/K). Discussion Mitochondrial shape varies in living cells and can range from punctuate structures to tubular networks. Maintaining this dynamic interconnected networks is crucial for both mitochondrial and cellular functions ( 38 ). Techniques reported in the literature mostly utilize purified mitochondria, which would inevitably break the branched network into dot-shaped mitochondria. This mechanical process is harmful because membrane breakage could result in the exchange of solution in and out of the mitochondria matrix and thus the dissipation of proton gradient, eventually leading to severe reduction of membrane potential (Fig. S5). Moreover, isolated mitochondria in the medium were exposed to a calcium concentration of about 10,000–20,000-fold higher than that in the cytosol. Calcium uptakes through mitochondrial calcium uniporter (MCU) will lead to calcium overload, and Ca2 + accumulation can impair mitochondrial function, resulting in reduced ATP production and increased production of reactive oxygen species (ROS) ( 39 ). Further, it has been reported that isolated mitochondria have low respiration activities and increased mitochondrial permeability, resulting in the releases of pro-apoptotic proteins ( 40 – 42 ). Therefore, even though the success of transplantation using isolated mitochondria in cell cultures, animal models and even in clinical settings has been reported numerously ( 43 – 45 ), the evidences and purported mechanisms are still controversial ( 16 , 17 ). Mitochondria are occasionally found in extracellular vesicles ( 46 ); however, their usage in mitochondria transplantation is questionable. Micro-manipulation techniques including nucleus transfer and the FluidFM-based approach are suitable only to transplantation of mitochondria to germ cells or a small number of culture cells ( 47 , 48 ). In contrast to the techniques mentioned above, we reported a novel approach for mitochondria transplantation using FMRCs, which is fusogenic and magnet-responsive (Fig. 1 /2). FMRCs could be versatile in terms of the incorporation of different fusogens ( 23 ), the usage of a variety of cell types ( 49 ), and the delivery of a multitude of cargo ( 50 ). Importantly, FMRCs were fabricated in bio-friendly environment, which is extremely suitable for maintaining the bioactivities of therapeutics. In addition, loading of Fe 3 O 4 nanoparticles, even in huge amount, apparently was tolerated. We did not detect noticeable cytotoxic effects, suggesting of the superior biocompatibility of the Fe 3 O 4 nanoparticles. Fusion of FMRCs with target cells depended critically on the magnetic force to overcome energy barriers (Fig. 3 ). Increasing the strength of magnet was favorable, but seemingly a plateau was reached around 3000 Gs. However, the cells were not aligned directly on top of each other, and thus the force did not push the cell against the other. Instead, the force accelerated spreading as indicated by the increase in cytoskeleton formation and calcium transient (Fig. 4 /S4). Conceivably, a stronger magnetic force applied to FMRCs in the capillary of microfluidics would stimulate fusion even better. Fusion with FMRCs was further optimized by increasing fusion temperature, which was important for cells that are extremely refractory to fusion (Fig. S2). Higher temperature probably disturbed the lipid crystallinity of plasma membrane. Noticeably, both the magnetic force and higher temperature were important only during the induction of fusion but not after, indicating that once a hemifusion is formed, the development into a full fusion is automatic. The majority of fusion occurred between 2 cells, which is favorable to cells still in cell cycle, because forming multinucleated aggregates would probably lead to cell death (please note one cell is enucleated in the present study). To ensure one to one fusion, the target cells were pre-seeded overnight at about 15% confluency, while FMRCs were added at a ratio of about 3:1. However, due to the uneven distribution (especially around the edge), a small fraction of fusion was formed with 3–4 cells. FMRCs (eBMSCs) were then prepared and used for fusion and mitochondrial transplantation to cells with partial mtDNA depletion (PMD) (Fig. 5 A/S5). Transplanted mitochondria maintained the tubular network structure with an about normal membrane potential (Fig. 5 B/C). Transplantation of mitochondria was further confirmed by qPCR amplification with a pair of mitochondria specific primers, showing more than one hundred-fold increase in mtDNA copies (Fig. 5 F/G). PMD cells transplanted with mitochondria restored mitotic activity within 3 days without uridine supplementation (Fig. 5 D/E). Of note, the number of cells under fusion condition was still lower than that with uridine. This probably can be explained by a couple of reasons: cells in the edge formed multi-nucleated aggregates, a faction of PMD cells did not fused with FMRCs, some of PMD cells might not be recused even with transplanted mitochondria in the absence of uridine. Alternatively, considering that mitochondria in eBMSCs had only about 80% of the normal membrane potential (Fig. S5), it is possible that exogenous mitochondria might not be able to function properly right after transplantation. SNP analysis of the mt-tRNA Arg gene further confirmed the transplantation of exogenous mitochondria (Fig. 6 A). The exogenous portion increased from about 20% to more than 90% (T:A ratio). Moreover, fusion cells were cloned and tested if they were hybrids of mtDNA and nDNA by SNP analysis (Fig. S6). Indeed, 2 of the 3 clones tested had a pure KM nuclear genome, but with a combination of mtDNA from both BALB/c and KM mice. The remaining endogenous mitochondria could be the result of unfinished mitophagy, or PMD cells generated in the study still maintained some functional mitochondria. In any event, the results demonstrated that exogenous mitochondria were able to colonize stably (if not permanently) in PMD cells. The result was consistent with the autophagy flux analysis (Fig. 6 B). PMD cells with defective mitochondria apparently could not support the energy consuming autophagy process, while transplantation of large amount of intact mitochondria was essential to trigger the restoration pathways. Western blot analysis of LC3-II and Beclin further confirmed the increased autophagy levels in PMD cells after transplantation of mitochondria (Fig. 6 C/D). The change of p62 levels was not expected; however, it is not uncommon that p62 levels changes irregularly. When autophagy is induced, p62 is degraded, this could be the explanation of reduced p62 levels in PMD cells transplanted with mitochondria ( 51 ). More over, the applicability of this technology in medical objective was tested using cybrids harboring a high percentage of mutant mtDNA (143B ∆4977 cells), which includes a 4977 bp deletion ranging from 8470–13447 bp of human mtDNA ( 37 , 52 ). This 4977-bp common deletion affects genes encoding 7 polypeptide components of the mitochondrial respiratory chain, and 5 of the 22 tRNAs necessary for mitochondrial protein synthesis. Accumulation of truncated mtDNA leads to three related mtDNA diseases: Pearson's syndrome, Kearns-Sayre syndrome and chronic progressive external ophthalmoplegia (CPEO). For technical reason, enucleation of Ad293 cells was achieved via mechanical extrusion. Nucleated cells can not pass the membrane filter; therefore, cytoplasts generated in this way could not be contaminated by nucleated Ad293 cells. The results from this study demonstrated clearly that exogenous mitochondria from Ad293 cells were able to reside stably in 143B ∆4977 cells, leading to normalization of mitotic activity, ROS levels and mitochondrial functions (Fig. 7 /S8). In addition, transfer of mitochondria apparently reduced the amount of mutant mtDNA and thus decreasing the ratio of heteroplasmy (Fig. 7 C). The results demonstrated the feasibility of this technology in medical treatment of related mitochondrial diseases. Conclusions In this manuscript, we reported a breakthrough in cell fusion and mitochondria transplantation both in vitro and in vivo by using the fabricated FMRCs. Transplanted mitochondria remained stable and provided energy for the clearance of damaged mitochondria and thus restored normal metabolic processes in cells harboring mtDNA with oxidative damage, depletion or deletion. It is obvious that materials other than mitochondria in FMRCs may affect in many aspects of cellular activities; however, transplantation of an intact mitochondria network is necessary and adequate. Therefore, this study provides a potential cure to age-related diseases and other disorders associated with mitochondria dysfunction. Declarations Data Availability Statements No data was used for the research described in the article. Acknowledgements and funding This work was supported by the Natural Science Foundation of Guangdong (http://gdstc.gd.gov.cn/ Grant No. 2019A1515011547, 2023A1515011906, 2023A1515012586); Guangdong High-Level University Project "Green Technologies for Marine Industries"; and Li Ka Shing Foundation (Grant No. 2020LKSFG10C); and Scientific Research Initiation Grant (NTF20030, NTF22025). Informed consent was obtained from all individual participants included in the study. The authors declare that they have not use AI-generated work in this manuscript. CRediT authorship contribution statement Liqun Xu: Conceptualization, Investigation, Methodology, Validation, Writing - original draft, Writing - review & editing. Xiao Li: Investigation, Methodology, Validation, Writing - original draft, Writing - review & editing. Xing Fan: Investigation, Methodology, Validation. Wei Yan: Investigation, Methodology, Validation. Wanfei Wu: Investigation, Methodology, Validation. Junwei Li: Investigation, Methodology, Validation. Ronghao Deng: Investigation, Methodology, Validation. Haibao Zhu: Funding acquisition, Methodology, Supervision, Writing - review & editing. Aihua Mao: Funding acquisition, Methodology, Supervision, Writing - review & editing. Pingnan Sun: Methodology, Resources, Writing - review & editing. Xin Zhang: Methodology, Resources, Writing - review & editing. Wencan Xu: Methodology, Resources, Writing - review & editing. Chi-ju Wei: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Validation, Writing - original draft, Writing - review & editing. Declaration of competing interest The authors declare: No competing financial interests exist. Ethics approval and consent to participate BMSCs (Balb/c), BMSCs (KM) and SK-MSCs (Balb/c) were generated in this lab according to reported protocol in the literature. The usage of mice was approved by the Animal and Human Experiment Ethical Committee of Shantou University in March 6, 2023 (Reversal of the inflammatory environment in senescence muscle cells via mitochondrial transplantation. No. 202301008). Experiments for mitochondrial transplantation into recipient cells was approved by the Animal and Human Experiment Ethical Committee of Shantou University in March 4, 2024 (Establishment of a novel mitochondrial transplantation technique. No. 202401007). Consent for publication Not applicable. References Friedman JR, Nunnari J. Mitochondrial form and function. Nature. 2014;505:335-43. Miwa S, Kashyap S, Chini E, von Zglinicki T. Mitochondrial dysfunction in cell senescence and aging. J Clin Invest. 2022;132:e158447. Burté F, Carelli V, Chinnery PF, Yu-Wai-Man P. Disturbed mitochondrial dynamics and neurodegenerative disorders. Nat Rev Neurol. 2015;11:11-24. Nardin RA, Johns DR. Mitochondrial dysfunction and neuromuscular disease. Muscle Nerve. 2001;24:170-91. Cordero Cervantes D, Zurzolo C. Peering into tunneling nanotubes-The path forward. EMBO J. 2021;40:e105789. Abounit S, Zurzolo C. Wiring through tunneling nanotubes-from electrical signals to organelle transfer. J Cell Sci. 2012;125:1089-98. Torralba D, Baixauli F, Sánchez-Madrid F. Mitochondria know no boundaries: Mechanisms and functions of intercellular mitochondrial transfer. Front Cell Dev Biol. 2016;4:107. Manickam DS. Delivery of mitochondria via extracellular vesicles-A new horizon in drug delivery. J Control Release. 2022;343:400-7. Jackson MV, Morrison TJ, Doherty DF, McAuley DF, Matthay MA, Kissenpfennig A, O'Kane CM, Krasnodembskaya AD. Mitochondrial transfer via tunneling nanotubes is an important mechanism by which mesenchymal stem cells enhance macrophage phagocytosis in the in vitro and in vivo models of ARDS. Stem Cells. 2016;34:2210-23. Wang, X., Gerdes, HH. Transfer of mitochondria via tunneling nanotubes rescues apoptotic PC12 cells. Cell Death Differ. 2015;22:1181-91. Islam MN, Das SR, Emin MT, Wei M, Sun L, Westphalen K, Rowlands DJ, Quadri SK, Bhattacharya S, Bhattacharya J. Mitochondrial transfer from bone-marrow-derived stromal cells to pulmonary alveoli protects against acute lung injury. Nat Med. 2012;18:759-65. El-Hattab AW, Zarante AM, Almannai M, Scaglia F. Therapies for mitochondrial diseases and current clinical trials. Mol Genet Metab. 2017;122:1-9. Norat P, Soldozy S, Sokolowski JD, Gorick CM, Kumar JS, Chae Y, Yağmurlu K, Prada F, Walker M, Levitt MR, et al. Mitochondrial dysfunction in neurological disorders: Exploring mitochondrial transplantation. NPJ Regen Med 2020;5:22. McCully JD, Cowan DB, Pacak CA, Toumpoulis IK, Dayalan H, Levitsky S. Injection of isolated mitochondria during early reperfusion for cardioprotection. Am J Physiol Heart Circ Physiol. 2009;296:H94-H105. Zhang Z, Ma Z, Yan C, Pu K, Wu M, Bai J, Li Y, Wang Q. Muscle-derived autologous mitochondrial transplantation: a novel strategy for treating cerebral ischemic injury. Behav. Brain Res. 2019;356:322-31. Bertero E, Maack C, O'Rourke B. Mitochondrial transplantation in humans: "magical" cure or cause for concern? J Clin Invest. 2018;128:5191-4. Lightowlers RN, Chrzanowska-Lightowlers ZM, Russell OM. Mitochondrial transplantation-a possible therapeutic for mitochondrial dysfunction?: Mitochondrial transfer is a potential cure for many diseases but proof of efficacy and safety is still lacking. EMBO Rep. 2020;21:e50964. Wilkins HM, Carl SM, Swerdlow RH. Cytoplasmic hybrid (cybrid) cell lines as a practical model for mitochondriopathies. Redox Biol. 2014;2:619-31. Lin HP, Zheng DJ, Li YP, Wang N, Chen SJ, Fu YC, Xu WC, Wei CJ. Incorporation of VSV-G produces fusogenic plasma membrane vesicles capable of efficient transfer of bioactive macromolecules and mitochondria. Biomed Microdevices. 2016;18:41. Lin MJ, Li S, Yang LJ, Ye DY, Xu LQ, Zhang X, Sun PN, Wei CJ. Plasma membrane vesicles of human umbilical cord mesenchymal stem cells ameliorate acetaminophen-induced damage in HepG2 cells: a novel stem cell therapy. Stem Cell Res Ther. 2020;11:225. Martens S, McMahon H. Mechanisms of membrane fusion: disparate players and common principles. Nat Rev Mol Cell Biol. 2008;9:543-56. Chernomordik L, Kozlov M. Mechanics of membrane fusion. Nat Struct Mol Biol. 2008;15:675-83. Mondal Roy S, Sarkar M. Membrane fusion induced by small molecules and ions. J Lipids. 2011;2011:528784. Yoshihara A, Watanabe S, Goel I, Ishihara K, Ekdahl KN, Nilsson B, Teramura Y. Promotion of cell membrane fusion by cell-cell attachment through cell surface modification with functional peptide-PEG-lipids. Biomaterials. 2020;253:120113. Tesarik J, Nagy ZP, Mendoza C, Greco E. Chemically and mechanically induced membrane fusion: non-activating methods for nuclear transfer in mature human oocytes. Hum Reprod. 2000;15:1149-54. Yang PF, Wang CH, Lee GB. Optically-induced cell fusion on cell pairing microstructures. Sci Rep. 2016;6:22036. Chen Y, Xu LQ, Lin MJ, Zhang W, Zhang ZJ, Xu WC, Yang LJ, Wei CJ. An improved cellular enucleation method with extracellular matrix and colchicine facilitates the study of nucleocytoplasmic interaction. Eur J Cell Biol. 2019;98:151045. Leuthner TC, Hartman JH, Ryde IT, Meyer JN. PCR based determination of mitochondrial DNA copy number in multiple species. Methods Mol Biol. 2021;2310:91-111.. Bayona-Bafaluy MP, Acín-Pérez R, Mullikin JC, Park JS, Moreno-Loshuertos R, Hu P, Pérez-Martos A, Fernández-Silva P, Bai Y, Enríquez JA. Revisiting the mouse mitochondrial DNA sequence. Nucleic Acids Res. 2003;31(18):5349-55. Vivian CJ, Hagedorn TM, Jensen RA, Brinker AE, Welch DR. Mitochondrial polymorphisms contribute to aging phenotypes in MNX mouse models. Cancer Metastasis Rev. 2018;37:633-42. Miura I, Kikkawa Y, Yasuda SP, Shinogi A, Usuda D, Kumar V, Takahashi JS, Tamura M, Masuya H, Wakana S. Characterization of single nucleotide polymorphisms for a forward genetics approach using genetic crosses in C57BL/6 and BALB/c substrains of mice. Exp Anim. 2022;71:240-51. Chen M, Tian X, Xu L, Wu R, He H, Zhu H, Xu W, Wei CJ. Membrane tethering of CreER decreases uninduced cell labeling and cytotoxicity while maintaining recombination efficiency. Mol Ther Nucleic Acids. 2022;27:1078-91. Kim JH, Ren Y, Ng WP, Li S, Son S, Kee YS, Zhang S, Zhang G, Fletcher DA, Robinson DN, et al. Mechanical tension drives cell membrane fusion. Dev Cell. 2015;32:561-73. Frey S, Marsh M, Günther S, Pelchen-Matthews A, Stephens P, Ortlepp S, Stegmann T. Temperature dependence of cell-cell fusion induced by the envelope glycoprotein of human immunodeficiency virus type 1. J Virol. 1995;69:1462-72. Grimes HD, Boss WF. Intracellular calcium and calmodulin involvement in protoplast fusion. Plant Physiol. 1985;79:253-8. Yoshii SR, Mizushima N. Monitoring and measuring autophagy. Int J Mol Sci. 2017;18:1865. Wei YH, Lee CF, Lee HC, Ma YS, Wang CW, Lu CY, Pang CY. Increases of mitochondrial mass and mitochondrial genome in association with enhanced oxidative stress in human cells harboring 4,977 BP-deleted mitochondrial DNA. Ann NY Acad Sci. 2001;928:97-112. Ahmad T, Aggarwal K, Pattnaik B, Mukherjee S, Sethi T, Tiwari BK, Kumar M, Micheal A, Mabalirajan U, Ghosh B, et al. Computational classification of mitochondrial shapes reflects stress and redox state. Cell Death Dis. 2013;4:e461. Santulli G, Xie W, Reiken SR, Marks AR. Mitochondrial calcium overload is a key determinant in heart failure. Proc Natl Acad Sci. 2015;112:11389-94. Hunter DR, Haworth RA, Southard JH. Relationship between configuration, function, and permeability in calcium-treated mitochondria. J Biol Chem. 1976;251:5069-77. Pandya JD, Nukala VN, Sullivan PG. Concentration dependent effect of calcium on brain mitochondrial bioenergetics and oxidative stress parameters. Front Neuroenergetics. 2013;5:10. Finkel T, Menazza S, Holmström KM, Parks RJ, Liu J, Sun J, Liu J, Pan X, Murphy E. The ins and outs of mitochondrial calcium. Circ Res. 2015;116:1810-9. Sun J, Lo HTJ, Fan L, Yiu TL, Shakoor A, Li G, Lee WYW, Sun D. High-efficiency quantitative control of mitochondrial transfer based on droplet microfluidics and its application on muscle regeneration. Sci Adv. 2022;8:eabp9245. Liu Z, Sun Y, Qi Z, Cao L, Ding S. Mitochondrial transfer/transplantation: an emerging therapeutic approach for multiple diseases. Cell Biosci. 2022;12:66. Hayashida K, Takegawa R, Shoaib M, Aoki T, Choudhary RC, Kuschner CE, Nishikimi M, Miyara SJ, Rolston DM, Guevara S, et al. Mitochondrial transplantation therapy for ischemia reperfusion injury: a systematic review of animal and human studies. J Transl Med. 2021;19:214. Coly PM, Boulanger CM. Extracellular mitochondria and vesicles. Circ Res. 2019;125:53-4. Wolf DP, Mitalipov N, Mitalipov S. Mitochondrial replacement therapy in reproductive medicine. Trends Mol Med. 2015;21:68-76. Gäbelein CG, Feng Q, Sarajlic E, Zambelli T, Guillaume-Gentil O, Kornmann B, Vorholt JA. Mitochondria transplantation between living cells. PLoS Biol. 2022;20:e3001576. Calikoglu-Koyuncu AC, Enguven G, Koyuncuoglu R. Cell sources for tissue engineering. Biomaterials and Tissue Engineering. Stem Cell Biology and Regenerative Medicine. 2023;74:73-95. Wang H, Alarcón CN, Liu B, Watson F, Searles S, Lee CK, Keys J, Pi W, Allen D, Lammerding J, et al. Genetically engineered and enucleated human mesenchymal stromal cells for the targeted delivery of therapeutics to diseased tissue. Nat Biomed Eng. 2022;6:882-97. Bjørkøy G, Lamark T, Pankiv S, Øvervatn A, Brech A, Johansen T. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 2009;452:181-97. Porteous WK, James AM, Sheard PW, et al. Bioenergetic consequences of accumulating the common 4977-bp mitochondrial DNA deletion. Eur J Biochem. 1998;257:192-201. Jou MJ, Peng TI, Wu HY, et ak. Enhanced generation of mitochondrial reactive oxygen species in cybrids containing 4977-bp mitochondrial DNA deletion. Ann N Y Acad Sci. 2005;1042:221-8. Supplementary Files Supplementalmaterials.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 06 Feb, 2025 Editor assigned by journal 10 Jan, 2025 First submitted to journal 09 Jan, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5579357","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":412103048,"identity":"7794509d-395e-4ca1-a27c-0a91a97dd3e1","order_by":0,"name":"Liqun Xu","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Liqun","middleName":"","lastName":"Xu","suffix":""},{"id":412103049,"identity":"f896a51b-3c54-46e8-9423-ad45482f6961","order_by":1,"name":"Xiao Li","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Li","suffix":""},{"id":412103050,"identity":"e0a1d02f-5a61-4a1f-acea-1243e74abd7c","order_by":2,"name":"Xing Fan","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Fan","suffix":""},{"id":412103051,"identity":"ff1cc905-f458-47e6-88d5-961f21c3c581","order_by":3,"name":"Wei Yan","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Yan","suffix":""},{"id":412103052,"identity":"1c70bc27-92b1-4778-b79d-04e08c9f5abe","order_by":4,"name":"Wanfei Wu","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Wanfei","middleName":"","lastName":"Wu","suffix":""},{"id":412103053,"identity":"02fdaef4-245f-4231-a465-9e5c48c9cb8d","order_by":5,"name":"Junwei Li","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Junwei","middleName":"","lastName":"Li","suffix":""},{"id":412103054,"identity":"4a436d81-0d12-4bad-9940-288ec951b4d1","order_by":6,"name":"Ronghao Deng","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Ronghao","middleName":"","lastName":"Deng","suffix":""},{"id":412103055,"identity":"94e433c4-7950-4b24-bf3d-4fa577d32446","order_by":7,"name":"Haibao Zhu","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Haibao","middleName":"","lastName":"Zhu","suffix":""},{"id":412103056,"identity":"01b7441b-ab5c-4cd0-ad6f-ac362637a336","order_by":8,"name":"Aihua Mao","email":"","orcid":"","institution":"Shantou University","correspondingAuthor":false,"prefix":"","firstName":"Aihua","middleName":"","lastName":"Mao","suffix":""},{"id":412103057,"identity":"1e9b2c98-84a2-4dd1-8234-d784a0566d82","order_by":9,"name":"Pingnan Sun","email":"","orcid":"","institution":"Shantou University Medical College","correspondingAuthor":false,"prefix":"","firstName":"Pingnan","middleName":"","lastName":"Sun","suffix":""},{"id":412103058,"identity":"3c62e39f-1cc5-43e3-847c-8ed6f7c43d28","order_by":10,"name":"Xin Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of Shantou University Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Zhang","suffix":""},{"id":412103059,"identity":"5d33bcf6-18aa-4728-8e41-fc2f41157666","order_by":11,"name":"Wencan Xu","email":"","orcid":"","institution":"The First Affiliated Hospital of Shantou University Medical College","correspondingAuthor":false,"prefix":"","firstName":"Wencan","middleName":"","lastName":"Xu","suffix":""},{"id":412103060,"identity":"7f90d3d7-bef6-4968-a8d4-282f052a60ce","order_by":12,"name":"Wei Chiju","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYDACCcYGAyDFww/hMpOgRbKBmWgtUNrgALFa+Gc3NxTzttnIGJ8/f0yCocI6sYH97AH8ltw52GDM25bGY3YjmU2C4Ux6YgNPXgJeLQYSiUAt2w4DtTCzSTC2HU5skOAxIEbLfx7j/sNALf+I13IAqAzoMMYGIrRI3EhsMJz7L5lH4kaysUXCsXTjNp4c/Fr4Z6Q/M3hzxs6ev//gwxsfaqxl+9nP4NcCBGwIFQkgLiH1QMD8gAhFo2AUjIJRMJIBAKqnPamM6FREAAAAAElFTkSuQmCC","orcid":"","institution":"Shantou University","correspondingAuthor":true,"prefix":"","firstName":"Wei","middleName":"","lastName":"Chiju","suffix":""}],"badges":[],"createdAt":"2024-12-04 11:32:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5579357/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5579357/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75883210,"identity":"61ed592f-e042-4fd0-9614-c29499d279a6","added_by":"auto","created_at":"2025-02-10 08:51:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":17978535,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic of the fabrication of FMRC, fusion and mitochondria\u003c/strong\u003e \u003cstrong\u003etransplantation.\u003c/strong\u003e Cells (eBMSCs of BALB/c mice) were loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles (MPs) and incorporated with VSV-G, forming FMRCs, which were then fused with target cells (partial mtDNA depleted BMSCs of KM mice by treatment with ddC and EB). The presence of a magnetic force improved the formation of hemifusion by overcoming the energy barriers, leading to a full fusion and mitochondria transplantation, and subsequently the elimination of defective endogenous mitochondria by autophagy. The figure was created using Figdraw (www.figdraw.com).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/e216db4433ded965b78bcb87.png"},{"id":75883174,"identity":"1e1c22b9-c920-4282-be8a-d23f0235793c","added_by":"auto","created_at":"2025-02-10 08:51:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":10527966,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoading of magnetic nanoparticles and incorporation of VSV-G.\u003c/strong\u003e (A) Ad293 cells were incubated with 50 ng of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles (rhodamine conjugated, red) on top a magnet (1500 Gs) for 12 h. Cells were stained with Hoechst 33342 (blue) before being examined by confocal microscopy. The intensity of loaded nanoparticles was quantified. Scale = 50 μm. n = 3. (B) Ad293 cells were incubated with VSV-G of different concentration for 2 h. Cells were stained with anti-VSV-G (green) and Hoechst 33342 (blue) before being examined by confocal microscopy. The intensity of incorporated VSV-G protein was quantified. Scale = 50 μm. n = 3. (C) Ad293 cells were loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles (0, 1, 2 mg/mL) and stained with calcein-AM. Cells were then harvested and added into a 24-well plate on top of magnet of 1500 Gs. Cells sedimented to the button within 1 and 3 min were examined by cofocal microscopy. Cell number was counted manually. Scale = 100 μm. n = 3. Bars denoted with a different letter on top are significantly different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/41d1a52c284be0a3289d9df2.png"},{"id":75884654,"identity":"979ea4c3-4b76-42b3-8fed-47250968d934","added_by":"auto","created_at":"2025-02-10 08:59:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":9723452,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMagnetic force stimulated fusion of Ad293 cells. \u003c/strong\u003e(A) Recipient cells (Ad293) were pre-seeded in a 96-well overnight and then labeled with DiI (Red). Donor cells (Ad293 cells loaded with MP and incorporated with VSV-G protein) were labeled with Calcein-AM (Green) and then added into the 96-well. pH-depend fusion was induced under a magnetic force (1500 Gs) after adding VSV-G condition medium for 30 min. Ctrl: control, no VSV-G; VG: with VSV-G condition medium; MP: FMRCs loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e magnetic nanoparticles (MP, 2 mg/mL). Hoechst: Blue. Scale = 50 mm. (B) Cell diameter was measured and fusion efficiency was determined. Cells have a diameter larger than 20 mm were arbitrarily considered fused cells. n = 8. The middle red horizontal lines represent the median, and the error bars represent the inter-quartile range (top and bottom of box). (C) Fusion efficiency was affected by the amount of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e magnetic nanoparticles. n = 8. (D) Fusion efficiency was affected by the strength of magnetic force. n = 8. Dot plots or bars denoted with a different letter on top are significantly different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/931a483354ceee40b4d3a498.png"},{"id":75884656,"identity":"4312388b-f919-4cf2-b953-7311655a84c4","added_by":"auto","created_at":"2025-02-10 08:59:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":11064482,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCalcium transient was stimulated by magnetic force.\u003c/strong\u003e Ad293cells loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles (2 mg/mL) and Fluo-4-AM (5 mM) were added into to an ECM (extracellular matrix) coated glass-bottom dish. The cells were incubated on top of a magnet (1500 Gs) for 10 min, and then were examined by confocal microscopy. (A) Photomicrographs of cells loaded with Fluo-4-AM (green). Ctrl: control cells; MP: cells loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles. Scale = 50 mm. (B) Quantification of Fluo-4 fluorescent intensity of cells in (A). n = 8. ***, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. (C) Photomicrographs\u0026nbsp; of cells treated with FX (Fluoxetine-HCL, 10 mm), BAPTA (3 mM), EDTA (2.5 mM) or DMEM medium (Ctrl) for 2 h before loading of Fluo-4-AM. Scale = 50 mm. (D) Quantification of Fluo-4 fluorescent intensity of cells in (C). n = 8. (E) Cell fusion assay was performed in the presence or absence of FX (Fluoxetine-HCL, 10 mm), BAPTA or EDTA. n = 8. Bars denoted with a different letter on top in (D) and (E) are significantly different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/0d2f37941948d6757141e95b.png"},{"id":75883186,"identity":"21e1c02a-13ba-4ac9-b7aa-0e5245d84c1d","added_by":"auto","created_at":"2025-02-10 08:51:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":13394902,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTransplantation of mitochondria stimulates mitotic activity of cells with partial mtDNA depletion.\u003c/strong\u003e(A) Fusion between FMRCs (enucleated BMSCs loaded with MP and Calcein-AM, and incorporated with VSV-G protein) and DiI-labeled BMSCs, C2C12 or C2C12-PMD (partial mtDNA depletion) cells. Scale = 50 mm. (B) Confocal images of TMRE staining. Fusion was carried out between FMRCs and C2C12-PMD cells (pre-stained with CFSE, MCE, Monmouth Junction, NJ). After fusion, cells were stained with TMRE and examined by confocal microspy. Scale = 50 mm. (C) An enlarged image showing rod-shaped mitochondria in C2C12-PMD cells after fusion. Scale = 20 mm. (D) Bright-field images of C2C12-PMD cells 3 days post fusion. Cells with or without uridine were presented as controls. Scale = 50 mm. U: uridine. (E) Cell numbers were counted at day 2 and 3 after mitochondria transplantation. (F) Electrophoresis showing PCR bands for B2M (Beta 2M, bottom, 177 bp) and mitochondrial DNA (upper, 117 bp). (G) Mitochondria copy number was evaluated with relative qPCR. n = 3. Bars denoted with a different letter on top are significant different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/bad7350ed0dc61fe3f0d7a0c.png"},{"id":75885001,"identity":"6ef2cc9c-c4db-446e-89b1-4ca55d4e4a7c","added_by":"auto","created_at":"2025-02-10 09:07:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":25195092,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClearance of endogeneous mitochondria in PMD cells post mitochondria transplantation. \u003c/strong\u003e(A) FMRCs of eBMSCs (Balb/c mice) were fused with BMSCs-PMD (KM mice). Cells were harvested at day 1, 3, 5, and 10 for SNP analysis of the mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene. (B) Cells were stained with Cyto-ID (Green) and LysoTracker (Red) or MitoTracker (Red) at 48 h post cell fusion and examined by confocal microscopy. Arrows indicated mitochondria possibly under going autophagy. Scale bar = 20 μm. (C) Relative fluorescence intensity of Cyto-ID, LysoTracker and MitoTracker was evaluated. n = 3. (D) Western blot analysis for autophagy markers, including LC3-II, p62 and Beclin (left). Beta-Actin was used for loading control. Relative protein band intensity was determined (right). n = 3. Full-length blots/gels are presented in Supplementary Figure 9. In B-D, Ctrl: normal BMSCs (KM) cells; PMD: BMSCs-PMD cells (KM) without mitochondria transplantation; R6G: BMSCs-PMD cells (KM) were fused with FMRCs pretreated with R6G (rhodamine 6G); fusion: BMSCs-PMD cells (KM) were fused with FMRCs. Bars denoted with a different letter on top are significant different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/f0be06cb663c2ca00ffd5e0c.png"},{"id":75883193,"identity":"0eec4cf2-8a9e-4030-8403-5c6a13390eb7","added_by":"auto","created_at":"2025-02-10 08:51:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":5025587,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTransplantation of mitochondria restored normal mitochondrial functions in 143B\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e∆4977\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e cells.\u003c/strong\u003e FMRCs of Ad293 cells (cytoplasts generated via extrusion) were fused with 143B\u003csup\u003e∆4977\u003c/sup\u003e cells. Cells were used for fluorescence staining, ATP measurement, viability and qPCR at indicated point of time post fusion. Fluorescence intensity of cells stained with TMRE (A), MitoTracker red (B), mito-SOX (C), NAO (D) and anti-SDHA (E). Measurement of cell mitotic activity by CCK8 (F) and ATP production (G). Heteroplasmy of mtDNA was assayed by qPCR analysis (H). Percentage of wild-type (WT) and mutant mtDNA (Mut.) was calculated (I). Assay of heteroplasmy of mtDNA 5 d post mitochondrial transplantation (J). Change in percentage of wild-type (WT) and mutant mtDNA (Mut.) 3 or 5 d post mitochondrial transplantation (K). Ctrl: 143B control cells; ∆4977: 143B\u003csup\u003e∆4977\u003c/sup\u003e cells; R6G: 143B\u003csup\u003e∆4977\u003c/sup\u003e cells fused with FMRCs pre-treated with R6G; Fusion: 143B\u003csup\u003e∆4977\u003c/sup\u003e cells fused with FMRCs. n = 3. Bars denoted with a different letter on top are significant different (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/77ad78f32e2e9a9afb30baa5.png"},{"id":75885009,"identity":"83e7b606-8275-4f8d-9c9e-aa0d009dacc1","added_by":"auto","created_at":"2025-02-10 09:08:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":106821274,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/6e97503b-9fef-4db6-857c-f0153969153b.pdf"},{"id":75885002,"identity":"7edd679e-1e35-455a-b4c2-e02f33d42f79","added_by":"auto","created_at":"2025-02-10 09:07:03","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":3123026,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementalmaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5579357/v1/d8d3356b871882cce89fda77.pdf"}],"financialInterests":"","formattedTitle":"Fabrication of fusogenic and magnet-responsive cells for transplantation of an intact mitochondrial network","fulltext":[{"header":"Background","content":"\u003cp\u003eMitochondria are semi-autonomous organelles that generate most of the chemical energy needed to power the cell's biochemical reactions. Mitochondria are also involved in many other fundamental cellular processes (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Mutations of mitochondrial DNA (mtDNA) could be Mendelian, maternally inherited or sporadic, and occur at various time points during development, leading to mitochondrial dysfunction that plays a major role in ageing, metabolic diseases, neurodegenerative diseases, neuromuscular disorders and cancers (\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Consequently, mitochondria are now becoming a strong research interest and a major target for pharmaceutical companies.\u003c/p\u003e \u003cp\u003eMitochondrial transfer offers a potential cure for diseases associated with mitochondrial dysfunction. Mitochondrial transfer has been observed naturally \u003cem\u003ein vivo\u003c/em\u003e and in cell culture via open-ended tubular extensions called tunneling nanotubes (TNTs) (\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). In addition, membrane-bound extracellular vesicles (EVs) occasionally contain mitochondria and transfer them to surrounding cells (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Mitochondria transfer via TNTs and EVs are reported to decrease reactive oxygen species (ROS) levels and apoptosis rates (\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). However, the low efficacy of these approaches limits their therapeutic value.\u003c/p\u003e \u003cp\u003eCurrently, there are many reports which claim fabulous effects of transplantation of isolated mitochondria in combating mitochondrial dysfunction either in model systems or under clinical settings (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). McCully and colleagues reported that ischemic hearts transplanted with healthy mitochondria had reduced infarct size, decreased cardiomyocyte loss, and improved post-ischemic myocardial function (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Injection of autologously derived mitochondria from muscle was reported to decrease brain infarct volume and reverse neurological deficits in a stroke model of rat (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). However, the underlying mechanism has not been elucidated in the above reports and the use of isolated mitochondria has raised uncertainty (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eEnucleated cells (cytoplasts) are traditionally used to form cybrids, which are cytoplasmic hybrids created by fusion of cells from patients harboring mtDNA mutation(s) to cells devoid of mtDNA (Rho0 cells) (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). In a sense, enucleated cells are excellent vehicles for transmission of mitochondria, because mitochondria in this case are protected from the harsh extracellular environment and thus remain almost intact. We previously demonstrated that a type of miniature cytoplasts, plasma membrane vehicles (PMVs) generated by mechanical extrusion, could be exploited for transplantation of functional mitochondria (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Rho0 cells or acetaminophen- damaged HepG2 cells transplanted with functional mitochondria from mesenchymal stem cells were protected from cell death and regained mitotic activity (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). However, these approaches rely critically on membrane fusion, which is notoriously difficult and often results in cell death.\u003c/p\u003e \u003cp\u003eMembrane fusion is a fundamental biological process in cellular life ranging from membrane biogenesis, intracellular traffic, hormone secretion and viral infection. Membrane fusion proceeds through a series of well-defined intermediate steps, characterized as the so called hemifusion model (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). These steps are governed by energy barriers, which can be overcome by disparate fusogens, including proteins, peptides, lipids and ions (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Energy barriers also can be brought down \u003cem\u003ein vitro\u003c/em\u003e by mechanical and chemical techniques, for examples, polyethylene glycol (PEG) induction, electrical stimulation and optically-induced cell fusion (\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). However, these approaches are flawed either by cytotoxicity or low efficiency.\u003c/p\u003e \u003cp\u003eIn this manuscript, we reported a breakthrough in VSV-G mediated membrane fusion. Fusogenic and magnet-responsive cells (FMRCs), which were enucleated stem cells loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles and further incorporated with fusogenic vesicular stomatitis virus glycoprotein G (VSV-G), were fabricated and used for mitochondria transfer via fusion. A magnetic force was introduced to bring FMRCs into close proximity with target cells, leading to efficient membrane fusion. Consequently, transplantation of functional mitochondrial networks from FMRCs to recipient cells was achieved both \u003cem\u003ein vitro\u003c/em\u003e and in the gastrocnemius of mice.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003ePreparation of VSV-G condition medium\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAd293 cells (Agilent, Santa Clara, CA) were seeded in 6-wells overnight and transfected with 0.8 \u0026mu;g/well of pLV-VSVG plasmid using the PolyJet reagent (SignaGen Laboratories, Ijamsville, MD) as per instruction manual. Condition medium (CM) was collected at 48 h. Ad293 cells were harvested and lysed by three freeze/thaw cycles. Lysate and CM were pooled into 2 mL tubes, and cell debris were removed by differential centrifugation at 300, 2000 and 10000 g for10 min at each step. Clear CM was then condensed by super centrifugation (Type 100Ti fixed angle, 344619, Beckman Coulter) at 100000 g for 70 min. About 200 mL of concentrated VSV-G CM were collected from 6 mL of debris free CM. Total protein concentration was then measured using the BCA assay (Thermo Scientific, China).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of enucleated BMSCs (eBMSCs)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell enucleation was carried out according to a previously reported method with modifications (27). About 5x10\u003csup\u003e5\u003c/sup\u003e/well of cells were seeded in an ECM (extracellular matrix) coated 24-well. After 24-48 h cultivation, cells reached about 90% confluency. The 24-well was then fitted upside-down into a 50-mL conical tube containing 10 mL of medium for enucleation: calcium-free DMEM supplemented with calcium chloride (100 ng/mL), cytochalasin B (10 mg/mL), colchicine (5 mg/mL), 2% sucrose (w/v) and N-acetyl-L-cysteine (2 mM, Sigma). The 24-wells were spun in a warm Eppendorf centrifuge at 4500 g and 35\u0026deg;C for 60 min. After enculeation, the medium was replaced with fresh culture medium and the cells were recovered in the incubator for at least 1 h before being used for fusion experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of cells with partial mtDNA depletion\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC2C12 cells (derived from BALB/c mice) or BMSCs of KM mice were treated with ddC (dideoxy-cytotidine, 10 mM) and EB (Ethidium bromide, 5 mM) for 4-7 days, which generated cells with partial mtDNA depletion (PMD). The remaining mitochondria in PMD cells were defective due to ddC and EB treatment. The medium was then replaced with normal culture medium supplemented with Uridine (50 mg/mL) and pyruvate (0.1 mM). Deficiency of mitochondria were verified by TMRE staining (500 nM, Abcam). The content of mtDNA was examined by qPCR.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFabrication and fusion of fusogenic and magnet-responsive cells (FMRCs)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo optimize the loading condition and visualize the distribution in the cells, rhodamine conjugated Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles (Gift from Professor Haibao Zhu) were used. Different amount of the nanoparticles were incubated with cells for 3-24 h on top of a magnet with a strength of 1000-5000 Gs (Gauss). To prepare FMRCs, enucleated cells (Ad293 or BMSCs) were loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles (200 ng,Sigma-Aldrich, 747327) in 24-well for 12 h on top of a magnet of 1500 Gs, and then incubated with VSV-G condition medium (5 mg/mL) for 30 min.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo increase one to one cell fusion, target cells were seeded in a 24-well \u0026nbsp;overnight at 15% confluency and then labeled with DiI (Red). FMRCs (\u003cem\u003e2 x 10\u003csup\u003e5\u003c/sup\u003e\u003c/em\u003e) were labeled with Calcein-AM (Green) and then added and cultivated for 30 min in the presence of a magnetic force (1500 Gs). pH-depend fusion was carried out by adding pre-warmed (45\u0026ordm;C) fusion buffer (pH = 4.5) for 1 min. After a 30 min incubation, cells were stained with Hoechst and examined by confocal microscopy in a glass-bottom dish. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of calcium transient\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFluo4-AM (5 mM, Thermo Scientific) in calcium-free HBSS was added into FMRCs. After incubation for 20 min, 1% FBS in HEPES saline buffer was supplemented and incubated for a further 20 min. FMRCs in glass-bottom 24-well were washed with HBSS three times and then examined by confocal microscopy. Six pictures were taken from each well. Relative fluorescence intensity was calculated using the ZEN 2 software. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of cytoskeleton formation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFormation of cytoskeleton was detected by immunofluorescent staining. FMRCs were fixed in 3.7% of paraformaldehyde at room temperature for 10 min, and then treated with 0.1% of Triton X-100 for 10 min. After washing with PBS three times, the micotubes were revealed by staining with Tubulin-Tracker Green (1:50 dilution in 5% BSA, Beyotime). For actin filament, FMRCs were stained with FITC-conjugated phalloidin (Beyotime, China). For detection of Myosin, FMRCs were incubated with \u0026nbsp;rabbit anti-mouse myosin (Sigma-Aldrich, St. Louis) at room temperature for 2 h, and then stained with Alexa Fluor 555-conjugated anti-rabbit IgG (1:200 dilution; Beyotime) for another 1 h. Cells were washed between the primary and secondary antibodies incubation. Finally, cells were stained with Hoechst 33342 (Solarbio, China) before being anyalyzed by confocal microscopy.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMitochondria transplantation into cells with partial mtDNA depletion\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo examine mitochondria transplantation via cell fusion, partial mtDNA depleted (PMD) cells (C2C12 cells) were used as the recipient cells, in which the transplanted mitochondria could be easily detected, because endogenous mitochondria are defective and displays faintly after dye staining. After fusion with FRMCs (eBMSCs), PMD cells were cultivated in normal medium without supplementation of uridine and pyruvate. Cells were stained with TMRE and examined by confocal microscopy at day 1. Mitotic activity was evaluated by counting cell numbers at day 2 and 3.\u003c/p\u003e\n\u003cp\u003eThe relative amount of mtDNA were determined by qPCR with a pair of mtDNA specific primers at day 3 (28): Forward/mtDNA, CCCAGCTACTACCATCA- TTCAAGT, Reverse/mtDNA, GATGGTTTGGGAGATTGGTTGATGT. The cycle threshold (Ct) was normalized to the reference gene beta-2M: Forward/beta-2M, ATG GGAAGCCGAACATACTG, Reverse/beta-2M, CAGTCTCAGTGGGGGTGAAT. The qPCR was carried out using SYBR Green qPCR Master Mix (TransGen Biotech). Thermocycle parameters were: 95\u0026deg;C for 3 min, followed by 95\u0026deg;C for 10 s, 60-65\u0026deg;C for 30 s and 72\u0026deg;C for 1 min for a total of 30 cycles.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMitochondria transplantation into cells harboring mtDNA common deletion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e and control cells were gifts from Dr. Lei Liu (Institute of Zoology, Chinese Academy of Sciences). Enucleation of Ad293 cells was performed as reported previously (19,20). Cells were mechanically extruded through a filter membrane with pores of 5 mm. After fusion, cell viability was assayed using a CCK8 kit (Beyotime, China) at day 3 and 5. ATP content was measured using an ATP assay kit according to the instruction provided by the company (Beyotime, China). ROS levels, cardiolipin content and SDHA levels in mitochondria was revealed by staining using MitoSOX (Invitrogen, Carlsbad, CA), 10-nonyl acridine orange (NAO, MCE, Monmouth Junction, NJ) and anti-SDHA (GeneTex, Irvine, CA), respectively. Heteroplasmy of mtDNA was evaluated by qPCR of three fragments of mtDNA: The D-loop maintained both in wild-type and mutant mtDNA was used for standardization of mtDNA mass. Nd4 gene included in the deleted region of 4977-bp was used for measurement of wild-type mtDNA. The TRNK-Nd5 region bordering the deletion was used for assay of mutant mtDNA. The specific primers are as following: Forward/D-loop, CACAGGTCTATCACCCTATTAAC, Reverse/D-loop, CAGAGATGTGTTTAAGTGCTGTG. Forward/Nd4, CGCTCATTGCATACTCTT- CAATC, Reverse/Nd4, GTTACTAGCACAGAGAGTTCTCC. Forward/TRNK, CTAGAGCCCACTGTAAAGCTAAC, Reverse/Nd5, GTTGACCTGTTAGGGTG- AGAAG. The cycle threshold (Ct) was normalized to the reference gene beta-2M: Forward/beta-2M, \u0026nbsp;ATGGGAAGCCGAACATACTG, Reverse/beta-2M, CAGTCT- CAGTGGGGGTGAAT. The qPCR was carried out using SYBR Green qPCR Master Mix (TransGen Biotech, China). Thermocycle parameters were: 95\u0026deg;C for 3 min, followed by 95\u0026deg;C for 10 s, 60-65\u0026deg;C for 30 s and 72\u0026deg;C for 1 min for a total of 30 cycles.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSNP analysis of mtDNA and nDNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFMRCs (eBMSCs from BALB/c mice) were fused with partial mtDNA deleted cells (BMSCs from KM mice) were use, or were injected into the gastrocnemius of KM mice. After fusion, the mt-tRNA\u003csup\u003eArg\u003c/sup\u003e or mt-Nd4 genes were amplified respectively at day 1, 3, 5 and 10 with a pair of primers reported previously (29,30): mt-tRNA\u003csup\u003eArg\u003c/sup\u003e, CTACTTCCACTACCATGAGC (F), GTATGGAGCTTATGGAGTTGG (R); mt-Nd4, GGACTTTACTTCACCATCCTCCAAG (F),\u0026nbsp;mt-Nd4, GTTCATTCATATGCTAG- GCCTAGAG (R). PCR products were sequenced for SNP analysis. Since the enucleation efficiency is about 95%, we cloned the cells immediately after fusion. Three clones were generated in about 2 weeks. SNP analysis of mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene was carried out as described above. Further, the SNP site of rs27250976 was chosen to distinguish nDNA of BALB/c or KM mice (31). The SNP site was amplified with the following primer pairs: CATCTTAAGTCCTCAGCACC (F), GGCTACCTGA- AACGTCAAAAT (R). PCR products were sequenced by Sangon Biotech (China). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAutophagy detection by Cyto-ID staining \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo measure autophagy flux, partial mtDNA deleted cells (BMSCs from KM mice) transplanted with or without mitochondria were stained with MitoTracker-Red (200 nM, Beyotime), or LysoTracker-Red (50 nM, Enzo Life Science) together with CYTO-ID Green (Enzo Life Science) in the presence or absence of chloroquine (CQ, 60 \u0026mu;M) at 37\u0026ordm;C for 20 min 48 h post fusion. The R6G group and normal BMSCs were used as controls. After washing, cells were examined by confocal microscopy. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAutophagy detection by Western blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe following antibodies were used for Western blot analysis of autophagy: anti-LC3B (ab192890, Abcam), anti-\u0026beta;-actin (AF5003, Beyotime), and anti-Beclin1 (HA721216, HUABIO), anti-p62 (HA721171, HUABIO), anti-p62 (A21020, Abbkine). Western blot analysis was carried out as described previously (32). Protein band intensity was quantified using Image-Pro Plus software (BioImager, Richmond Hill, Canada). \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll statistical analyses were performed using GraphPad Prizm 7 (GraphPad Software Inc., San Diego, CA). All data represent the means \u0026plusmn; standard deviation. The experiments had been repeated at least twice. The results were subjected to two-tailed Student\u0026apos;s t test and one-way ANOVA with Tukey\u0026apos;s post hoc test. \u003cem\u003eP\u003c/em\u003e values \u0026lt; 0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eFabrication of fusogenic and magnet-responsive cells (FMRCs)\u003c/strong\u003e\u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe idea of fabricating FMRCs and using them for cell fusion and mitochondrial transplantation is depicted in Figure 1. Enucleated stem cells were loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles while fusogenic VSV-G glycoproteins were incorporated into the plasma membrane (Fig. S1), forming FMRCs, which were fused with target cells in the presence of a magnet. The magnetic force overcame the energy barrier generated during the formation of a hemifusion. Consequently, mitochondria were transferred from FMRCs into recipient cells after the completion of fusion. The mitochondria network remained almost intact without exposure to the harsh environment. Endogenous defective mitochondria were eliminated by autophagy. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo examine the loading of nanoparticles, rhodamine conjugated Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e were added into the culture in the presence of a magnet (Fig. 2A). Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles appeared in the cytoplasm within 3 h. The intensity of rhodamine was correlated with the incubation time, the strength of magnet and the amount of nanoparticles (Fig. 2A/S2). VSV-G condition media were prepared from Ad293 cells transfected with a VSV-G expression cassette. Cells loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles were incubated with VSV-G and then examined for the incorporation by immunofluorescence staining. The result revealed that VSV-G appeared on the surface of cells (Fig. 2B). The intensity of staining increased with the amount of VSV-G added in the culture (Fig. 2B/S2). Magnet responsiveness of FMRCs was assayed by the speed of sedimentation in the presence or absence of a magnet (Fig. 2C). More cells reached the bottom of the well in the presence of a magnet, while only a few cells were detected at a specific point of time when the magnet was absence (Fig. 2C/S2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe magnetic force stimulated fusion of FMRCs \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt has been reported that mechanical tension at the fusogenic synapse drives cell membrane fusion to overcome energy barriers under physical conditions (33). We took advantage of the static force provided by a magnet and therefore fabricated FMRCs as described above to promote fusion. Indeed, fusion percentage increased from 40% to about 60% (Fig. 3A/B). Notably, the majority of fusion occurred between 2 cells with a diameter between 20-25mm. Decreasing cell density would favor forming two-cell fusion. Furthermore, fusion could be improved by increasing the amount of nanoparticles and strength of magnetic force, reaching a percentage of around 70% (Fig. 3C/D).\u003c/p\u003e\n\u003cp\u003eIn addition, we found that fusion of FMRCs was favorable at higher temperature. Actually, temperature dependent cell fusion has been reported (34), showing that HIV envelope glycoprotein mediated syncytium formation is favorable at 37\u0026ordm;C compared to 4\u0026ordm;C. In the present study, FMRCs fusion was induced for 1 min in buffer pre-warmed to 37-55\u0026ordm;C. Highest fusion rate was obtained when induction was performed at 50\u0026ordm;C (Fig. S3A/B). However, FMRCs were prone to form larger aggregates at 50\u0026ordm;C, while more two-cell fusion was found at 45\u0026ordm;C. Similar phenomenon was observed for fusion of FMRCs derived from a variety of cell types (Fig. S3C). Of note, only a few cells showed cytotoxic effect during the induction of fusion. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe magnetic force stimulated calcium transient and cytoskeleton formation\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo understand the mechanism underlying the stimulated fusion by magnetic force, fluorescence imaging of calcium transient was performed. Magnetic force triggered an increase of calcium transient (Fig. 4A/B), which could be dampen by inhibitors of voltage-gated calcium channels (fluoxetine), or selective intracellular or extracellular calcium chelators (BAPTA/EDTA) (Fig. 4C/D). Further, inhibition of calcium transient completely blocked the effect of magnetic force on fusion (Fig. 4E). The results are consistent with early reports of the involvement of calcium transient in various fusion models (35).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNext, the effect of magnetic force on the formation of cytoskeleton was examined. Cytoskeleton has been demonstrated to be critical for cell fusion. Indeed, the magnetic force significantly promoted the formation of actin filaments and Myosin II, while microtubule formation was not affected (Fig. S4A/B). The action of magnetic force on cytoskeleton could be abolished by cytochalasin B and/or colchicine (Fig. S4C/D). Moreover, inhibition of actin filaments decreased fusion efficiency. However, inhibition of microtubule had no effect.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMitochondria transplantation restored mitotic activities of cells with partial mtDNA depletion \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter establishing the optimal conditions, we prepared FMRCs from enucleated BMSCs (Fig. S5), which contained mitochondria networks that were mostly rod shaped. Mitochondria in FMRCs (eBMSCs) had a slightly lower (about 80%) membrane potential as compared to their nucleated counterparts. In contrast, isolated mitochondria were round shape and had reduced the membrane potential to barely above background.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFMRCs (eBMSCs) were also able to fused with a variety of target cells, including BMSCs, C2C12 cells, and C2C12 cells with partial mtDNA depletion (PMD). Fusion occurred at high efficiency, leading to transplantation of mitochondria, which displayed a network structure with about normal membrane potential (Fig. 5A-C). A large percentage of C2C12-PMD cells regained proliferation ability even when uridine was withdrew, while cells without mitochondria transplantation started to die (Fig. 5D). A loss of cell number occurred at day 2 but recovered quickly at day 3 (Fig. 5E). Finally, we quantified mtDNA amount in C2C12-PMD cells before and after mitochondria transplantation using qPCR (Fig. 5F). The results showed that mtDNA increased more than 100-fold after transplantation (Fig. 5G).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElimination of endogenous mitochondria in BMSCs-PMD by autophagy\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo reliable methods exist presently for long-term labeling and tracing of mitochondria. To unequivocally demonstrated the transfer of exogenous mitochondria, we took advantage of an SNP (single nucleotide polymorphism) in the mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene, which has a stretch of different number of adenosine (29). We confirmed this polymorphism by PCR amplification followed by sequencing. Consistent with the previous report, the mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene in BMSCs generated from BALB/c and KM mice harbored 10 and 9 As respectively (Fig. 6A). Subsequently, FMRCs (eBMSCs) derived from BALB/c mice were fused with BMSCs-PMD from KM mice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter fusion, mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene was amplified and sequenced at day 1, 3, 5 and 10. We found that the contribution of transplanted mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene increased from about 20% (T:A ratio) at day 1 to above 90% at day 10 (Fig. 6A). Further, we determined the origin of cells by SNP analysis of the nuclear genome (31). Cells were cloned in 96-wells immediately after fusion. A total of 3 clones were obtained, and used for SNP analysis of mtDNA and nDNA. The results showed that 2 of the clones were hybrids of mtDNA and nDNA derived from BALB/c and KM mice respectively (Fig. S6). The other was contaminated with some BMSCs of BALB/c mice that was not enucleated successfully. Of note, exogenous mitochondria in BMSCs-PMD accounted for about 50-60%, an increase from 20% at day 1, suggesting that some endogenous defective mitochondria might be eliminated. Nonetheless, the results demonstrated that exogenous mitochondria were able to colonize stably in BMSCs-PMD.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo confirm that autophagy was responsible to the clearance of some defective mitochondria in BMSCs-PMD, we carried out an autophgy flux test by the staining of Cyto-ID and LysoTracker in the presence of chloroquine (CQ) (Fig. 6B). The result showed that mitochondria transplantation significantly increased the levels of autophgy in BMSCs-PMD (Fig. 6B), suggesting that restored energy production due to mitochondria transplantation was essential to the activation of autophagy process. No significant diffirence was detected if CQ was absence (Data no shown). On the contrary, when FMRCs were pre-treated with rhodamine 6G (R6G), which compromises the normal function of mitochondria, the autophagy levels in BMSCs-PMD did not change after fusion. Further, staining of MitoTracker and Cyto-ID revealed that significantly more mitochondria co-localized with antophagosomes 48 h post fusion (Fig. 6C). In contrast, BMSCs-PMD and the R6G group had only few co-localization.\u003c/p\u003e\n\u003cp\u003eMoreover, we measured the protein levels of LC3, p62 and Beclin in BMSCs-PMD transplanted with or without mitochondria (Fig. 6D). Consistent with the observation reported in the literature (36), LC3-II and Beclin decreased in BMSCs-PMD but increased back to normal levels after fusion. On the other hand, p62 increased in BMSCs-PMD but decreased after fusion. Again, as a control, the R6G group did not showed the same trend as described above.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReduction of oxidative stress and heteroplasmy in 143B cells harboring mtDNA deletion after mitochondrial transplantation \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate if this technology can be used as a medical technology for the treatment of mitochondrial diseases, we tested the effect of mitochondrial transplantation in cybrids harboring a high percentage of mutant mtDNA with a 4977 bp deletion (143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e cells) (37). Due to technical reason, enucleation of human kidney embryonic cells (Ad293 cells) were achieved by mechanical extrusion through a filter with 5-mm pores (19,20), thus generating plasma membrane vesicles (PMVs), which are miniature cytoplasts with a diameter of about 5-mm (Fig. S7). Cytoplasts generated via extrusion contained segregated mitochondria, not an intact mitochondrial network. Nonetheless, FMRCs of enucleated Ad293 cells were able to transfer functional mitochondria to 143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e cells efficiently via fusion.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTransplantation of mitochondria restored normal mitochondria membrane potential and the tubular network in 143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e cells (Fig. 7A/B/S8). In addition, 143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e cells had increased mitochondrial ROS levels, cardiolipin content and amount of succinate dehydrogenase (SDHA) due to mtDNA deletion. Their levels returned to normal after mitochondrial transplantation (Fig. 7C-E). These effects were not shown if mitochondria in Ad293 cells were damaged by R6G before transplantation. Furthermore, ATP production and cell mitotic activity increased to the levels comparable to that in control 143B cells after mitochondrial transplantation (Fig. 7F/G).\u003c/p\u003e\n\u003cp\u003eFinally, the heteroplasmy was evaluated by qPCR of three fragments of mtDNA (Fig. 7H/I). The D-loop region, which is maintained both in wild-type and mutant mtDNA, was used for standardization of mtDNA mass. Nd4 gene, which is within the deleted region of 4977-bp, was used for measurement of wild-type mtDNA. The TRNK-Nd5 region, which borders the 4977-bp deletion, was used for assay of mutant mtDNA. The results demonstrated that 143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e cells harbors about 70% of mutant mtDNA. In contrast, 143B cells contain very low level of (about 0.12%?) mutant mtDNA. In any event, the heteroplasmy in 143B\u003csup\u003e∆\u003c/sup\u003e\u003csup\u003e4977\u003c/sup\u003e cells reduced to about 19% 5 d post mitochondrial transplantation (Fig. 7J/K). \u0026nbsp;\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eMitochondrial shape varies in living cells and can range from punctuate structures to tubular networks. Maintaining this dynamic interconnected networks is crucial for both mitochondrial and cellular functions (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Techniques reported in the literature mostly utilize purified mitochondria, which would inevitably break the branched network into dot-shaped mitochondria. This mechanical process is harmful because membrane breakage could result in the exchange of solution in and out of the mitochondria matrix and thus the dissipation of proton gradient, eventually leading to severe reduction of membrane potential (Fig. S5).\u003c/p\u003e \u003cp\u003eMoreover, isolated mitochondria in the medium were exposed to a calcium concentration of about 10,000\u0026ndash;20,000-fold higher than that in the cytosol. Calcium uptakes through mitochondrial calcium uniporter (MCU) will lead to calcium overload, and Ca2\u003csup\u003e+\u003c/sup\u003e accumulation can impair mitochondrial function, resulting in reduced ATP production and increased production of reactive oxygen species (ROS) (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Further, it has been reported that isolated mitochondria have low respiration activities and increased mitochondrial permeability, resulting in the releases of pro-apoptotic proteins (\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Therefore, even though the success of transplantation using isolated mitochondria in cell cultures, animal models and even in clinical settings has been reported numerously (\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), the evidences and purported mechanisms are still controversial (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMitochondria are occasionally found in extracellular vesicles (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e); however, their usage in mitochondria transplantation is questionable. Micro-manipulation techniques including nucleus transfer and the FluidFM-based approach are suitable only to transplantation of mitochondria to germ cells or a small number of culture cells (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). In contrast to the techniques mentioned above, we reported a novel approach for mitochondria transplantation using FMRCs, which is fusogenic and magnet-responsive (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e/2). FMRCs could be versatile in terms of the incorporation of different fusogens (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), the usage of a variety of cell types (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e), and the delivery of a multitude of cargo (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Importantly, FMRCs were fabricated in bio-friendly environment, which is extremely suitable for maintaining the bioactivities of therapeutics. In addition, loading of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles, even in huge amount, apparently was tolerated. We did not detect noticeable cytotoxic effects, suggesting of the superior biocompatibility of the Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles.\u003c/p\u003e \u003cp\u003eFusion of FMRCs with target cells depended critically on the magnetic force to overcome energy barriers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Increasing the strength of magnet was favorable, but seemingly a plateau was reached around 3000 Gs. However, the cells were not aligned directly on top of each other, and thus the force did not push the cell against the other. Instead, the force accelerated spreading as indicated by the increase in cytoskeleton formation and calcium transient (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e/S4). Conceivably, a stronger magnetic force applied to FMRCs in the capillary of microfluidics would stimulate fusion even better. Fusion with FMRCs was further optimized by increasing fusion temperature, which was important for cells that are extremely refractory to fusion (Fig. S2). Higher temperature probably disturbed the lipid crystallinity of plasma membrane. Noticeably, both the magnetic force and higher temperature were important only during the induction of fusion but not after, indicating that once a hemifusion is formed, the development into a full fusion is automatic.\u003c/p\u003e \u003cp\u003eThe majority of fusion occurred between 2 cells, which is favorable to cells still in cell cycle, because forming multinucleated aggregates would probably lead to cell death (please note one cell is enucleated in the present study). To ensure one to one fusion, the target cells were pre-seeded overnight at about 15% confluency, while FMRCs were added at a ratio of about 3:1. However, due to the uneven distribution (especially around the edge), a small fraction of fusion was formed with 3\u0026ndash;4 cells. FMRCs (eBMSCs) were then prepared and used for fusion and mitochondrial transplantation to cells with partial mtDNA depletion (PMD) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA/S5). Transplanted mitochondria maintained the tubular network structure with an about normal membrane potential (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB/C). Transplantation of mitochondria was further confirmed by qPCR amplification with a pair of mitochondria specific primers, showing more than one hundred-fold increase in mtDNA copies (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF/G). PMD cells transplanted with mitochondria restored mitotic activity within 3 days without uridine supplementation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD/E). Of note, the number of cells under fusion condition was still lower than that with uridine. This probably can be explained by a couple of reasons: cells in the edge formed multi-nucleated aggregates, a faction of PMD cells did not fused with FMRCs, some of PMD cells might not be recused even with transplanted mitochondria in the absence of uridine. Alternatively, considering that mitochondria in eBMSCs had only about 80% of the normal membrane potential (Fig. S5), it is possible that exogenous mitochondria might not be able to function properly right after transplantation.\u003c/p\u003e \u003cp\u003eSNP analysis of the mt-tRNA\u003csup\u003eArg\u003c/sup\u003e gene further confirmed the transplantation of exogenous mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The exogenous portion increased from about 20% to more than 90% (T:A ratio). Moreover, fusion cells were cloned and tested if they were hybrids of mtDNA and nDNA by SNP analysis (Fig. S6). Indeed, 2 of the 3 clones tested had a pure KM nuclear genome, but with a combination of mtDNA from both BALB/c and KM mice. The remaining endogenous mitochondria could be the result of unfinished mitophagy, or PMD cells generated in the study still maintained some functional mitochondria. In any event, the results demonstrated that exogenous mitochondria were able to colonize stably (if not permanently) in PMD cells.\u003c/p\u003e \u003cp\u003eThe result was consistent with the autophagy flux analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). PMD cells with defective mitochondria apparently could not support the energy consuming autophagy process, while transplantation of large amount of intact mitochondria was essential to trigger the restoration pathways. Western blot analysis of LC3-II and Beclin further confirmed the increased autophagy levels in PMD cells after transplantation of mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC/D). The change of p62 levels was not expected; however, it is not uncommon that p62 levels changes irregularly. When autophagy is induced, p62 is degraded, this could be the explanation of reduced p62 levels in PMD cells transplanted with mitochondria (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMore over, the applicability of this technology in medical objective was tested using cybrids harboring a high percentage of mutant mtDNA (143B\u003csup\u003e∆4977\u003c/sup\u003e cells), which includes a 4977 bp deletion ranging from 8470\u0026ndash;13447 bp of human mtDNA (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). This 4977-bp common deletion affects genes encoding 7 polypeptide components of the mitochondrial respiratory chain, and 5 of the 22 tRNAs necessary for mitochondrial protein synthesis. Accumulation of truncated mtDNA leads to three related mtDNA diseases: Pearson's syndrome, Kearns-Sayre syndrome and chronic progressive external ophthalmoplegia (CPEO).\u003c/p\u003e \u003cp\u003eFor technical reason, enucleation of Ad293 cells was achieved via mechanical extrusion. Nucleated cells can not pass the membrane filter; therefore, cytoplasts generated in this way could not be contaminated by nucleated Ad293 cells. The results from this study demonstrated clearly that exogenous mitochondria from Ad293 cells were able to reside stably in 143B\u003csup\u003e∆4977\u003c/sup\u003e cells, leading to normalization of mitotic activity, ROS levels and mitochondrial functions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e/S8). In addition, transfer of mitochondria apparently reduced the amount of mutant mtDNA and thus decreasing the ratio of heteroplasmy (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). The results demonstrated the feasibility of this technology in medical treatment of related mitochondrial diseases.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this manuscript, we reported a breakthrough in cell fusion and mitochondria transplantation both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e by using the fabricated FMRCs. Transplanted mitochondria remained stable and provided energy for the clearance of damaged mitochondria and thus restored normal metabolic processes in cells harboring mtDNA with oxidative damage, depletion or deletion. It is obvious that materials other than mitochondria in FMRCs may affect in many aspects of cellular activities; however, transplantation of an intact mitochondria network is necessary and adequate. Therefore, this study provides a potential cure to age-related diseases and other disorders associated with mitochondria dysfunction.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo data was used for the research described in the article.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements and funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of Guangdong (http://gdstc.gd.gov.cn/ Grant No. 2019A1515011547, 2023A1515011906, 2023A1515012586); Guangdong High-Level University Project \u0026quot;Green Technologies for Marine Industries\u0026quot;; and Li Ka Shing Foundation (Grant No. 2020LKSFG10C); and Scientific Research Initiation Grant (NTF20030, NTF22025). Informed consent was obtained from all individual participants included in the study. The authors declare that they have not use AI-generated work in this manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLiqun Xu: Conceptualization, Investigation, Methodology, Validation, Writing - original draft, Writing - review \u0026amp; editing. Xiao Li: Investigation, Methodology, Validation, Writing - original draft, Writing - review \u0026amp; editing. Xing Fan: Investigation, Methodology, Validation. Wei Yan: Investigation, Methodology, Validation. Wanfei Wu: Investigation, Methodology, Validation. Junwei Li: Investigation, Methodology, Validation. Ronghao Deng: Investigation, Methodology, Validation. Haibao Zhu: Funding acquisition, Methodology, Supervision, Writing - review \u0026amp; editing. Aihua Mao: Funding acquisition, Methodology, Supervision, Writing - review \u0026amp; editing. Pingnan Sun: Methodology, Resources, Writing - review \u0026amp; editing. Xin Zhang: Methodology, Resources, Writing - review \u0026amp; editing. Wencan Xu: Methodology, Resources, Writing - review \u0026amp; editing. Chi-ju Wei: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Validation, Writing - original draft, Writing - review \u0026amp; editing.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare: No competing financial interests exist.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBMSCs (Balb/c), BMSCs (KM) and SK-MSCs (Balb/c) were generated in this lab according to reported protocol in the literature. The usage of mice was approved by the Animal and Human Experiment Ethical Committee of Shantou University in March 6, 2023 (Reversal of the inflammatory environment in senescence muscle cells via mitochondrial transplantation. No. 202301008). Experiments for mitochondrial transplantation into recipient cells was approved by the Animal and Human Experiment Ethical Committee of Shantou University in March 4, 2024 (Establishment of a novel mitochondrial transplantation technique. No. 202401007).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFriedman JR, Nunnari J. Mitochondrial form and function. Nature. 2014;505:335-43. \u003c/li\u003e\n\u003cli\u003eMiwa S, Kashyap S, Chini E, von Zglinicki T. Mitochondrial dysfunction in cell senescence and aging. J Clin Invest. 2022;132:e158447.\u003c/li\u003e\n\u003cli\u003eBurt\u0026eacute; F, Carelli V, Chinnery PF, Yu-Wai-Man P. Disturbed mitochondrial dynamics and neurodegenerative disorders. Nat Rev Neurol. 2015;11:11-24.\u003c/li\u003e\n\u003cli\u003eNardin RA, Johns DR. Mitochondrial dysfunction and neuromuscular disease. Muscle Nerve. 2001;24:170-91.\u003c/li\u003e\n\u003cli\u003eCordero Cervantes D, Zurzolo C. Peering into tunneling nanotubes-The path forward. EMBO J. 2021;40:e105789.\u003c/li\u003e\n\u003cli\u003eAbounit S, Zurzolo C. Wiring through tunneling nanotubes-from electrical signals to organelle transfer. J Cell Sci. 2012;125:1089-98. \u003c/li\u003e\n\u003cli\u003eTorralba D, Baixauli F, S\u0026aacute;nchez-Madrid F. Mitochondria know no boundaries: Mechanisms and functions of intercellular mitochondrial transfer. Front Cell Dev Biol. 2016;4:107.\u003c/li\u003e\n\u003cli\u003eManickam DS. Delivery of mitochondria via extracellular vesicles-A new horizon in drug delivery. J Control Release. 2022;343:400-7.\u003c/li\u003e\n\u003cli\u003eJackson MV, Morrison TJ, Doherty DF, McAuley DF, Matthay MA, Kissenpfennig A, O\u0026apos;Kane CM, Krasnodembskaya AD. Mitochondrial transfer via tunneling nanotubes is an important mechanism by which mesenchymal stem cells enhance macrophage phagocytosis in the in vitro and in vivo models of ARDS. Stem Cells. 2016;34:2210-23.\u003c/li\u003e\n\u003cli\u003eWang, X., Gerdes, HH. Transfer of mitochondria via tunneling nanotubes rescues apoptotic PC12 cells. Cell Death Differ. 2015;22:1181-91.\u003c/li\u003e\n\u003cli\u003eIslam MN, Das SR, Emin MT, Wei M, Sun L, Westphalen K, Rowlands DJ, Quadri SK, Bhattacharya S, Bhattacharya J. Mitochondrial transfer from bone-marrow-derived stromal cells to pulmonary alveoli protects against acute lung injury. Nat Med. 2012;18:759-65.\u003c/li\u003e\n\u003cli\u003eEl-Hattab AW, Zarante AM, Almannai M, Scaglia F. Therapies for mitochondrial diseases and current clinical trials. Mol Genet Metab. 2017;122:1-9.\u003c/li\u003e\n\u003cli\u003eNorat P, Soldozy S, Sokolowski JD, Gorick CM, Kumar JS, Chae Y, Yağmurlu K, Prada F, Walker M, Levitt MR, et al. Mitochondrial dysfunction in neurological disorders: Exploring mitochondrial transplantation. NPJ Regen Med 2020;5:22. \u003c/li\u003e\n\u003cli\u003eMcCully JD, Cowan DB, Pacak CA, Toumpoulis IK, Dayalan H, Levitsky S. Injection of isolated mitochondria during early reperfusion for cardioprotection. Am J Physiol Heart Circ Physiol. 2009;296:H94-H105.\u003c/li\u003e\n\u003cli\u003eZhang Z, Ma Z, Yan C, Pu K, Wu M, Bai J, Li Y, Wang Q. Muscle-derived autologous mitochondrial transplantation: a novel strategy for treating cerebral ischemic injury. Behav. Brain Res. 2019;356:322-31.\u003c/li\u003e\n\u003cli\u003eBertero E, Maack C, O\u0026apos;Rourke B. Mitochondrial transplantation in humans: \u0026quot;magical\u0026quot; cure or cause for concern? J Clin Invest. 2018;128:5191-4.\u003c/li\u003e\n\u003cli\u003eLightowlers RN, Chrzanowska-Lightowlers ZM, Russell OM. Mitochondrial transplantation-a possible therapeutic for mitochondrial dysfunction?: Mitochondrial transfer is a potential cure for many diseases but proof of efficacy and safety is still lacking. EMBO Rep. 2020;21:e50964.\u003c/li\u003e\n\u003cli\u003eWilkins HM, Carl SM, Swerdlow RH. Cytoplasmic hybrid (cybrid) cell lines as a practical model for mitochondriopathies. Redox Biol. 2014;2:619-31. \u003c/li\u003e\n\u003cli\u003eLin HP, Zheng DJ, Li YP, Wang N, Chen SJ, Fu YC, Xu WC, Wei CJ. Incorporation of VSV-G produces fusogenic plasma membrane vesicles capable of efficient transfer of bioactive macromolecules and mitochondria. Biomed Microdevices. 2016;18:41.\u003c/li\u003e\n\u003cli\u003eLin MJ, Li S, Yang LJ, Ye DY, Xu LQ, Zhang X, Sun PN, Wei CJ. Plasma membrane vesicles of human umbilical cord mesenchymal stem cells ameliorate acetaminophen-induced damage in HepG2 cells: a novel stem cell therapy. Stem Cell Res Ther. 2020;11:225.\u003c/li\u003e\n\u003cli\u003eMartens S, McMahon H. Mechanisms of membrane fusion: disparate players and common principles. Nat Rev Mol Cell Biol. 2008;9:543-56.\u003c/li\u003e\n\u003cli\u003eChernomordik L, Kozlov M. Mechanics of membrane fusion. Nat Struct Mol Biol. 2008;15:675-83.\u003c/li\u003e\n\u003cli\u003eMondal Roy S, Sarkar M. Membrane fusion induced by small molecules and ions. J Lipids. 2011;2011:528784. \u003c/li\u003e\n\u003cli\u003eYoshihara A, Watanabe S, Goel I, Ishihara K, Ekdahl KN, Nilsson B, Teramura Y. Promotion of cell membrane fusion by cell-cell attachment through cell surface modification with functional peptide-PEG-lipids. Biomaterials. 2020;253:120113.\u003c/li\u003e\n\u003cli\u003eTesarik J, Nagy ZP, Mendoza C, Greco E. Chemically and mechanically induced membrane fusion: non-activating methods for nuclear transfer in mature human oocytes. Hum Reprod. 2000;15:1149-54. \u003c/li\u003e\n\u003cli\u003eYang PF, Wang CH, Lee GB. Optically-induced cell fusion on cell pairing microstructures. Sci Rep. 2016;6:22036.\u003c/li\u003e\n\u003cli\u003eChen Y, Xu LQ, Lin MJ, Zhang W, Zhang ZJ, Xu WC, Yang LJ, Wei CJ. An improved cellular enucleation method with extracellular matrix and colchicine facilitates the study of nucleocytoplasmic interaction. Eur J Cell Biol. 2019;98:151045.\u003c/li\u003e\n\u003cli\u003eLeuthner TC, Hartman JH, Ryde IT, Meyer JN. PCR based determination of mitochondrial DNA copy number in multiple species. Methods Mol Biol. 2021;2310:91-111..\u003c/li\u003e\n\u003cli\u003eBayona-Bafaluy MP, Ac\u0026iacute;n-P\u0026eacute;rez R, Mullikin JC, Park JS, Moreno-Loshuertos R, Hu P, P\u0026eacute;rez-Martos A, Fern\u0026aacute;ndez-Silva P, Bai Y, Enr\u0026iacute;quez JA. Revisiting the mouse mitochondrial DNA sequence. Nucleic Acids Res. 2003;31(18):5349-55.\u003c/li\u003e\n\u003cli\u003eVivian CJ, Hagedorn TM, Jensen RA, Brinker AE, Welch DR. Mitochondrial polymorphisms contribute to aging phenotypes in MNX mouse models. Cancer Metastasis Rev. 2018;37:633-42.\u003c/li\u003e\n\u003cli\u003eMiura I, Kikkawa Y, Yasuda SP, Shinogi A, Usuda D, Kumar V, Takahashi JS, Tamura M, Masuya H, Wakana S. Characterization of single nucleotide polymorphisms for a forward genetics approach using genetic crosses in C57BL/6 and BALB/c substrains of mice. Exp Anim. 2022;71:240-51. \u003c/li\u003e\n\u003cli\u003eChen M, Tian X, Xu L, Wu R, He H, Zhu H, Xu W, Wei CJ. Membrane tethering of CreER decreases uninduced cell labeling and cytotoxicity while maintaining recombination efficiency. Mol Ther Nucleic Acids. 2022;27:1078-91.\u003c/li\u003e\n\u003cli\u003eKim JH, Ren Y, Ng WP, Li S, Son S, Kee YS, Zhang S, Zhang G, Fletcher DA, Robinson DN, et al. Mechanical tension drives cell membrane fusion. Dev Cell. 2015;32:561-73.\u003c/li\u003e\n\u003cli\u003eFrey S, Marsh M, G\u0026uuml;nther S, Pelchen-Matthews A, Stephens P, Ortlepp S, Stegmann T. Temperature dependence of cell-cell fusion induced by the envelope glycoprotein of human immunodeficiency virus type 1. J Virol. 1995;69:1462-72.\u003c/li\u003e\n\u003cli\u003eGrimes HD, Boss WF. Intracellular calcium and calmodulin involvement in protoplast fusion. Plant Physiol. 1985;79:253-8.\u003c/li\u003e\n\u003cli\u003eYoshii SR, Mizushima N. Monitoring and measuring autophagy. Int J Mol Sci. 2017;18:1865.\u003c/li\u003e\n\u003cli\u003eWei YH, Lee CF, Lee HC, Ma YS, Wang CW, Lu CY, Pang CY. Increases of mitochondrial mass and mitochondrial genome in association with enhanced oxidative stress in human cells harboring 4,977 BP-deleted mitochondrial DNA. Ann NY Acad Sci. 2001;928:97-112.\u003c/li\u003e\n\u003cli\u003eAhmad T, Aggarwal K, Pattnaik B, Mukherjee S, Sethi T, Tiwari BK, Kumar M, Micheal A, Mabalirajan U, Ghosh B, et al. Computational classification of mitochondrial shapes reflects stress and redox state. Cell Death Dis. 2013;4:e461.\u003c/li\u003e\n\u003cli\u003eSantulli G, Xie W, Reiken SR, Marks AR. Mitochondrial calcium overload is a key determinant in heart failure. Proc Natl Acad Sci. 2015;112:11389-94.\u003c/li\u003e\n\u003cli\u003eHunter DR, Haworth RA, Southard JH. Relationship between configuration, function, and permeability in calcium-treated mitochondria. J Biol Chem. 1976;251:5069-77.\u003c/li\u003e\n\u003cli\u003ePandya JD, Nukala VN, Sullivan PG. Concentration dependent effect of calcium on brain mitochondrial bioenergetics and oxidative stress parameters. Front Neuroenergetics. 2013;5:10.\u003c/li\u003e\n\u003cli\u003eFinkel T, Menazza S, Holmstr\u0026ouml;m KM, Parks RJ, Liu J, Sun J, Liu J, Pan X, Murphy E. The ins and outs of mitochondrial calcium. Circ Res. 2015;116:1810-9.\u003c/li\u003e\n\u003cli\u003eSun J, Lo HTJ, Fan L, Yiu TL, Shakoor A, Li G, Lee WYW, Sun D. High-efficiency quantitative control of mitochondrial transfer based on droplet microfluidics and its application on muscle regeneration. Sci Adv. 2022;8:eabp9245.\u003c/li\u003e\n\u003cli\u003eLiu Z, Sun Y, Qi Z, Cao L, Ding S. Mitochondrial transfer/transplantation: an emerging therapeutic approach for multiple diseases. Cell Biosci. 2022;12:66.\u003c/li\u003e\n\u003cli\u003eHayashida K, Takegawa R, Shoaib M, Aoki T, Choudhary RC, Kuschner CE, Nishikimi M, Miyara SJ, Rolston DM, Guevara S, et al. Mitochondrial transplantation therapy for ischemia reperfusion injury: a systematic review of animal and human studies. J Transl Med. 2021;19:214.\u003c/li\u003e\n\u003cli\u003eColy PM, Boulanger CM. Extracellular mitochondria and vesicles. Circ Res. 2019;125:53-4.\u003c/li\u003e\n\u003cli\u003eWolf DP, Mitalipov N, Mitalipov S. Mitochondrial replacement therapy in reproductive medicine. Trends Mol Med. 2015;21:68-76. \u003c/li\u003e\n\u003cli\u003eG\u0026auml;belein CG, Feng Q, Sarajlic E, Zambelli T, Guillaume-Gentil O, Kornmann B, Vorholt JA. Mitochondria transplantation between living cells. PLoS Biol. 2022;20:e3001576.\u003c/li\u003e\n\u003cli\u003eCalikoglu-Koyuncu AC, Enguven G, Koyuncuoglu R. Cell sources for tissue engineering. Biomaterials and Tissue Engineering. Stem Cell Biology and Regenerative Medicine. 2023;74:73-95. \u003c/li\u003e\n\u003cli\u003eWang H, Alarc\u0026oacute;n CN, Liu B, Watson F, Searles S, Lee CK, Keys J, Pi W, Allen D, Lammerding J, et al. Genetically engineered and enucleated human mesenchymal stromal cells for the targeted delivery of therapeutics to diseased tissue. Nat Biomed Eng. 2022;6:882-97. \u003c/li\u003e\n\u003cli\u003eBj\u0026oslash;rk\u0026oslash;y G, Lamark T, Pankiv S, \u0026Oslash;vervatn A, Brech A, Johansen T. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 2009;452:181-97.\u003c/li\u003e\n\u003cli\u003ePorteous WK, James AM, Sheard PW, et al. Bioenergetic consequences of accumulating the common 4977-bp mitochondrial DNA deletion. Eur J Biochem. 1998;257:192-201.\u003c/li\u003e\n\u003cli\u003eJou MJ, Peng TI, Wu HY, et ak. Enhanced generation of mitochondrial reactive oxygen species in cybrids containing 4977-bp mitochondrial DNA deletion. Ann N Y Acad Sci. 2005;1042:221-8. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-5579357/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5579357/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMitochondrial transplantation is a promising cure for many diseases associated with mitochondrial defects or ageing; however, a reliable method for mitochondria transfer is still in urgent need.\u003c/p\u003e\u003ch2\u003eMethod\u003c/h2\u003e \u003cp\u003eIn this study, we assembled fusogenic and magnet-responsive cells (FMRCs), which were enucleated stem cells loaded with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles and further incorporated with fusogenic vesicular stomatitis virus glycoprotein G (VSV-G). Fusion was carried out in the presence of a magnetic force.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eMitochondrial transplantation in the presence of a magnetic force via fusion from FMRCs restored normal mitotic activity, mitochondrial membrane potential, ROS levels and ATP production in cells containing partial mtDNA depletion, or in cybrids harboring mtDNA with a 4977-bp deletion. SNP tracing and qPCR analysis of the mitochondrial and nuclear genomes unequivocally demonstrated that exogenous mitochondria were able to reside stably and predominately. Mitochondria transplantation stimulated autophgy and thus the clearance of defective endogenous counterparts, resulted in lower mtDNA heteroplasmy.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe results suggest that FMRCs is an excellent vehicle for mitochondrial transplantation, which could be applied to the treatment of ageing and mitochondria associated diseases.\u003c/p\u003e","manuscriptTitle":"Fabrication of fusogenic and magnet-responsive cells for transplantation of an intact mitochondrial network","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-10 08:50:57","doi":"10.21203/rs.3.rs-5579357/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2025-02-06T13:21:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-01-10T12:17:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2025-01-10T04:56:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"769e7bb5-89a3-4687-9db1-ac72cda2e29f","owner":[],"postedDate":"February 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-02-10T08:50:58+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-10 08:50:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5579357","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5579357","identity":"rs-5579357","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-04T02:00:05.705006+00:00
License: CC-BY-4.0